HBVdb

Dataset for nucleotide sequence P of genotype G

[Download (right click)] [Alignment] [Repertoires]

52 sequence(s)

>gnl|hbvcds|AB056513_P_P-G Feature FT:CDS AB056513_P_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcacagtaaatgagaaacgaagatt
aaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagacaaaggtatcaaaccgtattatc
cagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacagcatggggctttcttggacgg
tccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatcaccagttggacccagcattc
agagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaaggtaggagttgg
agcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtctcagggcacactaacaactt
tgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccatctctccaccactaagagac
agtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtattt
tcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccagga
ttggggaccctgcaccgaacatggagaatatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgt
gtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcc
tgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccat
catcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaa
catcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaag
atggggttattccttaaattttatgggatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaa
ttaagcaatgttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggt
ttcgctgctccttttacccaatgtggttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttac
tttctcgccaacttataaggcctttctctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgt
gccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactga
caattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtgctgccaactggatccttcgcggga
cgtcctttgtttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccctt
ctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgttacatggaaaccgccatga
>gnl|hbvcds|AB056514_P_P-G Feature FT:CDS AB056514_P_P-G of [Viruses] Hepatitis B Virus genotype G. Non-functional genomic sequence. [Hepadnaviridae] (length=2520 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcacagtaaatgagaaacgaagatt
aaaactagttatgcctgccagatttttccctaactctactaaatatttaccattagacaaaggtatcaaaccgtattatc
cagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaaggcgggtattttatataagaga
gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacagcatggggctttcttggacgg
tccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatcaccagttggacccagcattc
agagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaaggtaggagttgg
agcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtctcagggcacactaacaactt
tgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccatctctccaccactaagagac
agtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcagggttcctgctgg
tggctccagttcagggatagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccaggattggggacc
ctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgaca
agaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctgg
cctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtc
tgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatg
ttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaagg
caactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttggg
ctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttc
gtagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgag
tccctttataccgctgttaccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaagatggggtta
ttccttaaattttatgggatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaat
gttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggtttcgctgct
ccttttacccaatgtggttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctcgcc
aacttataaggcctttctctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgt
ttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccg
atccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactgacaattctgt
cgtcctttctcggaaatatacatcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttg
tttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgaccccttctccgtttg
ccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgca
cttcgcttcacctctgcacgttacatggaaaccgccatga
>gnl|hbvcds|AB056515_P_P-G Feature FT:CDS AB056515_P_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgaagagacaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcacagtaaatgagaaacgaagatt
aaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagacaaaggtatcaaaccgtattatc
cagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacagcatggggctttcttggacgg
tccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatcaccagttggacccagcattc
agagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaaggtaggagttgg
agcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtctcagggcacactaacaactt
tgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccatctctccacctctaagagac
agtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtattt
tcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccaaga
ttggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcgcccgt
gtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcc
tgctcaaggcaactctatgtatccctcatgttgctgtataaaaccttcggaaggaaattgcacctgtattcccatcccat
catcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaa
catcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaag
atggggttattccttaaattttatgggatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaa
ttaagcaatgttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggt
ttcgctgctccttttacccaatgtggttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttac
tttctcgccaacttataaggcctttctctgtaaacaatacctgaacctttaccccgttgctaggcaacggcccggtctgt
gccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaacactcattgggactga
caattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtgctgccaactggatccttcgcggga
cgtcctttgtttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccctt
ctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgttacatggaaaccgccatga
>gnl|hbvcds|AB064310_P_P-G Feature FT:CDS AB064310_P_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatccggattggcaaactccttcttttcca
aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcacagtaaatgagaaacgaagatt
aaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagacaaaggtatcaaaccgtattatc
cagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacagcatggggctttcttggacgg
tccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatcaccagttggacccagcattc
agagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaaggtaggagttgg
agcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtctcagggcacactaacaactt
tgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccatctctccaccactaagagac
agtcatcctcaggccctgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtattt
tcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccagga
ttggggaccctgcaccgaatatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgt
gtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcc
tgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccat
catcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaa
catcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaag
atggggttattccttaaattttatgggatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaa
ttaagcaatgttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggt
ttcgctgctccttttacccaatgtggttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttac
tttctcgccaacttataaggcctttctctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgt
gccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactga
caattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtgctgccaactggatccttcgcggga
cgtcctttgtttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccctt
ctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgttacatggaaaccgccatga
>gnl|hbvcds|AB064311_P_P-G Feature FT:CDS AB064311_P_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcacagtaaatgagaaacgaagatt
aaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagacaaaggtatcaaaccgtattatc
cagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacagcatggggctttcttggacgg
tccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatcaccagttggacccagcattc
agagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaaggtaggagttgg
agcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtctcagggcacactaacaactt
tgccagcagatccgcccactgcctccaccaatcgtcagtcagggaggcagcctactcccatctctccaccactaagagac
agtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtattt
tcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccagga
ttggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgt
gtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcc
tgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccat
catcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaa
catcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaag
atggggttattccttaaattttatgggatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaa
ttaagcaatgttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggt
ttcgctgctcctttcacccaatgtggttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttac
tttctcgccaacttataaggcctttctctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgt
gccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctcgctgcttgttttgctcgcagccggtctggagcaaaactcattgggactga
caattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtgccgccaactggatccttcgcggga
cgtcctttgtttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccctt
ctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgttacatggaaaccgccatga
>gnl|hbvcds|AB064312_P_P-G Feature FT:CDS AB064312_P_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcacagtaaatgagaaacgaagatt
aaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagacaaaggtatcaaaccgtattatc
cagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacagcatggggctttcttggacgg
tccctctcgagtggggaaggaacctttccaccagcaatcctctaggattccttcccgatcaccagttggacccagcattc
agagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaaggtaggagttgg
agcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtctcagggcacactaacaactt
tgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccatctctccaccactaagagac
agtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatcccacagtcaggggcctgtatct
tcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccagga
ttggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgt
gtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcc
tgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccat
catcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaa
catcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaaaccctgacaaaacaaaaag
atggggttattccttaaattttatgggatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaa
ttaagcaatgttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggt
ttcgctgctccttttacccaatgtggttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttac
tttctcgccaacttataaggcctttctctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgt
gccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactga
caattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtgctgccaactggatccttcgcggga
cgtcctttgtttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccctt
ctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgttacatggaaaccgccatga
>gnl|hbvcds|AB064313_P_C-G Feature FT:CDS AB064313_P_C-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcacagtaaatgagaaacgaagatt
aaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagacaaaggtatcaaaccgtattatc
cagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacagcatggggctttcttggacgg
tccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatcaccagttggacccagcattc
agagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaaggtaggagttgg
agcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtctcagggcacactaacaactt
tgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccatctctccaccactaagagac
agtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtattt
tcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccagga
ttggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgt
gtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcccctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcc
tgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccat
catcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaa
catcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaag
atggggttattccttaaattttatgggatatgtaattggaagttggggtactttgccacaagaacacatcacaaagaaaa
ttaagcaatgttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggt
ttcgctgctccttttacccaatgtggttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttac
tttctcgccaacttataaggcctttctctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgt
gccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctcgctgcttgttttgctcgcagccggtctggagcaaaactcattgggactga
caattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtgccgccaactggatccttcgcggga
cgtcctttgtttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccctt
ctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgttacatggaaaccgccatga
>gnl|hbvcds|AB375165_P_P-G Feature FT:CDS AB375165_P_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcacagtaaatgagaagcgaagatt
aaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagacaaaggtatcaaaccgtattatc
cagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacagcatggggctttcttggacgg
tccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatcaccagttggacccagcattc
agagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaaggtaggagttgg
agcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtctcagggcacactaacaactt
tgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccatctctccaccactaagagac
agtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtattt
tcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccagga
ttggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgt
gtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcc
tgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccat
catcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaa
catcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaag
atggggttattccttaarttttatgggatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaa
ttaagcratgttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggt
ttcgctgctccttttacccaatgtggttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttac
tttctcgccaacttataaggcctttctctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgt
gccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactga
caattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtgctgccaactggatccttcgcggga
cgtcctttgtttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccctt
ctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgttacatggaaaccgccatga
>gnl|hbvcds|AB375166_P_P-G Feature FT:CDS AB375166_P_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
aatatccatttgcatcaagacattataactaaatgtgagcaatttgtgggccctctcacagtaaatgagaaacgaagatt
aaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagacaaaggtatcaaaccgtattatc
cagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacagcatggggctttcttggacgg
tccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatcaccagttggacccagcattc
agagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaaggtaggagttgg
agcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtctcagggcacactaacaactt
tgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccatctctccaccactaagagac
agtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtattt
tcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccagga
ttggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgt
gtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctgatttcaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcc
tgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccat
catcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaa
catcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaag
atggggttattccttaaattttatgggatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaa
ttaagcaatgttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggt
ttcgctgctccttttacccaatgtggttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttac
tttctcgccaacttataaggcctttctctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgt
gccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactga
caattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtgctgccaactggatccttcgcggga
cgtcctttgtttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccctt
ctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgttacatggaaaccgccatga
>gnl|hbvcds|AB375167_P_P-G Feature FT:CDS AB375167_P_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
aatatccatttgcatcaagacattataactaaatgtgagcaatttgtgggccctctcacagtaaatgagaaacgaagatt
aaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagacaaaggtatcaaaccgtattatc
cagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacagcatggggctttcttggacgg
tccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatcaccagttggacccagcattc
agagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaaggtaggagttgg
agcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtctcagggcacactaacaactt
tgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccatctctccaccactaagagac
agtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtattt
tcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccagga
ttggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgt
gtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctgatttcaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcc
tgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccat
catcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaa
catcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaag
atggggttattccttaaattttatgggatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaa
ttaagcaatgttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggt
ttcgctgctccttttacccaatgtggttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttac
tttctcgccaacttataaggcctttctctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgt
gccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactga
caattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtgctgccaactggatccttcgcggga
cgtcctttgtttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccctt
ctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgttacatggaaaccgccatga
>gnl|hbvcds|AB375168_P_P-G Feature FT:CDS AB375168_P_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
aatatccatttgcatcaagacattataactaaatgtgagcaatttgtgggccctctcacagtaaatgagaaacgaagatt
aaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagacaaaggtatcaaaccgtattatc
cagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacagcatggggctttcttggacgg
tccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatcaccagttggacccagcattc
agagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaaggtaggagttgg
agcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtctcagggcacactaacaactt
tgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccatctctccaccactaagagac
agtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtattt
tcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccagga
ttggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgt
gtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctgatttcaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcc
tgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccat
catcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaa
catcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaag
atggggttattccttaaattttatgggatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaa
ttaagcaatgttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggt
ttcgctgctccttttacccaatgtggttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttac
tttctcgccaacttataaggcctttctctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgt
gccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactga
caattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtgctgccaactggatccttcgcggga
cgtcctttgtttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccctt
ctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgttacatggaaaccgccatga
>gnl|hbvcds|AB375169_P_P-G Feature FT:CDS AB375169_P_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
aatatccatttgcatcaagacattataactaaatgtgagcaatttgtgggccctctcacagtaaatgagaaacgaagatt
aaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagacaaaggtatcaaaccgtattatc
cagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacagcatggggctttcttggacgg
tccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatcaccagttggacccagcattc
agagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaaggtaggagttgg
agcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtctcagggcacactaacaactt
tgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccatctctccaccactaagagac
agtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtattt
tcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccagga
ttggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgt
gtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctgatttcaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcc
tgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccat
catcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaa
catcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaag
atggggttattccttaaattttatgggatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaa
ttaagcaatgttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggt
ttcgctgctccttttacccaatgtggttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttac
tttctcgccaacttataaggcctttctctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgt
gccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactga
caattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtgctgccaactggatccttcgcggga
cgtcctttgtttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccctt
ctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgttacatggaaaccgccatga
>gnl|hbvcds|AB375170_P_P-G Feature FT:CDS AB375170_P_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
aatatccatttgcatcaagacattataactaaatgtgagcaatttgtgggccctctcacagtaaatgagaaacgaagatt
aaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagacaaaggtatcaaaccgtattatc
cagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacagcatggggctttcttggacgg
tccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatcaccagttggacccagcattc
agagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaaggtaggagttgg
agcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtctcagggcacactaacaactt
tgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccatctctccaccactaagagac
agtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtattt
tcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccagga
ttggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgt
gtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctgatttcaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcc
tgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccat
catcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaa
catcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaag
atggggttattccttaaattttatgggatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaa
ttaagcaatgttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggt
ttcgctgctccttttacccaatgtggttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttac
tttctcgccaacttataaggcctttctctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgt
gccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactga
caattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtgctgccaactggatccttcgcggga
cgtcctttgtttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccctt
ctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgttacatggaaaccgccatga
>gnl|hbvcds|AF160501_P_C-G Feature FT:CDS AF160501_P_C-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcacagtaaatgagaaacgaagatt
aaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagacaaaggtatcaaaccgtattatc
cagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacagcatggggctttcttggacgg
tccctctcgagtggggaaagaacctttccgccagcaatcctctaggattccttcccgatcaccagttggacccagcattc
agagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaaggtaggagttgg
agcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtctcagggcacactaacaactt
tgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccatctctccaccactaagagac
agtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtattt
tcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccagga
ttggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgt
gtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcc
tgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccat
catcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaa
catcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaag
atggggttattccttaaattttatgggatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaa
ttaagcaatgttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggt
ttcgctgctcctttcacccaatgtggttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttac
tttctcgccaacttataaggcctttctctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgt
gccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactga
caattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtgctgccaactggatccttcgcggga
cgtcctttgtttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccctt
ctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgttacatggaaaccgccatga
>gnl|hbvcds|AF405706_P_P-G Feature FT:CDS AF405706_P_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 235/01). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcacagtaaatgagaaacgaagatt
aaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagacaaaggtatcaaaccgtattatc
cagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacagcatggggctttcttggacgg
tccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatcaccagttggacccagcattc
agagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaaggtaggagttgg
agcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtctcagggcacactaacaactt
tgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccatctctccaccactaagagac
agtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtattt
tcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccagga
ttggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgt
gtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcc
tgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccat
catcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaa
catcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaaaccctaccaaaacaaaaag
atggggttattccttaaattttatgggatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaa
ttaagcaatgttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggt
ttcgctgctccttttacccaatgtggttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttac
tttctcgccaacttataaggcctttctctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgt
gccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactga
caattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtgctgccaactggatccttcgcggga
cgtcctttgtttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccctt
ctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgttacatggaaaccgccatga
>gnl|hbvcds|DQ207798_P_P-G Feature FT:CDS DQ207798_P_P-G of [Viruses] Hepatitis B Virus genotype G. Non-functional genomic sequence. [Hepadnaviridae] (length=2526 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcacagtaaatgagaaacgaagatt
aaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagataaaggtatcaaaccgtattatc
cagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
gaaacatcccgtagcgcctcattttgtgggtcaccatatacttgggaacaagatctacagcatggggctttcttggacgg
tccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatcaccagttggacccagcattc
agagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaaggtaggagttgg
agcctatggacccgggttcacccctccgcacggaggccttttggggtggagccctcagtctcagggcacactaacaactt
tgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccatctctccaccactgagagac
agtcatcctcaggccatgcagtggaactctacagcattccaccaagctctgcaaaatcccaaagtcaggggcctgtatcc
tgctggtggctccagttcaggaacagtgagccctgttccgactattgcctctcacatctcgtcaatcttctccaggattg
gggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttg
ttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtg
tcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctgga
tgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaa
ggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgc
tcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcat
cttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcag
tggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacat
cttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaaaccctaccaaaacaaaaagatg
gggttattccttaaattttatgggatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaatta
agcaatgttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggtttc
gctgctccttttacccaatgtggttaccctgccttaatgcctttatatgcatgtatacaggctaagcaggcttttacttt
ctcgccaacttataaggcctttctctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgcc
aagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcct
ctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactgacaa
ttctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgt
cctttgtttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgcccccttctc
cgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccg
tgtgcacttcgcttcacctctgcacgttacatggaaaccgccatga
>gnl|hbvcds|EF464097_P_P-G Feature FT:CDS EF464097_P_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 06hac). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcacagtaaatgagaaacgaagatt
aaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagacaaaggtatcaaaccgtattatc
cagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacagcatggggctttcttggacgg
tccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatcaccagttggacccagcattc
agagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaaggtaggagttgg
agcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtctcagggcacactaacaactt
tgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccatctctccaccactaagagac
agtcatcctcaggccatgcagtggaactccacccagttccaccaagctctacaaaatcccaaagtcaggggcctgtattt
tcctgctggtggctccagttcagagacacagaaccctgttccgactattgcctctctcacatcatcaatcttctcgaaga
ctgggggccctgcaccgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggaagtgcccgt
gtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcc
tgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccat
catcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgtt
cagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaa
catcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaag
atggggttattccttaaattttatgggatacgtaattggaagttggggtactttgccacaggaacacatcgcacagaaaa
ttaagcaatgttttgggaaactacctgttaacaggccaattgattggaaagtttgtcaaagaatagttggtcttttggga
ttcgctgctccttttacccaatgtggttaccctgccttaatgcctttatatgcatgtatacaagttaagcaggcttttac
tttctcgccaacttataaggcctttctctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgt
gccaagtgtttgctgacgcaacccccactggttgggggttggccatcggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcattggaactga
caattctgtcgtcctctctcggaaatatacctcctttccatggctgctaggctgtgctgccatatcgaccctttcaggga
cgtcctttgtttacgtcccgtcagcgttgaatccagcggacgacccctcctggggtcgtttggggatctgtcgccccctt
ctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctcccggtctgttccttctcatctgccgga
ccgtgtgcactttgcttcacctctgcacgttacatggaaaccgccatga
>gnl|hbvcds|EF464098_P_P-G Feature FT:CDS EF464098_P_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 09hgg). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcacagtaaatgagaaacgaagatt
aaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagacaaaggtatcaaaccgtattatc
cagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacagcatggggctttcttggacgg
tccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatcaccagttggacccagcattc
agagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaaggtaggagttgg
agcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtctcagggcacactaacaactt
tgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccatctctccaccactaagagac
agtcatcctcaggccatgcagtggaactccacccagttccaccaagctctacaaaatcccaaagtcaggggcctgtattt
tcctgctggtggctccagttcagagacagcagaacctgctccgactattgcctctctcacatcatcaatcttctcgaaga
ctgggggccctgcaccgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggaagtgcccgt
gtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcc
tgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccat
catcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgtt
cagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaa
catcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaag
atggggttattccttaaactttatgggatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaa
ttaagcaatgttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggt
ttcgctgctccttttacccaatgtggttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttac
tttctcgccaacttataaggcctttctctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgt
gccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcatagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactga
caattctgtcgtcctttctcggaaatatacctcctttccatggcagctaggctgtgctgccaactggatccttcgcggga
cgtcctttgtttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccctt
ctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcactttgcttcacctctgcacgttacatggaaaccgccatga
>gnl|hbvcds|EF634480_P_P-G Feature FT:CDS EF634480_P_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcacagtaaatgagaaacgaagatt
aaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagacaaaggtatcaaaccgtattatc
cagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
gaaacatcacgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacagcatggggctttcttggacgg
tccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatcaccagttggacccagcattc
agagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaaggtaggagttgg
agcctatggacccgggttcacccctccacacggaggccttctggggtggagccctcagtctcagggcacactaacaactt
taccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccatctctccaccactaagagac
agtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtattt
tcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccagga
ttggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgt
gtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctgattccaggatcctccaccaccagtacgggaccctgcaaaacctgcacgactcc
tgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccat
catcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaa
catcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaag
atggggttattccttaaattttatgggatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaa
ttaagcaatgttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggt
ttcgctgctccttttacccaatgtggttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttac
tttctcgccaacttataaggcctttctctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgt
gccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactga
caattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtgctgccaactggatccttcgcggga
cgtcctttgtttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccctt
ctccgtctgtcgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgttacatggaaaccgccatga
>gnl|hbvcds|FJ023674_P_P-G Feature FT:CDS FJ023674_P_P-G of [Viruses] Hepatitis B Virus genotype G (isolate I2/C2_C04-0790). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcct
aacattcatttgcatgaggacattatcgataggtgtcaacagtttgtgggccctttgacagtgaatgaaaaaaggagact
aaaattaattatgcctgctaggttttatcctaacagtaccaagtatttgcccttagataaaggtattaaaccttattatc
ctgaacatgcagttaatcattacttcaaagccaggcattatttacatactctgtggaaagctggcattctatataagaga
gaaactacacgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagggtggacatcca
cccctcggaaaggcatggggacgaatctttctgtacccaatcctctgggatttcttcccgatcatcagttggatcctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggaccattggccacaagcccatcaggtaggagc
gggagcattcgggccagggttcacccctccacacggaggtctgttggggtggagccctcaggctcagggcatattaacaa
atgtgccagcagttcctcctcctgcctcaaccaatcggcagtcaggacggcagcccactcccatctctccacctctgaga
gacagycatcctcaggccatgcagtggaactccacaaccttccaccaagctcttcargatcccagagtcaggggcctgta
ttttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatattgcctctcacatctcatcaatcttcgcaa
ggactggggaccttgcaccgaacatggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcgggattt
ttcttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacaac
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggctatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggat
tatcarggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggaccctgcagaacctgcacgac
tcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagcccgtttctcctggctcagtttactagcgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgta
camcaccttgagtccatttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaa
gcgatggggttattccttgaatttcatgggatacgtaattggaagttggggtaccttgccacaagatcatattatacaga
aaatcagacaatgttttagaaaactccctgttaataggcccgttgattggaaagtrtgtcaaagaatttcgggtctcctg
ggctttgctgctcccttcacacaatgtggttaccctgcattaatgcctttatatgcmtgtatacaagccaaacaggcttt
cactttctcgccaacttacaaggcctttctatgtaaacaatatctgaacctttaccccgttgtcaggcaacggcccggtc
tgtgccaagtgtttgctgatgcaacccccactggctggggcttggccatgggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagctgcctgttttgctcgcagccggtctggagcaaacatcatcgggac
tgataattctgtcgtcctttcccggaaatatacmtcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatccagcggacgacccctctcggggccggttggggatctaccgtccc
