HBVdb

Dataset for nucleotide sequence PreC of genotype E

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* *   ****** ***  ****** ***  *   ** *  ***  * *  ****** * *  *  ** ********* **
ATGCAACTTTTTCACCTCTGCCTAATCATCTCTTGTTCATGTCCTACTGTTCAAGCCTCCAAGCTGTGCCTTGGGTGGCT
            g                               c                                   
                                                                                
                                                                                

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
** ** *****   * **     ** ***  ** ** *         *       *  ***   *     ** ** * **
TTgGGgCATGGACATTGACCCTTATAAAGAATTTGGAGCTaCTGTGGAGTTACTCTCGTTTTTGCCTTCTGACTTCTTTC
  a  a         c  t                     t c              t        gggc  t  t a  
                                                         a         aa           
                                                                   c            

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  **       *   *  *     *                 *    *   *  *          **     *       
CTTCAGTAAGAGATCTTCTAGATACCGCCTCaGCTCTGTATCGGGATGCCTTAGAATCTCCTGAgCATTGTTCACCtCAC
ag  ca tca       t     t     t   t c tc  a  a  t       t    a     ca    g  t
                               c     a                                          
                                                                                

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
          * * *          * ** *****  *  * *      *    **  **** **    **  *  * * 
CAcACtGCACTCAGGCAAGCCATTCTTTGCTGGGGgGAacTAATGACTCTAGCTACCTGGGTGGGTGtaAATTTGGAAGA
  t  g  ta a        ag  t g  t      ct t   taca   gc           g ct   ac c  
     a              t   a c           tg g      t                  g            
     c                                 a                                        

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *      *    **     *  *    ****  **   *      *               *  *  *  ** * **  
TCCAGCATCCAGGGACCTAGTaGTCAGTTATGTCAATACTAATATGGGCCTAAAGTTCAGGCAATTATTGTGGTTTCACA
c att    t  a  ttag   tg       t  c a c cg    at g  a  t  a   c           
    a    a     a  t   a                                                       
                                                                                

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  **     * *   * ** *        *      * *  *  ** ** *  ** *  ** **   ******       
TTTCTTGTCTCACTTTTGGAAGAGAAACcGTCaTAGAGTATTTGGTGTCTTTTGGAGTGTGGATTCGCACTCCTCCAGCT
  c  ca t tg  c      c tgtt  tg       c     a  c  c                     aacc  
                         c  a   t                                          tt   
                                c                                               

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
** ** **    ***********    **  *   *** **   *   *** *****              **** *   
TATAGACCACCAAATGCCCCTATCTTATCAACACTTCCGGAGAaTACTGTTGTTAGACGAAGAG------GCAGGTCCCC
  c       a             c             t  a c       a        c                   
                                           t                                    
                                                                                

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*  * ** *   * **** ***  *  **   *  **  *** *   **  *  *  * **  ***        *     
TAGAAGAAGAACTCCCTCGCCTCGCAGACGAAGATCTCAATCGCCGCGTCGCAGAAGATCTCAATCTCcaGctTCcCAAT
     c          a         c         a                       ggtaac tagc 
                                                                       g        
                                                                                

     
....:
     
GTTAG
     
     
     
© 1998-2020Legal notice