HBVdb

Dataset for nucleotide sequence P of genotype G

[Download (right click)] [Edit] [Sequences] [Repertoires]

52 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


EF464097_P_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtccc
EF464098_P_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtccc
KF779267_P_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtctc
DQ207798_P_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtccc
AB056515_P_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaagagacaggtccc
JQ707677_P_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtccc
JQ707678_P_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtccc
JQ707679_P_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtccc
JQ707680_P_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtccc
JQ707673_P_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtccc
JQ707671_P_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtccc
JQ707666_P_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtccc
JQ707660_P_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtccc
JQ707657_P_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtccc
JQ707668_P_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtccc
KF779357_P_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtccc
GU565217_P_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtccc
KF767452_P_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtccc
KF414679_P_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtccc
KF767451_P_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtccc
JQ707436_P_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtccc
KR230749_P_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtccc
EF634480_P_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtccc
AB056514_P_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtccc
HE981171_P_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtccc
HE981172_P_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtccc
HE981174_P_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtccc
AB064312_P_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtccc
AB064311_P_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtccc
AB064313_P_C-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtccc
KF779235_P_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtccc
AB375165_P_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtccc
AB064310_P_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtccc
KM998716_P_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtccc
HE981175_P_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtccc
HE981176_P_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtccc
AF405706_P_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtccc
AF160501_P_C-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtccc
AB375166_P_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtccc
AB375167_P_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtccc
AB375168_P_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtccc
AB375169_P_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtccc
AB375170_P_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtccc
KF779233_P_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtccc
AB056513_P_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtccc
GU563556_P_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtccc
KY004111_P_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtccc
KJ194508_P_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtccc
KF767450_P_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtccc
KX264500_P_P-G      atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtccc
FJ023674_P_P-G      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtccc
FR714503_P_P-G      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtccc
                    *********** **************** ****************** *** ****** *

EF464097_P_P-G      ctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagat
EF464098_P_P-G      ctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagat
KF779267_P_P-G      ctcgaagaagaactccctcgcctcgcagagccttctcccaatagccgcgtcgcagaagat
DQ207798_P_P-G      ctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagat
AB056515_P_P-G      ctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagat
JQ707677_P_P-G      ctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagat
JQ707678_P_P-G      ctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagat
JQ707679_P_P-G      ctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagat
JQ707680_P_P-G      ctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagat
JQ707673_P_P-G      ctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcggaagat
JQ707671_P_P-G      ctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagat
JQ707666_P_P-G      ctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagat
JQ707660_P_P-G      ctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagat
JQ707657_P_P-G      ctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagat
JQ707668_P_P-G      ctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagat
KF779357_P_P-G      ctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagat
GU565217_P_P-G      ctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagat
KF767452_P_P-G      ctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagat
KF414679_P_P-G      ctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagat
KF767451_P_P-G      ctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagat
JQ707436_P_P-G      ctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagat
KR230749_P_P-G      ctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagat
EF634480_P_P-G      ctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagat
AB056514_P_P-G      ctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagat
HE981171_P_P-G      ctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagat
HE981172_P_P-G      ctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagat
HE981174_P_P-G      ctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagat
AB064312_P_P-G      ctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagat
AB064311_P_P-G      ctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagat
AB064313_P_C-G      ctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagat
KF779235_P_P-G      ctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagat
AB375165_P_P-G      ctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagat
AB064310_P_P-G      ctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagat
KM998716_P_P-G      ctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgccgaagat
HE981175_P_P-G      ctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagat
HE981176_P_P-G      ctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagat
AF405706_P_P-G      ctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagat
AF160501_P_C-G      ctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagat
AB375166_P_P-G      ctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagat
AB375167_P_P-G      ctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagat
AB375168_P_P-G      ctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagat
AB375169_P_P-G      ctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagat
AB375170_P_P-G      ctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagat
KF779233_P_P-G      ctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagat
AB056513_P_P-G      ctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagat
GU563556_P_P-G      ctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagat
KY004111_P_P-G      ctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagat
KJ194508_P_P-G      ctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagat
KF767450_P_P-G      ctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagat
KX264500_P_P-G      ctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagat
FJ023674_P_P-G      ctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagat
FR714503_P_P-G      ctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagat
                    ** **************************      ** **** ********** ******

EF464097_P_P-G      ctgcatctccagcttcccaatgttagtattccttggactcacaaggtgggaaactttacg
EF464098_P_P-G      ctgcatctccagcttcccaatgttagtattccttggactcacaaggtgggaaactttacg
KF779267_P_P-G      ctgcatctccagcttcccaatgttagtattccttggactcacaaggtgggaaactttacg
DQ207798_P_P-G      ctgcatctccagcttcccaatgttagtattccttggactcacaaggtgggaaactttacg
AB056515_P_P-G      ctgcatctccagcttcccaatgttagtattccttggactcacaaggtgggaaactttacg
JQ707677_P_P-G      ctgcatctccagcttcccaatgttagtattccttggactcacaaggtgggaaactttacg
JQ707678_P_P-G      ctgcatctccagcttcccaatgttagtattccttggactcacaaggtgggaaactttacg
JQ707679_P_P-G      ctgcatctccagcttcccaatgttagtattccttggactcacaaggtgggaaactttacg
JQ707680_P_P-G      ctgcatctccagcttcccaatgttagtattccttggactcacaaggtgggaaactttacg
JQ707673_P_P-G      ctgcatctccagcttcccaatgttagtattccttggactcacaaggtgggaaactttacg
JQ707671_P_P-G      ctgcatctccagcttcccaatgttagtattccttggactcacaaggtgggaaactttacg
JQ707666_P_P-G      ctgcatctccagcttcccaatgttagtattccttggactcacaaggtgggaaactttacg
JQ707660_P_P-G      ctgcatctccagcttcccaatgttagtattccttggactcacaaggtgggaaactttacg
JQ707657_P_P-G      ctgcatctcaagcttcccaatgttagtattccttggactcacaaggtgggaaactttacg
JQ707668_P_P-G      ctgcatctccagcttcccaatgttagtattccttggactcacaaggtgggaaactttacg
KF779357_P_P-G      ctgcatctccagcttcccaatgttagtattccttggactcacaaggtgggaaactttacg
GU565217_P_P-G      ctgcatctccagcttcccaatgatagtattccttggactcacaaggtgggaaactttacg
KF767452_P_P-G      ctgcatctccagcttcccaatgttagtattccttggactcacaaggtgggaaactttacg
KF414679_P_P-G      ctgcatctccagcttcccaatgttagtattccttggactcacaaggtgggaaactttacg
KF767451_P_P-G      ctgcatctccagcttcccaatgttagtattccttggactcacaaggtgggaaactttacg
JQ707436_P_P-G      ctgcatctccagcttcccaatgttagtattccttggactcacaaggtgggaaactttacg
KR230749_P_P-G      ctgcatctccagcttcccaatgttagtattccttggactcacaaggtgggaaactttacg
EF634480_P_P-G      ctgcatctccagcttcccaatgttagtattccttggactcacaaggtgggaaactttacg
AB056514_P_P-G      ctgcatctccagcttcccaatgttagtattccttggactcacaaggtgggaaactttacg
HE981171_P_P-G      ctgcatctccagcttcccaatgttagtattccttggactcacaaggtgggaaactttacg
HE981172_P_P-G      ctgcatctccagcttcccaatgttagtattccttggactcacaaggtgggaaactttacg
HE981174_P_P-G      ctgcatctccagcttcccaatgttagtattccttggactcacaaggtgggaaactttacg
AB064312_P_P-G      ctgcatctccagcttcccaatgttagtattccttggactcacaaggtgggaaactttacg
AB064311_P_P-G      ctgcatctccagcttcccaatgttagtattccttggactcacaaggtgggaaactttacg
AB064313_P_C-G      ctgcatctccagcttcccaatgttagtattccttggactcacaaggtgggaaactttacg
KF779235_P_P-G      ctgcatcttcagcttcccaatgttagtattccttggactcacaaggtgggaaactttacg
AB375165_P_P-G      ctgcatctccagcttcccaatgttagtattccttggactcacaaggtgggaaactttacg
AB064310_P_P-G      ctgcatctccagcttcccaatgttagtattccttggactcacaaggtgggaaactttacg
KM998716_P_P-G      ctgcatctccagcttcccaatgttagtattccttggactcacaaggtgggaaactttacg
HE981175_P_P-G      ctgcatctccagcttcccaatgttagtattccttggactcacaaggtgggaaactttacg
HE981176_P_P-G      ctgcatctccagcttcccaatgttagtattccttggactcacaaggtgggaaactttacg
AF405706_P_P-G      ctgcatctccagcttcccaatgttagtattccttggactcacaaggtgggaaactttacg
AF160501_P_C-G      ctgcatctccagcttcccaatgttagtattccttggactcacaaggtgggaaactttacg
AB375166_P_P-G      ctgcatctccagcttcccaatgttagtattccttggactcacaaggtgggaaactttacg
AB375167_P_P-G      ctgcatctccagcttcccaatgttagtattccttggactcacaaggtgggaaactttacg
AB375168_P_P-G      ctgcatctccagcttcccaatgttagtattccttggactcacaaggtgggaaactttacg
AB375169_P_P-G      ctgcatctccagcttcccaatgttagtattccttggactcacaaggtgggaaactttacg
AB375170_P_P-G      ctgcatctccagcttcccaatgttagtattccttggactcacaaggtgggaaactttacg
KF779233_P_P-G      ctgcatctccagcttcccaatgttagtattccttggactcacaaggtgggaaactttacg
AB056513_P_P-G      ctgcatctccagcttcccaatgttagtattccttggactcacaaggtgggaaactttacg
GU563556_P_P-G      ctgcatctccagcttcccaatgttagtattccttggactcacaaggtgggaaactttacg
KY004111_P_P-G      ctacatctccagcttcccaatgttagtattccttggactcacaaggtgggaaactttacg
KJ194508_P_P-G      ctgcatctccagcttcccaatgttagtattccttggactcacaaggtgggaaactttacg
KF767450_P_P-G      ctgcatctccagcttcccaatgttagtattccttggactcacaaggtgggaaactttacg
KX264500_P_P-G      ctgcatctccagcttcccaatgttagtattccttggactcacaaggtgggaaactttacg
FJ023674_P_P-G      ctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactttact
FR714503_P_P-G      ctcaatctcgggaaccccaatgttagtattccttggactcataaggtgggaaactttacc
                    **  ****   *   * ***** ****** *********** ***************** 

EF464097_P_P-G      gggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
EF464098_P_P-G      gggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
KF779267_P_P-G      gggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
DQ207798_P_P-G      gggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
AB056515_P_P-G      gggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
JQ707677_P_P-G      gggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
JQ707678_P_P-G      gggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
JQ707679_P_P-G      gggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
JQ707680_P_P-G      gggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
JQ707673_P_P-G      gggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
JQ707671_P_P-G      gggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
JQ707666_P_P-G      gggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
JQ707660_P_P-G      gggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
JQ707657_P_P-G      gggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
JQ707668_P_P-G      gggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
KF779357_P_P-G      gggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
GU565217_P_P-G      gggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
KF767452_P_P-G      gggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
KF414679_P_P-G      gggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
KF767451_P_P-G      gggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
JQ707436_P_P-G      gggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
KR230749_P_P-G      gggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
EF634480_P_P-G      gggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
AB056514_P_P-G      gggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
HE981171_P_P-G      gggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
HE981172_P_P-G      gggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
HE981174_P_P-G      gggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
AB064312_P_P-G      gggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
AB064311_P_P-G      gggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
AB064313_P_C-G      gggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
KF779235_P_P-G      gggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
AB375165_P_P-G      gggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
AB064310_P_P-G      gggctgtattcttctactatacctgtctttaatccggattggcaaactccttcttttcca
KM998716_P_P-G      gggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
HE981175_P_P-G      gggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
HE981176_P_P-G      gggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
AF405706_P_P-G      gggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
AF160501_P_C-G      gggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
AB375166_P_P-G      gggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
AB375167_P_P-G      gggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
AB375168_P_P-G      gggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
AB375169_P_P-G      gggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
AB375170_P_P-G      gggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
KF779233_P_P-G      gggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
AB056513_P_P-G      gggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
GU563556_P_P-G      gggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
KY004111_P_P-G      gggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
KJ194508_P_P-G      gggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
KF767450_P_P-G      gggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
KX264500_P_P-G      gggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
FJ023674_P_P-G      gggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcct
FR714503_P_P-G      gggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcct
                    ***** ************ **************** ** *********** ******** 

EF464097_P_P-G      aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcaca
EF464098_P_P-G      aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcaca
KF779267_P_P-G      aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcaca
DQ207798_P_P-G      aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcaca
AB056515_P_P-G      aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcaca
JQ707677_P_P-G      aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcaca
JQ707678_P_P-G      aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcaca
JQ707679_P_P-G      aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcaca
JQ707680_P_P-G      aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcaca
JQ707673_P_P-G      aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcaca
JQ707671_P_P-G      aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcaca
JQ707666_P_P-G      aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcaca
JQ707660_P_P-G      aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcaca
JQ707657_P_P-G      aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcaca
JQ707668_P_P-G      aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcaca
KF779357_P_P-G      aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcaca
GU565217_P_P-G      aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcaca
KF767452_P_P-G      aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcaca
KF414679_P_P-G      aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcaca
KF767451_P_P-G      aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcaca
JQ707436_P_P-G      aatatacatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcaca
KR230749_P_P-G      aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcaca
EF634480_P_P-G      aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcaca
AB056514_P_P-G      aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcaca
HE981171_P_P-G      aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcaca
HE981172_P_P-G      aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcaca
HE981174_P_P-G      aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcaca
AB064312_P_P-G      aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcaca
AB064311_P_P-G      aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcaca
AB064313_P_C-G      aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcaca
KF779235_P_P-G      aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcaca
AB375165_P_P-G      aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcaca
AB064310_P_P-G      aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcaca
KM998716_P_P-G      aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcaca
HE981175_P_P-G      aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcaca
HE981176_P_P-G      aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcaca
AF405706_P_P-G      aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcaca
AF160501_P_C-G      aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcaca
AB375166_P_P-G      aatatccatttgcatcaagacattataactaaatgtgagcaatttgtgggccctctcaca
AB375167_P_P-G      aatatccatttgcatcaagacattataactaaatgtgagcaatttgtgggccctctcaca
AB375168_P_P-G      aatatccatttgcatcaagacattataactaaatgtgagcaatttgtgggccctctcaca
AB375169_P_P-G      aatatccatttgcatcaagacattataactaaatgtgagcaatttgtgggccctctcaca
AB375170_P_P-G      aatatccatttgcatcaagacattataactaaatgtgagcaatttgtgggccctctcaca
KF779233_P_P-G      aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcaca
AB056513_P_P-G      aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcaca
GU563556_P_P-G      aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcaca
KY004111_P_P-G      aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcaca
KJ194508_P_P-G      aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcaca
KF767450_P_P-G      aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcaca
KX264500_P_P-G      aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcaca
FJ023674_P_P-G      aacattcatttgcatgaggacattatcgataggtgtcaacagtttgtgggccctttgaca
FR714503_P_P-G      aacattcatttgcatgaggacattatcaataggtgtcaacaatttgtgggccctcttaca
                    ** ** ********* * ********   **  *** * ** ************ * ***

EF464097_P_P-G      gtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctact
EF464098_P_P-G      gtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctact
KF779267_P_P-G      gtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctact
DQ207798_P_P-G      gtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctact
AB056515_P_P-G      gtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctact
JQ707677_P_P-G      gtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctact
JQ707678_P_P-G      gtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctact
JQ707679_P_P-G      gtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctact
JQ707680_P_P-G      gtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctact
JQ707673_P_P-G      gtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctact
JQ707671_P_P-G      gtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctact
JQ707666_P_P-G      gtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctact
JQ707660_P_P-G      gtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctact
JQ707657_P_P-G      gtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctact
JQ707668_P_P-G      gtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctact
KF779357_P_P-G      gtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctact
GU565217_P_P-G      gtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctact
KF767452_P_P-G      gtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctact
KF414679_P_P-G      gtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctact
KF767451_P_P-G      gtgaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctact
JQ707436_P_P-G      gtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctact
KR230749_P_P-G      gtaaatgagaaac---------aactagttatgcctgccagatttttcccaaactctact
EF634480_P_P-G      gtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctact
AB056514_P_P-G      gtaaatgagaaacgaagattaaaactagttatgcctgccagatttttccctaactctact
HE981171_P_P-G      gtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctact
HE981172_P_P-G      gtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctact
HE981174_P_P-G      gtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctact
AB064312_P_P-G      gtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctact
AB064311_P_P-G      gtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctact
AB064313_P_C-G      gtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctact
KF779235_P_P-G      gtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctact
AB375165_P_P-G      gtaaatgagaagcgaagattaaaactagttatgcctgccagatttttcccaaactctact
AB064310_P_P-G      gtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctact
KM998716_P_P-G      gtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctact
HE981175_P_P-G      gtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctact
HE981176_P_P-G      gtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctact
AF405706_P_P-G      gtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctact
AF160501_P_C-G      gtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctact
AB375166_P_P-G      gtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctact
AB375167_P_P-G      gtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctact
AB375168_P_P-G      gtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctact
AB375169_P_P-G      gtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctact
AB375170_P_P-G      gtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctact
KF779233_P_P-G      gtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctact
AB056513_P_P-G      gtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctact
GU563556_P_P-G      gtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctact
KY004111_P_P-G      gtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctact
KJ194508_P_P-G      gtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctact
KF767450_P_P-G      gtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctact
KX264500_P_P-G      gtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctact
FJ023674_P_P-G      gtgaatgaaaaaaggagactaaaattaattatgcctgctaggttttatcctaacagtacc
FR714503_P_P-G      gttaatgaaaaaagaagattaaacttaattatgcctgctaggttctatcctaaccgtact
                    ** ***** **           *  ** ********** ** ** *  ** ***  *** 

