HBVdb

Dataset for nucleotide sequence P of genotype G

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*********** **************** ****************** *** ****** *** *****************
ATGCCCCTATCCTATCAACACTTCCGGAGACTACTGTTGTTAGACGAAGAGGCAGGTCCCCTCGAAGAAGAACTCCCTCG
           t                a                  c   a      t   a                 
                                                                                
                                                                                

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*********      ** **** ********** ********  ****   *   * ***** ****** **********
CCTCGCAGACGAAGATCTCAATCGCCGCGTCGCAGAAGATCTGCATCTCCAGCTTCCCAATGTTAGTATTCCTTGGACTC
         gccttg  c    a          g        ca    tgg aac t     a      c          
              c                  c             a                              
                                                                                

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* ***************** ***** ************ **************** ** *********** ******** 
ACAAGGTGGGAAACTTTACGGGGCTGTATTCTTCTACTATACCTGTCTTTAATCCTGATTGGCAAACTCCTTCTTTTCCA
 t                 t     t            g                g  g           c        t
                   c                                      c                     
                                                                                

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
** ** ********* * ********   **  *** * ** ************ * ***** ***** **         
AATATCCATTTGCATCAAGACATTATAACTAAATGTGAACAATTTGTGGGCCCTCTCACAGTAAATGAGAAACGAAGATT
  c  t         g g        cga  gg   c g  g            t t     g     a  ga-------
     a                                                  g     t           g   c 
                                                                                

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *  ** ********** ** ** *  ** ***  *** ** ***** ** ***** ***** ** **    ***** *
AAAACTAGTTATGCCTGCCAGATTTTTCCCAAACTCTACTAAATATTTACCATTAGACAAAGGTATCAAACCGTATTATC
-- ct  a          t  g  c at  t   cg   c  g     g  c     t     c  t  ---t     c 
                                                                a             
                                                                                

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* **  * *  *** ******* *** *  * ** ************** ** *****  * ** *** ******** **
CAGAAAATGTAGTTAATCATTACTTCCAGACCAGACATTATTTACATACCCTTTGGAAGGCGGGTATTCTATATAAGAGA
 t  gc g cc   c       t   a ag t  g              t  g     aa t  c   t        c  
                                                                                
                                                                                

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*****  * ** ***** *********************  * ********** * **********        **  **
GAAACATCCCGTAGCGCTTCATTTTGTGGGTCACCATATACTTGGGAACAAGATCTACAGCATGGGGCTTTCTTGGACGG
     ta a  c     c                     ta a          g c          a-------  tt  
                 a                                                            
                                                                                

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *        ****         *** * *** *****      ********* *****  ********** ********
TC-----CCTCTCGAGTG-----GGGAAAGAACCTTTCCACCAGCAATCCTCTAGGATTCCTTCCCGATCACCAGTTGGA
a ttccaaac    gaaaggcat   g c   t     tgttcc         g     tt          t        
  a                         g            a                                      
                                                                                

       650       660       670       680       690       700       710       720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 ** ** *** **** **  * *********************** ***** ******* ******* * *** *  ***
CCCAGCATTCAGAGCAAATACCAACAATCCAGATTGGGACTTCAATCCCAAAAAGGACCCTTGGCCAGAGGCCAACAAGG
t  t  g   g    c  ct a                       c     c       a       c a   c tc   
      c                                                                         
                                                                                

       730       740       750       760       770       780       790       800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
******  ***** *  ** ** ************** ******** **  ************ **   ********* *
TAGGAGTTGGAGCCTATGGACCCGGGTTCACCCCTCCACACGGAGGCCTTTTGGGGTGGAGCCCTCAGTCTCAGGGCACA
      cg     a tc  g  a              t        t  gc            t  cag         t 
       c                             g                                          
                                                                                

       810       820       830       840       850       860       870       880
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 ******   * ******* *** **  ******* ******** ********  ******* ******** ********
CTAACAACTTTGCCAGCAGATCCGCCTCCTGCCTCCACCAATCGTCAGTCAGGGAGGCAGCCTACTCCCATCTCTCCACC
t      acg a       t   t  ca       a        g        ac       c        a        
                                                              a                 
                                                                                

