HBVdb

Dataset for nucleotide sequence PreC of genotype E

[Download (right click)] [Alignment] [Repertoires]

503 sequence(s)

>gnl|hbvcds|AB091255_PreC_P-E Feature FT:CDS AB091255_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate ABI-129). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggatctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB091256_PreC_P-E Feature FT:CDS AB091256_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate ABI-212). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacacagcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgttaatactaatatgggcctaaaattcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB106564_PreC_C-E Feature FT:CDS AB106564_PreC_C-E of [Viruses] Hepatitis B Virus genotype E (isolate HBV-GA325). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttgacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctctatcgggatgccttagaatctcctgagcattgctcacctcac
catactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
cccagcatccagagacctagtagtcagttatgtcaatactaatatgggactaaagttcaggcaattattgtggtttcaca
tttcttgtctcactttgggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcccactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
acgaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB194947_PreC_P-E Feature FT:CDS AB194947_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CMR954). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagttagttatgtcaatactaatatgggactaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaactgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tacagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatctccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB194948_PreC_P-E Feature FT:CDS AB194948_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CMR936). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccttataaagaatttggagcttctgtggacttactctcgtttttgcctgccgacttctttc
cttcagtaagagatcttctagatactgcctcagctctgtatcgggatgccttagaatctcatgagcattgttcaccgcac
cacactgcactcaggcaagccatactttgctggggggacctaatgtctctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtggtcagttatgtcaatactaatatgggcctaaaattcaggcaattattgtggtttcaca
tttcttgtctcactttcggaagagacaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccacaaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB201287_PreC_P-E Feature FT:CDS AB201287_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Benin11). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttctcctcac
catacagcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggactaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaactgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB201288_PreC_P-E Feature FT:CDS AB201288_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Benin89). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcggttagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacacggcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggatctggtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaacagtcctagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB201289_PreC_P-E Feature FT:CDS AB201289_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Benin269). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggactaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB201290_PreC_P-E Feature FT:CDS AB201290_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Benin293). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgccctcaggcaagtcattctttgctggggagacctaatgactctagctacctgggtgggtgtaaatttggacga
tccagcatcaagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgttatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB205129_PreC_P-E Feature FT:CDS AB205129_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HBV-G758-2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccgtctgacttctttc
cgtcagttagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB205188_PreC_P-E Feature FT:CDS AB205188_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HBV-GA283). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgagatgccttggaatctcctgagcattgttcacctcac
catactgcactcaggcaggccattctttgctggggggacctaatgaatctaggtacctgggtgggtggaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagataccgtcgtagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccacccaatgcccctatcgtatcaacacttcccgagaatactgttgttagacgaagaagcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB205189_PreC_P-E Feature FT:CDS AB205189_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HBV-G138). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccccac
cacacggcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaactgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aaggactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB205190_PreC_P-E Feature FT:CDS AB205190_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HBV-G123). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagttagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacacggcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tcaagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaactgttatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB205191_PreC_P-E Feature FT:CDS AB205191_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HBV-G166). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttccgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccccac
cacacggcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgttaatactaatatgggcctaaaattcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB205192_PreC_P-E Feature FT:CDS AB205192_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HBV-G758). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccgtctgacttctttc
cgtcagttagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB219529_PreC_P-E Feature FT:CDS AB219529_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate UK1). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcctgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccttataaagaatttggagctactttgcagttactctcgtttttgcctggtgatttctttc
cttcagtaagagatcttctagataccgcctcagctctgtttcgggatgccttagaatctcctgagcattgtacccctcac
catactgcgctcaggcaagtcattctttgctggggagacctaatgaatctagctacctgggtgggtggaaatttgcaaga
tccagcatccagggatctagtagtcaattatgtcaatattaatatgggactaaagttcaggcaattattgtggttccaca
tttcttgtctcacttttggaagagaaaccgttacagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB219533_PreC_P-E Feature FT:CDS AB219533_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate UK5). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcctactgatttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatcttctcagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggatataatgactatagctacntgggtgggtgtgaatttgcaaga
tcaagaatccagggacctagtagtcagttatgtcaatactaatatgggactaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaatcgttattgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB219534_PreC_P-E Feature FT:CDS AB219534_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate UK6). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcctactgacttctttc
cttccgtaagagatcttctagataccgcctccgctctgtttcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggagaattaatgtctctagctacctgggtgggtgcaaatttgcaaga
tccagcatccagggaccaagtagtcacttatgtgaatactaatatgggcacaaagttcaggcaattattgtggtttcaca
tttcgtgtatcacttttggaagggaaattgtcgtagagtatttggtgtcttttggagtgtggattcgcactcctccacct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttattagatgcggaggcaggacctctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccgatgctag
>gnl|hbvcds|AB274969_PreC_P-E Feature FT:CDS AB274969_PreC_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatctgctagataccgcctcagctctgtatcgggatgcattagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcata
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB274970_PreC_P-E Feature FT:CDS AB274970_PreC_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgctcacctcac
catactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tcctgcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcacctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB274971_PreC_P-E Feature FT:CDS AB274971_PreC_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB274972_PreC_P-E Feature FT:CDS AB274972_PreC_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcagggaagcgattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggactaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB274973_PreC_P-E Feature FT:CDS AB274973_PreC_P-E of [Viruses] Hepatitis B Virus genotype E. Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaaaagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggacctaatgaatctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgttatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB274974_PreC_P-E Feature FT:CDS AB274974_PreC_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaactgtcatagagtatttggtatcttttggagtctggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB274975_PreC_P-E Feature FT:CDS AB274975_PreC_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcctgttgacttctatc
cttcagtaagagatcttctagataccgcctcagctctgtttcgggatgccttacaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggacgtaatgaatctagctacctgggtgggtgcaaatttggaaga
tccagcatccagggacctagtagtcggttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcata
tttcttgtctcacttttggaagagaaaccgtcgtagagtatttggtctcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctaaatcgccgagtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB274976_PreC_P-E Feature FT:CDS AB274976_PreC_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggatattgacccttataaagaatttggagctactgtggagttgctctcgtttttgcctactgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctcagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccatcatccagggacctagtagtcggttatgtcaatagtaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaatcgtcctagagtttttggtgtcttttggagtgtggattcgcactcctccacct
tatagaccaccaaatgcccctatcttatcaacacttccggagattactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB274977_PreC_P-E Feature FT:CDS AB274977_PreC_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagctactgtagagttactctcgtttttgcctactgacttctttc
cttcagtaagagatcttctagataccgcctcagctttgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactttagctacctgggtgggtgcaaatttggaaga
tccagcatcccgggacctagtagtcagttatgtcaataataatatgggcctaaagttcaggcaattattgtggtttcaca
cttcttgtatcacttttggaagagatatcgtcttagagtatttggtgtcttttggagtgtggatacgcactcctccacct
tatagaccagcaaatgcccctatcttatcaacacttccggagactactgttcttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB274978_PreC_P-E Feature FT:CDS AB274978_PreC_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtaccgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactcatatgggcctaaagttcaggcaattattgtggtttcata
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB274979_PreC_P-E Feature FT:CDS AB274979_PreC_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccttataaagaatttggagcgactgtgcagttactctcgtttttgcctggtgaattctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggaagccttagaatctcctgagcattgtacacctcat
cacacggcactcaggcaagccattctttgctggggggaactaatgacactagctacttgggtgggtgtaaatttggaaga
tccatcatccagggacctagtagtcagttatgtcaatgataatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagacgtcgttctagagtttttggtgtcttttggagtgtggattcgcactcctccacct
tatagaccaccaaatgcccctatcttatcaacacttccggagattactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB274980_PreC_P-E Feature FT:CDS AB274980_PreC_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcctgctgacttctwtc
cgtcagtaaaagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcat
catactgcactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggtgaaaatttggaaga
tccagcatccagggacctcgtagtcagttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgccgaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB274981_PreC_P-E Feature FT:CDS AB274981_PreC_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagctactgtcgagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctttgtttcgggatgccttagaatctccagagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggactaaagttcaggcaattattgtggtttcata
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccactaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcacaatgttag
>gnl|hbvcds|AB274982_PreC_P-E Feature FT:CDS AB274982_PreC_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcatagttcaccgcat
cacactgcactcaggcaagccattctttgctggggggacttaatgtctctagctacctgggtgggtgcaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctaacttttggaagagaaacagtcatagagtatttggtgtcttttggagtgtggattcgcactcctacagct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcacaatgttag
>gnl|hbvcds|AB274984_PreC_P-E Feature FT:CDS AB274984_PreC_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcctgctgacttctatc
cttcagtaaaagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggacctaatgaatctagctacctgggtgggtgttaatttggaaga
tcaagcatccagggacctagtagtcagttatgtcaatactaatatgggcctgaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcgtagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccgatgttag
>gnl|hbvcds|AB274985_PreC_P-E Feature FT:CDS AB274985_PreC_P-E of [Viruses] Hepatitis B Virus genotype E. Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggagttaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
cttcttgtatcacttttggaagagaaaccgtcgtagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccactgttag
>gnl|hbvcds|AB915175_PreC_P-E Feature FT:CDS AB915175_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SA1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggactaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB915178_PreC_P-E Feature FT:CDS AB915178_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SA4). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccatagaatctccggagcattgttcacctcac
cacacggcactcaggcaagccattatttgctggggagacctaatgtctctagctacctgggtgggtgaaaatttgcaaga
tcaagcatccagggacctggtagtaagttatgtcaacactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcttagagtatttggtgtcctttggagtgtggattcgcactcctcaagct
tatagaccactaaatgcccctatcttatcaacacttcctgagactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB915180_PreC_P-E Feature FT:CDS AB915180_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SA6). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcacctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgatccttataaagaatttggagctactgtggagttaatctcgtttttgcctagtgacttctttc
cttckgtacgagatctactagataccgcctcagctctgtttcgggatgccttagaatcttctgagcattgctcacctcac
cacactgcactcaggcaagccgttctttgctggggggatataatgaatatagctacctgggtgggtgcaaatttggaaga
tccagcatccagggaactagtagtaagttatgtcaatactaacatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcg
tacagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgcaaaagatctcaatctcgaggtgcccaatgttag
>gnl|hbvcds|AF350099_PreC_P-E Feature FT:CDS AF350099_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam4102). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350100_PreC_P-E Feature FT:CDS AF350100_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam4125). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgctctcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350101_PreC_P-E Feature FT:CDS AF350101_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam4527). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatccagggacctagttgtcagttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgccatagagtatttggtgtcttttggagtgtggattcgcactcctcaagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350102_PreC_P-E Feature FT:CDS AF350102_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam4537). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350103_PreC_P-E Feature FT:CDS AF350103_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam4531). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttcttgataccgcctccgctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggggtaaatttggaaga
tccagcatccagggatctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350104_PreC_P-E Feature FT:CDS AF350104_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam4579). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350105_PreC_P-E Feature FT:CDS AF350105_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam4550). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgaggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttcttgataccgcctccgctctgtatcgggatgccttagaatctcctgagcatcgttcaccgcac
cacactgcactcaggcaagccatactttgctggggggaactaatgactctagctacctgggtgggggtaaatttggaaga
tccagcatccaaggatctagtagtcagttatgctaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350106_PreC_P-E Feature FT:CDS AF350106_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam4607). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttctgtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagctattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350107_PreC_P-E Feature FT:CDS AF350107_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam4625). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttcttgataccgcctccgctctgtatcgggatgccttagaatctcctgagcattgttcaccgaac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggggtaaatttggaaga
tccagcatccagggatttagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350108_PreC_P-E Feature FT:CDS AF350108_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam4628). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350109_PreC_P-E Feature FT:CDS AF350109_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam4640). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttcttgataccgcctccgctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggggtaaatttggaaga
tccagcatccagggatctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaacccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350110_PreC_P-E Feature FT:CDS AF350110_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam4644). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgtacaccgcac
cacactgcactcaggcaagccattctgtgctggggggacctaatgagtctagctacctgggtgggtgttaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcata
tttcttgtctcacttttggaagacaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350111_PreC_P-E Feature FT:CDS AF350111_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam4539). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatccagggacctagttgtcagttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcaagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggccccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350112_PreC_P-E Feature FT:CDS AF350112_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam4618). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagatactctcgtttttgccttctgacttctttc
cttcagtaagagatcttcttgataccgcctccgctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggggtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350113_PreC_P-E Feature FT:CDS AF350113_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam4690). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgactcttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cgtcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350114_PreC_P-E Feature FT:CDS AF350114_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam4697). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctctgctctgtatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtctttcggagtgtgtattcgcactcctccagct
tatagaccgcccaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350115_PreC_P-E Feature FT:CDS AF350115_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1001F1). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgaggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350116_PreC_P-E Feature FT:CDS AF350116_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1002F1). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350117_PreC_P-E Feature FT:CDS AF350117_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1003F1). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagccactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtttcgggatgccttagaatctcctgagcatggttcaccgcac
cacactgcactcaggcaagccatactttgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagataccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcaagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350118_PreC_P-E Feature FT:CDS AF350118_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1011F5). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacatgggtgggtgttaatttggaaga
tccagcatccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350119_PreC_P-E Feature FT:CDS AF350119_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1013F5). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350120_PreC_P-E Feature FT:CDS AF350120_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1073F18). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctatatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatccagggacctagtagtcagttatgttaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350121_PreC_P-E Feature FT:CDS AF350121_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1074F18). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctatatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatccagggacctagtagtcagttatgttaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350122_PreC_P-E Feature FT:CDS AF350122_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1076F18). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctttgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgctctcaggcaagccattctttgctggggggaattaatgactctagccacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcccccagct
tatagaccaccaaatgcccctatcctatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350123_PreC_P-E Feature FT:CDS AF350123_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1081F20). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagccttcaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggaagccttagaatctcctgagcattgttcacggcac
cacattgcactcaggcaagctattctttgctggggggaactgatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagtttaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350124_PreC_P-E Feature FT:CDS AF350124_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1099F18). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctatatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350125_PreC_P-E Feature FT:CDS AF350125_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1100F20). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctttgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacacggctctcaggcaagccattctttgctggggggaattaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350126_PreC_P-E Feature FT:CDS AF350126_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1115). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttttttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgctcacctcac
catactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tcctgcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcacctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350127_PreC_P-E Feature FT:CDS AF350127_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1119F29). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagttcgagatcttctagatactgcctcagctctgtaccgggatgccttagaatctcctgagcattgctcacctcac
catacagcactaaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaacatgggcctaaagttcaggcaattattgtggtttcaca
tttcctgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tacagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350128_PreC_P-E Feature FT:CDS AF350128_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1121F29). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtacgagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcagacaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350130_PreC_P-E Feature FT:CDS AF350130_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1127F28). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctttgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacacggctctcaggcaagccattctttgctggggggaattaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcccccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350131_PreC_P-E Feature FT:CDS AF350131_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1129). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtgagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacacggctctcaggcaagccattctttgctggggggaattaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattagcactcccccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350132_PreC_P-E Feature FT:CDS AF350132_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1131F31). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctttgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacacggctctcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatcaagagacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggggtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350133_PreC_P-E Feature FT:CDS AF350133_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1132F31). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctttgtatcgggatgccttagaatctcctgagcattgttcaccgcac
catacggctctcaggcaagccattctttgctggggggaattaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaacatgggcctaaagttcaggcaattattgtggtttcaca
tttcctgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350134_PreC_P-E Feature FT:CDS AF350134_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1135F31). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactcttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgttcgagatctcctagatactgcctcagctctgtaccgggatgccttagaatctcctgagcattgctcacctcac
catacagcactaaggcaagctattctctgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaacatgggcctaaagttcaggcaattattgtggtttcata
tttcctgccttacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tacagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350135_PreC_P-E Feature FT:CDS AF350135_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1136F31). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactcttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgttcgagatctcctagatactgcctcagctctgtaccgggatgccttagaatctcctgagcattgctcacctcac
catacagcactaaggcaagctattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaacatgggcctaaagttcaggcaattattgtggtttcata
tttcctgccttacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tacagaccaccaaatgcccctatcttatcaacacttccggagaatattgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350136_PreC_P-E Feature FT:CDS AF350136_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1139). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtacgagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatccagagacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctacagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350137_PreC_P-E Feature FT:CDS AF350137_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1142F33). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgaggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttcttgataccgcctccgctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggggtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350138_PreC_P-E Feature FT:CDS AF350138_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1143F33). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350139_PreC_P-E Feature FT:CDS AF350139_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1145F33). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactcttcaagcctgcaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgttcgagatctcctagatactgcctcagctctgtaccgggatgccttagaatctcctgagcattgctcacctcac
catacagcacttaggcaagctattctttgctggggggaactaatgactctagctacctgggtgggtgtgaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaacatgggcctaaagttcaggcaattattgtggtttcata
tttcctgcctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tacagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350140_PreC_P-E Feature FT:CDS AF350140_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1149F34). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacatcgacccttataaagaatttggagctacagtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttagaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350141_PreC_P-E Feature FT:CDS AF350141_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1152F34). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacatcgacccttataaagaatttggagctacagtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttagaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350142_PreC_P-E Feature FT:CDS AF350142_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1157F35). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctttgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggaactaatgactctagccacctgggtgggtgtaaatttggaaga
tccagcatccagagacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcaagct
tatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350143_PreC_P-E Feature FT:CDS AF350143_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1158F35). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctttgtatcgggatgctttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggaactaatgactctagccacctgggtgggtgtaaatttggaaga
tccagcatccagagacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcctatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350144_PreC_P-E Feature FT:CDS AF350144_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1159F36). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggacttaatgtctctaggtacctgggtgggtggtaatttggaaga
tcaagcatccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcaagct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350145_PreC_P-E Feature FT:CDS AF350145_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1162F36). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagctactgtgcagttactctcgtttttgccttctgacttctttc
cgtcagtaagagatcttctagataccgcctcagctctgtttcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaattaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatccagagacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcgtagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350146_PreC_P-E Feature FT:CDS AF350146_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1167). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgagatgccttagaatctcctgagcattgttcaccttac
cacacggcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacttagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattgttgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350147_PreC_P-E Feature FT:CDS AF350147_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1175F40). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatccagagacctagtagtcagttatgttaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350148_PreC_P-E Feature FT:CDS AF350148_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1179F42). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctatatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatccagggacctagtagtcagttatgttaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350149_PreC_P-E Feature FT:CDS AF350149_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1181F41). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagctattctttgctggggggaactgatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagtttaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaaggggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350150_PreC_P-E Feature FT:CDS AF350150_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1182F41). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350151_PreC_P-E Feature FT:CDS AF350151_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1184F41). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgctcacctcac
catactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggatctagtagtcagttatgtcaatactaatatgggcctaaaattcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350152_PreC_P-E Feature FT:CDS AF350152_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1187F42). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttccgacttctttc
cttcagtaagagatcttctagataccgcctcagctctatatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatccagggacctagtagtcagttatgttaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350153_PreC_P-E Feature FT:CDS AF350153_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1194). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtacgagatctcctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcacttaggcaagccattctttgctggggggaattaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcactattggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatctcatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350154_PreC_P-E Feature FT:CDS AF350154_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1208). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagtcactctcgtttctgccttctgacttctttc
cttcagtacgagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaaga
tcctgcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350155_PreC_P-E Feature FT:CDS AF350155_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1211). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
catacggctctcaggcaagccattctttgctggggggaattaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350156_PreC_P-E Feature FT:CDS AF350156_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1246F53). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgttaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350157_PreC_P-E Feature FT:CDS AF350157_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1247F53). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatccagggacctagtagtcagttatgttaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350158_PreC_P-E Feature FT:CDS AF350158_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1249F53). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatccagggacctagtagtcagttatgttaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagtactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350159_PreC_P-E Feature FT:CDS AF350159_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1285). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagatactgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcat
cacactgcactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatccagggacttagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagataccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350160_PreC_P-E Feature FT:CDS AF350160_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1288F61). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagatactgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcat
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatccagggacttagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagataccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350161_PreC_P-E Feature FT:CDS AF350161_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1307). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttaacctttgcctaatcatctgttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagttcgagatcttctagatactgcctcagctctgtatcgggatgccttagaatctcctgagcattgctcacctcac
catacagcactaaagcaagctattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaacatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgcctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350162_PreC_P-E Feature FT:CDS AF350162_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1325F81). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350163_PreC_P-E Feature FT:CDS AF350163_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1326F81). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350164_PreC_P-E Feature FT:CDS AF350164_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1327F81). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgttcgagatcttctagatactgcctcagctctgtatcgggatgccttagaatctcctgagcattgctcacctcac
catacagcactcaggcaagctattctctgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaacatgggcctaaagttcaggcaattattgtggtttcaca
tttcctgcctcacttttggaagagaaaccgtcatagagtattcggtgtcttttggagtgtggattcgcactcctccagct
tacagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350165_PreC_P-E Feature FT:CDS AF350165_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1328F82). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggatccgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350166_PreC_P-E Feature FT:CDS AF350166_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1331). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggggttaatttggaaga
tccagcatccagagacctagttgtcagttatgtcaatactaatatgggcctgaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagataccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350167_PreC_P-E Feature FT:CDS AF350167_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1348F82). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgttcgagatctcctagatactgcctcagctctgtaccgggatgccttagaatctcctgagcattgctcacctcac
catacagcactaaggcaagctattctctgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaacatgggcctaaagttcaggcaattattgtggtttcata
tttcctgccttacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tacagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtggcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350168_PreC_P-E Feature FT:CDS AF350168_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1349F90). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgactcttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagggatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgctctcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaaga
tccatcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagtttaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaagtcgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350169_PreC_P-E Feature FT:CDS AF350169_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1352F90). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtacgagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catacagctctcaggcaagccattctttgctggggggaattaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350170_PreC_P-E Feature FT:CDS AF350170_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1353F89). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagtttaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350171_PreC_P-E Feature FT:CDS AF350171_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1374). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcttcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350172_PreC_P-E Feature FT:CDS AF350172_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1376). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcat
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaactattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcctatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350173_PreC_P-E Feature FT:CDS AF350173_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1442). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatccagggacctagtagtcagttatgttaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatactatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgcggcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350174_PreC_P-E Feature FT:CDS AF350174_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1444). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350175_PreC_P-E Feature FT:CDS AF350175_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1453). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttcttgataccgcctccgctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattgtttgctggggggatataatgactctagctacctgggtgggggtaaatttggaaga
tccagcatccagggacctggtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350176_PreC_P-E Feature FT:CDS AF350176_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1456). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttcttgataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccgttctttgctggggggacttaatgtctctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggatctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagacaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350177_PreC_P-E Feature FT:CDS AF350177_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1461). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgagatgccttagaatctcctgagcattgttcacctcac
cacacggcactcaggcaagccattctttgctggggggatctaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattgttgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgcagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350178_PreC_P-E Feature FT:CDS AF350178_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1482F89). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagtttaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350179_PreC_P-E Feature FT:CDS AF350179_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1520). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagttagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350180_PreC_P-E Feature FT:CDS AF350180_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1522F137). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgctttagaatctcctgagcattgttctccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggggtaaatttggaaga
tccagcacccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350181_PreC_P-E Feature FT:CDS AF350181_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1524F137). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgctttagaatctcctgagcattgttctccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggggtaaatttggaaga
tccagcatcaagagacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggggtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350182_PreC_P-E Feature FT:CDS AF350182_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1525F137). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgctttagaatctcctgagcattgttctccgcac
cacactgcactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagtttaggcaattattgtggtttcaca
tttcttgtctcactttcggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350183_PreC_P-E Feature FT:CDS AF350183_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1535). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatccagggacttagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagataccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350184_PreC_P-E Feature FT:CDS AF350184_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1540). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgagatgccttggaatctcctgagcattgttcacctcat
catactgcactcaggcatgccgttctttgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcaagct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350185_PreC_P-E Feature FT:CDS AF350185_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1557F61). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagatactgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcat
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350186_PreC_P-E Feature FT:CDS AF350186_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1560). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcacctcac
cacacggcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350187_PreC_P-E Feature FT:CDS AF350187_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1577). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagcttctgtggagttactctcctttttgccttctgacttctttc
cttccataagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcaatcaggcaagccattctttgctggggggaattaatgaatctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaatttctgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcctagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350188_PreC_P-E Feature FT:CDS AF350188_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1590). Partial genome (Contains: HBe, HBc, HBx). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgagatgccttagaatctcctgagcattgttcacctcac
cacacggcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattgttgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcataagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350189_PreC_P-E Feature FT:CDS AF350189_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1594). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcac
catactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagtttaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350190_PreC_P-E Feature FT:CDS AF350190_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1615). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctttgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacacggctctcaggcaagccattctttgctggggggaattaatgactctagccacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcagacaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcccccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350191_PreC_P-E Feature FT:CDS AF350191_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1654F172). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatccagggacctagttgtcagttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcaagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350192_PreC_P-E Feature FT:CDS AF350192_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1660F173). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350193_PreC_P-E Feature FT:CDS AF350193_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1664F174). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350194_PreC_P-E Feature FT:CDS AF350194_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1665F174). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350195_PreC_P-E Feature FT:CDS AF350195_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1670F172). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350196_PreC_P-E Feature FT:CDS AF350196_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1676F174). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350197_PreC_P-E Feature FT:CDS AF350197_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1678). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagccactgtggagttactctcgtttttgccttctgacttctttc
cgtcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaattaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350198_PreC_P-E Feature FT:CDS AF350198_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1682). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagttcgagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcacctcac
catactgcactaaggcaagctattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350199_PreC_P-E Feature FT:CDS AF350199_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1691). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcacctcac
catactgcactaaggcaagctattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350200_PreC_P-E Feature FT:CDS AF350200_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1713). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350201_PreC_P-E Feature FT:CDS AF350201_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1720). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaactattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350202_PreC_P-E Feature FT:CDS AF350202_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1722). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatgtgggcctaaagttcaggcaactattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctacagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350203_PreC_P-E Feature FT:CDS AF350203_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1729F202). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctttgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgctctcaggcaagccattctgtgctggggggacctaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgttatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350204_PreC_P-E Feature FT:CDS AF350204_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1741F173). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcat
cacactgcactcaggcaagccattctttgctggggggacctaatgagtctagctacctgggtgggtgttaatttggaaga
tccagcatccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350205_PreC_P-E Feature FT:CDS AF350205_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1821F217). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgagatgccttagaatctcctgagcattgttcacctcac
cacacggcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattgttgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350206_PreC_P-E Feature FT:CDS AF350206_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1822F217). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgagatgccttagaatctcctgagcattgttcacctcac
cacacggcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattgttgtggtttcaca
tttcttgtgtcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccaggt
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350207_PreC_P-E Feature FT:CDS AF350207_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1824F218). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctttgtatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggacttaataactctatctacctgggtgggtgctaatttggaaga
tccagcatccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350208_PreC_P-E Feature FT:CDS AF350208_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1825F218). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcctaatgacttctttc
cttcagtaagagatcttctagataccgcctcagctttgtatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgctaatttggaaga
tccagcatccagggacctagttgtcagttatgtcaatactcatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaatcgtcttagagtatttggtgtcttttggagtgtggattcgcactcctccacct
tatagaccaccaaatgcccctatcttatcatcacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350209_PreC_P-E Feature FT:CDS AF350209_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1827F218). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctttgtatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggacctaatgtctctagctacctgggtgggtgttaatttggaaga
tccagcatccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350210_PreC_P-E Feature FT:CDS AF350210_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1828F219). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgagatgccttagaatctcctgaacattgttcacctcac
cacacggcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggatctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattgttgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tacagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350211_PreC_P-E Feature FT:CDS AF350211_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1831F219). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttggaatctcctcaacatcattcaccacac
cacactgcactcaggcaagccattctttgctggggggacctaatgtctctagctacctgggtgggtgttaatttggaaga
tccagcatccagggacctagtagtcagttatgttaatactaatatgggcctaaagtttaggcaattattgtggtttcaca
tttcttgcctcacttttggaagagataccgtcttagagtatttggtgtcttttggagtgtggattcgcactcctccacct
tatagaccaccaaatgcccctatcttatcaacacttccggaaattactgttgttagacgaagaggcaggtcccctagaag
aagaaatccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350212_PreC_P-E Feature FT:CDS AF350212_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1833F217). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgagatgccttagaatctcctgagcattgttcacctcac
cacacggcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattgttgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350213_PreC_P-E Feature FT:CDS AF350213_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1834F217). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgagatgccttagaatctcctgagcattgttcacctcac
cacacggcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattgttgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350214_PreC_P-E Feature FT:CDS AF350214_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1842). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgctcacctcac
catactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tcctgcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350215_PreC_P-E Feature FT:CDS AF350215_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1847). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgttttggccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgctcacctcac
catactgcaatcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tcctgcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcacctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350216_PreC_P-E Feature FT:CDS AF350216_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1862F231). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctcgctacctgggtgggtgttaatttggaaga
tccagcttccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350217_PreC_P-E Feature FT:CDS AF350217_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1863F231). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctcgctacctgggtgggtgttaatttggaaga
tccagcttccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350218_PreC_P-E Feature FT:CDS AF350218_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1872). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttccgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggggttaatttggaaga
tccagcatccagagacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaataccgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350219_PreC_P-E Feature FT:CDS AF350219_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1874F238). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatcgcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggatctaatgactatagctacctgggtgggtgttaatttggaaga
tccagcatccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcagttattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggaaaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350220_PreC_P-E Feature FT:CDS AF350220_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1876F238). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatcgcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggatctaatgactatagctacctgggtgggtgttaatttggaaga
tccagcatccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcagttattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AM494689_PreC_P-E Feature FT:CDS AM494689_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR006). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatctacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494690_PreC_P-E Feature FT:CDS AM494690_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR008). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494691_PreC_P-E Feature FT:CDS AM494691_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR024). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacatcgacccttataaagagtttggagctactgtggagttactctcgtttttgcctaatgacttctttc
cttccgtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgctctcaggcaagctattctttgctggggggacctaatgactctagctacctgggtgggtgcaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtcttacttttggaagagaaaccgttatagagtatttggtgtcttttggagtgtggattcgcactcctcaagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttccaaatgttag
>gnl|hbvcds|AM494692_PreC_P-E Feature FT:CDS AM494692_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR026). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacatcgacccttataaagaatttggagcttctgtggatttactctcgtttttgccttctgacttctttc
cttcggttcgagatctcctagacactgccttagctctgtatcgggatgccttagagtctcctgagcattgctcacctcat
catacagcactcaggcaagcgattctttgctggggggaattaatgactctagctacctgggtgggtgcaaacttggaaga
tccagcatccagggacctagttgtcagttatgtcaatactaatatgggcttaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtatcttttggagtgtggattcgcactcctcaagct
tatagaccaccaaatgcccctatcttatcaacacttccggagattactgttgttagacgaagaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494693_PreC_P-E Feature FT:CDS AM494693_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR039). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494694_PreC_P-E Feature FT:CDS AM494694_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR047). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttccgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtggtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcactttcggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494695_PreC_P-E Feature FT:CDS AM494695_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR053). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccttataaagaatttggagcttctgttgagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctccgctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggagtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
cttcttgtatcacttttggaagagaaaccgtcgtagagtatttggtgtcttttggagtgtggattcgcactcctccagcg
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttattagacacagaggcaggtccactagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494696_PreC_P-E Feature FT:CDS AM494696_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR060). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttccgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtggtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcactttcggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494697_PreC_P-E Feature FT:CDS AM494697_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR063). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaacttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcagacaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494698_PreC_P-E Feature FT:CDS AM494698_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR066). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttttttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgctcacctcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggagtaaacttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcaagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494699_PreC_P-E Feature FT:CDS AM494699_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR082). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494700_PreC_P-E Feature FT:CDS AM494700_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR083). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttccgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtggtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcactttcggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494701_PreC_P-E Feature FT:CDS AM494701_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR097). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttttagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccgccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494702_PreC_P-E Feature FT:CDS AM494702_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR106). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatcgagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494703_PreC_P-E Feature FT:CDS AM494703_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR107). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggatgtaatgactctagccacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcggttatgtcaatactaatatgggactaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctaaaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccatcttcccaatgttag
>gnl|hbvcds|AM494704_PreC_P-E Feature FT:CDS AM494704_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR112). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494705_PreC_P-E Feature FT:CDS AM494705_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR115). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagctattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494706_PreC_P-E Feature FT:CDS AM494706_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR131). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttccggcaattgttgtggtttcaca
tttcttgtctcacttttggaagagaaaccgttatagagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494707_PreC_P-E Feature FT:CDS AM494707_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR137). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccgccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494708_PreC_P-E Feature FT:CDS AM494708_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR138). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494709_PreC_P-E Feature FT:CDS AM494709_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR143). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaacttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcttaaaattcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494710_PreC_P-E Feature FT:CDS AM494710_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR144). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaacttggaaga
tccagcatccagggacctagtagtcagttatgttaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcctgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494711_PreC_P-E Feature FT:CDS AM494711_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR146). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcat
cacactgcactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggtctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcaagct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494712_PreC_P-E Feature FT:CDS AM494712_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR150). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494713_PreC_P-E Feature FT:CDS AM494713_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR154). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatctagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494714_PreC_P-E Feature FT:CDS AM494714_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR165). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccttataaagaatttggagctagtgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggacttaatgaatctagctacctgggtgggtgtaaacttggaaga
tccagcatccagagacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccatcttcccaatgttag
>gnl|hbvcds|AM494715_PreC_P-E Feature FT:CDS AM494715_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR171). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494717_PreC_P-E Feature FT:CDS AM494717_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR187). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494791_PreC_P-E Feature FT:CDS AM494791_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR001-1). Partial genome (Contains: HBe, HBc, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgaccctcataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cgtccgtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattggtcacctcac
cactctgcaatcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaaattggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatttgggcctaaagttccagcaattgttgtggtttcaca
tttcttgtctcacttttggaagagaaaccgttatagagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tatagaccaccaaatgcccctatcttatcaacaattccggagaatactgttgttagacgaagaggcaggtcccctcgaag
aagaacttcctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccaggttcccaatgttag
>gnl|hbvcds|AY738144_PreC_P-E Feature FT:CDS AY738144_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate patient B, 7/98). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattttgtgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctctcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AY738145_PreC_C-E Feature FT:CDS AY738145_PreC_C-E of [Viruses] Hepatitis B Virus genotype E (isolate patient B, 7/98). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattttgtgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctctcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AY738146_PreC_P-E Feature FT:CDS AY738146_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate patient B, 7/98). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattttgtgctggggagaattaatgactctagctacctgggtgggcgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctctcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AY738147_PreC_P-E Feature FT:CDS AY738147_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate patient B, 10/98). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattttgtgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctctcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AY739674_PreC_P-E Feature FT:CDS AY739674_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate patient P2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctcgtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaacagtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcg
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AY739675_PreC_P-E Feature FT:CDS AY739675_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate patient P2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaaaagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctcgtagtcagttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaacagtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcg
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AY935700_PreC_P-E Feature FT:CDS AY935700_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate TH-HBV-012). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggagatgtaatgtctctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcggttatgtcaatactaatatgggcctaaagtttaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|DQ060822_PreC_P-E Feature FT:CDS DQ060822_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 8510-91). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttgacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctccgctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggagaattaatgactctagctacctgggtgggggtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|DQ060823_PreC_P-E Feature FT:CDS DQ060823_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 8504-91). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttgacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacttagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgttatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|DQ060824_PreC_P-E Feature FT:CDS DQ060824_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 0121-20). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|DQ060825_PreC_P-E Feature FT:CDS DQ060825_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 0262-09). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|DQ060826_PreC_P-E Feature FT:CDS DQ060826_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 0433-20). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctccgctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cataccgcactcaggcaagccattctttgctggggagaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|DQ060827_PreC_P-E Feature FT:CDS DQ060827_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 0317-04). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctccgctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cataccgcactcaggcaagccattctttgctggggagaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|DQ060828_PreC_P-E Feature FT:CDS DQ060828_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 0443-03). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctccgctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cataccgcactcaggcaagccattctttgctggggagaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcttaaagttcaggcaattactgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|DQ060829_PreC_P-E Feature FT:CDS DQ060829_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 0350-03). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctccgctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cataccgcactcaggcaagccattctttgctggggagaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcttaaagttcaggcaattactgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|DQ060830_PreC_P-E Feature FT:CDS DQ060830_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 235-01). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttgacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagatactgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatccagagacttagtagttagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgacgatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|EU239217_PreC_P-E Feature FT:CDS EU239217_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate G2451). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgctctcaggcaagccattctttgctggggggacttaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatgtgggcctaaagttcaggcaattattggggtttcata
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactccttcagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|EU239219_PreC_P-E Feature FT:CDS EU239219_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PW3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctctatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttagaaga
cccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
acgaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|EU239220_PreC_P-E Feature FT:CDS EU239220_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PW5). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccttataaagaatttggagctactgtggagttactctcttttttgcctggtgacttctttc
cttcagtaagagatcttctagataccgccacagctctgtatcgggatgccttagaatctcctgagcattgctcacctcac
catactgcactcaggcaggccattctttgctggggggaactaatgactctagctacatgggtgggtgcaaatttagaaga
tccagcatccagggaccttgtagtcagttatgtcaatgataatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaagtcgtcctagagtatttggtgtcttttggagtgtggattcgcactcctccacct
tatagaccaccaaatgcccctatcttatcaacacttccggagattactgttattagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|EU239221_PreC_P-E Feature FT:CDS EU239221_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PW1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccccac
cacacggcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaactgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|EU239222_PreC_P-E Feature FT:CDS EU239222_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PW2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgttggggggaccttatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattactgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcgtagagtatttggtgtcttttggagtgtggattcgcactcctacagca
tatagaccaccaaatgcccctatcttatcaacacttcctgagactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|EU239223_PreC_P-E Feature FT:CDS EU239223_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PW4). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctttatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggatataatgactatagctacctgggtgggtgtaaatttagaaga
cccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
acgaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|EU239224_PreC_P-E Feature FT:CDS EU239224_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate BD1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccgtctgacttctttc
cttcagtaagggatcttctagataccgcctcagcactgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacggagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagaactcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|EU239226_PreC_P-E Feature FT:CDS EU239226_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PW6). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcata
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|EU620071_PreC_P-E Feature FT:CDS EU620071_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Irish-16). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcttccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|EU726883_PreC_P-E Feature FT:CDS EU726883_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IR-RCGLD-7064). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactattcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacgcttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtacgagatcttctagataccgcctcagctctgtatcgggaagctttagaatctcctgagcattgctcacctcac
cacactgcactcaggcaagcaattctctgctggggggaactaatgactctagctacttgggtgggtggtaatttggaaga
tccaatatctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcaca
tttcttgtctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726953_PreC_P-E Feature FT:CDS EU726953_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IR-RCGLD-3551). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagcttctgtgcagttactctcgtttttgccttctgacttctttc
cttcaatacgagatcttctagataccgccgcagctctgtatcgggatgccttagaatctcctgagcattgttcagctcac
catactgcactcaggcaagcaattctgtgctggggggacttaatgtccctggctacctgggtgggtggtaatttggaaga
tccagtatccagggaactagtaatcggttatgtcaacactactgtgggcctaaagttcaggcaactattgtggtttcaca
tttcttgtcttatgtttggaagagaaacagttgtagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ349226_PreC_P-E Feature FT:CDS FJ349226_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate H6). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccatcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|FJ349237_PreC_P-E Feature FT:CDS FJ349237_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C27). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggccttaagttcaggcaattattgtggtttcaca
tttcttgtctaactttcggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|FJ349238_PreC_P-E Feature FT:CDS FJ349238_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C65). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggccttaagttcaggcaattattgtggtttcaca
tttcttgtctaactttcggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|FJ349239_PreC_P-E Feature FT:CDS FJ349239_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C74). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|FJ349240_PreC_P-E Feature FT:CDS FJ349240_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C89). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgatccttataaagaatttggagctactgtggagttactctcttttttgcctcctgacttctttc
cttcagtaagagatcttctagataccgccaaagctctgtttcgggatgccttggaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggtgcaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatattaatgtgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcgtagagtatttggtgtcttttggagtgtggattcgcactcctcaagct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|FN545821_PreC_P-E Feature FT:CDS FN545821_PreC_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgaaaatttacaaga
tcaagcatccagggacctagtagtcagttatgtcaatactcatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcytagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagacctccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|FN545822_PreC_P-E Feature FT:CDS FN545822_PreC_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagttagagatcttctagataccgcctcagctctgtttcgggatgccttagaatctcctgagcaytgttcacctcac
cacacggcactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggatctggtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctacagct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|FN545823_PreC_P-E Feature FT:CDS FN545823_PreC_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttrgggcatggacatcgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttc
cttcrgtaaragatctcctagataccgcctcagctctgtttcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggamytaaygamtctagctacctgggtgggkgtaaatttggaaga
tccagcatccagggacckagtagttagttatgtcaatactaatatgggcctaaagttcagacaattattgtggtttcaca
tttcttgtctcacttttggaagagataccgttgtagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccacaaaatgcccctatcttatcaacacttccggagamtgctgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagctgcccaatgttag
>gnl|hbvcds|FN545827_PreC_P-E Feature FT:CDS FN545827_PreC_P-E of [Viruses] Hepatitis B Virus genotype E. Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggrcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaaragatcttctagataccgcctcagctctgtatagggatgccttggaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccmttctttgctggggggacctaatgaatctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactcmtgtgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcyagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|FN545841_PreC_P-E Feature FT:CDS FN545841_PreC_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacacggcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|FN545842_PreC_P-E Feature FT:CDS FN545842_PreC_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcractttttcacctctgcctartcatctcttgttcatgtcctayttttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagctactgtsgagttactctcatttttgcctggtgacttctttc
cttcagtaagagatcttctagataccgcccaagctctgtttcgggatgctttagaatctcctgagcattgttcacctcat
cacactgcactcaggcaagccattctttgctggggggacctaatgtctctagctacctgggtgggtacaaatttggatga
tccagcatccagggaccwagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtcttacttttggaagagaaatcgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|FN594748_PreC_P-E Feature FT:CDS FN594748_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne6). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgccttctgacttctatc
cttcagtaagagatcttctagataccgcctcagctctctatcgggatgccttagaatcttctgagcattgttcaactcac
cctgctgcactcaggcaagccattctttgctggggggacctaatgaatctaggtacctgggtgggcggcaatttggaaga
ccaagcatccagggacgcagtagtcagttatgtcaatactaatatgggactaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttgggagagatacagtcgtagagtatttggtgtcttttggagtgtggattcgcactcctacagct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaag
acgaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|FN594749_PreC_P-E Feature FT:CDS FN594749_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne8). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcaactctgtatcgggatgccttagaatctcctccgcattgttcaccctca
catactgcwctcaggcaagccgttctttgctggggggatgtaatgaatctagctaccggggtgggtacaaatttggaaga
tccagcatccagggacctagtagtcggttatgtcaatactaatatgggactaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtctcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|FN594750_PreC_P-E Feature FT:CDS FN594750_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne12). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctyca
catactgcactcaggcaagccattctttgctggggggaccttatgtctctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggactaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctctagct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|FN594751_PreC_P-E Feature FT:CDS FN594751_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne52H). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccttataaagaatttggagctastgtggagttactctcgtttttgccgtctgatttctttc
cgtcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacytcac
cctgctgcwctcaggcaagccattctctgctggggggacctaatgaatctagctacctgggtgggtgcaaatttggatga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggactaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaacaccaaccgtcgtagagtatttggtatcttttggagtgtggattcgcactcctattgct
tatagaccaccaaatgcccctatcttatcaacacttccggagcatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|FN594752_PreC_P-E Feature FT:CDS FN594752_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne134). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcatctyca
catctgccactcaggcaagccattctttgctggggggatgtaatgaacctagcaacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcggttatgtcaatactaatatgggactaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|FN594753_PreC_P-E Feature FT:CDS FN594753_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne137). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccttataaagaatttggagcttccgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgccctcaggcaagccattctttgctggggggatgtaatgaatatggctacatgggtgggtgtgaatttgcaaga
tcaagcatccagggaccaagtagtcagttatgtcaatactaatatgggactaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagacaaaccgtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccaggttcccaatgttag
>gnl|hbvcds|FN594756_PreC_P-E Feature FT:CDS FN594756_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne250). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagatacagcctcagctctgtatcgtgatgccttggaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggacataatgaatatagctacctgggtaggtgcaaatttggaaga
tcaagcatccagggacctagtagtcagttatgtcaattctaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcctagagtatttggtgtcttttggagtgtggattcgcactcctccacct
tatagaccaccaaatgcccctatcttatcaacacttccggagattactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|FN594758_PreC_P-E Feature FT:CDS FN594758_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne341). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctacagtggagttactctcgtttttgccttctgacttctttc
cttcagtaaaagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcccytcac
cacactgcactcaggcaagccattctttgctggggggacctaatgaatctagctacctgggtgggtgcaaatttggaaga
tccatcatccagggaactagtagtcggttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcctagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttgtcaacgcttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcacctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttaa
>gnl|hbvcds|FN594759_PreC_P-E Feature FT:CDS FN594759_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne342). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagcttctgtgsagytactctcgtttttgccttctgacttctttc
cttcagtaagagatctcctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacytcac
accactgcactcaggcaagcccttctttgctggggggacctaatgaatctagctacctgggtgggtgcaaatttggaaga
tccatcatccagggaactagtagtcggttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcctagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttgtcaacgcttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcacctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttaa
>gnl|hbvcds|FN594760_PreC_P-E Feature FT:CDS FN594760_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne362). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggrcatggacattgacccttataaagaatttggagctagtgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttggaatctcctgagcattgttcccytcac
cacactgcactcaggcaagccattctttgctggggggacctaatgaatctagctacctgggtgggtgcaaatttggaaga
tccatcatccagggaactagtagtcggttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcctagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttgtcaacgcttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcacctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttaa
>gnl|hbvcds|FN594761_PreC_P-E Feature FT:CDS FN594761_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne385). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacatygacccttataaagaatttggagctwctgkggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatctactagataccgcctcagctctctgtcggggtgccttagaatctcctgagcattgttcacctcac
catactgctctcaggcaagccattctttgctggggggatcttatgaacctagctacctgggtgggtgcaaatttggaaga
cccagcatccagggacctagtagtcggttatgtcaatactactgtgggactaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagacgtcgtcatagagtatttggtgtcttttggagtgtggattcgcactcctatagct
tataggccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
acgaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|FN594762_PreC_P-E Feature FT:CDS FN594762_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne439). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtaagagatcttctagataccgcctcagctctctttcgggatgccttagaatctcctgagcattgctcacctcac
catagtgcactcaggcaagccgttctttgctggggggacctaatgaatctagctacctgggtgggtgtaaatttggaaga
tccagcctccagggacctggtagtcagttatgtcaatactgatatgggcctgaagttcagacaattattgtggtttcaca
tttcttgtctcacttttggaagagataccgtcgtagagtatttggtgtcttttggagtgtggattcgcactcctatacct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|FN594763_PreC_P-E Feature FT:CDS FN594763_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne446). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccttataaagaatttggagctagtgtggagttactctcgtttttgccttctgatttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
aatactgcactcaggcaagccattctttgctggggggacctaatgaatctagctacctgggtgggtgcaaatttggatga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggactaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaacaccaaccgtcgtagagtatttggtatcttttggagtgtggattcgcactcctattgct
tatagaccaccaaatgcccctatcttatcaacacttccggagcatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|FN594765_PreC_P-E Feature FT:CDS FN594765_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne9447). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagcttcygtggagttactctcktttttgccgtctgacttctttc
cttcagtaaaagatcttctagataccgcctcagctctgtatcgggatgccttggaatcttctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggacctaatgtctctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggaccaagtagtcagttatgtcaacactaatatgggagtaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcgtagagtatttggtgtctttcggagtgtggattcgcactcctccacct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccgatgttag
>gnl|hbvcds|FN594766_PreC_P-E Feature FT:CDS FN594766_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne9449). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccktctgacttctttc
cttcagtaaaagatcttctagataccgcctcagctctgtatagggatgccttgaaatctcctgagcattgttcmcctcac
cacactgcactcaggcaagcaattctttgctggggggacctaatgaatctagctacctgggtgggtgcaaatttggaaga
tcaagcatccagggacttagtagtcggttatgtcaatactactgtgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagatatcgtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagacttctgttgttagacgaagaggcaggtcccctagaag
aagaactccctcacctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161755_PreC_P-E Feature FT:CDS GQ161755_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1694). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagggatcttctagataccgcctcagctttgtatggggatgccttagaatctcctgagcattgttcgccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgtctctagctacctgggtgggtgtaaatttggaaga
tccagcctccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161756_PreC_P-E Feature FT:CDS GQ161756_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1684). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcattcaggcaagccattctttgctggggggacctaatgtctctagctacctgggtgggtgtaaatttagaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161757_PreC_P-E Feature FT:CDS GQ161757_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1156). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcctactgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggacctaataactctaagtacctgggtgggtgctaatttggaaga
tccagcatccagggacctagtagtcagttatgttaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaagtcgttttagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161758_PreC_P-E Feature FT:CDS GQ161758_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1506). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
cttcagtaaaagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacacggcactcaggcaagccattctttgctggggggacctgatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggaccttgtagtcagttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161759_PreC_P-E Feature FT:CDS GQ161759_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU934). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagccacctgggtgggggtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcagacaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttcctgagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161760_PreC_P-E Feature FT:CDS GQ161760_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1374). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggacttaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacgtttggaagagaaaccgtagtagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161761_PreC_P-E Feature FT:CDS GQ161761_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1033). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttagaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161762_PreC_P-E Feature FT:CDS GQ161762_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU716). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
attcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggacctaatgtctctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161763_PreC_P-E Feature FT:CDS GQ161763_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1013). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgctcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
cccagcatccagggacctagtagttagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161764_PreC_P-E Feature FT:CDS GQ161764_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1056). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactttagctacctgggtgggggtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161765_PreC_P-E Feature FT:CDS GQ161765_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU952). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacacggcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161766_PreC_P-E Feature FT:CDS GQ161766_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1671). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
cttcagtaaaagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacacggcactcaggcaagccattctttgctggggggacctgatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggaccttgtagtcagttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161768_PreC_P-E Feature FT:CDS GQ161768_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU960). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcatcagctctgtatcgagatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggatgtaatgaatttagctacctgggtgggtgtaaatttgcaaga
tccagcatccagggaccaagtagtcggttatgtcaatactaatatgggactaaagttcaggcaactattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tacagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttccaaatgttag
>gnl|hbvcds|GQ161769_PreC_P-E Feature FT:CDS GQ161769_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU865). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacaccgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161770_PreC_P-E Feature FT:CDS GQ161770_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU927). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggggtaaatttggaaga
tccagcatccagggacctagtggtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtacttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161771_PreC_P-E Feature FT:CDS GQ161771_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU896). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaacatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161772_PreC_P-E Feature FT:CDS GQ161772_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU873). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggggtaaacttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161773_PreC_P-E Feature FT:CDS GQ161773_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1406). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttc
cttcaataagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaacttatgactctagctacctgggtgggggtaaatttggaaga
tccatcatccagggaactagtagtcagttatgtcaatactaatatgggcctaaagttcagacaattattgtggtttcaca
tttcttgtctcacttttggaagacaagtcgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161774_PreC_P-E Feature FT:CDS GQ161774_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1501). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
cttcagtaaaagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacacggcactcaggcaagccattctttgctggggggacctgatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggaccttgtagtcagttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161775_PreC_P-E Feature FT:CDS GQ161775_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU754). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcatgtttcaccgcac
cacactgcactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggggtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcagacaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccgatgttag
>gnl|hbvcds|GQ161776_PreC_P-E Feature FT:CDS GQ161776_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1178). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161777_PreC_P-E Feature FT:CDS GQ161777_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU807). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgctcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
cccagcatccagggacctagtagttagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161778_PreC_P-E Feature FT:CDS GQ161778_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1035). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgctcaccgcac
cacactgcactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctacagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttccaaatgttag
>gnl|hbvcds|GQ161779_PreC_P-E Feature FT:CDS GQ161779_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU557). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacaccgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161780_PreC_P-E Feature FT:CDS GQ161780_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU50). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgrgatgccttagaatctcctgagcattgttcacctcac
cacacggcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagggtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagatctccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161781_PreC_P-E Feature FT:CDS GQ161781_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU200). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcatctttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161782_PreC_P-E Feature FT:CDS GQ161782_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1489). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggatctaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatattgccctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161783_PreC_P-E Feature FT:CDS GQ161783_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU981). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctctatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaaga
tccatcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
cttcttgtatcacttttggaagacaaaccgtcgtagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaaaatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161784_PreC_P-E Feature FT:CDS GQ161784_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU766). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161785_PreC_P-E Feature FT:CDS GQ161785_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU758). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagctactgtggagttgctctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcagcgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgcaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaactgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161786_PreC_P-E Feature FT:CDS GQ161786_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1688). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactcttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccggcccagctctgtatcgggatgccttagaatctcctgagcattgtacaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggggtaaatttgcaaga
tcaagcatccagggacctagtagtcaattatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaatcgtcttagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccactaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161787_PreC_P-E Feature FT:CDS GQ161787_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU841). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggggtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161789_PreC_P-E Feature FT:CDS GQ161789_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1169). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161790_PreC_P-E Feature FT:CDS GQ161790_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1408). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161791_PreC_P-E Feature FT:CDS GQ161791_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU459). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggggtaaatttggaaga
tccagcatccagggacctagtggtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtacttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgccttgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161792_PreC_P-E Feature FT:CDS GQ161792_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU605). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggatctaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatattgccctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaacccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161793_PreC_P-E Feature FT:CDS GQ161793_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU932). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctctatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggggtaaatttggaaga
tccagcatccagggacctagtggtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161794_PreC_P-E Feature FT:CDS GQ161794_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU846). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcatgagcattgttcaccgcac
cacactgcactcaggcaagctattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaactgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagacccccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161795_PreC_P-E Feature FT:CDS GQ161795_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1558). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggacctaatgtctctagctacctgggtgggtgtaaatttagaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161796_PreC_P-E Feature FT:CDS GQ161796_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1146). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgctcaccgcac
cacactgcactcaggcaagccattctttgctggggggacctaatgaatctaggtacctgggtgggtgcaaatttggatga
tcaagcatccagggaccttgtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcgtgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tacagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttccaaatgttag
>gnl|hbvcds|GQ161797_PreC_P-E Feature FT:CDS GQ161797_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1660). Complete genome. [Hepadnaviridae] (length=639 residues).
acgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcaatcaggcaagccattatttgctggggggaactaatgactctagctacctgggtgggggtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcagacaattattgtggtttcaca
catcttgtatcacttttggaagagaaaccgtcttagagtatttggtgtcttttggagtgtggattcgcactcctccacct
tatagaccaccaaatgcccctatcttatcaacacttccggaaattactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161798_PreC_P-E Feature FT:CDS GQ161798_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1222). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161800_PreC_P-E Feature FT:CDS GQ161800_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1039). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggggtaaatttggaaga
tccagcatccagggacctagtggtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtacttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161801_PreC_P-E Feature FT:CDS GQ161801_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU438). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaagtaatgactctagctacctgggtgggggtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161802_PreC_P-E Feature FT:CDS GQ161802_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU921). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttc
cttcaataagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaacttatgactctagctacctgggtgggggtaaatttggaaga
tccatcatccagggaactagtagtcagttatgtcaatactaatatgggcctaaagttcagacaattattgtggtttcaca
tttcttgtctcacttttggaagacaagtcgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161803_PreC_P-E Feature FT:CDS GQ161803_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1700). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccttataaagaatttggagctactgaggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggggtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcagacaattattgtggtttcaca
tttcttgtctcacttttgggagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccgccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccacgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161804_PreC_P-E Feature FT:CDS GQ161804_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1428). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161807_PreC_P-E Feature FT:CDS GQ161807_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1168). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacaccgcactcaggcaagccattctttgctggggggatctaatgactctagctacctgggtgggtgcaaatttagaaga
tccagcatccagggaccaagtagtcagttatgtcaatgataatatagccctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcgtagagtatttggtgtcttttggagtgtggattcgcactcctccacct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161808_PreC_P-E Feature FT:CDS GQ161808_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1398). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161810_PreC_P-E Feature FT:CDS GQ161810_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU852). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgctcaccgcac
cacactgcactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctacagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttccaaatgttag
>gnl|hbvcds|GQ161811_PreC_P-E Feature FT:CDS GQ161811_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1361). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatygacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttcagcaagagatcttctagatacygcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacacggcactcaggcaagccattctttgctggggggaattaatgactctagctacctgggtgggtggaaatttggaaga
tccagcatccagggaccttgtagtcggttatgtcaacactaatatgggcataaggttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagacaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161812_PreC_P-E Feature FT:CDS GQ161812_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1577). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttttagattccgcatcagctatgtttcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaagccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161814_PreC_P-E Feature FT:CDS GQ161814_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU625). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacatygacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
attcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggatctaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggaactattagtcagttatgtcaatactaatattgccctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgccaacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161815_PreC_P-E Feature FT:CDS GQ161815_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1241). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctctatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggamctaatgactctagctacctgggtgggagttaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttgtggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161816_PreC_P-E Feature FT:CDS GQ161816_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1214). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161817_PreC_P-E Feature FT:CDS GQ161817_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU630). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161819_PreC_P-E Feature FT:CDS GQ161819_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1062). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggggtaaatttggaaga
tccagcatccagggacctagtggtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtacttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161820_PreC_P-E Feature FT:CDS GQ161820_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1089). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
attcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaycgcac
cacactgcactcaggcaagccattctttgctggggggaastaatgactytagctacctgggtgggtgtaaatttggaaga
tccagcatccagggayctagtagtcagttatgtcaatamtaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccasct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161823_PreC_P-E Feature FT:CDS GQ161823_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU3397). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccttatgaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacacggcactcaggcaagccattctttgctggggggacctaatgaatctaggcacctgggtgggtgtaaatttagaaga
tcaagcatccagggaccgagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcttagagtatttggtgtcttttggagtgtggattcgcactcctccacct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161824_PreC_P-E Feature FT:CDS GQ161824_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU893). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctctatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaaga
tccatcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
cttcttgtatcacttttggaagacaaaccgtcgtagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaaaatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161825_PreC_P-E Feature FT:CDS GQ161825_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1769). Complete genome. [Hepadnaviridae] (length=636 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggaccttgacccttataaagaatttggagctactgtggagttactctcgtttttgcctggtgacttctttc
cttcagtaagagatcttctatataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgctcacctcat
catactgcactcaggcaagccattctttgctggggagatgtaatgaatttagctacctgggtgggtgcaaatttggagga
tcctgtatccagggacctagtcgtcagctatgtcaataataatatgggcctaaagttcaggcaattattgtgggttcaca
tttcttgtctcacttttggaagagaaacagtcctacagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagaccaagcaggtcctatagaagaag
aactccctcacctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161826_PreC_P-E Feature FT:CDS GQ161826_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU607). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaaaagatcttctatataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggacttaatgaatctagcgacctgggtgggtgtaaatttggaaga
tccagcatccagggacctggtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tacagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161827_PreC_P-E Feature FT:CDS GQ161827_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU180). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctctatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggggtaaatttggaaga
tccagcatccagggacctagtggtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161828_PreC_P-E Feature FT:CDS GQ161828_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1399). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161829_PreC_P-E Feature FT:CDS GQ161829_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU719). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggggtaaatttggaaga
tccagcatccagggacctagtggtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtacttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161831_PreC_P-E Feature FT:CDS GQ161831_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU779). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgctcacctcac
catactgcactcaggcaagccattctttgctggggggacctaatgaatctagctacctgggtggggggaaatttggaaga
tcctgcatccagggacgtagtagtcaattatgtcaatactaatatagccctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagacaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161832_PreC_P-E Feature FT:CDS GQ161832_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1091). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcactttcggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161833_PreC_P-E Feature FT:CDS GQ161833_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU489). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgttaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacaactccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161834_PreC_P-E Feature FT:CDS GQ161834_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1128). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcatggttcaccgcac
cacactgcactcaggcaagccattctttgctggggggacttaatgactctagctacctgggtgggggaaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatgcgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctacagct
tatagaccaccaaatgcccctatcttatcaactcttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161835_PreC_P-E Feature FT:CDS GQ161835_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU925). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctttgtatcgggatgccttagaatctcttgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgtctctagctacctgggtgggtgtaaatttggaaga
tccagcctccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161836_PreC_P-E Feature FT:CDS GQ161836_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1051). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
attcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggatctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ491112_PreC_P-E Feature FT:CDS GQ491112_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 8804335). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcggttcgagatctcctagacactgcctcagctctgtatcgggatgccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagcgattctttgctggggggaattaatgactctagctacctgggtgggggcaaacctggacga
tcaagcatccagggacctagtagtcagttatgtcaatactcatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaacagtccacgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctcgaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctccagcttcccaatgttag
>gnl|hbvcds|HM363565_PreC_P-E Feature FT:CDS HM363565_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A186). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccacgctgtgccttgggtggct
ttagggcatggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcctcttgacttctttc
cttcagtaaaagatcttctagataccgcctcagctctatatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggacctaatgaatttagccacctgggtgggtgcaaatttggacga
cccaggatctagggaccaagtagtcagttatgtcaatactaatatgggcttaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagatactgtcttagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaag
acgaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccattgttag
>gnl|hbvcds|HM363566_PreC_P-E Feature FT:CDS HM363566_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IBL1082). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcatgtttcacatcac
catactgcactcaggcaagccattctttgctggggggatataatgaatatagctacctgggtgggtgcaaatttggaaga
ccaagcatctagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaactgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatccacacttccggagactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363567_PreC_P-E Feature FT:CDS HM363567_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C16). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgtacacctcac
catactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggggtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcgtagagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363568_PreC_P-E Feature FT:CDS HM363568_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C98). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgtacacctcac
catactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggggtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363569_PreC_P-E Feature FT:CDS HM363569_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A51). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgtgcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtggtcagctatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcata
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctaaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363570_PreC_P-E Feature FT:CDS HM363570_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A85). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtcccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtggtcagctatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcata
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctaaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363571_PreC_P-E Feature FT:CDS HM363571_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V16). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363572_PreC_P-E Feature FT:CDS HM363572_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V5). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363573_PreC_P-E Feature FT:CDS HM363573_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctttgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagttagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaactgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tacagacctccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363574_PreC_P-E Feature FT:CDS HM363574_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V70). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggaattactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcctctagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcattgagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatccacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363575_PreC_P-E Feature FT:CDS HM363575_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V30). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagatactggctcatctctgtatggggatgccttacaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggaattaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagttagttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccaggttcccaatgttag
>gnl|hbvcds|HM363576_PreC_P-E Feature FT:CDS HM363576_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V43). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatttcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagatactggctcatctctgtgtggggatgccctagaatctcctgagcattgttcacctcac
catactgaactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagttagttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccaggttcccaatgttag
>gnl|hbvcds|HM363577_PreC_P-E Feature FT:CDS HM363577_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C19). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggagctaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagttagttatgtcaatactaatatgggcctaaagttcagacaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363578_PreC_P-E Feature FT:CDS HM363578_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IBL802). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctaatgttcaagcctccaagttgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttc
cttcagtgagagatcttctagataccgcctcagctctgtttcgggatgccttagaatctcctgagcattgttcagctcac
catactgctctcaggcaagccgttctttgctggggggagctaatgactctagctacctgggtgggtgtaaatttggaaga
tcaagcatccagggacctagtagttagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcgtagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccactgttag
>gnl|hbvcds|HM363579_PreC_P-E Feature FT:CDS HM363579_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A32). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363580_PreC_P-E Feature FT:CDS HM363580_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A79). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363581_PreC_P-E Feature FT:CDS HM363581_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A84). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcctttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363582_PreC_P-E Feature FT:CDS HM363582_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IBL314). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cgtcagtaagagatcttctagatactgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363583_PreC_P-E Feature FT:CDS HM363583_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V137). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cgtcagtaagagatcttctagatactgcctccgcgctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaaga
tcccgcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaactgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363584_PreC_P-E Feature FT:CDS HM363584_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V129). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cgtcagtaagagatcttctagatactgcctccgcgctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaaga
tcccgcatccagggacctagtagtcagttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaactgtcatagagtatttggtgtcttttggagtgtggattcgcactcctacagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363585_PreC_P-E Feature FT:CDS HM363585_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IBL1455). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctcccagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttccgacttctttc
cttcagtaagagatcttctagatactgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363586_PreC_P-E Feature FT:CDS HM363586_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A227). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctttgtatcgggatgccttagaatcgcctgagcattgtacacctcac
catactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcttagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363587_PreC_P-E Feature FT:CDS HM363587_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V195). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgtacccctcac
catactgcactcaggcaagtcattctttgctggggggacctaatgactctagctacctgggtgggtggaaatttggaaga
tcaaacatccagggacctaatagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363588_PreC_P-E Feature FT:CDS HM363588_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A100). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcttcagctctgtatcgggatgccttagaatctcctgagcattgtacacctcac
catactgcactcaggcaagccattctttgttggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttcctgagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363589_PreC_P-E Feature FT:CDS HM363589_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A178). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgctcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcttcagctctgtatcgggatgccttagaatctcctgagcattgcacacctcac
catactgcactcaggcaagccattctttgttggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttcctgagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363590_PreC_P-E Feature FT:CDS HM363590_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V119). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgtacacctcat
catactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcagacaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttcctgagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363591_PreC_P-E Feature FT:CDS HM363591_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A114). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgtacacctcac
catactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcttagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363592_PreC_P-E Feature FT:CDS HM363592_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A153). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgtacacctcac
catactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacctttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363593_PreC_P-E Feature FT:CDS HM363593_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IBL1577). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttcggacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtttcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggaattaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccacaaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363594_PreC_P-E Feature FT:CDS HM363594_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V157). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagctcttctagataccgcctcagctctgtttcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattatttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363595_PreC_P-E Feature FT:CDS HM363595_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IBL1219). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagatgtcccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttccgacttctttc
cttcagtaagagatcttatagatactgcctcagctttgtatcgggatgccttcgaatctcctgagcattgttcaccttac
catactgcactcaggcaagccattctttgctggggggaattaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363596_PreC_P-E Feature FT:CDS HM363596_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V87). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagctcttctagataccgcctcagctctgtttcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattatttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagttagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcttagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363597_PreC_P-E Feature FT:CDS HM363597_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A112). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttc
cttcaataagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgtacacatcac
catactgcaatcaggcaagccattatttgctggggggaactaatgaatctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctggtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacg
tttcttgtctcacttttggaagagataccgtcttagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363598_PreC_P-E Feature FT:CDS HM363598_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V15). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggaggtactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctttgtatcgggatgccttagaatctcctgagcattgcacacctcac
catactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tcaaggatccagggacctagtagtcagttatgtcaataatcatatgggcctaaagttcaggcaattgatgtggtttcaca
tttcttgtctcacttttggaagagaaatcgtcctagagtttttggtgtcttttggagtgtggattcgcactcctccacct
tatagaccaccaaatgcccctatcttatcaacacttccggagattactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363599_PreC_P-E Feature FT:CDS HM363599_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V144). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcctactgacttctttc
cttcagtaagagatcttctagatactgcatcagctctgtttcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggtgcaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtcttatttttggaagagacgtcgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcaagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363600_PreC_P-E Feature FT:CDS HM363600_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C8). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacatcgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttccgacttctttc
cttcagtaagagatcttctagatactgcctcagctctgtttcgggatgccttagaaggtcctgagcattgtacacctcac
catactgcactcaggcaagccattatttgctggggggaactaatgactctagctacctgggtgggtgtaaatttagacga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagataccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccacgtcgcagaagatctcaatctccagcttcccgatgttag
>gnl|hbvcds|HM363601_PreC_P-E Feature FT:CDS HM363601_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IBL911). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcaccgctgcctaatcatctcttgttcatgtcctactgttcaagccttcaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcctgccgacttctttc
cttcagtaagagatcttctagataccgcttcagctctgtttcgggatgccttagaatctcctgagcattgtacacctcac
catactgcactcaggcaagccattctttgttggggggaactaatgactctagctacctgggtgggtgcaaatttggaaga
tcaagcatccagggacctaatagtcagttatgtcaatagtagtatgggcctaaagttcaggcaaatattctggtttcaca
tttcttgtctcacttttggaagagaagtcgttctagagtatttggtgtcttttggagtgtggattcgcactcctccacct
tatagaccaccaaatgcccctatcttatcaacacttcctgagattactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363602_PreC_P-E Feature FT:CDS HM363602_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A231). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtgtct
ttagggcatggtcattgacccttataaagaatttggcgcttctgtggagttactctcgtttttgccttccgacttctttc
cttcagtaagagatcttatagataccgcctcagctttgtatcgggatgccttcgaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggatttaatgaatctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaatcgtcgtagagtatttggtgtcttttggagtgtggattcgcactcctatagct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagacgcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363603_PreC_P-E Feature FT:CDS HM363603_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IBL1274). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagccttcaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagctagtgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcccaagctctgtatcgggatgccttagaatcttctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggacctaatgtccctaggtacctgggtggggggaaatttggaaga
tcaagcgtccagggacctagtagttagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttagtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccactgttag
>gnl|hbvcds|HM363604_PreC_P-E Feature FT:CDS HM363604_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A28). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcaataagagatcttctagataccgcctcagctctcttccgggatgccttggaatctcctgatcattgctcacctcac
catactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgcaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaaattcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgttatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatccacacttccggagaatgctgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363605_PreC_P-E Feature FT:CDS HM363605_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C58). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcatcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggaattaatgactctagctacctgggtgggtgcaaatttggacga
tccagcatccagggacctagtagtcagttatgttaatactcatatgggcctaaagttcaggcaattattgtggtttcacc
tttcttgtctcatgtttggaagagacactgtcgtagagtatttggtgtcttttggagtgtggattcgcactcctatagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccaggttcccaatgttag
>gnl|hbvcds|HM363606_PreC_P-E Feature FT:CDS HM363606_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V64). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggtcattgacccctataaagaatttggagctactgtggagttactctcgtttttgccttccgacttctttc
cttcagtaagagatcttctagataccgcctcagctttgtatcgggatgccttggaatctcctgagcattggtcacctcac
catactgcactcaggcacgtcattctttgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgttaatactaatatgggcctaaagttcaggcaattattgtggtttcacg
tttcttgtctcatgtttggaagagaaaccgtcctagagtatttggtgtcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatctccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363607_PreC_P-E Feature FT:CDS HM363607_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C78). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctagtgttcaagcatccaagatgtcccttgggtggct
ttagggcatggacatcgacccttataaagaatttggagcttccgtggagttactctcgtttttgccttctgatttctttc
cttcagtaagagatattatagatactgcctcaggtttgtttcgggatgccttcgaatctcttgagcattgttcaccttac
catactgcactcaggcaagccattctttgctggggggaattaatgactctagctacctgggtgggtgcaaatttggaaga
tccagcatccagggacctagtagttagttatgtcaatactcatatgggcctaaagttcaggcaattattgtggtttcact
tctcttgtatcacttttggaagagacaccgtcttagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgccgatctcaatcgccgcgtcgcagaagatctcaatctccatcttcccactgttag
>gnl|hbvcds|HM363608_PreC_P-E Feature FT:CDS HM363608_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A212). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgtgcatgtcatactgttcaagccttcaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtttcgggatgccttagaatctcctgagcattgttcaccccac
cacactgcactcaggcaagccattctttgctggggggatgtaatgaatctagctacctgggtgggtgcaaatttggaaga
tcccacatccagggaccttgtagtcagttatgtcaatactcatatgggcttaaagaccaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagatatcgtcttagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363609_PreC_P-E Feature FT:CDS HM363609_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A58). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgtgcatgtcatactgttcaagccttcaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttttggtaaccgctccggctcggaaccggaatgccttagaatttcctgagcattgttcaactcaa
cctaccgcaatcaggccaagccttttttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccatcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363610_PreC_P-E Feature FT:CDS HM363610_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C113). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctcccagctgtcccttgggtggct
ttagggcatggacatcgacccttataaagaatttggagcttctgtggagttactctcgtttttgcctcctgatttctttc
cttcagtaagagatcttctggataccgccgcagctttgtttcgggatgccttcgaatctcctgagcattgtacacctcac