EF464097_P_P-G      aaatatttaccattagacaaaggtatcaaaccgtattatccagaaaatgtagttaatcat
EF464098_P_P-G      aaatatttaccattagacaaaggtatcaaaccgtattatccagaaaatgtagttaatcat
KF779267_P_P-G      aaatatttaccattagacaaaggtatcaaaccgtattatccagagaatgtagttaatcat
DQ207798_P_P-G      aaatatttaccattagataaaggtatcaaaccgtattatccagaaaatgtagttaatcat
AB056515_P_P-G      aaatatttaccattagacaaaggtatcaaaccgtattatccagaaaatgtagttaatcat
JQ707677_P_P-G      aaatatttaccattagacaaaggtatcaaaccgtattatccagaaaatgtagttaatcat
JQ707678_P_P-G      aaatatttaccattagacaaaggtatcaaaccgtattatccagaaaatgtagttaatcat
JQ707679_P_P-G      aaatatttaccattagacaaaggtatcaaaccgtattatccagaaaatgtagttaatcat
JQ707680_P_P-G      aaatatttaccattagacaaaggtatcaaaccgtattatccagaaaatgtagttaatcat
JQ707673_P_P-G      aaatatttaccattagacaaaggtatcaaaccgtattatccagaaaatgtagttaatcat
JQ707671_P_P-G      aaatatttaccattagacaaaggtatcaaaccgtattatccagaaaatgtagttaatcat
JQ707666_P_P-G      aaatatttaccattagacaaaggtatcaaaccgtattatccagaaaatgtagttaatcat
JQ707660_P_P-G      aaatatttaccattagacaaaggtatcaaaccgtattatccagaaaatgtagttaatcat
JQ707657_P_P-G      aaatatttaccattagacaaaggtatcaaaccgtattatccagaaaatgtagttaatcat
JQ707668_P_P-G      aaatatttaccattagacaaaggtatcaaaccgtattatccagaaaatgtagttaatcat
KF779357_P_P-G      aaatatttaccattagacaaaggtatcaaaccgtattatccagaaaatgtagttaatcat
GU565217_P_P-G      aaatatttaccattagacaaaggtatcaaaccgtattatccagaaaatgtagttaatcat
KF767452_P_P-G      aaatatttaccattagacaaaggtatcaaaccgtattatccagaaaatgtagttaatcat
KF414679_P_P-G      aaatatttaccattagacaaaggtatcaaaccgtattatccagaaaatgtagttaatcat
KF767451_P_P-G      aaatatttaccattagacaaaggtatcaaaccgtattatccagaaaatgtagttaatcat
JQ707436_P_P-G      aaatatttaccattagacaaaggtatcaaaccgtattatccagaaaatgtagttcatcat
KR230749_P_P-G      aaatatttaccattagacaaaggtatcaa---gtattacccagaaaatgtagttaatcat
EF634480_P_P-G      aaatatttaccattagacaaaggtatcaaaccgtattatccagaaaatgtagttaatcat
AB056514_P_P-G      aaatatttaccattagacaaaggtatcaaaccgtattatccagaaaatgtagttaatcat
HE981171_P_P-G      aaatatttaccattagacaaaggtatcaaaccgtattatccagaaaatgtagttaatcat
HE981172_P_P-G      aaatatttaccattagacaaaggtatcaaaccgtattatccagaaaatgtagttaatcat
HE981174_P_P-G      aaatatttaccattagacaaaggtatcaaaccgtattatccagaaaatgtagttaatcat
AB064312_P_P-G      aaatatttaccattagacaaaggtatcaaaccgtattatccagaaaatgtagttaatcat
AB064311_P_P-G      aaatatttaccattagacaaaggtatcaaaccgtattatccagaaaatgtagttaatcat
AB064313_P_C-G      aaatatttaccattagacaaaggtatcaaaccgtattatccagaaaatgtagttaatcat
KF779235_P_P-G      aaatatttaccattagacaaaggtatcaaaccgtattatccagaaaatgtagttaatcat
AB375165_P_P-G      aaatatttaccattagacaaaggtatcaaaccgtattatccagaaaatgtagttaatcat
AB064310_P_P-G      aaatatttaccattagacaaaggtatcaaaccgtattatccagaaaatgtagttaatcat
KM998716_P_P-G      aaatatttaccattagacaaaggtatcaaaccgtattatccagaaaatgtagttaatcat
HE981175_P_P-G      aaatatttaccattagacaaaggtatcaaaccgtattatccagaaaatgtagttaatcat
HE981176_P_P-G      aaatatttaccattagacaaaggtatcaaaccgtattatccagaaaatgtagttaatcat
AF405706_P_P-G      aaatatttaccattagacaaaggtatcaaaccgtattatccagaaaatgtagttaatcat
AF160501_P_C-G      aaatatttaccattagacaaaggtatcaaaccgtattatccagaaaatgtagttaatcat
AB375166_P_P-G      aaatatttaccattagacaaaggtatcaaaccgtattatccagaaaatgtagttaatcat
AB375167_P_P-G      aaatatttaccattagacaaaggtatcaaaccgtattatccagaaaatgtagttaatcat
AB375168_P_P-G      aaatatttaccattagacaaaggtatcaaaccgtattatccagaaaatgtagttaatcat
AB375169_P_P-G      aaatatttaccattagacaaaggtatcaaaccgtattatccagaaaatgtagttaatcat
AB375170_P_P-G      aaatatttaccattagacaaaggtatcaaaccgtattatccagaaaatgtagttaatcat
KF779233_P_P-G      aaatatttaccattagacaaaggtatcaaaccgtattatccagaaaatgtagttaatcat
AB056513_P_P-G      aaatatttaccattagacaaaggtatcaaaccgtattatccagaaaatgtagttaatcat
GU563556_P_P-G      aaatatttaccattagacaaaggtatcaaaccgtattatccagaaaatgtagttaatcat
KY004111_P_P-G      aaatatttaccattagacaaaggtatcaaaccgtattatccagaaaatgtagttaatcat
KJ194508_P_P-G      aaatatttaccattagacaaaggtatcaaaccgtattatccagaaaatgtagttaatcat
KF767450_P_P-G      aaatatttaccattagacaaaggtatcaaaccgtattatccagaaaatgtagttaatcat
KX264500_P_P-G      aaatatttaccattagacaaaggtatcaaaccgtattatccagaaaatgtagttaatcat
FJ023674_P_P-G      aagtatttgcccttagataaaggtattaaaccttattatcctgaacatgcagttaatcat
FR714503_P_P-G      aagtatttgcccttagataaaggcataaaaccttattatcctgagcaggccgttaatcat
                    ** ***** ** ***** ***** ** **    ***** ** **  * *  *** *****

EF464097_P_P-G      tacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
EF464098_P_P-G      tacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
KF779267_P_P-G      tacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
DQ207798_P_P-G      tacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
AB056515_P_P-G      tacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
JQ707677_P_P-G      tacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
JQ707678_P_P-G      tacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
JQ707679_P_P-G      tacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
JQ707680_P_P-G      tacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
JQ707673_P_P-G      tacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
JQ707671_P_P-G      tacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
JQ707666_P_P-G      tacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
JQ707660_P_P-G      tacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
JQ707657_P_P-G      tacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
JQ707668_P_P-G      tacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
KF779357_P_P-G      tacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
GU565217_P_P-G      tacttccagaccagacattatttacataccctttggaagacgggtattctatataagaga
KF767452_P_P-G      tacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
KF414679_P_P-G      tacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
KF767451_P_P-G      tacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
JQ707436_P_P-G      tacttccagaccagacattatttacataccctttggaaggcgggtattctatataagcga
KR230749_P_P-G      tacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
EF634480_P_P-G      tacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
AB056514_P_P-G      tacttccagaccagacattatttacataccctttggaaggcgggtattttatataagaga
HE981171_P_P-G      tacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
HE981172_P_P-G      tacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
HE981174_P_P-G      tacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
AB064312_P_P-G      tacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
AB064311_P_P-G      tacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
AB064313_P_C-G      tacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
KF779235_P_P-G      tacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
AB375165_P_P-G      tacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
AB064310_P_P-G      tacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
KM998716_P_P-G      tacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
HE981175_P_P-G      tacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
HE981176_P_P-G      tacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
AF405706_P_P-G      tacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
AF160501_P_C-G      tacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
AB375166_P_P-G      tacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
AB375167_P_P-G      tacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
AB375168_P_P-G      tacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
AB375169_P_P-G      tacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
AB375170_P_P-G      tacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
KF779233_P_P-G      tacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
AB056513_P_P-G      tacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
GU563556_P_P-G      tacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
KY004111_P_P-G      tacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
KJ194508_P_P-G      tacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
KF767450_P_P-G      tacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
KX264500_P_P-G      tacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
FJ023674_P_P-G      tacttcaaagccaggcattatttacatactctgtggaaagctggcattctatataagaga
FR714503_P_P-G      tatttcaaaactaggcattatttacatactctgtggaaagctggcattctatataagaga
                    ** *** *  * ** ************** ** *****  * ** *** ******** **

EF464097_P_P-G      gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacag
EF464098_P_P-G      gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacag
KF779267_P_P-G      gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacag
DQ207798_P_P-G      gaaacatcccgtagcgcctcattttgtgggtcaccatatacttgggaacaagatctacag
AB056515_P_P-G      gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacag
JQ707677_P_P-G      gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacag
JQ707678_P_P-G      gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacag
JQ707679_P_P-G      gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacag
JQ707680_P_P-G      gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacag
JQ707673_P_P-G      gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacag
JQ707671_P_P-G      gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacag
JQ707666_P_P-G      gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacag
JQ707660_P_P-G      gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacag
JQ707657_P_P-G      gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacag
JQ707668_P_P-G      gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacag
KF779357_P_P-G      gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacag
GU565217_P_P-G      gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacag
KF767452_P_P-G      gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacag
KF414679_P_P-G      gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacag
KF767451_P_P-G      gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacag
JQ707436_P_P-G      gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacag
KR230749_P_P-G      gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacag
EF634480_P_P-G      gaaacatcacgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacag
AB056514_P_P-G      gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacag
HE981171_P_P-G      gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacag
HE981172_P_P-G      gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacag
HE981174_P_P-G      gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacag
AB064312_P_P-G      gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacag
AB064311_P_P-G      gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacag
AB064313_P_C-G      gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacag
KF779235_P_P-G      gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacag
AB375165_P_P-G      gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacag
AB064310_P_P-G      gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacag
KM998716_P_P-G      gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacag
HE981175_P_P-G      gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacag
HE981176_P_P-G      gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacag
AF405706_P_P-G      gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacag
AF160501_P_C-G      gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacag
AB375166_P_P-G      gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacag
AB375167_P_P-G      gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacag
AB375168_P_P-G      gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacag
AB375169_P_P-G      gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacag
AB375170_P_P-G      gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacag
KF779233_P_P-G      gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacag
AB056513_P_P-G      gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacag
GU563556_P_P-G      gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacag
KY004111_P_P-G      gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacag
KJ194508_P_P-G      gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacag
KF767450_P_P-G      gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacag
KX264500_P_P-G      gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacag
FJ023674_P_P-G      gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacag
FR714503_P_P-G      gaaacaacacgcagcgcatcattttgtgggtcaccatattatagggaacaagagccacag
                    *****  * ** ***** *********************  * ********** * ****

EF464097_P_P-G      catggggctttcttggacggtc-----cctctcgagtg-----gggaaagaacctttcca
EF464098_P_P-G      catggggctttcttggacggtc-----cctctcgagtg-----gggaaagaacctttcca
KF779267_P_P-G      catggggctttcttggacggtc-----cctctcgagtg-----gggaaagaacctttcca
DQ207798_P_P-G      catggggctttcttggacggtc-----cctctcgagtg-----gggaaagaacctttcca
AB056515_P_P-G      catggggctttcttggacggtc-----cctctcgagtg-----gggaaagaacctttcca
JQ707677_P_P-G      catggggctttcttggacggtc-----cctctcgagtg-----gggaaagaacctttcca
JQ707678_P_P-G      catggggctttcttggacggtc-----cctctcgagtg-----gggaaagaacctttcca
JQ707679_P_P-G      catggggctttcttggacggtc-----cctctcgagtg-----gggaaagaacctttcca
JQ707680_P_P-G      catggggctttcttggacggtc-----cctctcgagtg-----gggaaagaacctttcca
JQ707673_P_P-G      catggggctttcttggacggtc-----cctctcgagtg-----gggaaagaacctttcca
JQ707671_P_P-G      catggggctttcttggacggtc-----cctctcgagtg-----gggaaagaacctttcca
JQ707666_P_P-G      catggggctttcttggacggtc-----cctctcgagtg-----gggaaagaacctttcca
JQ707660_P_P-G      catggggctttcttggacggtc-----cctctcgagtg-----gggaaagaacctttcca
JQ707657_P_P-G      catggggctttcttggacggtc-----cctctcgagtg-----gggaaagaacctttcca
JQ707668_P_P-G      catggggctttcttggacggtc-----cctctcgagtg-----gggaaagaacctttcca
KF779357_P_P-G      catggggctttcttggacggtc-----cctctcgagtg-----gggaaagaacctttcca
GU565217_P_P-G      catggggctttcttggacggtc-----cctctcgagtg-----gggaaagaacctttcca
KF767452_P_P-G      catggggctttcttggacggtc-----cctctcgagtg-----gggaaagaacctttcca
KF414679_P_P-G      catggggctttcttggacggtc-----cctctcgagtg-----gggaaagaacctttcca
KF767451_P_P-G      catggggctttcttggacggtc-----cctctcgagtg-----gggaaagaacctttcca
JQ707436_P_P-G      catggggctttcttggacggtc-----cctctcgagtg-----gggaaagaacctttcca
KR230749_P_P-G      catggggctttcttggacggtc-----cctctcgagtg-----gggaaagaacctttcca
EF634480_P_P-G      catggggctttcttggacggtc-----cctctcgagtg-----gggaaagaacctttcca
AB056514_P_P-G      catggggctttcttggacggtc-----cctctcgagtg-----gggaaagaacctttcca
HE981171_P_P-G      catggggctttcttggacggtc-----cctctcgagtg-----gggaaagaacctttcca
HE981172_P_P-G      catggggctttcttggacggtc-----cctctcgagtg-----gggaaagaacctttcca
HE981174_P_P-G      catggggctttcttggacggtc-----cctctcgagtg-----gggaaagaacctttcca
AB064312_P_P-G      catggggctttcttggacggtc-----cctctcgagtg-----gggaaggaacctttcca
AB064311_P_P-G      catggggctttcttggacggtc-----cctctcgagtg-----gggaaagaacctttcca
AB064313_P_C-G      catggggctttcttggacggtc-----cctctcgagtg-----gggaaagaacctttcca
KF779235_P_P-G      catggggctttcttggacggtc-----cctctcgagtg-----gggaaagaacctttcca
AB375165_P_P-G      catggggctttcttggacggtc-----cctctcgagtg-----gggaaagaacctttcca
AB064310_P_P-G      catggggctttcttggacggtc-----cctctcgagtg-----gggaaagaacctttcca
KM998716_P_P-G      catggggctttcttggacggtc-----cctctcgagtg-----gggaaagaacctttcca
HE981175_P_P-G      catggggctttcttggacggtc-----cctctcgagtg-----gggaaagaacctttcca
HE981176_P_P-G      catggggctttcttggacggtc-----cctctcgagtg-----gggaaagaacctttcca
AF405706_P_P-G      catggggctttcttggacggtc-----cctctcgagtg-----gggaaagaacctttcca
AF160501_P_C-G      catggggctttcttggacggtc-----cctctcgagtg-----gggaaagaacctttccg
AB375166_P_P-G      catggggctttcttggacggtc-----cctctcgagtg-----gggaaagaacctttcca
AB375167_P_P-G      catggggctttcttggacggtc-----cctctcgagtg-----gggaaagaacctttcca
AB375168_P_P-G      catggggctttcttggacggtc-----cctctcgagtg-----gggaaagaacctttcca
AB375169_P_P-G      catggggctttcttggacggtc-----cctctcgagtg-----gggaaagaacctttcca
AB375170_P_P-G      catggggctttcttggacggtc-----cctctcgagtg-----gggaaagaacctttcca
KF779233_P_P-G      catggggctttcttggacggtc-----cctctcgagtg-----gggaaagaacctttcca
AB056513_P_P-G      catggggctttcttggacggtc-----cctctcgagtg-----gggaaagaacctttcca
GU563556_P_P-G      catggggctttcttggacggtc-----cctctcgagtg-----gggaaagaacctttcca
KY004111_P_P-G      catggggctttcttggacggtc-----cctctcgagtg-----gggaaagaacctttcca
KJ194508_P_P-G      catggggctttcttggacggtc-----cctctcgagtg-----gggaaagaacctttcca
KF767450_P_P-G      catggggctttcttggacggtc-----cctctcgagtg-----gggaaagaacctttcca
KX264500_P_P-G      catggggctttcttggacggtc-----cctctcgagtg-----gggaaagaacctttcca
FJ023674_P_P-G      catggga-------gggtggacatccacccctcggaaaggcatggggacgaatctttctg
FR714503_P_P-G      catggga-------ggttggtcttccaaacctcgaaaaggcatggggacgaatctttctg
                    ******        **  ** *        ****         *** * *** *****  