       890       900       910       920       930       940       950       960
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 ** ******** ************ *******   *** **    ************** **  ****** * ****  
ACTAAGAGACAGTCATCCTCAGGCCATGCAGTGGAACTCTACAGCATTCCACCAAGCTCTACAAAATCCCAAAGTCAGGG
t  g        y            c       ---   c  ccag              t  rg      g a    --
                                           a c              g          c        
                                                                                

       970       980       990      1000      1010      1020      1030      1040
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
          ***********************  * *      * ** ***** *********** **  ** ******
GCCTGTAttTTCCTGCTGGTGGCTCCAGTTCAGGGATAGTGAACCCTGTTCCGACTATTGCCTCTCACATCTCGTCAATC
--------c-                       aa c ccagga t  c     a           t  ca  a      
        -                              a                                        
                                                                                

      1050      1060      1070      1080      1090      1100      1110      1120
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*** * * ** ***** ** ** * **** ******** ************ **** ***********************
TTCTCCAGGATTGGGGACCCTGCACCGAACATGGAGAACATCACATCAGGATTCCTAGGACCCCTGCTCGTGTTACAGGC
   g g a  c     g  t  t a    t        t            c    c                       
   a a                                                                          
                                                                                

      1130      1140      1150      1160      1170      1180      1190      1200
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**    **** ********* * ** ********** *******************************************
GGGGTTTTTCTTGTTGACAAGAATCCTCACAATACCGCAGAGTCTAGACTCGTGGTGGACTTCTCTCAATTTTCTAGGGG
  tagg    g         a t  t          a                                           
     a                                                                          
                                                                                

      1210      1220      1230      1240      1250      1260      1270      1280
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *    ********* ***** ******************************** ** ************** *******
GAGTGCCCGTGTGTCCTGGCCTAAATTCGCAGTCCCCAACCTCCAATCACTCACCAATCTCCTGTCCTCCAACTTGTCCT
a acaa         t     a                                t  c              t       
                                                                                
                                                                                

      1290      1300      1310      1320      1330      1340      1350      1360
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
** **************  **************** ********************************************
GGCTATCGCTGGATGTGTCTGCGGCGTTTTATCATATTCCTCTTCATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCT
  a              gt                c                                            
                                                                                
                                                                                

      1370      1380      1390      1400      1410      1420      1430      1440
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
****** ***** ******************** ** *** ********** ******** ******** **** *****
TCTGGACTATCAAGGTATGTTGCCCGTTTGTCCTCTGATTCCAGGATCCTCGACCACCAGTACGGGACCCTGCAAAACCT
      t     r                    c  a   t          c        c        a    g     
                                                                                
                                                                                

      1450      1460      1470      1480      1490      1500      1510      1520
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
***** ****************************************** ***** ******  *****************
GCACGACTCCTGCTCAAGGCAACTCTATGTATCCCTCATGTTGCTGTACAAAACCTTCGGACGGAAATTGCACCTGTATT
     t                                          t     t      aa                 
                                                                                
                                                                                

      1530      1540      1550      1560      1570      1580      1590      1600
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
***************************************** **** ***** ********* **************** 
CCCATCCCATCATCTTGGGCTTTCGCAAAATACCTATGGGAGTGGGCCTCAGTCCGTTTCTCtTGGCTCAGTTTACTAGT
                                         t    t     c         a                c
                                         c                    c                 
                                                                                

      1610      1620      1630      1640      1650      1660      1670      1680
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*************************************** ********** *** * ***********************
GCCATTTGTTCAGTGGTTCGTAGGGCTTTCCCCCACTGTCTGGCTTTCAGCTATaTgGATGATGTGGTATTGGGGGCCAA
                                       t          t   g t                       
                                                        c                       
                                                                                

      1690      1700      1710      1720      1730      1740      1750      1760
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 ******** ** ****** ** *** ************************ *************** ****   *  **
ATCTGTACAACATCTTGAGTCCCTTTaTACCGCTGTTACCAATTTTCTTTTGTCTTTGGGTATACATCTAAACCcTAACA
g        m  c      g  a   t                        t               t    tta gc  
         g                                                                      
                                                                                