cttctccgtctgccgtaccggccgwccacggggcgcacctctctttacgcggactccccgagtgtgccttttcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|FR714503_P_P-G Feature FT:CDS FR714503_P_P-G of [Viruses] Hepatitis B Virus genotype G (isolate TZ306). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgttagtattccttggactc
ataaggtgggaaactttaccgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcct
aacattcatttgcatgaggacattatcaataggtgtcaacaatttgtgggccctcttacagttaatgaaaaaagaagatt
aaacttaattatgcctgctaggttctatcctaaccgtactaagtatttgcccttagataaaggcataaaaccttattatc
ctgagcaggccgttaatcattatttcaaaactaggcattatttacatactctgtggaaagctggcattctatataagaga
gaaacaacacgcagcgcatcattttgtgggtcaccatattatagggaacaagagccacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacgaatctttctgttcccaatcctctgggatttcttcccgatcatcagttggaccctgcg
ttcggagccaactcaaacaatccagattgggacttcaaccccaacaaggaccattggccacaagcccatcaggtaggagc
gggagcattcgggccagggttcacccctcctcacggaggtcttttggggtggagccctcaggctcagggcatattaacaa
acgtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagccaactcccatatctccacctctaaga
gacagtcatcctcaggccatgcagtggaactccaccaccttccaccaagctctacaagatcccagaatcaggggcctgta
tcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcatcaatcttcacga
ggattggggaccctgcaacgaacatggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggat
tatcaaggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggaccatgcaaaacctgcacgac
tcctgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgaggccatttataccgctgttaccaattttcttttgtctttgggtatacatttaaattctaacaaaactaa
gcgatggggttattccctaaacttcatgggatatgtaattggaagttggggtaccttgccacaagatcatattatacaga
aaatcaaacaatgttttagaaaactccctgttaacaggcccattgattggaaagtatgtcaaagaatttcaggactcttg
ggctttgctgctccatttacacaatgtggttaccctgcgttaatgcctttgtatgcatgtatacaagctaaacaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatatgaacctttaccccgttgcccggcaacggcccggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactgctagctgcctgttttgctcgcagcaggtctggagcaaaacttatcgggac
tgataattctgtcgtcctttcgcggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgcttggggatctaccgtcct
cttcttcatctgccgtaccgaccgtccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GU563556_P_P-G Feature FT:CDS GU563556_P_P-G of [Viruses] Hepatitis B Virus genotype G (isolate BV-55). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcacagtaaatgagaaacgaagatt
aaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagacaaaggtatcaaaccgtattatc
cagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacagcatggggctttcttggacgg
tccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatcaccagttggacccagcattc
agagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaaggtaggagttgg
agcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtctcagggcacactaacaactt
tgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccatctctccaccactaagagac
agtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtattt
tcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccagga
ttggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgt
gtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcc
tgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccat
catcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaa
catcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaag
atggggttattccttaaattttatgggatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaa
ttaagcaatgttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggt
ttcgctgctccttttacccaatgtggttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttac
tttctcgccaacttataaggcctttctctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgt
gccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactga
caattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtgctgccaactggatccttcgcggga
cgtcctttgtttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccctt
ctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgttacatggaaaccgccatga
>gnl|hbvcds|GU565217_P_P-G Feature FT:CDS GU565217_P_P-G of [Viruses] Hepatitis B Virus genotype G. Non-functional genomic sequence. [Hepadnaviridae] (length=2529 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttcccaatgatagtattccttggactc
acaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcacagtaaatgagaaacgaagatt
aaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagacaaaggtatcaaaccgtattatc
cagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaagacgggtattctatataagaga
gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacagcatggggctttcttggacgg
tccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatcaccagttggacccagcattc
agagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaaggtaggagttgg
agcctatggacccgggttcacccctccacacggaggccttttggggtggagccctccgtctcagggcacactaacaactt
tgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccatctctccaccactaagagac
agtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtatct
tcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccagga
ttggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgt
gtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcc
tgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccat
catcttgggctttcgcaaaatacctatgggattgggcctcagtccgtttctcatggctcagtttactagtgccatttgtt
cagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaa
catcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaag
atggggttattccttaaattttatgggatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaa
ttaagcaatgttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggt
ttcgctgctccttttacccaatgtggttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttac
tttctcgccaacttataaggcctttctctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgt
gccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactga
caattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtgctgccaactggatccttcgcggga
cgtcctttgtttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctatcgccccctt
ctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgttacatggaaaccgccatga
>gnl|hbvcds|HE981171_P_P-G Feature FT:CDS HE981171_P_P-G of [Viruses] Hepatitis B Virus genotype G. Non-functional genomic sequence. [Hepadnaviridae] (length=2517 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcacagtaaatgagaaacgaagatt
aaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagacaaaggtatcaaaccgtattatc
cagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacagcatggggctttcttggacgg
tccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatcaccagttggacccagcattc
agagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaaggtaggagttgg
agcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtctcagggcacactaacaactt
tgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccatctctccaccactaagagac
agtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcagtcctgctggtgg
ctccagttcagggatagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccaggattggggaccctg
caccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaga
atcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcct
aaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgc
ggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttg
cccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaa
ctctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctt
tcgcaaaatacctatgggagtgggtctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgta
gggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtcc
ctttataccgctgttaccaattttcttttttctttgggtatacatctaaaccctaacaaaacaaaaagatggggttattc
cttaaattttatgggatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatgtt
ttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggtttcgctgctcct
tttacccaatgtggttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctcgccaac
ttataaggcctttctctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtttg
ctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatc
catactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactgacaattctgtcgt
cctttctcggaaatatacatcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgttt
acgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccg
ttcctgccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcactt
cgcttcacctctgcacgttacatggaaaccgccatga
>gnl|hbvcds|HE981172_P_P-G Feature FT:CDS HE981172_P_P-G of [Viruses] Hepatitis B Virus genotype G. Non-functional genomic sequence. [Hepadnaviridae] (length=2517 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcacagtaaatgagaaacgaagatt
aaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagacaaaggtatcaaaccgtattatc
cagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacagcatggggctttcttggacgg
tccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatcaccagttggacccagcattc
agagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaaggtaggagttgg
agcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtctcagggcacactaacaactt
tgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccatctctccaccactaagagac
agtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcagtcctgctggtgg
ctccagttcagggatagtgaaccttgttccgactattgcctctcacatctcgtcaatcttctccaggattggggaccctg
taccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaga
atcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcct
aaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgc
ggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttg
cccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaa
ctctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctt
tcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgta
gggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtcc
ctttataccgctgttaccaattttcttttttctttgggtatacatctaaaccctaacaaaacaaaaagatggggttattc
cttaaattttatgggatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatgtt
ttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggtttcgctgctcct
tttacccaatgtggttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctcgccaac
ttataaggcctttctctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtttg
ctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatc
catactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactgacaattctgtcgt
cctttctcggaaatatacatcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgttt
acgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccg
ttcctgccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcactt
cgcttcacctctgcacgttacatggaaaccgccatga
>gnl|hbvcds|HE981174_P_P-G Feature FT:CDS HE981174_P_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcacagtaaatgagaaacgaagatt
aaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagacaaaggtatcaaaccgtattatc
cagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacagcatggggctttcttggacgg
tccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatcaccagttggacccagcattc
agagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaaggtaggagttgg
agcctatggacccgggttcacccctccacacggaggccttttggggtggagccttcaatctcagggcacactaacaactt
tgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccatctctccaccactaagagac
agtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtatct
tcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccagga
ttggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgt
gtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagcacgggaccctgcaaaacctgcacgactcc
tgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccat
catcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaa
catcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaag
atggggttattccttaaattttatgggatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaa
ttaagcaatgttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggt
ttcgctgctccttttacccaatgtggttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttac
tttctcgccaacttataaggcctttctctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgt
gccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactga
caattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtgctgccaactggatccttcgcggga
cgtcctttgtttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccctt
ctccgtctgtcgttcctgccgaccacggggcgcacctctatttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgttacatggaaaccgccatga
>gnl|hbvcds|HE981175_P_P-G Feature FT:CDS HE981175_P_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcacagtaaatgagaaacgaagatt
aaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagacaaaggtatcaaaccgtattatc
cagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacagcatggggctttcttggacgg
tccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatcaccagttggacccagcattc
agagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaaggtaggagttgg
agcctatggacccgggttcacccctccacacggaggccttttggggtggagccttcagtctcagggcacactaacaactt
tgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccatctctccaccactaagagac
agtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtattt
tcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccagga
ttggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgt
gtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagcacgggaccctgcaaaacctgcacgactcc
tgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccat
catcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaa
catcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaag
atggggttattccttaaattttatgggatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaa
ttaagcaatgttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggt
ttcgctgctccttttacccaatgtggttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttac
tttctcgccaacttataaggcctttctctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgt
gccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactga
caattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtgctgccaactggatccttcgcggga
cgtcctttgtttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccctt
ctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgttacatggaaaccgccatga
>gnl|hbvcds|HE981176_P_P-G Feature FT:CDS HE981176_P_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcacagtaaatgagaaacgaagatt
aaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagacaaaggtatcaaaccgtattatc
cagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacagcatggggctttcttggacgg
tccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatcaccagttggacccagcattc
agagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaaggtaggagttgg
agcctatggacccgggttcacccctccacacggaggccttttggggtggagccttcagtctcagggcacactaacaactt
tgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccatctctccaccactaagagac
agtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtattt
tcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccagga
ttggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgt
gtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagcacgggaccctgcaaaacctgcacgactcc
tgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccat
catcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaa
catcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaag
atggggttattccttaaattttatgggatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaa
ttaagcaatgttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggt
ttcgctgctccttttacccaatgtggttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttac
tttctcgccaacttataaggcctttctctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgt
gccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactga
caattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtgctgccaactggatccttcgcggga
cgtcctttgtttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccctt
ctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgttacatggaaaccgccatga
>gnl|hbvcds|JQ707436_P_P-G Feature FT:CDS JQ707436_P_P-G of [Viruses] Hepatitis B Virus genotype G (isolate MC1_C27). Non-functional genomic sequence. [Hepadnaviridae] (length=2526 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
aatatacatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcacagtaaatgagaaacgaagatt
aaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagacaaaggtatcaaaccgtattatc
cagaaaatgtagttcatcattacttccagaccagacattatttacataccctttggaaggcgggtattctatataagcga
gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacagcatggggctttcttggacgg
tccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatcaccagttggacccagcattc
agagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaaggtaggagttgg
agcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtctcagggcacactaacaactt
tgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccatctctccaccactaagagac
agtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtatcc
tgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccaggattg
gggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttg
ttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtg
tcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctgga
tgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaa
ggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgc
tcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcat
cttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcag
tggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacat
cttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaagatg
gggttattccttaaattttatgggatatgtaattggaagttggggtactttgccacaagaacacatcacacaaaaaatta
agcaatgttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggtttc
gctgctccttttacccaatgtggttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttacttt
ctcgccaacttataaggcctttctctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgcc
aagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcct
ctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactgacaa
ttctgtcgtcctttctcggaaatatacatcctttccctggctgctaggctgtgctgccaactggatccttcgcgggacgt
cctttgtttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctatcgcccccttctc
cgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccg
tgtgcacttcgcttcacctctgcacgttacatggaaaccgccatga
>gnl|hbvcds|JQ707657_P_P-G Feature FT:CDS JQ707657_P_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_1). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctcaagcttcccaatgttagtattccttggactc
acaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcacagtaaatgagaaacgaagatt
aaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagacaaaggtatcaaaccgtattatc
cagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacagcatggggctttcttggacgg
tccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatcaccagttggacccagcattc
agagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaaggtaggagttgg
agcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtctcagggcacactaacaactt
tgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccatctctccaccactaagagac
agtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtatct
tcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccagga
ttggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgt
gtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcc
tgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccat
catcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
cagtggttcgtagggctttcccccactgtctggctttcagctatattgatgatgtggtattgggggccaaatctgtacaa
catcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatctaaaccataacaaaacaaaaag
atggggttattccttaaattttatgggatatgtaattggaagttggggtactttgccacaagaacacatcacacaaaaaa
ttaagcaatgttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggt
ttcgctgctccttttacccaatgtggttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttac
tttctcgccaacttataaggcctttctctgtaaacaatacatgaacctttaccctgttgctaggcaacggcccggtctgt
gccaagtgtttgctgacgcaacccccactggttggggcttggccatcggacatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactga
caattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtgctgccaactggatccttcgcggga
cgtcctttgtttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccctt
ctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgttacatggaaaccgccatga
>gnl|hbvcds|JQ707660_P_P-G Feature FT:CDS JQ707660_P_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_17). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcacagtaaatgagaaacgaagatt
aaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagacaaaggtatcaaaccgtattatc
cagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacagcatggggctttcttggacgg
tccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatcaccagttggacccagcattc
agagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaaggtaggagttgg
agcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtctcagggcacactaacaactt
tgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccatctctccaccactaagagac
agtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtatct
tcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccagga
ttggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgt
gtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcc
tgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccat
catcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
cagtggttcgtagggctttcccccactgtctggctttcagctatattgatgatgtggtattgggggccaaatctgtacaa
catcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatctaaaccataacaaaacaaaaag
atggggttattccttaaattttatgggatatgtaattggaagttggggtactttgccacaagaacacatcacacaaaaaa
ttaagcaatgttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggt
ttcgctgctccttttacccaatgtggttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttac
tttctcgccaacttataaggcctttctctgtaaacaatacatgaacctttaccctgttgctaggcaacggcccggtctgt
gccaagtgtttgctgacgcaacccccactggttggggcttggccatcggacatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactga
caattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtgctgccaactggatccttcgcggga
cgtcctttgtttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccctt
ctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgttacatggaaaccgccatga
>gnl|hbvcds|JQ707666_P_P-G Feature FT:CDS JQ707666_P_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_22). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcacagtaaatgagaaacgaagatt
aaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagacaaaggtatcaaaccgtattatc
cagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacagcatggggctttcttggacgg
tccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatcaccagttggacccagcattc
agagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaaggtaggagttgg
agcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtctcagggcacactaacaactt
tgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccatctctccaccactaagagac
agtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtatct
tcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccagga
ttggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgt
gtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcc
tgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccat
catcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
cagtggttcgtagggctttcccccactgtctggctttcagctatattgatgatgtggtattgggggccaaatctgtacaa
catcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatctaaaccataacaaaacaaaaag
atggggttattccttaaattttatgggatatgtaattggaagttggggtactttgccacaagaacacatcacacaaaaaa
ttaagcaatgttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggt
ttcgctgctccttttacccaatgtggttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttac
tttctcgccaacttataaggcctttctctgtaaacaatacatgaacctttaccctgttgctaggcaacggcccggtctgt
gccaagtgtttgctgacgcaacccccactggttggggcttggccatcggacatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactga
caattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtgctgccacctggatccttcgcggga
cgtcctttgtttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccctt
ctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgttacatggaaaccgccatga
>gnl|hbvcds|JQ707668_P_P-G Feature FT:CDS JQ707668_P_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_26-5). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcacagtaaatgagaaacgaagatt
aaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagacaaaggtatcaaaccgtattatc
cagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacagcatggggctttcttggacgg
tccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatcaccagttggacccagcattc
agagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaaggtaggagttgg
agcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtctcagggcacactaacaactt
tgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccatctctccaccactaagagac
agtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtatct
tcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccagga
ttggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgt
gtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcc
tgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccat
catcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
cagtggttcgtagggctttcccccactgtctggctttcagctatattgatgatgtggtattgggggccaaatctgtacaa
catcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatctaaaccataacaaaacaaaaag
atggggttattccttaaattttatgggatatgtaattggaagttggggtactttgccacaagaacacatcacacaaaaaa
ttaagcaatgttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggt
ttcgctgctccttttacccaatgtggttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttac
tttctcgccaacttataaggcctttctctgtaaacaatacatgaacctttaccctgttgctaggcaacggcccggtctgt