EF464097_P_P-G      ccagcaatcctctaggattccttcccgatcaccagttggacccagcattcagagcaaata
EF464098_P_P-G      ccagcaatcctctaggattccttcccgatcaccagttggacccagcattcagagcaaata
KF779267_P_P-G      ccagcaatcctctgggattctttcccgatcaccagttggacccagccttcagagcaaata
DQ207798_P_P-G      ccagcaatcctctaggattccttcccgatcaccagttggacccagcattcagagcaaata
AB056515_P_P-G      ccagcaatcctctaggattccttcccgatcaccagttggacccagcattcagagcaaata
JQ707677_P_P-G      ccagcaatcctctaggattccttcccgatcaccagttggacccagcattcagagcaaata
JQ707678_P_P-G      ccagcaatcctctaggattccttcccgatcaccagttggacccagcattcagagcaaata
JQ707679_P_P-G      ccagcaatcctctaggattccttcccgatcaccagttggacccagcattcagagcaaata
JQ707680_P_P-G      ccagcaatcctctaggattccttcccgatcaccagttggacccagcattcagagcaaata
JQ707673_P_P-G      ccagcaatcctctaggattccttcccgatcaccagttggacccagcattcagagcaaata
JQ707671_P_P-G      ccagcaatcctctaggattccttcccgatcaccagttggacccagcattcagagcaaata
JQ707666_P_P-G      ccagcaatcctctaggattccttcccgatcaccagttggacccagcattcagagcaaata
JQ707660_P_P-G      ccagcaatcctctaggattccttcccgatcaccagttggacccagcattcagagcaaata
JQ707657_P_P-G      ccagcaatcctctaggattccttcccgatcaccagttggacccagcattcagagcaaata
JQ707668_P_P-G      ccagcaatcctctaggattccttcccgatcaccagttggacccagcattcagagcaaata
KF779357_P_P-G      ccagcaatcctctaggattccttcccgatcaccagttggacccagcattcagagcaaata
GU565217_P_P-G      ccagcaatcctctaggattccttcccgatcaccagttggacccagcattcagagcaaata
KF767452_P_P-G      ccagcaatcctctaggattccttcccgatcaccagttggacccagcattcagagcaaata
KF414679_P_P-G      ccagcaatcctctaggattccttcccgatcaccagttggacccagcattcagagcaaata
KF767451_P_P-G      ccagcaatcctctaggattccttcccgatcaccagttggacccagcattcagagcaaata
JQ707436_P_P-G      ccagcaatcctctaggattccttcccgatcaccagttggacccagcattcagagcaaata
KR230749_P_P-G      ccagcaatcctctaggattccttcccgatcaccagttggacccagcattcagagcaaata
EF634480_P_P-G      ccagcaatcctctaggattccttcccgatcaccagttggacccagcattcagagcaaata
AB056514_P_P-G      ccagcaatcctctaggattccttcccgatcaccagttggacccagcattcagagcaaata
HE981171_P_P-G      ccagcaatcctctaggattccttcccgatcaccagttggacccagcattcagagcaaata
HE981172_P_P-G      ccagcaatcctctaggattccttcccgatcaccagttggacccagcattcagagcaaata
HE981174_P_P-G      ccagcaatcctctaggattccttcccgatcaccagttggacccagcattcagagcaaata
AB064312_P_P-G      ccagcaatcctctaggattccttcccgatcaccagttggacccagcattcagagcaaata
AB064311_P_P-G      ccagcaatcctctaggattccttcccgatcaccagttggacccagcattcagagcaaata
AB064313_P_C-G      ccagcaatcctctaggattccttcccgatcaccagttggacccagcattcagagcaaata
KF779235_P_P-G      ccagcaatcctctaggattccttcccgatcaccagttggacccagcattcagagcaaata
AB375165_P_P-G      ccagcaatcctctaggattccttcccgatcaccagttggacccagcattcagagcaaata
AB064310_P_P-G      ccagcaatcctctaggattccttcccgatcaccagttggacccagcattcagagcaaata
KM998716_P_P-G      ccagcaatcctctaggattccttcccgatcaccagttggacccagcattcagagcaaata
HE981175_P_P-G      ccagcaatcctctaggattccttcccgatcaccagttggacccagcattcagagcaaata
HE981176_P_P-G      ccagcaatcctctaggattccttcccgatcaccagttggacccagcattcagagcaaata
AF405706_P_P-G      ccagcaatcctctaggattccttcccgatcaccagttggacccagcattcagagcaaata
AF160501_P_C-G      ccagcaatcctctaggattccttcccgatcaccagttggacccagcattcagagcaaata
AB375166_P_P-G      ccagcaatcctctaggattccttcccgatcaccagttggacccagcattcagagcaaata
AB375167_P_P-G      ccagcaatcctctaggattccttcccgatcaccagttggacccagcattcagagcaaata
AB375168_P_P-G      ccagcaatcctctaggattccttcccgatcaccagttggacccagcattcagagcaaata
AB375169_P_P-G      ccagcaatcctctaggattccttcccgatcaccagttggacccagcattcagagcaaata
AB375170_P_P-G      ccagcaatcctctaggattccttcccgatcaccagttggacccagcattcagagcaaata
KF779233_P_P-G      ccagcaatcctctaggattccttcccgatcaccagttggacccagcattcagagcaaata
AB056513_P_P-G      ccagcaatcctctaggattccttcccgatcaccagttggacccagcattcagagcaaata
GU563556_P_P-G      ccagcaatcctctaggattccttcccgatcaccagttggacccagcattcagagcaaata
KY004111_P_P-G      ccagcaatcctctaggattccttcccgatcaccagttggacccagcattcagagcaaata
KJ194508_P_P-G      ccagcaatcctctaggattccttcccgatcaccagttggacccagcattcagagcaaata
KF767450_P_P-G      ccagcaatcctctaggattccttcccgatcaccagttggacccagcattcagagcaaata
KX264500_P_P-G      ccagcaatcctctaggattccttcccgatcaccagttggacccagcattcagagcaaata
FJ023674_P_P-G      tacccaatcctctgggatttcttcccgatcatcagttggatcctgcgttcggagccaact
FR714503_P_P-G      ttcccaatcctctgggatttcttcccgatcatcagttggaccctgcgttcggagccaact
                        ********* *****  ********** ******** ** ** *** **** **  

EF464097_P_P-G      ccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaagg
EF464098_P_P-G      ccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaagg
KF779267_P_P-G      ccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaagg
DQ207798_P_P-G      ccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaagg
AB056515_P_P-G      ccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaagg
JQ707677_P_P-G      ccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaagg
JQ707678_P_P-G      ccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaagg
JQ707679_P_P-G      ccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaagg
JQ707680_P_P-G      ccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaagg
JQ707673_P_P-G      ccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaagg
JQ707671_P_P-G      ccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaagg
JQ707666_P_P-G      ccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaagg
JQ707660_P_P-G      ccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaagg
JQ707657_P_P-G      ccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaagg
JQ707668_P_P-G      ccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaagg
KF779357_P_P-G      ccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaagg
GU565217_P_P-G      ccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaagg
KF767452_P_P-G      ccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaagg
KF414679_P_P-G      ccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaagg
KF767451_P_P-G      ccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaagg
JQ707436_P_P-G      ccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaagg
KR230749_P_P-G      ccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaagg
EF634480_P_P-G      ccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaagg
AB056514_P_P-G      ccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaagg
HE981171_P_P-G      ccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaagg
HE981172_P_P-G      ccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaagg
HE981174_P_P-G      ccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaagg
AB064312_P_P-G      ccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaagg
AB064311_P_P-G      ccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaagg
AB064313_P_C-G      ccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaagg
KF779235_P_P-G      ccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaagg
AB375165_P_P-G      ccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaagg
AB064310_P_P-G      ccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaagg
KM998716_P_P-G      ccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaagg
HE981175_P_P-G      ccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaagg
HE981176_P_P-G      ccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaagg
AF405706_P_P-G      ccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaagg
AF160501_P_C-G      ccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaagg
AB375166_P_P-G      ccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaagg
AB375167_P_P-G      ccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaagg
AB375168_P_P-G      ccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaagg
AB375169_P_P-G      ccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaagg
AB375170_P_P-G      ccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaagg
KF779233_P_P-G      ccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaagg
AB056513_P_P-G      ccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaagg
GU563556_P_P-G      ccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaagg
KY004111_P_P-G      ccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaagg
KJ194508_P_P-G      ccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaagg
KF767450_P_P-G      ccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaagg
KX264500_P_P-G      ccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaagg
FJ023674_P_P-G      caaacaatccagattgggacttcaaccccaacaaggaccattggccacaagcccatcagg
FR714503_P_P-G      caaacaatccagattgggacttcaaccccaacaaggaccattggccacaagcccatcagg
                    * *********************** ***** ******* ******* * *** *  ***

EF464097_P_P-G      taggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtgga
EF464098_P_P-G      taggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtgga
KF779267_P_P-G      taggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtgga
DQ207798_P_P-G      taggagttggagcctatggacccgggttcacccctccgcacggaggccttttggggtgga
AB056515_P_P-G      taggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtgga
JQ707677_P_P-G      taggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtgga
JQ707678_P_P-G      taggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtgga
JQ707679_P_P-G      taggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtgga
JQ707680_P_P-G      taggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtgga
JQ707673_P_P-G      taggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtgga
JQ707671_P_P-G      taggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtgga
JQ707666_P_P-G      taggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtgga
JQ707660_P_P-G      taggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtgga
JQ707657_P_P-G      taggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtgga
JQ707668_P_P-G      taggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtgga
KF779357_P_P-G      taggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtgga
GU565217_P_P-G      taggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtgga
KF767452_P_P-G      taggagtcggagcctatggacccgggttcacccctccacacggaggccttttggggtgga
KF414679_P_P-G      taggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtgga
KF767451_P_P-G      taggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtgga
JQ707436_P_P-G      taggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtgga
KR230749_P_P-G      taggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtgga
EF634480_P_P-G      taggagttggagcctatggacccgggttcacccctccacacggaggccttctggggtgga
AB056514_P_P-G      taggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtgga
HE981171_P_P-G      taggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtgga
HE981172_P_P-G      taggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtgga
HE981174_P_P-G      taggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtgga
AB064312_P_P-G      taggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtgga
AB064311_P_P-G      taggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtgga
AB064313_P_C-G      taggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtgga
KF779235_P_P-G      taggagttggagcctacggacccgggttcacccctccacacggaggccttttggggtgga
AB375165_P_P-G      taggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtgga
AB064310_P_P-G      taggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtgga
KM998716_P_P-G      taggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtgga
HE981175_P_P-G      taggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtgga
HE981176_P_P-G      taggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtgga
AF405706_P_P-G      taggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtgga
AF160501_P_C-G      taggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtgga
AB375166_P_P-G      taggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtgga
AB375167_P_P-G      taggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtgga
AB375168_P_P-G      taggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtgga
AB375169_P_P-G      taggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtgga
AB375170_P_P-G      taggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtgga
KF779233_P_P-G      taggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtgga
AB056513_P_P-G      taggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtgga
GU563556_P_P-G      taggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtgga
KY004111_P_P-G      taggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtgga
KJ194508_P_P-G      taggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtgga
KF767450_P_P-G      taggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtgga
KX264500_P_P-G      taggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtgga
FJ023674_P_P-G      taggagcgggagcattcgggccagggttcacccctccacacggaggtctgttggggtgga
FR714503_P_P-G      taggagcgggagcattcgggccagggttcacccctcctcacggaggtcttttggggtgga
                    ******  ***** *  ** ** ************** ******** **  *********

EF464097_P_P-G      gccctcagtctcagggcacactaacaactttgccagcagatccgcctcctgcctccacca
EF464098_P_P-G      gccctcagtctcagggcacactaacaactttgccagcagatccgcctcctgcctccacca
KF779267_P_P-G      gccctcagtctcagggcacactaacaactttgccagcagatccgcctcctgcctccacca
DQ207798_P_P-G      gccctcagtctcagggcacactaacaactttgccagcagatccgcctcctgcctccacca
AB056515_P_P-G      gccctcagtctcagggcacactaacaactttgccagcagatccgcctcctgcctccacca
JQ707677_P_P-G      gccctcagtctcagggcacactaacaactttgccagcagatccgcctcctgcctccacca
JQ707678_P_P-G      gccctcagtctcagggcacactaacaactttgccagcagatccgcctcctgcctccacca
JQ707679_P_P-G      gccctcagtctcagggcacactaacaactttgccagcagatccgcctcctgcctccacca
JQ707680_P_P-G      gccctcagtctcagggcacactaacaactttgccagcagatccgcctcctgcctccacca
JQ707673_P_P-G      gccctcagtctcagggcacactaacaactttgccagcagatccgcctcctgcctccacca
JQ707671_P_P-G      gccctcagtctcagggcacactaacaactttgccagcagatccgcctcctgcctccacca
JQ707666_P_P-G      gccctcagtctcagggcacactaacaactttgccagcagatccgcctcctgcctccacca
JQ707660_P_P-G      gccctcagtctcagggcacactaacaactttgccagcagatccgcctcctgcctccacca
JQ707657_P_P-G      gccctcagtctcagggcacactaacaactttgccagcagatccgcctcctgcctccacca
JQ707668_P_P-G      gccctcagtctcagggcacactaacaactttgccagcagatccgcctcctgcctccacca
KF779357_P_P-G      gccctcagtctcagggcacactaacaactttgccagcagatccgcctcctgcctccacca
GU565217_P_P-G      gccctccgtctcagggcacactaacaactttgccagcagatccgcctcctgcctccacca
KF767452_P_P-G      gccctcagtctcagggcacactaacaactttgccagcagatccgcctcctgcctccacca
KF414679_P_P-G      gccctcagtctcagggcacactaacaactttgccagcagatccgcctcctgcctccacca
KF767451_P_P-G      gccctcagtctcagggcacactaacaactttgccagcagatccgcctcctgcctccacca
JQ707436_P_P-G      gccctcagtctcagggcacactaacaactttgccagcagatccgcctcctgcctccacca
KR230749_P_P-G      gccctcagtctcagggcacactaacaactttgccagcagatccgcctcctgcctccacca
EF634480_P_P-G      gccctcagtctcagggcacactaacaactttaccagcagatccgcctcctgcctccacca
AB056514_P_P-G      gccctcagtctcagggcacactaacaactttgccagcagatccgcctcctgcctccacca
HE981171_P_P-G      gccctcagtctcagggcacactaacaactttgccagcagatccgcctcctgcctccacca
HE981172_P_P-G      gccctcagtctcagggcacactaacaactttgccagcagatccgcctcctgcctccacca
HE981174_P_P-G      gccttcaatctcagggcacactaacaactttgccagcagatccgcctcctgcctccacca
AB064312_P_P-G      gccctcagtctcagggcacactaacaactttgccagcagatccgcctcctgcctccacca
AB064311_P_P-G      gccctcagtctcagggcacactaacaactttgccagcagatccgcccactgcctccacca
AB064313_P_C-G      gccctcagtctcagggcacactaacaactttgccagcagatccgcctcctgcctccacca
KF779235_P_P-G      gccctcagtctcagggcacactaacaactttgccagcagatccgcctcctgcctccacca
AB375165_P_P-G      gccctcagtctcagggcacactaacaactttgccagcagatccgcctcctgcctccacca
AB064310_P_P-G      gccctcagtctcagggcacactaacaactttgccagcagatccgcctcctgcctccacca
KM998716_P_P-G      gccctcagtctcagggcacactaacaactttgccagcagatccgcctcctgcctccacca
HE981175_P_P-G      gccttcagtctcagggcacactaacaactttgccagcagatccgcctcctgcctccacca
HE981176_P_P-G      gccttcagtctcagggcacactaacaactttgccagcagatccgcctcctgcctccacca
AF405706_P_P-G      gccctcagtctcagggcacactaacaactttgccagcagatccgcctcctgcctccacca
AF160501_P_C-G      gccctcagtctcagggcacactaacaactttgccagcagatccgcctcctgcctccacca
AB375166_P_P-G      gccctcagtctcagggcacactaacaactttgccagcagatccgcctcctgcctccacca
AB375167_P_P-G      gccctcagtctcagggcacactaacaactttgccagcagatccgcctcctgcctccacca
AB375168_P_P-G      gccctcagtctcagggcacactaacaactttgccagcagatccgcctcctgcctccacca
AB375169_P_P-G      gccctcagtctcagggcacactaacaactttgccagcagatccgcctcctgcctccacca
AB375170_P_P-G      gccctcagtctcagggcacactaacaactttgccagcagatccgcctcctgcctccacca
KF779233_P_P-G      gccctcagtctcagggcacactaacaactttgccagcagatccgcctcctgcctccacca
AB056513_P_P-G      gccctcagtctcagggcacactaacaactttgccagcagatccgcctcctgcctccacca
GU563556_P_P-G      gccctcagtctcagggcacactaacaactttgccagcagatccgcctcctgcctccacca
KY004111_P_P-G      gccctcagtctcagggcacactaacaactttgccagcagatccgcctcctgcctccacca
KJ194508_P_P-G      gccctcagtctcagggcacactaacaactttgccagcagatccgcctcctgcctccacca
KF767450_P_P-G      gccctcagtctcagggcacactaacaactttgccagcagatccgcctcctgcctccacca
KX264500_P_P-G      gccctcagtctcagggcacactaacaactttgccagcagatccgcctcctgcctccacca
FJ023674_P_P-G      gccctcaggctcagggcatattaacaaatgtgccagcagttcctcctcctgcctcaacca
FR714503_P_P-G      gccctcaggctcagggcatattaacaaacgtgccagcagttcctcctcctgcctccacca
                    *** **   ********* * ******   * ******* *** **  ******* ****