      1770      1780      1790      1800      1810      1820      1830      1840
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**** **  ************** * *  ** ******** ******************** ******** ** ** ** 
AAACAAAAAGATGGGGTTATTCCTTAAATTTTATGGGATATGTAATTGGAAGTTGGGGTACTTTGCCACAAGAACACATC
    t  gc              c g rc  c        c                    c        g  t  t  t
    g                                                                           
                                                                                

      1850      1860      1870      1880      1890      1900      1910      1920
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  * * ***** *  * ******* * ***** ******** *****  ************* ****** ****    **
ACACAgAAAATTAAGCAATGTTTTCGGAAACTCCCTGTTAACAGGCCAATTGATTGGAAAGTCTGTCAACGAATAACTGG
gt a a     c ga r       a a     a        t     cg             t      a    tttg  
                        g                                     r            g a  
                                                              a                 

      1930      1940      1950      1960      1970      1980      1990      2000
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 **  **** ** ******** ** ** ***************** *********** ***** ******** *  ** *
TCTGTTGGGTTTCGCTGCTCCTTTTACCCAATGTGGTTACCCTGCCTTAATGCCTTTATATGCATGTATACAAGCTAAGC
a  cc    c  t        c  c  a                 g           g     m        g tc  a 
       a           a                       a                                  
                                                                                

      2010      2020      2030      2040      2050      2060      2070      2080
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
******* ***************** *********** ***********   ************ ****   ********
AGGCTTTTACTTTCTCGCCAACTTATAAGGCCTTTCTCTGTAAACAATACATGAACCTTTACCCcGTTGCTAGGCAACGG
       c                 c           g           tcg            t    tcc        
                                     a                                          
                                                                                

      2090      2100      2110      2120      2130      2140      2150      2160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
************************** ************** ***** ******** ** ********************
CCCGGTCTGTGCCAAGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCTTGGCCATCGGcCATCAGCGCATGCGTGGAAC
                          t              c     g        g  a                    
                                                        a                       
                                                                                

      2170      2180      2190      2200      2210      2220      2230      2240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
********************************* **    ***** *************** ************   * *
CTTTGTGGCTCCTCTGCCGATCCATACTGCGGAACTCCTAGCTGCTTGTTTTGCTCGCAGCCGGTCTGGAGCAAAACTCA
                                 t  gagc     c               a            cca t 
                                                                                
                                                                                

      2250      2260      2270      2280      2290      2300      2310      2320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* ** ***** ************** ** *********** ** ***** **** ************ ****  * ** *
TTGGGACTGACAATTCTGTCGTCCTTTCTCGGAAATATACATCCTTTCCATGGCTGCTAGGCTGTGCTGCCAACTGGATC
 c  a     t              c  g           c  a     c    a            c    ta c  c 
                            c           m                                     
                                                                                

      2330      2340      2350      2360      2370      2380      2390      2400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**    ************** ********* * *** ******* **************  **** ** ****** *** 
CTTCGCGGGACGTCCTTTGTTTACGTCCCGTCAGCGCTGAATCCAGCGGACGACCCCTCCCGGGGCCGTTTGGGGCTCTg
  gtca              c         a g   t       t              tt    t  g      a   a
                                                                    c           
                                                                                

      2410      2420      2430      2440      2450      2460      2470      2480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 ** ** ***** * * ** *** **  *** ***************** ********* ***** *  *** **** **
TCGCCCCCTTCTCCGTCTGCCGTTCCTGCCGACCACGGGGCGCACCTCTCTTTACGCGGTCTCCCCGTCTGTtCCTTCTC
c  t  t     t a t  t   a  ga   w                 a         a     g ag   g    t  
   a                           t                                                
                               c                                                

      2490      2500      2510      2520      2530         
....:....|....:....|....:....|....:....|....:....|....:....
********************** ********    ** **  ****** *** ** ***
ATCTGCCGGACCGTGTGCACTTCGCTTCACCTCTGCACGTTACATGGAAACCGCCATGA
                      t        aagt  t  cg      g   a  g   
                                                           
                                                           
© 1998-2020Legal notice