gccaagtgtttgctgacgcaacccccactggttggggcttggccatcggacatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactga
caattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtgctgccaactggatccttcgcggga
cgtcctttgtttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccctt
ctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgttacatggaaaccgccatga
>gnl|hbvcds|JQ707671_P_P-G Feature FT:CDS JQ707671_P_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_3). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcacagtaaatgagaaacgaagatt
aaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagacaaaggtatcaaaccgtattatc
cagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacagcatggggctttcttggacgg
tccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatcaccagttggacccagcattc
agagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaaggtaggagttgg
agcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtctcagggcacactaacaactt
tgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccatctctccaccactaagagac
agtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtatct
tcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccagga
ttggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgt
gtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcc
tgctcaaggcaactctatgtatccctcatgttgctgtacaaaactttcggacggaaattgcacctgtattcccatcccat
catcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
cagtggttcgtagggctttcccccactgtctggctttcagctatattgatgatgtggtattgggggccaaatctgtacaa
catcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatctaaaccataacaaaacaaaaag
atggggttattccttaaattttatgggatatgtaattggaagttggggtactttgccacaagaacacatcacacaaaaaa
ttaagcaatgttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggt
ttcgctgctccttttacccaatgtggttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttac
tttctcgccaacttataaggcctttctctgtaaacaatacatgaacctttaccctgttgctaggcaacggcccggtctgt
gccaagtgtttgctgacgcaacccccactggttggggcttggccatcggacatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactga
caattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtgctgccaactggatccttcgcggga
cgtcctttgtttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccctt
ctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgttacatggaaaccgccatga
>gnl|hbvcds|JQ707673_P_P-G Feature FT:CDS JQ707673_P_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_33). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcggaagatctgcatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcacagtaaatgagaaacgaagatt
aaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagacaaaggtatcaaaccgtattatc
cagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacagcatggggctttcttggacgg
tccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatcaccagttggacccagcattc
agagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaaggtaggagttgg
agcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtctcagggcacactaacaactt
tgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccatctctccaccactaagagac
agtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtatct
tcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccagga
ttggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgt
gtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcc
tgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccat
catcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
cagtggttcgtagggctttcccccactgtctggctttcagctatattgatgatgtggtattgggggccaaatctgtacaa
catcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatctaaaccataacaaaacaaaaag
atggggttattccttaaattttatgggatatgtaattggaagttggggtactttgccacaagaacacatcacacaaaaaa
ttaagcaatgttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggt
ttcgctgctccttttacccaatgtggttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttac
tttctcgccaacttataaggcctttctctgtaaacaatacatgaacctttaccctgttgctaggcaacggcccggtctgt
gccaagtgtttgctgacgcaacccccactggttggggcttggccatcggacatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactga
caattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtgctgccaactggatccttcgcggga
cgtcctttgtttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccctt
ctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgttacatggaaaccgccatga
>gnl|hbvcds|JQ707677_P_P-G Feature FT:CDS JQ707677_P_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_45). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcacagtaaatgagaaacgaagatt
aaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagacaaaggtatcaaaccgtattatc
cagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacagcatggggctttcttggacgg
tccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatcaccagttggacccagcattc
agagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaaggtaggagttgg
agcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtctcagggcacactaacaactt
tgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccatctctccaccactaagagac
agtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtatct
tcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccagga
ttggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgt
gtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggatatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcc
tgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccat
catcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
cagtggttcgtagggctttcccccactgtctggctttcagctatattgatgatgtggtattgggggccaaatctgtacaa
catcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaaaccataacaaaacaaaaag
atggggttattccttaaattttatgggatatgtaattggaagttggggtactttgccacaagaacacatcacacaaaaaa
ttaagcaatgttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggt
ttcgctgctccttttacccaatgtggttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttac
tttctcgccaacttataaggcctttctctgtaaacaatacatgaacctttaccctgttgctaggcaacggcccggtctgt
gccaagtgtttgctgacgcaacccccactggttggggcttggccatcggacatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactga
caattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtgctgccaactggatccttcgcggga
cgtcctttgtttacgtcccgacagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccctt
ctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgttacatggaaaccgccatga
>gnl|hbvcds|JQ707678_P_P-G Feature FT:CDS JQ707678_P_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_47). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcacagtaaatgagaaacgaagatt
aaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagacaaaggtatcaaaccgtattatc
cagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacagcatggggctttcttggacgg
tccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatcaccagttggacccagcattc
agagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaaggtaggagttgg
agcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtctcagggcacactaacaactt
tgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccatctctccaccactaagagac
agtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtatct
tcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccagga
ttggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgt
gtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgct
ggatgtgtttgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcc
tgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccat
catcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
cagtggttcgtagggctttcccccactgtctggctttcagctatatcgatgatgtggtattgggggccaaatctgtacaa
catcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaaaccataacaaaacaaaaag
atggggttattccttaaattttatgggatatgtaattggaagttggggtactttgccacaagaacacatcacacaaaaaa
ttaagcaatgttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggt
ttcgctgctccttttacccaatgtggttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttac
tttctcgccaacttataaggcctttctctgtaaacaatacatgaacctttaccctgttgctaggcaacggcccggtctgt
gccaagtgtttgctgacgcaacccccactggttggggcttggccatcggacatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactga
caattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtgctgccaactggatccttcgcggga
cgtcctttgtttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccctt
ctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgttacatggaaaccgccatga
>gnl|hbvcds|JQ707679_P_P-G Feature FT:CDS JQ707679_P_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_48). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcacagtaaatgagaaacgaagatt
aaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagacaaaggtatcaaaccgtattatc
cagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacagcatggggctttcttggacgg
tccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatcaccagttggacccagcattc
agagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaaggtaggagttgg
agcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtctcagggcacactaacaactt
tgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccatctctccaccactaagagac
agtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtatct
tcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccagga
ttggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgt
gtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgct
ggatgtgtttgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcc
tgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccat
catcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
cagtggttcgtagggctttcccccactgtctggctttcagctatattgatgatgtggtattgggggccaaatctgtacaa
catcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaaaccataacaaaacaaaaag
atggggttattccttaaattttatgggatatgtaattggaagttggggtactttgccacaagaacacatcacacaaaaaa
ttaagcaatgttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggt
ttcgctgctccttttacccaatgtggttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttac
tttctcgccaacttataaggcctttctctgtaaacaatacatgaacctttaccctgttgctaggcaacggcccggtctgt
gccaagtgtttgctgacgcaacccccactggttggggcttggccatcggacatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactga
caattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtgctgccaactggatccttcgcggga
cgtcctttgtttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccctt
ctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgttacatggaaaccgccatga
>gnl|hbvcds|JQ707680_P_P-G Feature FT:CDS JQ707680_P_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_6). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcacagtaaatgagaaacgaagatt
aaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagacaaaggtatcaaaccgtattatc
cagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacagcatggggctttcttggacgg
tccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatcaccagttggacccagcattc
agagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaaggtaggagttgg
agcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtctcagggcacactaacaactt
tgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccatctctccaccactaagagac
agtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtatct
tcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccagga
ttggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgt
gtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcc
tgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccat
catcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
cagtggttcgtagggctttcccccactgtctggctttcagctatattgatgatgtggtattgggggccaaatctgtacaa
catcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatctaaaccataacaaaacaaaaag
atggggttattccttaaattttatgggatatgtaattggaagttggggtactttgccacaagaacacatcacacaaaaaa
ttaagcaatgttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggt
ttcgctgctccttttacccaatgtggttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttac
tttctcgccaacttataaggcctttctctgtaaacaatacatgaacctttaccctgttgctaggcaacggcccggtctgt
gccaagtgtttgctgacgcaacccccactggttggggcttggccatcggacatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactga
caattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtgctgccaactggatccttcgcggga
cgtcctttgtttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccctt
ctccgtctgccgttcctgccgcccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgttacatggaaaccgccatga
>gnl|hbvcds|KF414679_P_P-G Feature FT:CDS KF414679_P_P-G of [Viruses] Hepatitis B Virus genotype G (isolate B213). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcacagtaaatgagaaacgaagatt
aaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagacaaaggtatcaaaccgtattatc
cagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacagcatggggctttcttggacgg
tccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatcaccagttggacccagcattc
agagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaaggtaggagttgg
agcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtctcagggcacactaacaactt
tgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccatctctccaccactaagagac
agtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtatct
tcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccagga
ttggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgt
gtgtcctggcctaaattcgcagtccccaacctccaatcactcactaatctcctgtcctccaacttgtcctggctatcgct
ggatgtggctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcc
tgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacagaaattgcacctgtattcccatcccat
catcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgtt
cagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaa
catcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaag
atggggttattccttaaattttatgggatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaa
ttaagcaatgttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggt
ttcgctgctccttttacccaatgtggttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttac
tttctcgccaacttataaggcctttctctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgt
gccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactga
caattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtgctgccaactggatccttcgcggga
cgtcctttgtttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccctt
ctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgttacatggaaaccgccatga
>gnl|hbvcds|KF767450_P_P-G Feature FT:CDS KF767450_P_P-G of [Viruses] Hepatitis B Virus genotype G (isolate patient_23). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcacagtaaatgagaaacgaagatt
aaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagacaaaggtatcaaaccgtattatc
cagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacagcatggggctttcttggacgg
tccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatcaccagttggacccagcattc
agagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaaggtaggagttgg
agcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtctcagggcacactaacaactt
tgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccatctctccaccactaagagac
agtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtattt
tcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccagga
ttggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgt
gtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcc
tgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccat
catcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaa
catcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaag
atggggttattccttaaattttatgggatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaa
ttaagcaatgttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggt
ttcgctgctccttttacccaatgtggttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttac
tttctcgccaacttataaggcctttctctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgt
gccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactga
caattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtgctgccaactggatccttcgcggga
cgtcctttgtttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctatcgccccctt
ctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgttacatggaaaccgccatga
>gnl|hbvcds|KF767451_P_P-G Feature FT:CDS KF767451_P_P-G of [Viruses] Hepatitis B Virus genotype G (isolate patient_27). Non-functional genomic sequence. [Hepadnaviridae] (length=2526 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcacagtgaatgagaaacgaagatt
aaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagacaaaggtatcaaaccgtattatc
cagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacagcatggggctttcttggacgg
tccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatcaccagttggacccagcattc
agagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaaggtaggagttgg
agcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtctcagggcacactaacaactt
tgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccatctctccaccactaagagac
agtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtatcc
tgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccaggattg
gggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttg
ttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtg
tcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctgga
tgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaa
ggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgc
tcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcat
cttgggctttcgcaaaatacctatgggactgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcag
tggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtattgggggccaaatctgtacagcat
cttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaagatg
gggttattccttaaattttatgggatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaatta
agcaatgttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggtttc
gctgctccttttacccaatgtggttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttacttt
ctcgccaacttataaggcctttctctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgcc
aagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcct
ctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactgacaa
ttctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgt
cctttgtttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgcccccttctc
cgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccg
tgtgcacttcgcttcacctctgcacgttacatggaaaccgccatga
>gnl|hbvcds|KF767452_P_P-G Feature FT:CDS KF767452_P_P-G of [Viruses] Hepatitis B Virus genotype G (isolate patient_7). Non-functional genomic sequence. [Hepadnaviridae] (length=2526 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcacagtaaatgagaaacgaagatt
aaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagacaaaggtatcaaaccgtattatc
cagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacagcatggggctttcttggacgg
tccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatcaccagttggacccagcattc
agagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaaggtaggagtcgg
agcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtctcagggcacactaacaactt
tgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccatctctccaccactaagagac
agtcatcctcaggccatgcagtgctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtatcttcc
tgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccaggattg
gggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttg
ttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtg
tcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctgga
tgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaa
ggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgtctcctgc
tcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcat
cttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcag
tggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaacat
cttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaaaccctaacaaaacgaaaagatg
gggttattccttaaattttatgggatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaatta
agcaatgttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggtttc
gctgctccttttacccaatgtggttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttacttt
ctcgccaacttataaggcctttctctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgcc
aagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcct
ctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactgacaa
ttctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgt
cctttgtttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctatcgcccccttctc
cgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccg
tgtgcacttcgcttcacctctgcacgttacatggaaaccgccatga
>gnl|hbvcds|KF779233_P_P-G Feature FT:CDS KF779233_P_P-G of [Viruses] Hepatitis B Virus genotype G (isolate DEN6090). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2529 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcacagtaaatgagaaacgaagatt
aaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagacaaaggtatcaaaccgtattatc
cagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacagcatggggctttcttggacgg
tccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatcaccagttggacccagcattc
agagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaaggtaggagttgg
agcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtctcagggcacactaacaactt
tgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccatctctccaccactaagagac
agtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtattt
tcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccagga
ttggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgt
gtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcc
tgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccat
catcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaa
catcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaag
atggggttattccttaaattttatgggatatgtaattggaagttggggtactttgccacaagaacacatcacaaagaaaa
ttaagcaatgttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggt
ttcgctgctccttttacccaatgtggttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttac
tttctcgccaacttataaggcctttctctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgt
gccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactga
caattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtgctgccaactggatccttcgcggga
cgtcctttgtttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccctt
ctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgttacatggaaaccgccatga
>gnl|hbvcds|KF779235_P_P-G Feature FT:CDS KF779235_P_P-G of [Viruses] Hepatitis B Virus genotype G (isolate DEN6106). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2529 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatcttcagcttcccaatgttagtattccttggactc
acaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcacagtaaatgagaaacgaagatt
aaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagacaaaggtatcaaaccgtattatc
cagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacagcatggggctttcttggacgg
tccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatcaccagttggacccagcattc
agagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaaggtaggagttgg
agcctacggacccgggttcacccctccacacggaggccttttggggtggagccctcagtctcagggcacactaacaactt
tgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccatctctccaccactaagagac
agtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtattt
tcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccagga
ttggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgt
gtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcc
tgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccat
catcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaa
catcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaag
atggggttattccttaaattttatgggatatgtaattggaagttggggtactttgccacaagaacacatcacaaagaaaa
ttaagcaatgttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggt
ttcgctgctccttttacccaatgtggttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttac
tttctcgccaacttataaggcctttctctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgt
gccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactga
caattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtgctgccaactggatccttcgcggga
cgtcctttgtttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccctt
ctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgttacatggaaaccgccatga
>gnl|hbvcds|KF779267_P_P-G Feature FT:CDS KF779267_P_P-G of [Viruses] Hepatitis B Virus genotype G (isolate JFA3956). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2529 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtctcctcgaagaagaactccctcg
cctcgcagagccttctcccaatagccgcgtcgcagaagatctgcatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcacagtaaatgagaaacgaagatt
aaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagacaaaggtatcaaaccgtattatc
cagagaatgtagttaatcattacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacagcatggggctttcttggacgg
tccctctcgagtggggaaagaacctttccaccagcaatcctctgggattctttcccgatcaccagttggacccagccttc
agagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaaggtaggagttgg
agcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtctcagggcacactaacaactt
tgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccatctctccaccactaagagac
agtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtattt
tcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccagga
ttggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgt
gtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcc
tgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacagaaattgcacctgtattcccatcccat
catcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaa
catcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaag
atggggttattccttaaattttatgggatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaa
ttaagcaatgttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggt
ttcgctgctccttttacccaatgtggttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttac
tttctcgccaacttataaggcctttctctgtaaacaatacaggaacctttaccccgttgctaggcaacggcccggtctgt
gccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactga
caattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtgctgccaactggatccttcgcggga
cgtcctttgtttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccctt
ctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcaccaagtcatgttacatggaaaccgccatga
>gnl|hbvcds|KF779357_P_P-G Feature FT:CDS KF779357_P_P-G of [Viruses] Hepatitis B Virus genotype G (isolate PNF5187). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2529 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcacagtaaatgagaaacgaagatt
aaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagacaaaggtatcaaaccgtattatc
cagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacagcatggggctttcttggacgg
tccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatcaccagttggacccagcattc
agagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaaggtaggagttgg
agcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtctcagggcacactaacaactt
tgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccatctctccaccactaagagac
agtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtattt
tcctgctggtggctccagttcagggatagtgaaccctgttccgaatattgcctctcacatctcgtcaatcttctccagga
ttggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtatttc
gtgttgacaagattcttcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgt
gtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcc
tgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccat
catcttgggctttcgcaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgtt
cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaa
catcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaag
atggggttattccttaaattttatgggatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaa
ttaagcaatgttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggt
ttcgctgctccttttacccaatgtggttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttac
tttctcgccaacttataaggcctttctctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgt
gccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggatctcagagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactga
caattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtgctgccaactggatccttcgcggga
cgtcctttgtttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccctt
ctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgttacatggaaaccgccatga
>gnl|hbvcds|KJ194508_P_P-G Feature FT:CDS KJ194508_P_P-G of [Viruses] Hepatitis B Virus genotype G (isolate HBV_Amsterdam_2_1994). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcacagtaaatgagaaacgaagatt
aaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagacaaaggtatcaaaccgtattatc
cagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacagcatggggctttcttggacgg
tccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatcaccagttggacccagcattc
agagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaaggtaggagttgg
agcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtctcagggcacactaacaactt
tgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccatctctccaccactaagagac
agtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtattt
tcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccagga
ttggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgt
gtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcc
tgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccat
catcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaa
catcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaag
atggggttattccttaaattttatgggatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaa
ttaagcaatgttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggt
ttcgctgctccttttacccaatgtggttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttac
tttctcgccaacttataaggcctttctctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgt
gccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactga
caattctgtcgtcctttctcggaaatatacatcctttccctggctgctaggctgtgctgccaactggatccttcgcggga
cgtcctttgtttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccctt
ctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgttacatggaaaccgccatga
>gnl|hbvcds|KM998716_P_P-G Feature FT:CDS KM998716_P_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgccgaagatctgcatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcacagtaaatgagaaacgaagatt
aaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagacaaaggtatcaaaccgtattatc
cagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacagcatggggctttcttggacgg
tccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatcaccagttggacccagcattc
agagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaaggtaggagttgg
agcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtctcagggcacactaacaactt
tgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccatctctccaccactaagagac
agtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtatct
tcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccagga
ttggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgt
gtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcc
tgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccat
catcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaa
catcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaag
atggggttattccttaaattttatgggatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaa
ttaagcaatgttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggt
ttcgctgctccttttacccaatgtggttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttac
tttctcgccaacttataaggcctttctctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgt
gccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactga
caattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtgctgccaactggatccttcgcggga
cgtcctttgtttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccctt
ctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgttacatggaaaccgccatga
>gnl|hbvcds|KR230749_P_P-G Feature FT:CDS KR230749_P_P-G of [Viruses] Hepatitis B Virus genotype G (isolate ENDV06GG). Complete genome. [Hepadnaviridae] (length=2517 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcacagtaaatgagaaacaactagt
tatgcctgccagatttttcccaaactctactaaatatttaccattagacaaaggtatcaagtattacccagaaaatgtag
ttaatcattacttccagaccagacattatttacataccctttggaaggcgggtattctatataagagagaaacatcccgt
agcgcttcattttgtgggtcaccatatacttgggaacaagatctacagcatggggctttcttggacggtccctctcgagt
ggggaaagaacctttccaccagcaatcctctaggattccttcccgatcaccagttggacccagcattcagagcaaatacc
aacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaaggtaggagttggagcctatggacc
cgggttcacccctccacacggaggccttttggggtggagccctcagtctcagggcacactaacaactttgccagcagatc
cgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccatctctccaccactaagagacagtcatcctcag
gccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtattttcctgctggtgg
ctccagttcagggatagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccaggattggggaccctg
caccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcgggggttttcttgttgacaaga
atcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcct
aaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgc
ggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttg
cccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaa
ctctatgtatccctcatgttgctgtacaaaaccttcggacagaaattgcacctgtattcccatcccatcatcttgggctt
tcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgta
gggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtcc
ctttataccgctgttaccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaagatggggttattc
cttaaattttatgggatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatgtt
ttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggtttcgctgctcct
tttacccaatgtggttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctcgccaac
ttataaggcctttctctgtaaacaatacaggaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtttg
ctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatc
catactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactgacaattctgtcgt
cctttctcggaaatatacatcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgttt
acgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccg
ttcctgccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcactt
cgcttcacctctgcacgttacatggaaaccgccatga
>gnl|hbvcds|KX264500_P_P-G Feature FT:CDS KX264500_P_P-G of [Viruses] Hepatitis B Virus genotype G (isolate G-aej). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcacagtaaatgagaaacgaagatt
aaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagacaaaggtatcaaaccgtattatc
cagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacagcatggggctttcttggacgg
tccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatcaccagttggacccagcattc
agagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaaggtaggagttgg
agcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtctcagggcacactaacaactt
tgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccatctctccaccactaagagac
agtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtattt
tcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccagga
ttggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgt
gtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcc
tgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccat
catcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaa
catcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaag
atggggttattccttaaattttatgggatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaa
ttaagcaatgttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggt
ttcgctgctccttttacccaatgtggttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttac
tttctcgccaacttataaggcctttctctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgt
gccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactga
caattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtgctgccaactggatccttcgcggga
cgtcctttgtttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccctt
ctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgttacatggaaaccgccatga
>gnl|hbvcds|KY004111_P_P-G Feature FT:CDS KY004111_P_P-G of [Viruses] Hepatitis B Virus genotype G (isolate M-2015). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctacatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctgattggcaaactccttcttttcca
aatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctcacagtaaatgagaaacgaagatt
aaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagacaaaggtatcaaaccgtattatc
cagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaaggcgggtattctatataagaga
gaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacagcatggggctttcttggacgg
tccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatcaccagttggacccagcattc
agagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaaggtaggagttgg
agcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtctcagggcacactaacaactt
tgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccatctctccaccactaagagac
agtcatcctcaggccatgcagtggaactctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtattt
tcctgctggtggctccagttcagggatagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccagga
ttggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgt
gtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcc
tgctcaaggcaactctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccat
catcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaa
catcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaag
atggggttattccttaaattttatgggatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaa
ttaagcaatgttttcggaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggt
ttcgctgctccttttacccaatgtggttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttac
tttctcgccaacttataaggcctttctctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgt
gccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactga
caattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtgctgccaactggatccttcgcggga
cgtcctttgtttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgtttggggctctgtcgccccctt
ctccgtctgccgttcctgccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgttacatggaaaccgccatga
© 1998-2020Legal notice