EF464097_P_P-G      atcgtcagtcagggaggcagcctactcccatctctccaccactaagagacagtcatcctc
EF464098_P_P-G      atcgtcagtcagggaggcagcctactcccatctctccaccactaagagacagtcatcctc
KF779267_P_P-G      atcgtcagtcagggaggcagcctactcccatctctccaccactaagagacagtcatcctc
DQ207798_P_P-G      atcgtcagtcagggaggcagcctactcccatctctccaccactgagagacagtcatcctc
AB056515_P_P-G      atcgtcagtcagggaggcagcctactcccatctctccacctctaagagacagtcatcctc
JQ707677_P_P-G      atcgtcagtcagggaggcagcctactcccatctctccaccactaagagacagtcatcctc
JQ707678_P_P-G      atcgtcagtcagggaggcagcctactcccatctctccaccactaagagacagtcatcctc
JQ707679_P_P-G      atcgtcagtcagggaggcagcctactcccatctctccaccactaagagacagtcatcctc
JQ707680_P_P-G      atcgtcagtcagggaggcagcctactcccatctctccaccactaagagacagtcatcctc
JQ707673_P_P-G      atcgtcagtcagggaggcagcctactcccatctctccaccactaagagacagtcatcctc
JQ707671_P_P-G      atcgtcagtcagggaggcagcctactcccatctctccaccactaagagacagtcatcctc
JQ707666_P_P-G      atcgtcagtcagggaggcagcctactcccatctctccaccactaagagacagtcatcctc
JQ707660_P_P-G      atcgtcagtcagggaggcagcctactcccatctctccaccactaagagacagtcatcctc
JQ707657_P_P-G      atcgtcagtcagggaggcagcctactcccatctctccaccactaagagacagtcatcctc
JQ707668_P_P-G      atcgtcagtcagggaggcagcctactcccatctctccaccactaagagacagtcatcctc
KF779357_P_P-G      atcgtcagtcagggaggcagcctactcccatctctccaccactaagagacagtcatcctc
GU565217_P_P-G      atcgtcagtcagggaggcagcctactcccatctctccaccactaagagacagtcatcctc
KF767452_P_P-G      atcgtcagtcagggaggcagcctactcccatctctccaccactaagagacagtcatcctc
KF414679_P_P-G      atcgtcagtcagggaggcagcctactcccatctctccaccactaagagacagtcatcctc
KF767451_P_P-G      atcgtcagtcagggaggcagcctactcccatctctccaccactaagagacagtcatcctc
JQ707436_P_P-G      atcgtcagtcagggaggcagcctactcccatctctccaccactaagagacagtcatcctc
KR230749_P_P-G      atcgtcagtcagggaggcagcctactcccatctctccaccactaagagacagtcatcctc
EF634480_P_P-G      atcgtcagtcagggaggcagcctactcccatctctccaccactaagagacagtcatcctc
AB056514_P_P-G      atcgtcagtcagggaggcagcctactcccatctctccaccactaagagacagtcatcctc
HE981171_P_P-G      atcgtcagtcagggaggcagcctactcccatctctccaccactaagagacagtcatcctc
HE981172_P_P-G      atcgtcagtcagggaggcagcctactcccatctctccaccactaagagacagtcatcctc
HE981174_P_P-G      atcgtcagtcagggaggcagcctactcccatctctccaccactaagagacagtcatcctc
AB064312_P_P-G      atcgtcagtcagggaggcagcctactcccatctctccaccactaagagacagtcatcctc
AB064311_P_P-G      atcgtcagtcagggaggcagcctactcccatctctccaccactaagagacagtcatcctc
AB064313_P_C-G      atcgtcagtcagggaggcagcctactcccatctctccaccactaagagacagtcatcctc
KF779235_P_P-G      atcgtcagtcagggaggcagcctactcccatctctccaccactaagagacagtcatcctc
AB375165_P_P-G      atcgtcagtcagggaggcagcctactcccatctctccaccactaagagacagtcatcctc
AB064310_P_P-G      atcgtcagtcagggaggcagcctactcccatctctccaccactaagagacagtcatcctc
KM998716_P_P-G      atcgtcagtcagggaggcagcctactcccatctctccaccactaagagacagtcatcctc
HE981175_P_P-G      atcgtcagtcagggaggcagcctactcccatctctccaccactaagagacagtcatcctc
HE981176_P_P-G      atcgtcagtcagggaggcagcctactcccatctctccaccactaagagacagtcatcctc
AF405706_P_P-G      atcgtcagtcagggaggcagcctactcccatctctccaccactaagagacagtcatcctc
AF160501_P_C-G      atcgtcagtcagggaggcagcctactcccatctctccaccactaagagacagtcatcctc
AB375166_P_P-G      atcgtcagtcagggaggcagcctactcccatctctccaccactaagagacagtcatcctc
AB375167_P_P-G      atcgtcagtcagggaggcagcctactcccatctctccaccactaagagacagtcatcctc
AB375168_P_P-G      atcgtcagtcagggaggcagcctactcccatctctccaccactaagagacagtcatcctc
AB375169_P_P-G      atcgtcagtcagggaggcagcctactcccatctctccaccactaagagacagtcatcctc
AB375170_P_P-G      atcgtcagtcagggaggcagcctactcccatctctccaccactaagagacagtcatcctc
KF779233_P_P-G      atcgtcagtcagggaggcagcctactcccatctctccaccactaagagacagtcatcctc
AB056513_P_P-G      atcgtcagtcagggaggcagcctactcccatctctccaccactaagagacagtcatcctc
GU563556_P_P-G      atcgtcagtcagggaggcagcctactcccatctctccaccactaagagacagtcatcctc
KY004111_P_P-G      atcgtcagtcagggaggcagcctactcccatctctccaccactaagagacagtcatcctc
KJ194508_P_P-G      atcgtcagtcagggaggcagcctactcccatctctccaccactaagagacagtcatcctc
KF767450_P_P-G      atcgtcagtcagggaggcagcctactcccatctctccaccactaagagacagtcatcctc
KX264500_P_P-G      atcgtcagtcagggaggcagcctactcccatctctccaccactaagagacagtcatcctc
FJ023674_P_P-G      atcggcagtcaggacggcagcccactcccatctctccacctctgagagacagycatcctc
FR714503_P_P-G      atcggcagtcaggaaggcagccaactcccatatctccacctctaagagacagtcatcctc
                    **** ********  ******* ******** ******** ** ******** *******

EF464097_P_P-G      aggccatgcagtggaactccacccagttccaccaagctctacaaaatcccaaagtcaggg
EF464098_P_P-G      aggccatgcagtggaactccacccagttccaccaagctctacaaaatcccaaagtcaggg
KF779267_P_P-G      aggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggg
DQ207798_P_P-G      aggccatgcagtggaactctacagcattccaccaagctctgcaaaatcccaaagtcaggg
AB056515_P_P-G      aggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggg
JQ707677_P_P-G      aggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggg
JQ707678_P_P-G      aggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggg
JQ707679_P_P-G      aggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggg
JQ707680_P_P-G      aggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggg
JQ707673_P_P-G      aggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggg
JQ707671_P_P-G      aggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggg
JQ707666_P_P-G      aggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggg
JQ707660_P_P-G      aggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggg
JQ707657_P_P-G      aggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggg
JQ707668_P_P-G      aggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggg
KF779357_P_P-G      aggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggg
GU565217_P_P-G      aggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggg
KF767452_P_P-G      aggccatgcagtg---ctctacagcattccaccaagctctacaaaatcccaaagtcaggg
KF414679_P_P-G      aggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggg
KF767451_P_P-G      aggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggg
JQ707436_P_P-G      aggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggg
KR230749_P_P-G      aggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggg
EF634480_P_P-G      aggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggg
AB056514_P_P-G      aggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggg
HE981171_P_P-G      aggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcag--
HE981172_P_P-G      aggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcag--
HE981174_P_P-G      aggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggg
AB064312_P_P-G      aggccatgcagtggaactctacagcattccaccaagctctacaaaatcccacagtcaggg
AB064311_P_P-G      aggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggg
AB064313_P_C-G      aggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggg
KF779235_P_P-G      aggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggg
AB375165_P_P-G      aggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggg
AB064310_P_P-G      aggccctgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggg
KM998716_P_P-G      aggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggg
HE981175_P_P-G      aggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggg
HE981176_P_P-G      aggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggg
AF405706_P_P-G      aggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggg
AF160501_P_C-G      aggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggg
AB375166_P_P-G      aggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggg
AB375167_P_P-G      aggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggg
AB375168_P_P-G      aggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggg
AB375169_P_P-G      aggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggg
AB375170_P_P-G      aggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggg
KF779233_P_P-G      aggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggg
AB056513_P_P-G      aggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggg
GU563556_P_P-G      aggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggg
KY004111_P_P-G      aggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggg
KJ194508_P_P-G      aggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggg
KF767450_P_P-G      aggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggg
KX264500_P_P-G      aggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggg
FJ023674_P_P-G      aggccatgcagtggaactccacaaccttccaccaagctcttcargatcccagagtcaggg
FR714503_P_P-G      aggccatgcagtggaactccaccaccttccaccaagctctacaagatcccagaatcaggg
                    ***** *******   *** **    ************** **  ****** * ****  

EF464097_P_P-G      gcctgtattttcctgctggtggctccagttcagagacacagaaccctgttccgactattg
EF464098_P_P-G      gcctgtattttcctgctggtggctccagttcagagacagcagaacctgctccgactattg
KF779267_P_P-G      gcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattg
DQ207798_P_P-G      gcctgta---tcctgctggtggctccagttcaggaacagtgagccctgttccgactattg
AB056515_P_P-G      gcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattg
JQ707677_P_P-G      gcctgtatcttcctgctggtggctccagttcagggatagtgaaccctgttccgactattg
JQ707678_P_P-G      gcctgtatcttcctgctggtggctccagttcagggatagtgaaccctgttccgactattg
JQ707679_P_P-G      gcctgtatcttcctgctggtggctccagttcagggatagtgaaccctgttccgactattg
JQ707680_P_P-G      gcctgtatcttcctgctggtggctccagttcagggatagtgaaccctgttccgactattg
JQ707673_P_P-G      gcctgtatcttcctgctggtggctccagttcagggatagtgaaccctgttccgactattg
JQ707671_P_P-G      gcctgtatcttcctgctggtggctccagttcagggatagtgaaccctgttccgactattg
JQ707666_P_P-G      gcctgtatcttcctgctggtggctccagttcagggatagtgaaccctgttccgactattg
JQ707660_P_P-G      gcctgtatcttcctgctggtggctccagttcagggatagtgaaccctgttccgactattg
JQ707657_P_P-G      gcctgtatcttcctgctggtggctccagttcagggatagtgaaccctgttccgactattg
JQ707668_P_P-G      gcctgtatcttcctgctggtggctccagttcagggatagtgaaccctgttccgactattg
KF779357_P_P-G      gcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgaatattg
GU565217_P_P-G      gcctgtatcttcctgctggtggctccagttcagggatagtgaaccctgttccgactattg
KF767452_P_P-G      gcctgtatcttcctgctggtggctccagttcagggatagtgaaccctgttccgactattg
KF414679_P_P-G      gcctgtatcttcctgctggtggctccagttcagggatagtgaaccctgttccgactattg
KF767451_P_P-G      gcctgta---tcctgctggtggctccagttcagggatagtgaaccctgttccgactattg
JQ707436_P_P-G      gcctgta---tcctgctggtggctccagttcagggatagtgaaccctgttccgactattg
KR230749_P_P-G      gcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattg
EF634480_P_P-G      gcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattg
AB056514_P_P-G      ---------ttcctgctggtggctccagttcagggatagtgaaccctgttccgactattg
HE981171_P_P-G      ----------tcctgctggtggctccagttcagggatagtgaaccctgttccgactattg
HE981172_P_P-G      ----------tcctgctggtggctccagttcagggatagtgaaccttgttccgactattg
HE981174_P_P-G      gcctgtatcttcctgctggtggctccagttcagggatagtgaaccctgttccgactattg
AB064312_P_P-G      gcctgtatcttcctgctggtggctccagttcagggatagtgaaccctgttccgactattg
AB064311_P_P-G      gcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattg
AB064313_P_C-G      gcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattg
KF779235_P_P-G      gcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattg
AB375165_P_P-G      gcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattg
AB064310_P_P-G      gcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattg
KM998716_P_P-G      gcctgtatcttcctgctggtggctccagttcagggatagtgaaccctgttccgactattg
HE981175_P_P-G      gcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattg
HE981176_P_P-G      gcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattg
AF405706_P_P-G      gcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattg
AF160501_P_C-G      gcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattg
AB375166_P_P-G      gcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattg
AB375167_P_P-G      gcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattg
AB375168_P_P-G      gcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattg
AB375169_P_P-G      gcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattg
AB375170_P_P-G      gcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattg
KF779233_P_P-G      gcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattg
AB056513_P_P-G      gcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattg
GU563556_P_P-G      gcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattg
KY004111_P_P-G      gcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattg
KJ194508_P_P-G      gcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattg
KF767450_P_P-G      gcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattg
KX264500_P_P-G      gcctgtattttcctgctggtggctccagttcagggatagtgaaccctgttccgactattg
FJ023674_P_P-G      gcctgtattttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatattg
FR714503_P_P-G      gcctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattg
                              ***********************  * *      * ** ***** *****

EF464097_P_P-G      cctctctcacatcatcaatcttctcgaagactgggggccctgcaccgaacatggagaaca
EF464098_P_P-G      cctctctcacatcatcaatcttctcgaagactgggggccctgcaccgaacatggagaaca
KF779267_P_P-G      cctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggagaaca
DQ207798_P_P-G      cctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggagaaca
AB056515_P_P-G      cctctcacatctcgtcaatcttctccaagattggggaccctgcaccgaacatggagaaca
JQ707677_P_P-G      cctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggagaaca
JQ707678_P_P-G      cctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggagaaca
JQ707679_P_P-G      cctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggagaaca
JQ707680_P_P-G      cctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggagaaca
JQ707673_P_P-G      cctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggagaaca
JQ707671_P_P-G      cctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggagaaca
JQ707666_P_P-G      cctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggagaaca
JQ707660_P_P-G      cctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggagaaca
JQ707657_P_P-G      cctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggagaaca
JQ707668_P_P-G      cctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggagaaca
KF779357_P_P-G      cctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggagaaca
GU565217_P_P-G      cctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggagaaca
KF767452_P_P-G      cctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggagaaca
KF414679_P_P-G      cctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggagaaca
KF767451_P_P-G      cctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggagaaca
JQ707436_P_P-G      cctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggagaaca
KR230749_P_P-G      cctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggagaaca
EF634480_P_P-G      cctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggagaaca
AB056514_P_P-G      cctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggagaaca
HE981171_P_P-G      cctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggagaaca
HE981172_P_P-G      cctctcacatctcgtcaatcttctccaggattggggaccctgtaccgaacatggagaaca
HE981174_P_P-G      cctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggagaaca
AB064312_P_P-G      cctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggagaaca
AB064311_P_P-G      cctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggagaaca
AB064313_P_C-G      cctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggagaaca
KF779235_P_P-G      cctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggagaaca
AB375165_P_P-G      cctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggagaaca
AB064310_P_P-G      cctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaatatggagaaca
KM998716_P_P-G      cctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggagaaca
HE981175_P_P-G      cctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggagaaca
HE981176_P_P-G      cctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggagaaca
AF405706_P_P-G      cctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggagaaca
AF160501_P_C-G      cctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggagaaca
AB375166_P_P-G      cctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggagaaca
AB375167_P_P-G      cctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggagaaca
AB375168_P_P-G      cctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggagaaca
AB375169_P_P-G      cctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggagaaca
AB375170_P_P-G      cctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggagaaca
KF779233_P_P-G      cctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggagaaca
AB056513_P_P-G      cctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggagaata
GU563556_P_P-G      cctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggagaaca
KY004111_P_P-G      cctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggagaaca
KJ194508_P_P-G      cctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggagaaca
KF767450_P_P-G      cctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggagaaca
KX264500_P_P-G      cctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggagaaca
FJ023674_P_P-G      cctctcacatctcatcaatcttcgcaaggactggggaccttgcaccgaacatggagaaca
FR714503_P_P-G      cctctcacatctcatcaatcttcacgaggattggggaccctgcaacgaacatggagaaca
                    ****** **  ** ********* * * ** ***** ** ** * **** ******** *

EF464097_P_P-G      tcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaa
EF464098_P_P-G      tcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaa
KF779267_P_P-G      tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaa
DQ207798_P_P-G      tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaa
AB056515_P_P-G      tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaa
JQ707677_P_P-G      tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaa
JQ707678_P_P-G      tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaa
JQ707679_P_P-G      tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaa
JQ707680_P_P-G      tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaa
JQ707673_P_P-G      tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaa
JQ707671_P_P-G      tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaa
JQ707666_P_P-G      tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaa
JQ707660_P_P-G      tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaa
JQ707657_P_P-G      tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaa
JQ707668_P_P-G      tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaa
KF779357_P_P-G      tcacatcaggattcctaggacccctgctcgtgttacaggcggggtatttcgtgttgacaa
GU565217_P_P-G      tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaa
KF767452_P_P-G      tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaa
KF414679_P_P-G      tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaa
KF767451_P_P-G      tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaa
JQ707436_P_P-G      tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaa
KR230749_P_P-G      tcacatcaggattcctaggacccctgctcgtgttacaggcgggggttttcttgttgacaa
EF634480_P_P-G      tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaa
AB056514_P_P-G      tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaa
HE981171_P_P-G      tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaa
HE981172_P_P-G      tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaa
HE981174_P_P-G      tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaa
AB064312_P_P-G      tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaa
AB064311_P_P-G      tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaa
AB064313_P_C-G      tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaa
KF779235_P_P-G      tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaa
AB375165_P_P-G      tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaa
AB064310_P_P-G      tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaa
KM998716_P_P-G      tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaa
HE981175_P_P-G      tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaa
HE981176_P_P-G      tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaa
AF405706_P_P-G      tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaa
AF160501_P_C-G      tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaa
AB375166_P_P-G      tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaa
AB375167_P_P-G      tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaa
AB375168_P_P-G      tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaa
AB375169_P_P-G      tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaa
AB375170_P_P-G      tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaa
KF779233_P_P-G      tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaa
AB056513_P_P-G      tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaa
GU563556_P_P-G      tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaa
KY004111_P_P-G      tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaa
KJ194508_P_P-G      tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaa
KF767450_P_P-G      tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaa
KX264500_P_P-G      tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaa
FJ023674_P_P-G      tcacatcaggattcctcggacccctgctcgtgttacaggcgggatttttcttgttgacaa
FR714503_P_P-G      tcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaa
                    *********** **** *************************    **** *********

EF464097_P_P-G      gaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggg
EF464098_P_P-G      gaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggg
KF779267_P_P-G      gaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggg
DQ207798_P_P-G      gaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggg
AB056515_P_P-G      gaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggg
JQ707677_P_P-G      gaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggg
JQ707678_P_P-G      gaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggg
JQ707679_P_P-G      gaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggg
JQ707680_P_P-G      gaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggg
JQ707673_P_P-G      gaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggg
JQ707671_P_P-G      gaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggg
JQ707666_P_P-G      gaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggg
JQ707660_P_P-G      gaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggg
JQ707657_P_P-G      gaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggg
JQ707668_P_P-G      gaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggg
KF779357_P_P-G      gattcttcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggg
GU565217_P_P-G      gaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggg
KF767452_P_P-G      gaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggg
KF414679_P_P-G      gaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggg
KF767451_P_P-G      gaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggg
JQ707436_P_P-G      gaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggg
KR230749_P_P-G      gaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggg
EF634480_P_P-G      gaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggg
AB056514_P_P-G      gaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggg
HE981171_P_P-G      gaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggg
HE981172_P_P-G      gaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggg
HE981174_P_P-G      gaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggg
AB064312_P_P-G      gaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggg
AB064311_P_P-G      gaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggg
AB064313_P_C-G      gaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggg
KF779235_P_P-G      gaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggg
AB375165_P_P-G      gaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggg
AB064310_P_P-G      gaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggg
KM998716_P_P-G      gaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggg
HE981175_P_P-G      gaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggg
HE981176_P_P-G      gaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggg
AF405706_P_P-G      gaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggg
AF160501_P_C-G      gaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggg
AB375166_P_P-G      gaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggg
AB375167_P_P-G      gaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggg
AB375168_P_P-G      gaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggg
AB375169_P_P-G      gaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggg
AB375170_P_P-G      gaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggg
KF779233_P_P-G      gaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggg
AB056513_P_P-G      gaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggg
GU563556_P_P-G      gaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggg
KY004111_P_P-G      gaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggg
KJ194508_P_P-G      gaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggg
KF767450_P_P-G      gaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggg
KX264500_P_P-G      gaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggg
FJ023674_P_P-G      aaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggg
FR714503_P_P-G      aaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggg
                     * ** ********** *******************************************

EF464097_P_P-G      aagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatct
EF464098_P_P-G      aagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatct
KF779267_P_P-G      gagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatct
DQ207798_P_P-G      gagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatct
AB056515_P_P-G      gagcgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatct
JQ707677_P_P-G      gagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatct
JQ707678_P_P-G      gagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatct
JQ707679_P_P-G      gagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatct
JQ707680_P_P-G      gagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatct
JQ707673_P_P-G      gagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatct
JQ707671_P_P-G      gagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatct
JQ707666_P_P-G      gagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatct
JQ707660_P_P-G      gagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatct
JQ707657_P_P-G      gagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatct
JQ707668_P_P-G      gagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatct
KF779357_P_P-G      gagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatct
GU565217_P_P-G      gagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatct
KF767452_P_P-G      gagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatct
KF414679_P_P-G      gagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcactaatct
KF767451_P_P-G      gagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatct
JQ707436_P_P-G      gagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatct
KR230749_P_P-G      gagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatct
EF634480_P_P-G      gagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatct
AB056514_P_P-G      gagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatct
HE981171_P_P-G      gagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatct
HE981172_P_P-G      gagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatct
HE981174_P_P-G      gagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatct
AB064312_P_P-G      gagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatct
AB064311_P_P-G      gagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatct
AB064313_P_C-G      gagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatct
KF779235_P_P-G      gagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatct
AB375165_P_P-G      gagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatct
AB064310_P_P-G      gagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatct
KM998716_P_P-G      gagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatct
HE981175_P_P-G      gagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatct
HE981176_P_P-G      gagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatct
AF405706_P_P-G      gagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatct
AF160501_P_C-G      gagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatct
AB375166_P_P-G      gagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatct
AB375167_P_P-G      gagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatct
AB375168_P_P-G      gagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatct
AB375169_P_P-G      gagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatct
AB375170_P_P-G      gagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatct
KF779233_P_P-G      gagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatct
AB056513_P_P-G      gagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatct
GU563556_P_P-G      gagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatct
KY004111_P_P-G      gagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatct
KJ194508_P_P-G      gagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatct
KF767450_P_P-G      gagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatct
KX264500_P_P-G      gagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatct
FJ023674_P_P-G      gaacaaccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacct
FR714503_P_P-G      gagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacct
                     *    ********* ***** ******************************** ** **

EF464097_P_P-G      cctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcc
EF464098_P_P-G      cctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcc
KF779267_P_P-G      cctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcc
DQ207798_P_P-G      cctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcc
AB056515_P_P-G      cctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcc
JQ707677_P_P-G      cctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgttttatcatattcc
JQ707678_P_P-G      cctgtcctccaacttgtcctggctatcgctggatgtgtttgcggcgttttatcatattcc
JQ707679_P_P-G      cctgtcctccaacttgtcctggctatcgctggatgtgtttgcggcgttttatcatattcc
JQ707680_P_P-G      cctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcc
JQ707673_P_P-G      cctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcc
JQ707671_P_P-G      cctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcc
JQ707666_P_P-G      cctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcc
JQ707660_P_P-G      cctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcc
JQ707657_P_P-G      cctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcc
JQ707668_P_P-G      cctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcc
KF779357_P_P-G      cctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcc
GU565217_P_P-G      cctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcc
KF767452_P_P-G      cctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcc
KF414679_P_P-G      cctgtcctccaacttgtcctggctatcgctggatgtggctgcggcgttttatcatattcc
KF767451_P_P-G      cctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcc
JQ707436_P_P-G      cctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcc
KR230749_P_P-G      cctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcc
EF634480_P_P-G      cctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcc
AB056514_P_P-G      cctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcc
HE981171_P_P-G      cctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcc
HE981172_P_P-G      cctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcc
HE981174_P_P-G      cctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcc
AB064312_P_P-G      cctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcc
AB064311_P_P-G      cctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcc
AB064313_P_C-G      cctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcc
KF779235_P_P-G      cctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcc
AB375165_P_P-G      cctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcc
AB064310_P_P-G      cctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcc
KM998716_P_P-G      cctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcc
HE981175_P_P-G      cctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcc
HE981176_P_P-G      cctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcc
AF405706_P_P-G      cctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcc
AF160501_P_C-G      cctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcc
AB375166_P_P-G      cctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcc
AB375167_P_P-G      cctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcc
AB375168_P_P-G      cctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcc
AB375169_P_P-G      cctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcc
AB375170_P_P-G      cctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcc
KF779233_P_P-G      cctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcc
AB056513_P_P-G      cctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcc
GU563556_P_P-G      cctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcc
KY004111_P_P-G      cctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcc
KJ194508_P_P-G      cctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcc
KF767450_P_P-G      cctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcc
KX264500_P_P-G      cctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcc
FJ023674_P_P-G      cctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatcttcc
FR714503_P_P-G      cctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatcttcc
                    ************ ********* **************  **************** ****

EF464097_P_P-G      tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgt
EF464098_P_P-G      tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgt
KF779267_P_P-G      tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgt
DQ207798_P_P-G      tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgt
AB056515_P_P-G      tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgt
JQ707677_P_P-G      tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgt
JQ707678_P_P-G      tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgt
JQ707679_P_P-G      tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgt
JQ707680_P_P-G      tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgt
JQ707673_P_P-G      tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgt
JQ707671_P_P-G      tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgt
JQ707666_P_P-G      tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgt
JQ707660_P_P-G      tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgt
JQ707657_P_P-G      tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgt
JQ707668_P_P-G      tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgt
KF779357_P_P-G      tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgt
GU565217_P_P-G      tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgt
KF767452_P_P-G      tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgt
KF414679_P_P-G      tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgt
KF767451_P_P-G      tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgt
JQ707436_P_P-G      tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgt
KR230749_P_P-G      tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgt
EF634480_P_P-G      tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgt
AB056514_P_P-G      tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgt
HE981171_P_P-G      tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgt
HE981172_P_P-G      tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgt
HE981174_P_P-G      tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgt
AB064312_P_P-G      tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgt
AB064311_P_P-G      tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgt
AB064313_P_C-G      tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgt
KF779235_P_P-G      tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgt
AB375165_P_P-G      tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgt
AB064310_P_P-G      tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgt
KM998716_P_P-G      tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgt
HE981175_P_P-G      tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgt
HE981176_P_P-G      tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgt
AF405706_P_P-G      tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgt
AF160501_P_C-G      tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgt
AB375166_P_P-G      tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgt
AB375167_P_P-G      tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgt
AB375168_P_P-G      tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgt
AB375169_P_P-G      tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgt
AB375170_P_P-G      tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgt
KF779233_P_P-G      tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgt
AB056513_P_P-G      tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgt
GU563556_P_P-G      tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgt
KY004111_P_P-G      tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgt
KJ194508_P_P-G      tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgt
KF767450_P_P-G      tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgt
KX264500_P_P-G      tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgt
FJ023674_P_P-G      tcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcarggtatgt
FR714503_P_P-G      tcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgt
                    ********************************************** ***** *******

EF464097_P_P-G      tgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacct
EF464098_P_P-G      tgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacct
KF779267_P_P-G      tgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacct
DQ207798_P_P-G      tgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacct
AB056515_P_P-G      tgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacct
JQ707677_P_P-G      tgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacct
JQ707678_P_P-G      tgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacct
JQ707679_P_P-G      tgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacct
JQ707680_P_P-G      tgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacct
JQ707673_P_P-G      tgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacct
JQ707671_P_P-G      tgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacct
JQ707666_P_P-G      tgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacct
JQ707660_P_P-G      tgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacct
JQ707657_P_P-G      tgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacct
JQ707668_P_P-G      tgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacct
KF779357_P_P-G      tgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacct
GU565217_P_P-G      tgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacct
KF767452_P_P-G      tgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacct
KF414679_P_P-G      tgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacct
KF767451_P_P-G      tgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacct
JQ707436_P_P-G      tgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacct
KR230749_P_P-G      tgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacct
EF634480_P_P-G      tgcccgtttgtcctctgattccaggatcctccaccaccagtacgggaccctgcaaaacct
AB056514_P_P-G      tgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacct
HE981171_P_P-G      tgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacct
HE981172_P_P-G      tgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacct
HE981174_P_P-G      tgcccgtttgtcctctgattccaggatcctcgaccaccagcacgggaccctgcaaaacct
AB064312_P_P-G      tgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacct
AB064311_P_P-G      tgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacct
AB064313_P_C-G      tgcccgtttgtcccctgattccaggatcctcgaccaccagtacgggaccctgcaaaacct
KF779235_P_P-G      tgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacct
AB375165_P_P-G      tgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacct
AB064310_P_P-G      tgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacct
KM998716_P_P-G      tgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacct
HE981175_P_P-G      tgcccgtttgtcctctgattccaggatcctcgaccaccagcacgggaccctgcaaaacct
HE981176_P_P-G      tgcccgtttgtcctctgattccaggatcctcgaccaccagcacgggaccctgcaaaacct
AF405706_P_P-G      tgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacct
AF160501_P_C-G      tgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacct
AB375166_P_P-G      tgcccgtttgtcctctgatttcaggatcctcgaccaccagtacgggaccctgcaaaacct
AB375167_P_P-G      tgcccgtttgtcctctgatttcaggatcctcgaccaccagtacgggaccctgcaaaacct
AB375168_P_P-G      tgcccgtttgtcctctgatttcaggatcctcgaccaccagtacgggaccctgcaaaacct
AB375169_P_P-G      tgcccgtttgtcctctgatttcaggatcctcgaccaccagtacgggaccctgcaaaacct
AB375170_P_P-G      tgcccgtttgtcctctgatttcaggatcctcgaccaccagtacgggaccctgcaaaacct
KF779233_P_P-G      tgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacct
AB056513_P_P-G      tgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacct
GU563556_P_P-G      tgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacct
KY004111_P_P-G      tgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacct
KJ194508_P_P-G      tgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacct
KF767450_P_P-G      tgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacct
KX264500_P_P-G      tgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacct
FJ023674_P_P-G      tgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggaccctgcagaacct
FR714503_P_P-G      tgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggaccatgcaaaacct
                    ************* ** *** ********** ******** ******** **** *****

EF464097_P_P-G      gcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcgg
EF464098_P_P-G      gcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcgg
KF779267_P_P-G      gcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcgg
DQ207798_P_P-G      gcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcgg
AB056515_P_P-G      gcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtataaaaccttcgg
JQ707677_P_P-G      gcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcgg
JQ707678_P_P-G      gcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcgg
JQ707679_P_P-G      gcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcgg
JQ707680_P_P-G      gcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcgg
JQ707673_P_P-G      gcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcgg
JQ707671_P_P-G      gcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaactttcgg
JQ707666_P_P-G      gcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcgg
JQ707660_P_P-G      gcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcgg
JQ707657_P_P-G      gcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcgg
JQ707668_P_P-G      gcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcgg
KF779357_P_P-G      gcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcgg
GU565217_P_P-G      gcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcgg
KF767452_P_P-G      gcacgtctcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcgg
KF414679_P_P-G      gcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcgg
KF767451_P_P-G      gcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcgg
JQ707436_P_P-G      gcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcgg
KR230749_P_P-G      gcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcgg
EF634480_P_P-G      gcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcgg
AB056514_P_P-G      gcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcgg
HE981171_P_P-G      gcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcgg
HE981172_P_P-G      gcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcgg
HE981174_P_P-G      gcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcgg
AB064312_P_P-G      gcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcgg
AB064311_P_P-G      gcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcgg
AB064313_P_C-G      gcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcgg
KF779235_P_P-G      gcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcgg
AB375165_P_P-G      gcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcgg
AB064310_P_P-G      gcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcgg
KM998716_P_P-G      gcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcgg
HE981175_P_P-G      gcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcgg
HE981176_P_P-G      gcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcgg
AF405706_P_P-G      gcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcgg
AF160501_P_C-G      gcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcgg
AB375166_P_P-G      gcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcgg
AB375167_P_P-G      gcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcgg
AB375168_P_P-G      gcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcgg
AB375169_P_P-G      gcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcgg
AB375170_P_P-G      gcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcgg
KF779233_P_P-G      gcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcgg
AB056513_P_P-G      gcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcgg
GU563556_P_P-G      gcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcgg
KY004111_P_P-G      gcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcgg
KJ194508_P_P-G      gcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcgg
KF767450_P_P-G      gcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcgg
KX264500_P_P-G      gcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcgg
FJ023674_P_P-G      gcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcgg
FR714503_P_P-G      gcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcgg
                    ***** ****************************************** ***** *****

EF464097_P_P-G      acggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatggg
EF464098_P_P-G      acggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatggg
KF779267_P_P-G      acagaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatggg
DQ207798_P_P-G      acggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatggg
AB056515_P_P-G      aaggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatggg
JQ707677_P_P-G      acggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatggg
JQ707678_P_P-G      acggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatggg
JQ707679_P_P-G      acggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatggg
JQ707680_P_P-G      acggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatggg
JQ707673_P_P-G      acggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatggg
JQ707671_P_P-G      acggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatggg
JQ707666_P_P-G      acggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatggg
JQ707660_P_P-G      acggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatggg
JQ707657_P_P-G      acggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatggg
JQ707668_P_P-G      acggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatggg
KF779357_P_P-G      acggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatggg
GU565217_P_P-G      acggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatggg
KF767452_P_P-G      acggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatggg
KF414679_P_P-G      acagaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatggg
KF767451_P_P-G      acggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatggg
JQ707436_P_P-G      acggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatggg
KR230749_P_P-G      acagaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatggg
EF634480_P_P-G      acggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatggg
AB056514_P_P-G      acggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatggg
HE981171_P_P-G      acggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatggg
HE981172_P_P-G      acggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatggg
HE981174_P_P-G      acggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatggg
AB064312_P_P-G      acggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatggg
AB064311_P_P-G      acggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatggg
AB064313_P_C-G      acggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatggg
KF779235_P_P-G      acggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatggg
AB375165_P_P-G      acggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatggg
AB064310_P_P-G      acggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatggg
KM998716_P_P-G      acggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatggg
HE981175_P_P-G      acggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatggg
HE981176_P_P-G      acggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatggg
AF405706_P_P-G      acggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatggg
AF160501_P_C-G      acggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatggg
AB375166_P_P-G      acggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatggg
AB375167_P_P-G      acggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatggg
AB375168_P_P-G      acggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatggg
AB375169_P_P-G      acggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatggg
AB375170_P_P-G      acggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatggg
KF779233_P_P-G      acggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatggg
AB056513_P_P-G      acggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatggg
GU563556_P_P-G      acggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatggg
KY004111_P_P-G      acggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatggg
KJ194508_P_P-G      acggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatggg
KF767450_P_P-G      acggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatggg
KX264500_P_P-G      acggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatggg
FJ023674_P_P-G      acggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatggg
FR714503_P_P-G      acggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatggg
                    *  *********************************************************

EF464097_P_P-G      agtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcg
EF464098_P_P-G      agtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcg
KF779267_P_P-G      agtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcg
DQ207798_P_P-G      agtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcg
AB056515_P_P-G      agtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcg
JQ707677_P_P-G      agtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcg
JQ707678_P_P-G      agtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcg
JQ707679_P_P-G      agtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcg
JQ707680_P_P-G      agtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcg
JQ707673_P_P-G      agtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcg
JQ707671_P_P-G      agtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcg
JQ707666_P_P-G      agtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcg
JQ707660_P_P-G      agtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcg
JQ707657_P_P-G      agtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcg
JQ707668_P_P-G      agtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcg
KF779357_P_P-G      agtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcg
GU565217_P_P-G      attgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcg
KF767452_P_P-G      agtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcg
KF414679_P_P-G      agtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcg
KF767451_P_P-G      actgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcg
JQ707436_P_P-G      agtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcg
KR230749_P_P-G      agtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcg
EF634480_P_P-G      agtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcg
AB056514_P_P-G      agtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcg
HE981171_P_P-G      agtgggtctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcg
HE981172_P_P-G      agtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcg
HE981174_P_P-G      agtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcg
AB064312_P_P-G      agtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcg
AB064311_P_P-G      agtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcg
AB064313_P_C-G      agtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcg
KF779235_P_P-G      agtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcg
AB375165_P_P-G      agtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcg
AB064310_P_P-G      agtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcg
KM998716_P_P-G      agtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcg
HE981175_P_P-G      agtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcg
HE981176_P_P-G      agtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcg
AF405706_P_P-G      agtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcg
AF160501_P_C-G      agtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcg
AB375166_P_P-G      agtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcg
AB375167_P_P-G      agtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcg
AB375168_P_P-G      agtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcg
AB375169_P_P-G      agtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcg
AB375170_P_P-G      agtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcg
KF779233_P_P-G      agtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcg
AB056513_P_P-G      agtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcg
GU563556_P_P-G      agtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcg
KY004111_P_P-G      agtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcg
KJ194508_P_P-G      agtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcg
KF767450_P_P-G      agtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcg
KX264500_P_P-G      agtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcg
FJ023674_P_P-G      agtgggcctcagcccgtttctcctggctcagtttactagcgccatttgttcagtggttcg
FR714503_P_P-G      agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcg
                    * **** ***** ********* **************** ********************

EF464097_P_P-G      tagggctttcccccactgtctggctttcagctatgtggatgatgtggtattgggggccaa
EF464098_P_P-G      tagggctttcccccactgtctggctttcagctatgtggatgatgtggtattgggggccaa
KF779267_P_P-G      tagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaa
DQ207798_P_P-G      tagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaa
AB056515_P_P-G      tagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaa
JQ707677_P_P-G      tagggctttcccccactgtctggctttcagctatattgatgatgtggtattgggggccaa
JQ707678_P_P-G      tagggctttcccccactgtctggctttcagctatatcgatgatgtggtattgggggccaa
JQ707679_P_P-G      tagggctttcccccactgtctggctttcagctatattgatgatgtggtattgggggccaa
JQ707680_P_P-G      tagggctttcccccactgtctggctttcagctatattgatgatgtggtattgggggccaa
JQ707673_P_P-G      tagggctttcccccactgtctggctttcagctatattgatgatgtggtattgggggccaa
JQ707671_P_P-G      tagggctttcccccactgtctggctttcagctatattgatgatgtggtattgggggccaa
JQ707666_P_P-G      tagggctttcccccactgtctggctttcagctatattgatgatgtggtattgggggccaa
JQ707660_P_P-G      tagggctttcccccactgtctggctttcagctatattgatgatgtggtattgggggccaa
JQ707657_P_P-G      tagggctttcccccactgtctggctttcagctatattgatgatgtggtattgggggccaa
JQ707668_P_P-G      tagggctttcccccactgtctggctttcagctatattgatgatgtggtattgggggccaa
KF779357_P_P-G      tagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaa
GU565217_P_P-G      tagggctttcccccactgtctggctttcagctatgtggatgatgtggtattgggggccaa
KF767452_P_P-G      tagggctttcccccactgtctggctttcagctatgtggatgatgtggtattgggggccaa
KF414679_P_P-G      tagggctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaa
KF767451_P_P-G      tagggctttcccccactgtctggctttcagctatgtggatgatgtggtattgggggccaa
JQ707436_P_P-G      tagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaa
KR230749_P_P-G      tagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaa
EF634480_P_P-G      tagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaa
AB056514_P_P-G      tagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaa
HE981171_P_P-G      tagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaa
HE981172_P_P-G      tagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaa
HE981174_P_P-G      tagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaa
AB064312_P_P-G      tagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaa
AB064311_P_P-G      tagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaa
AB064313_P_C-G      tagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaa
KF779235_P_P-G      tagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaa
AB375165_P_P-G      tagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaa
AB064310_P_P-G      tagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaa
KM998716_P_P-G      tagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaa
HE981175_P_P-G      tagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaa
HE981176_P_P-G      tagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaa
AF405706_P_P-G      tagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaa
AF160501_P_C-G      tagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaa
AB375166_P_P-G      tagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaa
AB375167_P_P-G      tagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaa
AB375168_P_P-G      tagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaa
AB375169_P_P-G      tagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaa
AB375170_P_P-G      tagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaa
KF779233_P_P-G      tagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaa
AB056513_P_P-G      tagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaa
GU563556_P_P-G      tagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaa
KY004111_P_P-G      tagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaa
KJ194508_P_P-G      tagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaa
KF767450_P_P-G      tagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaa
KX264500_P_P-G      tagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaa
FJ023674_P_P-G      tagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaa
FR714503_P_P-G      tagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaa
                    ******************* ********** *** * ***********************

EF464097_P_P-G      atctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttggg
EF464098_P_P-G      atctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttggg
KF779267_P_P-G      atctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttggg
DQ207798_P_P-G      atctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttggg
AB056515_P_P-G      atctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttggg
JQ707677_P_P-G      atctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttggg
JQ707678_P_P-G      atctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttggg
JQ707679_P_P-G      atctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttggg
JQ707680_P_P-G      atctgtacaacatcttgagtccctttttaccgctgttaccaattttcttttgtctttggg
JQ707673_P_P-G      atctgtacaacatcttgagtccctttttaccgctgttaccaattttcttttgtctttggg
JQ707671_P_P-G      atctgtacaacatcttgagtccctttttaccgctgttaccaattttcttttgtctttggg
JQ707666_P_P-G      atctgtacaacatcttgagtccctttttaccgctgttaccaattttcttttgtctttggg
JQ707660_P_P-G      atctgtacaacatcttgagtccctttttaccgctgttaccaattttcttttgtctttggg
JQ707657_P_P-G      atctgtacaacatcttgagtccctttttaccgctgttaccaattttcttttgtctttggg
JQ707668_P_P-G      atctgtacaacatcttgagtccctttttaccgctgttaccaattttcttttgtctttggg
KF779357_P_P-G      atctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttggg
GU565217_P_P-G      atctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttggg
KF767452_P_P-G      atctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttggg
KF414679_P_P-G      atctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttggg
KF767451_P_P-G      atctgtacagcatcttgagtccctttataccgctgttaccaattttcttttgtctttggg
JQ707436_P_P-G      atctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttggg
KR230749_P_P-G      atctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttggg
EF634480_P_P-G      atctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttggg
AB056514_P_P-G      atctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttggg
HE981171_P_P-G      atctgtacaacatcttgagtccctttataccgctgttaccaattttcttttttctttggg
HE981172_P_P-G      atctgtacaacatcttgagtccctttataccgctgttaccaattttcttttttctttggg
HE981174_P_P-G      atctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttggg
AB064312_P_P-G      atctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttggg
AB064311_P_P-G      atctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttggg
AB064313_P_C-G      atctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttggg
KF779235_P_P-G      atctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttggg
AB375165_P_P-G      atctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttggg
AB064310_P_P-G      atctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttggg
KM998716_P_P-G      atctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttggg
HE981175_P_P-G      atctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttggg
HE981176_P_P-G      atctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttggg
AF405706_P_P-G      atctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttggg
AF160501_P_C-G      atctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttggg
AB375166_P_P-G      atctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttggg
AB375167_P_P-G      atctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttggg
AB375168_P_P-G      atctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttggg
AB375169_P_P-G      atctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttggg
AB375170_P_P-G      atctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttggg
KF779233_P_P-G      atctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttggg
AB056513_P_P-G      atctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttggg
GU563556_P_P-G      atctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttggg
KY004111_P_P-G      atctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttggg
KJ194508_P_P-G      atctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttggg
KF767450_P_P-G      atctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttggg
KX264500_P_P-G      atctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttggg
FJ023674_P_P-G      atctgtacamcaccttgagtccatttataccgctgttaccaattttcttttgtctttggg
FR714503_P_P-G      gtctgtacaacatcttgaggccatttataccgctgttaccaattttcttttgtctttggg
                     ******** ** ****** ** *** ************************ ********

EF464097_P_P-G      tatacatttaaaccctaacaaaacaaaaagatggggttattccttaaattttatgggata
EF464098_P_P-G      tatacatttaaaccctaacaaaacaaaaagatggggttattccttaaactttatgggata
KF779267_P_P-G      tatacatctaaaccctaacaaaacaaaaagatggggttattccttaaattttatgggata
DQ207798_P_P-G      tatacatctaaaccctaccaaaacaaaaagatggggttattccttaaattttatgggata
AB056515_P_P-G      tatacatctaaaccctaacaaaacaaaaagatggggttattccttaaattttatgggata
JQ707677_P_P-G      tatacatctaaaccataacaaaacaaaaagatggggttattccttaaattttatgggata
JQ707678_P_P-G      tatacatctaaaccataacaaaacaaaaagatggggttattccttaaattttatgggata
JQ707679_P_P-G      tatacatctaaaccataacaaaacaaaaagatggggttattccttaaattttatgggata
JQ707680_P_P-G      tatacatctaaaccataacaaaacaaaaagatggggttattccttaaattttatgggata
JQ707673_P_P-G      tatacatctaaaccataacaaaacaaaaagatggggttattccttaaattttatgggata
JQ707671_P_P-G      tatacatctaaaccataacaaaacaaaaagatggggttattccttaaattttatgggata
JQ707666_P_P-G      tatacatctaaaccataacaaaacaaaaagatggggttattccttaaattttatgggata
JQ707660_P_P-G      tatacatctaaaccataacaaaacaaaaagatggggttattccttaaattttatgggata
JQ707657_P_P-G      tatacatctaaaccataacaaaacaaaaagatggggttattccttaaattttatgggata
JQ707668_P_P-G      tatacatctaaaccataacaaaacaaaaagatggggttattccttaaattttatgggata
KF779357_P_P-G      tatacatctaaaccctaacaaaacaaaaagatggggttattccttaaattttatgggata
GU565217_P_P-G      tatacatctaaaccctaacaaaacaaaaagatggggttattccttaaattttatgggata
KF767452_P_P-G      tatacatctaaaccctaacaaaacgaaaagatggggttattccttaaattttatgggata
KF414679_P_P-G      tatacatctaaaccctaacaaaacaaaaagatggggttattccttaaattttatgggata
KF767451_P_P-G      tatacatctaaaccctaacaaaacaaaaagatggggttattccttaaattttatgggata
JQ707436_P_P-G      tatacatctaaaccctaacaaaacaaaaagatggggttattccttaaattttatgggata
KR230749_P_P-G      tatacatctaaaccctaacaaaacaaaaagatggggttattccttaaattttatgggata
EF634480_P_P-G      tatacatctaaaccctaacaaaacaaaaagatggggttattccttaaattttatgggata
AB056514_P_P-G      tatacatctaaaccctaacaaaacaaaaagatggggttattccttaaattttatgggata
HE981171_P_P-G      tatacatctaaaccctaacaaaacaaaaagatggggttattccttaaattttatgggata
HE981172_P_P-G      tatacatctaaaccctaacaaaacaaaaagatggggttattccttaaattttatgggata
HE981174_P_P-G      tatacatctaaaccctaacaaaacaaaaagatggggttattccttaaattttatgggata
AB064312_P_P-G      tatacatctaaaccctgacaaaacaaaaagatggggttattccttaaattttatgggata
AB064311_P_P-G      tatacatctaaaccctaacaaaacaaaaagatggggttattccttaaattttatgggata
AB064313_P_C-G      tatacatctaaaccctaacaaaacaaaaagatggggttattccttaaattttatgggata
KF779235_P_P-G      tatacatctaaaccctaacaaaacaaaaagatggggttattccttaaattttatgggata
AB375165_P_P-G      tatacatctaaaccctaacaaaacaaaaagatggggttattccttaarttttatgggata
AB064310_P_P-G      tatacatctaaaccctaacaaaacaaaaagatggggttattccttaaattttatgggata
KM998716_P_P-G      tatacatctaaaccctaacaaaacaaaaagatggggttattccttaaattttatgggata
HE981175_P_P-G      tatacatctaaaccctaacaaaacaaaaagatggggttattccttaaattttatgggata
HE981176_P_P-G      tatacatctaaaccctaacaaaacaaaaagatggggttattccttaaattttatgggata
AF405706_P_P-G      tatacatctaaaccctaccaaaacaaaaagatggggttattccttaaattttatgggata
AF160501_P_C-G      tatacatctaaaccctaacaaaacaaaaagatggggttattccttaaattttatgggata
AB375166_P_P-G      tatacatctaaaccctaacaaaacaaaaagatggggttattccttaaattttatgggata
AB375167_P_P-G      tatacatctaaaccctaacaaaacaaaaagatggggttattccttaaattttatgggata
AB375168_P_P-G      tatacatctaaaccctaacaaaacaaaaagatggggttattccttaaattttatgggata
AB375169_P_P-G      tatacatctaaaccctaacaaaacaaaaagatggggttattccttaaattttatgggata
AB375170_P_P-G      tatacatctaaaccctaacaaaacaaaaagatggggttattccttaaattttatgggata
KF779233_P_P-G      tatacatctaaaccctaacaaaacaaaaagatggggttattccttaaattttatgggata
AB056513_P_P-G      tatacatctaaaccctaacaaaacaaaaagatggggttattccttaaattttatgggata
GU563556_P_P-G      tatacatctaaaccctaacaaaacaaaaagatggggttattccttaaattttatgggata
KY004111_P_P-G      tatacatctaaaccctaacaaaacaaaaagatggggttattccttaaattttatgggata
KJ194508_P_P-G      tatacatctaaaccctaacaaaacaaaaagatggggttattccttaaattttatgggata
KF767450_P_P-G      tatacatctaaaccctaacaaaacaaaaagatggggttattccttaaattttatgggata
KX264500_P_P-G      tatacatctaaaccctaacaaaacaaaaagatggggttattccttaaattttatgggata
FJ023674_P_P-G      tatacatttaaaccctaacaaaactaagcgatggggttattccttgaatttcatgggata
FR714503_P_P-G      tatacatttaaattctaacaaaactaagcgatggggttattccctaaacttcatgggata
                    ******* ****   *  ****** **  ************** * *  ** ********

EF464097_P_P-G      cgtaattggaagttggggtactttgccacaggaacacatcgcacagaaaattaagcaatg
EF464098_P_P-G      tgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatg
KF779267_P_P-G      tgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatg
DQ207798_P_P-G      tgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatg
AB056515_P_P-G      tgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatg
JQ707677_P_P-G      tgtaattggaagttggggtactttgccacaagaacacatcacacaaaaaattaagcaatg
JQ707678_P_P-G      tgtaattggaagttggggtactttgccacaagaacacatcacacaaaaaattaagcaatg
JQ707679_P_P-G      tgtaattggaagttggggtactttgccacaagaacacatcacacaaaaaattaagcaatg
JQ707680_P_P-G      tgtaattggaagttggggtactttgccacaagaacacatcacacaaaaaattaagcaatg
JQ707673_P_P-G      tgtaattggaagttggggtactttgccacaagaacacatcacacaaaaaattaagcaatg
JQ707671_P_P-G      tgtaattggaagttggggtactttgccacaagaacacatcacacaaaaaattaagcaatg
JQ707666_P_P-G      tgtaattggaagttggggtactttgccacaagaacacatcacacaaaaaattaagcaatg
JQ707660_P_P-G      tgtaattggaagttggggtactttgccacaagaacacatcacacaaaaaattaagcaatg
JQ707657_P_P-G      tgtaattggaagttggggtactttgccacaagaacacatcacacaaaaaattaagcaatg
JQ707668_P_P-G      tgtaattggaagttggggtactttgccacaagaacacatcacacaaaaaattaagcaatg
KF779357_P_P-G      tgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatg
GU565217_P_P-G      tgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatg
KF767452_P_P-G      tgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatg
KF414679_P_P-G      tgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatg
KF767451_P_P-G      tgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatg
JQ707436_P_P-G      tgtaattggaagttggggtactttgccacaagaacacatcacacaaaaaattaagcaatg
KR230749_P_P-G      tgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatg
EF634480_P_P-G      tgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatg
AB056514_P_P-G      tgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatg
HE981171_P_P-G      tgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatg
HE981172_P_P-G      tgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatg
HE981174_P_P-G      tgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatg
AB064312_P_P-G      tgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatg
AB064311_P_P-G      tgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatg
AB064313_P_C-G      tgtaattggaagttggggtactttgccacaagaacacatcacaaagaaaattaagcaatg
KF779235_P_P-G      tgtaattggaagttggggtactttgccacaagaacacatcacaaagaaaattaagcaatg
AB375165_P_P-G      tgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcratg
AB064310_P_P-G      tgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatg
KM998716_P_P-G      tgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatg
HE981175_P_P-G      tgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatg
HE981176_P_P-G      tgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatg
AF405706_P_P-G      tgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatg
AF160501_P_C-G      tgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatg
AB375166_P_P-G      tgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatg
AB375167_P_P-G      tgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatg
AB375168_P_P-G      tgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatg
AB375169_P_P-G      tgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatg
AB375170_P_P-G      tgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatg
KF779233_P_P-G      tgtaattggaagttggggtactttgccacaagaacacatcacaaagaaaattaagcaatg
AB056513_P_P-G      tgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatg
GU563556_P_P-G      tgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatg
KY004111_P_P-G      tgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatg
KJ194508_P_P-G      tgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatg
KF767450_P_P-G      tgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatg
KX264500_P_P-G      tgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatg
FJ023674_P_P-G      cgtaattggaagttggggtaccttgccacaagatcatattatacagaaaatcagacaatg
FR714503_P_P-G      tgtaattggaagttggggtaccttgccacaagatcatattatacagaaaatcaaacaatg
                     ******************** ******** ** ** **   * * ***** *  * ***

EF464097_P_P-G      ttttgggaaactacctgttaacaggccaattgattggaaagtttgtcaaagaatagttgg
EF464098_P_P-G      ttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactgg
KF779267_P_P-G      ttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactgg
DQ207798_P_P-G      ttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactgg
AB056515_P_P-G      ttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactgg
JQ707677_P_P-G      ttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactgg
JQ707678_P_P-G      ttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactgg
JQ707679_P_P-G      ttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactgg
JQ707680_P_P-G      ttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactgg
JQ707673_P_P-G      ttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactgg
JQ707671_P_P-G      ttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactgg
JQ707666_P_P-G      ttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactgg
JQ707660_P_P-G      ttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactgg
JQ707657_P_P-G      ttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactgg
JQ707668_P_P-G      ttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactgg
KF779357_P_P-G      ttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactgg
GU565217_P_P-G      ttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactgg
KF767452_P_P-G      ttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactgg
KF414679_P_P-G      ttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactgg
KF767451_P_P-G      ttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactgg
JQ707436_P_P-G      ttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactgg
KR230749_P_P-G      ttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactgg
EF634480_P_P-G      ttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactgg
AB056514_P_P-G      ttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactgg
HE981171_P_P-G      ttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactgg
HE981172_P_P-G      ttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactgg
HE981174_P_P-G      ttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactgg
AB064312_P_P-G      ttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactgg
AB064311_P_P-G      ttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactgg
AB064313_P_C-G      ttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactgg
KF779235_P_P-G      ttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactgg
AB375165_P_P-G      ttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactgg
AB064310_P_P-G      ttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactgg
KM998716_P_P-G      ttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactgg
HE981175_P_P-G      ttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactgg
HE981176_P_P-G      ttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactgg
AF405706_P_P-G      ttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactgg
AF160501_P_C-G      ttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactgg
AB375166_P_P-G      ttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactgg
AB375167_P_P-G      ttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactgg
AB375168_P_P-G      ttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactgg
AB375169_P_P-G      ttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactgg
AB375170_P_P-G      ttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactgg
KF779233_P_P-G      ttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactgg
AB056513_P_P-G      ttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactgg
GU563556_P_P-G      ttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactgg
KY004111_P_P-G      ttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactgg
KJ194508_P_P-G      ttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactgg
KF767450_P_P-G      ttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactgg
KX264500_P_P-G      ttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactgg
FJ023674_P_P-G      ttttagaaaactccctgttaataggcccgttgattggaaagtrtgtcaaagaatttcggg
FR714503_P_P-G      ttttagaaaactccctgttaacaggcccattgattggaaagtatgtcaaagaatttcagg
                    **** * ***** ******** *****  ************* ****** ****    **

EF464097_P_P-G      tcttttgggattcgctgctccttttacccaatgtggttaccctgccttaatgcctttata
EF464098_P_P-G      tctgttgggtttcgctgctccttttacccaatgtggttaccctgccttaatgcctttata
KF779267_P_P-G      tctgttgggtttcgctgctccttttacccaatgtggttaccctgccttaatgcctttata
DQ207798_P_P-G      tctgttgggtttcgctgctccttttacccaatgtggttaccctgccttaatgcctttata
AB056515_P_P-G      tctgttgggtttcgctgctccttttacccaatgtggttaccctgccttaatgcctttata
JQ707677_P_P-G      tctgttgggtttcgctgctccttttacccaatgtggttaccctgccttaatgcctttata
JQ707678_P_P-G      tctgttgggtttcgctgctccttttacccaatgtggttaccctgccttaatgcctttata
JQ707679_P_P-G      tctgttgggtttcgctgctccttttacccaatgtggttaccctgccttaatgcctttata
JQ707680_P_P-G      tctgttgggtttcgctgctccttttacccaatgtggttaccctgccttaatgcctttata
JQ707673_P_P-G      tctgttgggtttcgctgctccttttacccaatgtggttaccctgccttaatgcctttata
JQ707671_P_P-G      tctgttgggtttcgctgctccttttacccaatgtggttaccctgccttaatgcctttata
JQ707666_P_P-G      tctgttgggtttcgctgctccttttacccaatgtggttaccctgccttaatgcctttata
JQ707660_P_P-G      tctgttgggtttcgctgctccttttacccaatgtggttaccctgccttaatgcctttata
JQ707657_P_P-G      tctgttgggtttcgctgctccttttacccaatgtggttaccctgccttaatgcctttata
JQ707668_P_P-G      tctgttgggtttcgctgctccttttacccaatgtggttaccctgccttaatgcctttata
KF779357_P_P-G      tctgttgggtttcgctgctccttttacccaatgtggttaccctgccttaatgcctttata
GU565217_P_P-G      tctgttgggtttcgctgctccttttacccaatgtggttaccctgccttaatgcctttata
KF767452_P_P-G      tctgttgggtttcgctgctccttttacccaatgtggttaccctgccttaatgcctttata
KF414679_P_P-G      tctgttgggtttcgctgctccttttacccaatgtggttaccctgccttaatgcctttata
KF767451_P_P-G      tctgttgggtttcgctgctccttttacccaatgtggttaccctgccttaatgcctttata
JQ707436_P_P-G      tctgttgggtttcgctgctccttttacccaatgtggttaccctgccttaatgcctttata
KR230749_P_P-G      tctgttgggtttcgctgctccttttacccaatgtggttaccctgccttaatgcctttata
EF634480_P_P-G      tctgttgggtttcgctgctccttttacccaatgtggttaccctgccttaatgcctttata
AB056514_P_P-G      tctgttgggtttcgctgctccttttacccaatgtggttaccctgccttaatgcctttata
HE981171_P_P-G      tctgttgggtttcgctgctccttttacccaatgtggttaccctgccttaatgcctttata
HE981172_P_P-G      tctgttgggtttcgctgctccttttacccaatgtggttaccctgccttaatgcctttata
HE981174_P_P-G      tctgttgggtttcgctgctccttttacccaatgtggttaccctgccttaatgcctttata
AB064312_P_P-G      tctgttgggtttcgctgctccttttacccaatgtggttaccctgccttaatgcctttata
AB064311_P_P-G      tctgttgggtttcgctgctcctttcacccaatgtggttaccctgccttaatgcctttata
AB064313_P_C-G      tctgttgggtttcgctgctccttttacccaatgtggttaccctgccttaatgcctttata
KF779235_P_P-G      tctgttgggtttcgctgctccttttacccaatgtggttaccctgccttaatgcctttata
AB375165_P_P-G      tctgttgggtttcgctgctccttttacccaatgtggttaccctgccttaatgcctttata
AB064310_P_P-G      tctgttgggtttcgctgctccttttacccaatgtggttaccctgccttaatgcctttata
KM998716_P_P-G      tctgttgggtttcgctgctccttttacccaatgtggttaccctgccttaatgcctttata
HE981175_P_P-G      tctgttgggtttcgctgctccttttacccaatgtggttaccctgccttaatgcctttata
HE981176_P_P-G      tctgttgggtttcgctgctccttttacccaatgtggttaccctgccttaatgcctttata
AF405706_P_P-G      tctgttgggtttcgctgctccttttacccaatgtggttaccctgccttaatgcctttata
AF160501_P_C-G      tctgttgggtttcgctgctcctttcacccaatgtggttaccctgccttaatgcctttata
AB375166_P_P-G      tctgttgggtttcgctgctccttttacccaatgtggttaccctgccttaatgcctttata
AB375167_P_P-G      tctgttgggtttcgctgctccttttacccaatgtggttaccctgccttaatgcctttata
AB375168_P_P-G      tctgttgggtttcgctgctccttttacccaatgtggttaccctgccttaatgcctttata
AB375169_P_P-G      tctgttgggtttcgctgctccttttacccaatgtggttaccctgccttaatgcctttata
AB375170_P_P-G      tctgttgggtttcgctgctccttttacccaatgtggttaccctgccttaatgcctttata
KF779233_P_P-G      tctgttgggtttcgctgctccttttacccaatgtggttaccctgccttaatgcctttata
AB056513_P_P-G      tctgttgggtttcgctgctccttttacccaatgtggttaccctgccttaatgcctttata
GU563556_P_P-G      tctgttgggtttcgctgctccttttacccaatgtggttaccctgccttaatgcctttata
KY004111_P_P-G      tctgttgggtttcgctgctccttttacccaatgtggttaccctgccttaatgcctttata
KJ194508_P_P-G      tctgttgggtttcgctgctccttttacccaatgtggttaccctgccttaatgcctttata
KF767450_P_P-G      tctgttgggtttcgctgctccttttacccaatgtggttaccctgccttaatgcctttata
KX264500_P_P-G      tctgttgggtttcgctgctccttttacccaatgtggttaccctgccttaatgcctttata
FJ023674_P_P-G      tctcctgggctttgctgctcccttcacacaatgtggttaccctgcattaatgcctttata
FR714503_P_P-G      actcttgggctttgctgctccatttacacaatgtggttaccctgcgttaatgcctttgta
                     **  **** ** ******** ** ** ***************** *********** **

EF464097_P_P-G      tgcatgtatacaagttaagcaggcttttactttctcgccaacttataaggcctttctctg
EF464098_P_P-G      tgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttctctg
KF779267_P_P-G      tgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttctctg
DQ207798_P_P-G      tgcatgtatacaggctaagcaggcttttactttctcgccaacttataaggcctttctctg
AB056515_P_P-G      tgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttctctg
JQ707677_P_P-G      tgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttctctg
JQ707678_P_P-G      tgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttctctg
JQ707679_P_P-G      tgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttctctg
JQ707680_P_P-G      tgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttctctg
JQ707673_P_P-G      tgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttctctg
JQ707671_P_P-G      tgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttctctg
JQ707666_P_P-G      tgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttctctg
JQ707660_P_P-G      tgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttctctg
JQ707657_P_P-G      tgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttctctg
JQ707668_P_P-G      tgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttctctg
KF779357_P_P-G      tgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttctctg
GU565217_P_P-G      tgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttctctg
KF767452_P_P-G      tgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttctctg
KF414679_P_P-G      tgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttctctg
KF767451_P_P-G      tgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttctctg
JQ707436_P_P-G      tgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttctctg
KR230749_P_P-G      tgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttctctg
EF634480_P_P-G      tgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttctctg
AB056514_P_P-G      tgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttctctg
HE981171_P_P-G      tgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttctctg
HE981172_P_P-G      tgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttctctg
HE981174_P_P-G      tgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttctctg
AB064312_P_P-G      tgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttctctg
AB064311_P_P-G      tgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttctctg
AB064313_P_C-G      tgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttctctg
KF779235_P_P-G      tgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttctctg
AB375165_P_P-G      tgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttctctg
AB064310_P_P-G      tgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttctctg
KM998716_P_P-G      tgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttctctg
HE981175_P_P-G      tgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttctctg
HE981176_P_P-G      tgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttctctg
AF405706_P_P-G      tgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttctctg
AF160501_P_C-G      tgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttctctg
AB375166_P_P-G      tgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttctctg
AB375167_P_P-G      tgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttctctg
AB375168_P_P-G      tgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttctctg
AB375169_P_P-G      tgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttctctg
AB375170_P_P-G      tgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttctctg
KF779233_P_P-G      tgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttctctg
AB056513_P_P-G      tgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttctctg
GU563556_P_P-G      tgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttctctg
KY004111_P_P-G      tgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttctctg
KJ194508_P_P-G      tgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttctctg
KF767450_P_P-G      tgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttctctg
KX264500_P_P-G      tgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttctctg
FJ023674_P_P-G      tgcmtgtatacaagccaaacaggctttcactttctcgccaacttacaaggcctttctatg
FR714503_P_P-G      tgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttctgtg
                    *** ******** *  ** ******** ***************** *********** **

EF464097_P_P-G      taaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtt
EF464098_P_P-G      taaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtt
KF779267_P_P-G      taaacaatacaggaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtt
DQ207798_P_P-G      taaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtt
AB056515_P_P-G      taaacaatacctgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtt
JQ707677_P_P-G      taaacaatacatgaacctttaccctgttgctaggcaacggcccggtctgtgccaagtgtt
JQ707678_P_P-G      taaacaatacatgaacctttaccctgttgctaggcaacggcccggtctgtgccaagtgtt
JQ707679_P_P-G      taaacaatacatgaacctttaccctgttgctaggcaacggcccggtctgtgccaagtgtt
JQ707680_P_P-G      taaacaatacatgaacctttaccctgttgctaggcaacggcccggtctgtgccaagtgtt
JQ707673_P_P-G      taaacaatacatgaacctttaccctgttgctaggcaacggcccggtctgtgccaagtgtt
JQ707671_P_P-G      taaacaatacatgaacctttaccctgttgctaggcaacggcccggtctgtgccaagtgtt
JQ707666_P_P-G      taaacaatacatgaacctttaccctgttgctaggcaacggcccggtctgtgccaagtgtt
JQ707660_P_P-G      taaacaatacatgaacctttaccctgttgctaggcaacggcccggtctgtgccaagtgtt
JQ707657_P_P-G      taaacaatacatgaacctttaccctgttgctaggcaacggcccggtctgtgccaagtgtt
JQ707668_P_P-G      taaacaatacatgaacctttaccctgttgctaggcaacggcccggtctgtgccaagtgtt
KF779357_P_P-G      taaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtt
GU565217_P_P-G      taaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtt
KF767452_P_P-G      taaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtt
KF414679_P_P-G      taaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtt
KF767451_P_P-G      taaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtt
JQ707436_P_P-G      taaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtt
KR230749_P_P-G      taaacaatacaggaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtt
EF634480_P_P-G      taaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtt
AB056514_P_P-G      taaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtt
HE981171_P_P-G      taaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtt
HE981172_P_P-G      taaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtt
HE981174_P_P-G      taaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtt
AB064312_P_P-G      taaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtt
AB064311_P_P-G      taaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtt
AB064313_P_C-G      taaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtt
KF779235_P_P-G      taaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtt
AB375165_P_P-G      taaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtt
AB064310_P_P-G      taaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtt
KM998716_P_P-G      taaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtt
HE981175_P_P-G      taaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtt
HE981176_P_P-G      taaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtt
AF405706_P_P-G      taaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtt
AF160501_P_C-G      taaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtt
AB375166_P_P-G      taaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtt
AB375167_P_P-G      taaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtt
AB375168_P_P-G      taaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtt
AB375169_P_P-G      taaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtt
AB375170_P_P-G      taaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtt
KF779233_P_P-G      taaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtt
AB056513_P_P-G      taaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtt
GU563556_P_P-G      taaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtt
KY004111_P_P-G      taaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtt
KJ194508_P_P-G      taaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtt
KF767450_P_P-G      taaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtt
KX264500_P_P-G      taaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtt
FJ023674_P_P-G      taaacaatatctgaacctttaccccgttgtcaggcaacggcccggtctgtgccaagtgtt
FR714503_P_P-G      taaacaatatatgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtt
                    *********   ************ ****   ****************************

EF464097_P_P-G      tgctgacgcaacccccactggttgggggttggccatcggccatcagcgcatgcgtggaac
EF464098_P_P-G      tgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaac
KF779267_P_P-G      tgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaac
DQ207798_P_P-G      tgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaac
AB056515_P_P-G      tgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaac
JQ707677_P_P-G      tgctgacgcaacccccactggttggggcttggccatcggacatcagcgcatgcgtggaac
JQ707678_P_P-G      tgctgacgcaacccccactggttggggcttggccatcggacatcagcgcatgcgtggaac
JQ707679_P_P-G      tgctgacgcaacccccactggttggggcttggccatcggacatcagcgcatgcgtggaac
JQ707680_P_P-G      tgctgacgcaacccccactggttggggcttggccatcggacatcagcgcatgcgtggaac
JQ707673_P_P-G      tgctgacgcaacccccactggttggggcttggccatcggacatcagcgcatgcgtggaac
JQ707671_P_P-G      tgctgacgcaacccccactggttggggcttggccatcggacatcagcgcatgcgtggaac
JQ707666_P_P-G      tgctgacgcaacccccactggttggggcttggccatcggacatcagcgcatgcgtggaac
JQ707660_P_P-G      tgctgacgcaacccccactggttggggcttggccatcggacatcagcgcatgcgtggaac
JQ707657_P_P-G      tgctgacgcaacccccactggttggggcttggccatcggacatcagcgcatgcgtggaac
JQ707668_P_P-G      tgctgacgcaacccccactggttggggcttggccatcggacatcagcgcatgcgtggaac
KF779357_P_P-G      tgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaac
GU565217_P_P-G      tgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaac
KF767452_P_P-G      tgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaac
KF414679_P_P-G      tgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaac
KF767451_P_P-G      tgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaac
JQ707436_P_P-G      tgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaac
KR230749_P_P-G      tgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaac
EF634480_P_P-G      tgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaac
AB056514_P_P-G      tgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaac
HE981171_P_P-G      tgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaac
HE981172_P_P-G      tgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaac
HE981174_P_P-G      tgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaac
AB064312_P_P-G      tgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaac
AB064311_P_P-G      tgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaac
AB064313_P_C-G      tgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaac
KF779235_P_P-G      tgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaac
AB375165_P_P-G      tgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaac
AB064310_P_P-G      tgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaac
KM998716_P_P-G      tgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaac
HE981175_P_P-G      tgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaac
HE981176_P_P-G      tgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaac
AF405706_P_P-G      tgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaac
AF160501_P_C-G      tgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaac
AB375166_P_P-G      tgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaac
AB375167_P_P-G      tgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaac
AB375168_P_P-G      tgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaac
AB375169_P_P-G      tgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaac
AB375170_P_P-G      tgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaac
KF779233_P_P-G      tgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaac
AB056513_P_P-G      tgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaac
GU563556_P_P-G      tgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaac
KY004111_P_P-G      tgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaac
KJ194508_P_P-G      tgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaac
KF767450_P_P-G      tgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaac
KX264500_P_P-G      tgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaac
FJ023674_P_P-G      tgctgatgcaacccccactggctggggcttggccatgggccatcagcgcatgcgtggaac
FR714503_P_P-G      tgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaac
                    ****** ************** ***** ******** ** ********************

EF464097_P_P-G      ctttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcag
EF464098_P_P-G      ctttgtggctcctctgccgatccatactgcggaactcatagctgcttgttttgctcgcag
KF779267_P_P-G      ctttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcag
DQ207798_P_P-G      ctttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcag
AB056515_P_P-G      ctttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcag
JQ707677_P_P-G      ctttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcag
JQ707678_P_P-G      ctttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcag
JQ707679_P_P-G      ctttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcag
JQ707680_P_P-G      ctttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcag
JQ707673_P_P-G      ctttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcag
JQ707671_P_P-G      ctttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcag
JQ707666_P_P-G      ctttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcag
JQ707660_P_P-G      ctttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcag
JQ707657_P_P-G      ctttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcag
JQ707668_P_P-G      ctttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcag
KF779357_P_P-G      ctttgtggctcctctgccgatccatactgcggatctcagagctgcttgttttgctcgcag
GU565217_P_P-G      ctttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcag
KF767452_P_P-G      ctttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcag
KF414679_P_P-G      ctttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcag
KF767451_P_P-G      ctttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcag
JQ707436_P_P-G      ctttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcag
KR230749_P_P-G      ctttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcag
EF634480_P_P-G      ctttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcag
AB056514_P_P-G      ctttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcag
HE981171_P_P-G      ctttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcag
HE981172_P_P-G      ctttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcag
HE981174_P_P-G      ctttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcag
AB064312_P_P-G      ctttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcag
AB064311_P_P-G      ctttgtggctcctctgccgatccatactgcggaactcctcgctgcttgttttgctcgcag
AB064313_P_C-G      ctttgtggctcctctgccgatccatactgcggaactcctcgctgcttgttttgctcgcag
KF779235_P_P-G      ctttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcag
AB375165_P_P-G      ctttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcag
AB064310_P_P-G      ctttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcag
KM998716_P_P-G      ctttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcag
HE981175_P_P-G      ctttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcag
HE981176_P_P-G      ctttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcag
AF405706_P_P-G      ctttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcag
AF160501_P_C-G      ctttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcag
AB375166_P_P-G      ctttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcag
AB375167_P_P-G      ctttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcag
AB375168_P_P-G      ctttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcag
AB375169_P_P-G      ctttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcag
AB375170_P_P-G      ctttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcag
KF779233_P_P-G      ctttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcag
AB056513_P_P-G      ctttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcag
GU563556_P_P-G      ctttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcag
KY004111_P_P-G      ctttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcag
KJ194508_P_P-G      ctttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcag
KF767450_P_P-G      ctttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcag
KX264500_P_P-G      ctttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcag
FJ023674_P_P-G      ctttgtggctcctctgccgatccatactgcggaactcctagctgcctgttttgctcgcag
FR714503_P_P-G      ctttgtggctcctctgccgatccatactgcggaactgctagctgcctgttttgctcgcag
                    ********************************* **    ***** **************

EF464097_P_P-G      ccggtctggagcaaaactcattggaactgacaattctgtcgtcctctctcggaaatatac
EF464098_P_P-G      ccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaatatac
KF779267_P_P-G      ccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaatatac
DQ207798_P_P-G      ccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaatatac
AB056515_P_P-G      ccggtctggagcaacactcattgggactgacaattctgtcgtcctttctcggaaatatac
JQ707677_P_P-G      ccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaatatac
JQ707678_P_P-G      ccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaatatac
JQ707679_P_P-G      ccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaatatac
JQ707680_P_P-G      ccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaatatac
JQ707673_P_P-G      ccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaatatac
JQ707671_P_P-G      ccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaatatac
JQ707666_P_P-G      ccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaatatac
JQ707660_P_P-G      ccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaatatac
JQ707657_P_P-G      ccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaatatac
JQ707668_P_P-G      ccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaatatac
KF779357_P_P-G      ccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaatatac
GU565217_P_P-G      ccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaatatac
KF767452_P_P-G      ccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaatatac
KF414679_P_P-G      ccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaatatac
KF767451_P_P-G      ccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaatatac
JQ707436_P_P-G      ccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaatatac
KR230749_P_P-G      ccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaatatac
EF634480_P_P-G      ccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaatatac
AB056514_P_P-G      ccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaatatac
HE981171_P_P-G      ccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaatatac
HE981172_P_P-G      ccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaatatac
HE981174_P_P-G      ccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaatatac
AB064312_P_P-G      ccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaatatac
AB064311_P_P-G      ccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaatatac
AB064313_P_C-G      ccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaatatac
KF779235_P_P-G      ccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaatatac
AB375165_P_P-G      ccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaatatac
AB064310_P_P-G      ccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaatatac
KM998716_P_P-G      ccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaatatac
HE981175_P_P-G      ccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaatatac
HE981176_P_P-G      ccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaatatac
AF405706_P_P-G      ccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaatatac
AF160501_P_C-G      ccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaatatac
AB375166_P_P-G      ccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaatatac
AB375167_P_P-G      ccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaatatac
AB375168_P_P-G      ccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaatatac
AB375169_P_P-G      ccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaatatac
AB375170_P_P-G      ccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaatatac
KF779233_P_P-G      ccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaatatac
AB056513_P_P-G      ccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaatatac
GU563556_P_P-G      ccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaatatac
KY004111_P_P-G      ccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaatatac
KJ194508_P_P-G      ccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaatatac
KF767450_P_P-G      ccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaatatac
KX264500_P_P-G      ccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaatatac
FJ023674_P_P-G      ccggtctggagcaaacatcatcgggactgataattctgtcgtcctttcccggaaatatac
FR714503_P_P-G      caggtctggagcaaaacttatcgggactgataattctgtcgtcctttcgcggaaatatac
                    * ************   * ** ** ***** ************** ** ***********

EF464097_P_P-G      ctcctttccatggctgctaggctgtgctgccatatcgaccctttcagggacgtcctttgt
EF464098_P_P-G      ctcctttccatggcagctaggctgtgctgccaactggatccttcgcgggacgtcctttgt
KF779267_P_P-G      atcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgt
DQ207798_P_P-G      atcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgt
AB056515_P_P-G      atcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgt
JQ707677_P_P-G      atcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgt
JQ707678_P_P-G      atcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgt
JQ707679_P_P-G      atcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgt
JQ707680_P_P-G      atcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgt
JQ707673_P_P-G      atcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgt
JQ707671_P_P-G      atcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgt
JQ707666_P_P-G      atcctttccatggctgctaggctgtgctgccacctggatccttcgcgggacgtcctttgt
JQ707660_P_P-G      atcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgt
JQ707657_P_P-G      atcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgt
JQ707668_P_P-G      atcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgt
KF779357_P_P-G      atcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgt
GU565217_P_P-G      atcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgt
KF767452_P_P-G      atcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgt
KF414679_P_P-G      atcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgt
KF767451_P_P-G      atcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgt
JQ707436_P_P-G      atcctttccctggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgt
KR230749_P_P-G      atcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgt
EF634480_P_P-G      atcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgt
AB056514_P_P-G      atcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgt
HE981171_P_P-G      atcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgt
HE981172_P_P-G      atcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgt
HE981174_P_P-G      atcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgt
AB064312_P_P-G      atcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgt
AB064311_P_P-G      atcctttccatggctgctaggctgtgccgccaactggatccttcgcgggacgtcctttgt
AB064313_P_C-G      atcctttccatggctgctaggctgtgccgccaactggatccttcgcgggacgtcctttgt
KF779235_P_P-G      atcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgt
AB375165_P_P-G      atcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgt
AB064310_P_P-G      atcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgt
KM998716_P_P-G      atcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgt
HE981175_P_P-G      atcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgt
HE981176_P_P-G      atcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgt
AF405706_P_P-G      atcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgt
AF160501_P_C-G      atcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgt
AB375166_P_P-G      atcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgt
AB375167_P_P-G      atcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgt
AB375168_P_P-G      atcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgt
AB375169_P_P-G      atcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgt
AB375170_P_P-G      atcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgt
KF779233_P_P-G      atcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgt
AB056513_P_P-G      atcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgt
GU563556_P_P-G      atcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgt
KY004111_P_P-G      atcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgt
KJ194508_P_P-G      atcctttccctggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgt
KF767450_P_P-G      atcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgt
KX264500_P_P-G      atcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgt
FJ023674_P_P-G      mtcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgt
FR714503_P_P-G      atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgt
                     ** ***** **** ************ ****  * ** ***    **************

EF464097_P_P-G      ttacgtcccgtcagcgttgaatccagcggacgacccctcctggggtcgtttggggatctg
EF464098_P_P-G      ttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctg
KF779267_P_P-G      ttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctg
DQ207798_P_P-G      ttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctg
AB056515_P_P-G      ttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctg
JQ707677_P_P-G      ttacgtcccgacagcgctgaatccagcggacgacccctcccggggccgtttggggctctg
JQ707678_P_P-G      ttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctg
JQ707679_P_P-G      ttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctg
JQ707680_P_P-G      ttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctg
JQ707673_P_P-G      ttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctg
JQ707671_P_P-G      ttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctg
JQ707666_P_P-G      ttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctg
JQ707660_P_P-G      ttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctg
JQ707657_P_P-G      ttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctg
JQ707668_P_P-G      ttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctg
KF779357_P_P-G      ttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctg
GU565217_P_P-G      ttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctcta
KF767452_P_P-G      ttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctcta
KF414679_P_P-G      ttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctg
KF767451_P_P-G      ttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctg
JQ707436_P_P-G      ttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctcta
KR230749_P_P-G      ttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctg
EF634480_P_P-G      ttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctg
AB056514_P_P-G      ttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctg
HE981171_P_P-G      ttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctg
HE981172_P_P-G      ttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctg
HE981174_P_P-G      ttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctg
AB064312_P_P-G      ttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctg
AB064311_P_P-G      ttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctg
AB064313_P_C-G      ttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctg
KF779235_P_P-G      ttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctg
AB375165_P_P-G      ttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctg
AB064310_P_P-G      ttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctg
KM998716_P_P-G      ttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctg
HE981175_P_P-G      ttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctg
HE981176_P_P-G      ttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctg
AF405706_P_P-G      ttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctg
AF160501_P_C-G      ttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctg
AB375166_P_P-G      ttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctg
AB375167_P_P-G      ttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctg
AB375168_P_P-G      ttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctg
AB375169_P_P-G      ttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctg
AB375170_P_P-G      ttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctg
KF779233_P_P-G      ttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctg
AB056513_P_P-G      ttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctg
GU563556_P_P-G      ttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctg
KY004111_P_P-G      ttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctg
KJ194508_P_P-G      ttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctg
KF767450_P_P-G      ttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctcta
KX264500_P_P-G      ttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctg
FJ023674_P_P-G      ctacgtcccgtcggcgctgaatccagcggacgacccctctcggggccggttggggatcta
FR714503_P_P-G      ttacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgcttggggatcta
                     ********* * *** ******* **************  **** ** ****** *** 

EF464097_P_P-G      tcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggt
EF464098_P_P-G      tcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggt
KF779267_P_P-G      tcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggt
DQ207798_P_P-G      tcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggt
AB056515_P_P-G      tcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggt
JQ707677_P_P-G      tcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggt
JQ707678_P_P-G      tcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggt
JQ707679_P_P-G      tcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggt
JQ707680_P_P-G      tcgcccccttctccgtctgccgttcctgccgcccacggggcgcacctctctttacgcggt
JQ707673_P_P-G      tcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggt
JQ707671_P_P-G      tcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggt
JQ707666_P_P-G      tcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggt
JQ707660_P_P-G      tcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggt
JQ707657_P_P-G      tcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggt
JQ707668_P_P-G      tcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggt
KF779357_P_P-G      tcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggt
GU565217_P_P-G      tcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggt
KF767452_P_P-G      tcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggt
KF414679_P_P-G      tcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggt
KF767451_P_P-G      tcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggt
JQ707436_P_P-G      tcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggt
KR230749_P_P-G      tcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggt
EF634480_P_P-G      tcgcccccttctccgtctgtcgttcctgccgaccacggggcgcacctctctttacgcggt
AB056514_P_P-G      tcgaccccttctccgtttgccgttcctgccgaccacggggcgcacctctctttacgcggt
HE981171_P_P-G      tcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggt
HE981172_P_P-G      tcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggt
HE981174_P_P-G      tcgcccccttctccgtctgtcgttcctgccgaccacggggcgcacctctatttacgcggt
AB064312_P_P-G      tcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggt
AB064311_P_P-G      tcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggt
AB064313_P_C-G      tcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggt
KF779235_P_P-G      tcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggt
AB375165_P_P-G      tcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggt
AB064310_P_P-G      tcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggt
KM998716_P_P-G      tcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggt
HE981175_P_P-G      tcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggt
HE981176_P_P-G      tcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggt
AF405706_P_P-G      tcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggt
AF160501_P_C-G      tcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggt
AB375166_P_P-G      tcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggt
AB375167_P_P-G      tcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggt
AB375168_P_P-G      tcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggt
AB375169_P_P-G      tcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggt
AB375170_P_P-G      tcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggt
KF779233_P_P-G      tcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggt
AB056513_P_P-G      tcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggt
GU563556_P_P-G      tcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggt
KY004111_P_P-G      tcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggt
KJ194508_P_P-G      tcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggt
KF767450_P_P-G      tcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggt
KX264500_P_P-G      tcgcccccttctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggt
FJ023674_P_P-G      ccgtccccttctccgtctgccgtaccggccgwccacggggcgcacctctctttacgcgga
FR714503_P_P-G      ccgtcctcttcttcatctgccgtaccgaccgtccacggggcgcacctctctttacgcggt
                     ** ** ***** * * ** *** **  *** ***************** ********* 

EF464097_P_P-G      ctcccggtctgttccttctcatctgccggaccgtgtgcactttgcttcacctctgcacgt
EF464098_P_P-G      ctccccgtctgttccttctcatctgccggaccgtgtgcactttgcttcacctctgcacgt
KF779267_P_P-G      ctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcaccaagtcatgt
DQ207798_P_P-G      ctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
AB056515_P_P-G      ctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
JQ707677_P_P-G      ctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
JQ707678_P_P-G      ctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
JQ707679_P_P-G      ctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
JQ707680_P_P-G      ctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
JQ707673_P_P-G      ctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
JQ707671_P_P-G      ctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
JQ707666_P_P-G      ctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
JQ707660_P_P-G      ctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
JQ707657_P_P-G      ctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
JQ707668_P_P-G      ctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
KF779357_P_P-G      ctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
GU565217_P_P-G      ctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
KF767452_P_P-G      ctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
KF414679_P_P-G      ctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
KF767451_P_P-G      ctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
JQ707436_P_P-G      ctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
KR230749_P_P-G      ctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
EF634480_P_P-G      ctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
AB056514_P_P-G      ctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
HE981171_P_P-G      ctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
HE981172_P_P-G      ctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
HE981174_P_P-G      ctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
AB064312_P_P-G      ctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
AB064311_P_P-G      ctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
AB064313_P_C-G      ctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
KF779235_P_P-G      ctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
AB375165_P_P-G      ctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
AB064310_P_P-G      ctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
KM998716_P_P-G      ctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
HE981175_P_P-G      ctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
HE981176_P_P-G      ctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
AF405706_P_P-G      ctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
AF160501_P_C-G      ctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
AB375166_P_P-G      ctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
AB375167_P_P-G      ctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
AB375168_P_P-G      ctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
AB375169_P_P-G      ctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
AB375170_P_P-G      ctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
KF779233_P_P-G      ctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
AB056513_P_P-G      ctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
GU563556_P_P-G      ctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
KY004111_P_P-G      ctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
KJ194508_P_P-G      ctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
KF767450_P_P-G      ctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
KX264500_P_P-G      ctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
FJ023674_P_P-G      ctccccgagtgtgccttttcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
FR714503_P_P-G      ctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
                    ***** *  *** **** ************************ ********    ** **

EF464097_P_P-G      tacatggaaaccgccatga
EF464098_P_P-G      tacatggaaaccgccatga
KF779267_P_P-G      tacatggaaaccgccatga
DQ207798_P_P-G      tacatggaaaccgccatga
AB056515_P_P-G      tacatggaaaccgccatga
JQ707677_P_P-G      tacatggaaaccgccatga
JQ707678_P_P-G      tacatggaaaccgccatga
JQ707679_P_P-G      tacatggaaaccgccatga
JQ707680_P_P-G      tacatggaaaccgccatga
JQ707673_P_P-G      tacatggaaaccgccatga
JQ707671_P_P-G      tacatggaaaccgccatga
JQ707666_P_P-G      tacatggaaaccgccatga
JQ707660_P_P-G      tacatggaaaccgccatga
JQ707657_P_P-G      tacatggaaaccgccatga
JQ707668_P_P-G      tacatggaaaccgccatga
KF779357_P_P-G      tacatggaaaccgccatga
GU565217_P_P-G      tacatggaaaccgccatga
KF767452_P_P-G      tacatggaaaccgccatga
KF414679_P_P-G      tacatggaaaccgccatga
KF767451_P_P-G      tacatggaaaccgccatga
JQ707436_P_P-G      tacatggaaaccgccatga
KR230749_P_P-G      tacatggaaaccgccatga
EF634480_P_P-G      tacatggaaaccgccatga
AB056514_P_P-G      tacatggaaaccgccatga
HE981171_P_P-G      tacatggaaaccgccatga
HE981172_P_P-G      tacatggaaaccgccatga
HE981174_P_P-G      tacatggaaaccgccatga
AB064312_P_P-G      tacatggaaaccgccatga
AB064311_P_P-G      tacatggaaaccgccatga
AB064313_P_C-G      tacatggaaaccgccatga
KF779235_P_P-G      tacatggaaaccgccatga
AB375165_P_P-G      tacatggaaaccgccatga
AB064310_P_P-G      tacatggaaaccgccatga
KM998716_P_P-G      tacatggaaaccgccatga
HE981175_P_P-G      tacatggaaaccgccatga
HE981176_P_P-G      tacatggaaaccgccatga
AF405706_P_P-G      tacatggaaaccgccatga
AF160501_P_C-G      tacatggaaaccgccatga
AB375166_P_P-G      tacatggaaaccgccatga
AB375167_P_P-G      tacatggaaaccgccatga
AB375168_P_P-G      tacatggaaaccgccatga
AB375169_P_P-G      tacatggaaaccgccatga
AB375170_P_P-G      tacatggaaaccgccatga
KF779233_P_P-G      tacatggaaaccgccatga
AB056513_P_P-G      tacatggaaaccgccatga
GU563556_P_P-G      tacatggaaaccgccatga
KY004111_P_P-G      tacatggaaaccgccatga
KJ194508_P_P-G      tacatggaaaccgccatga
KF767450_P_P-G      tacatggaaaccgccatga
KX264500_P_P-G      tacatggaaaccgccatga
FJ023674_P_P-G      cgcatggaaaccaccgtga
FR714503_P_P-G      cgcatggagaccaccgtga
                      ****** *** ** ***

© 1998-2020Legal notice