catactgcactcaggcaagccattctttgctggggggaacttatgactctagctacctgggtgggtgcaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctgaagttcaggcaattattctggtttcaca
tttcttgtctcacttttggaagagaagtcgtattagagtatttggtgtcttttggagtgtggattcgcactcctccaccc
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363611_PreC_P-E Feature FT:CDS HM363611_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A67). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacatcgacccttataaagaatttggagcttccgtggagttactctcttttttgcctactgacttctatc
cttccgtaagagatcttctagataccgcctcagctctgtttagggatgccttggaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggtgcaaatttggaagg
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacg
tttcttgcctcacttttgggagagaagtcgtagtagagtttttggtgtcttttggggtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctggaag
aagaactccctcgcctcgcagacgaagacctcaatcgccgcgtcgcagaagatctcaatctccatcttcccaatgttag
>gnl|hbvcds|HQ700550_PreC_P-E Feature FT:CDS HQ700550_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate E_Mad_A032a). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatccagagacctagtagttagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgacgatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HQ700551_PreC_P-E Feature FT:CDS HQ700551_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate E_Mad_F017A). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttggaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatccagagacctagtagttagttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagaatatttggtgtcttttggagtgtggattcgcactcctacagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HQ700552_PreC_P-E Feature FT:CDS HQ700552_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate E_Mad_030). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatccagagacctagtagttagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgacgatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|JQ000008_PreC_P-E Feature FT:CDS JQ000008_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate S1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggagaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|JQ000009_PreC_P-E Feature FT:CDS JQ000009_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate S2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggcttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KF170741_PreC_P-E Feature FT:CDS KF170741_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SDAC_047). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacccctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggatctagtagtcagttatgtcaatactaatatgggactaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatcccaacccccccccttggag
>gnl|hbvcds|KF170742_PreC_P-E Feature FT:CDS KF170742_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SDAC_125). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagtttaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcacaatgttag
>gnl|hbvcds|KF798259_PreC_P-E Feature FT:CDS KF798259_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate EICIB-01). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtacgagatctccttgataccgcctcagctctgtatcgggaagccttagaatctcctgagcattgttcacctcat
catactgcactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgtgaatttggaaga
tccagcatctagggacctagtagtcagttatgtcaacactaatatgggcctaaaattcaggcaactattgtggtttcaca
tttcttgtctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagct
tatagaccacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF798270_PreC_P-E Feature FT:CDS KF798270_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate EICIB-12). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttc
cttcagtacgagatcttctagataccgcctcagctctgtatcgggaagccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagcaattctttgctggggggaattaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcaca
tttcttgtctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF798275_PreC_P-E Feature FT:CDS KF798275_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate EICIB-17). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcgactgtggagttactctcatttttgccttctgatttctttc
cgtctgtacgagatcttctagataccgccgcagctctatatcgggatgcgttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagcaattctttgctggggagaactaatgactctagctacctgggtgggtactaatttggaaga
tccagcatctagggatctagtggtcagttatgtcaacactaacatgggcctaaagttcaggcaactattgtggtttcata
tttcttgtctcacttttgggagagaaacggttttggagtatttggtgtctttcggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF798298_PreC_P-E Feature FT:CDS KF798298_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate EICIB-40). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttc
cttcagtacgagatcttctagataccgcctcagctctgtatcgggatgccttagaatcgcctgagcattgttcacctcac
catactgcactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcaca
tttcttgtctcacttttggaagagaaacagtaatagaatatttggtgtctttcggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF798305_PreC_P-E Feature FT:CDS KF798305_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate EICIB-47). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttc
cttcagtacgagatctgctagataccgccgcagctctgtatcgggatgccttagaatctcctgagcattgtacacctcac
catactgcactcaggcaagcatttctttgctggggtgaattaatgactctagctacctgggtgggtgctaatttggaaga
tcaaggatctagggacctagtagtcagttatgtcaacgttaacatgggcctaaagttcaggcaactcttgtggtttcaca
tttcttgtctcacttttggaagacaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctcaacct
tataggccaccaaatgcccctatcttatcaacacttccggagtgtactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF849713_PreC_P-E Feature FT:CDS KF849713_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA277). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggrgaaytaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggmctaaagttcagggaattattgtggtttcaca
tttcttgtctcactttgggaagagaaaccgtcwtagactatttggtgtcttttggagtgtggattcccactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KF849714_PreC_P-E Feature FT:CDS KF849714_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA439). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctmtkgttcwkgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttacyctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KF849715_PreC_P-E Feature FT:CDS KF849715_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA445). Complete genome. [Hepadnaviridae] (length=639 residues).
atgttactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagctattctttgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KF849716_PreC_P-E Feature FT:CDS KF849716_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA278). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctctgctctgtatcgggatgccttaaaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcasgcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KF849717_PreC_P-E Feature FT:CDS KF849717_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA504). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttgacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggagaattgatgactctagctacctgggtgggtgtaaatttggagga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgttatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KF849718_PreC_P-E Feature FT:CDS KF849718_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA72). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatgtcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttcygacttctttc
cttcagtaagagatcttytagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagycattctttgctggggagaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcttaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcttagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagtgtactgttattagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KF849719_PreC_P-E Feature FT:CDS KF849719_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA154). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttcctctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggatctagtagtcagttatgtcaatactaacatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KF849720_PreC_P-E Feature FT:CDS KF849720_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA265). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcgtgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggtcatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggagaattaatgactctagctacctgggtgggtggaaatttgcaaga
tccaacatccagggacctagtggtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgcctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KF849721_PreC_P-E Feature FT:CDS KF849721_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA379). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcactttgggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KF849722_PreC_P-E Feature FT:CDS KF849722_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA386). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catacggcactcaggcaagccattctttgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcttaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KF849723_PreC_P-E Feature FT:CDS KF849723_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA173). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagctattctttgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KF849724_PreC_P-E Feature FT:CDS KF849724_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA274). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctctgctctgtttcgggatgccttagaatctcctgagcattgtacacctcac
catactgcactcaggcaagccgttctttgctggggagaattaatgaatctagctacctgggtgggtgcaaatttgcaaga
tccgacatccagggatctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcctagagtatttggtgtcttttggagtgtggattcgcactcctccacct
tatagaccacaaaatgcccctatcttatcaacacttccggagactactgttgttagacgaaggggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KF849725_PreC_P-E Feature FT:CDS KF849725_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA399). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagcctgtctttgctggggagatgtaatgaatctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcggttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcctagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KF849726_PreC_P-E Feature FT:CDS KF849726_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA417). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cgtcagtaagagaccttctagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattatttgctggggagaattaatgactctagctacctgggtgggtgtaaatttggagga
tccatcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcatcacttccggagtgtactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KF849727_PreC_P-E Feature FT:CDS KF849727_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA405). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggagaattaatgacgctagctacctgggtgggggtaaatttggaaga
tccagcatctagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KF849728_PreC_P-E Feature FT:CDS KF849728_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA423). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctctgctttgtttcgggatgccttagaatcacctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggtgatgtaatgaatctagcgacatgggtgggtgtaaatttggaaga
tccggcatccagggacctagtagtgggttatgtcaatactaatatgggcctaaagttccggcaattattgtggtttcacc
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccactgttag
>gnl|hbvcds|KF922438_PreC_P-E Feature FT:CDS KF922438_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PO04v1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgttatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KF922439_PreC_P-E Feature FT:CDS KF922439_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PO04v2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgttatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttccccatgttag
>gnl|hbvcds|KM606738_PreC_P-E Feature FT:CDS KM606738_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Cuba27a). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctccgctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cataccgcactcaggcaagccattctttgctggggagacctaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgttaatactaatgtgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcaagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KM606739_PreC_P-E Feature FT:CDS KM606739_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Cuba32a). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgtaactttttcacctctgcctaatcatctcttgttcaggtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcctgctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtttcgggatgccttagaatctcctgtacatgtttcaccgcac
cacactgcactcaggcaagccattctttgctggggggatgtaatgtctctagctacctgggtgggtgttaatttggaaga
tccagcatccagggacctagtagtcggttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcttagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccatagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KP856973_PreC_P-E Feature FT:CDS KP856973_PreC_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcctcaggacttctttc
cttcagtacgcgatcttctagataccgcctcagctctgtatcggcaagccttagaatctcctgagcattgttcacctcac
catactgcaatcaggcaagcaattttgtgctggggggaattaatgactctagctacctgggtgggtggtaatttggacga
tccaacatccagggatctagtagtcagttatgtcaacactaatatgggcctaaaattcaggcaactattgtggtttcaca
tttcttgcctcacttttggaagagatacagtcctagagtatttggtgtctttcggagtgtggattcgcactccccaagct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KP856982_PreC_P-E Feature FT:CDS KP856982_PreC_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcctactgacttctttc
cttcagtacgagatcttctagatactgcctcagctctgtatcgggatgccttagaatctcctgagcattgtacacctcac
catactgcactcaggcaagcaattctgtgctggggggaattaatgactctagctacctgggtgggtggtaatttggaaga
tcccacatccagggacctagtagtcagttatgtcaacactaatatgggcctgaagtttaggcaattattgtggtttcaca
tttcttgtctcacttttggaagacaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaaggt
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttattagaggacgacgcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|KP856998_PreC_P-E Feature FT:CDS KP856998_PreC_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccttataaagaatttggagctactatagagttactctcgtttttgccttctgacttctatc
cgtcagtacgagatcttctagataccgcctcagctctgtatcgggaagccttagaatctcaggatcattgctcacctcac
catactgcactcaggcaagcaattctctgctggggggaactaatgaatctagctacctgggtgggtggtaatttggaaga
cccaacatccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcaca
tttcttgtctcacttttggaagagacacagttgcagagtatttggtgtctttcggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagatgtcgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttag
>gnl|hbvcds|KP857001_PreC_P-E Feature FT:CDS KP857001_PreC_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcgtgttcatgtcctactattcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttc
cttcagtacgagatcttctagataccgccgcagctctgtatcgggaagctttagaatctcctgagcattgctcacctcac
catactgcactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaaga
tccaacatccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcaca
tttcttgtctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctagggaatctcaatgttag
>gnl|hbvcds|KP857010_PreC_P-E Feature FT:CDS KP857010_PreC_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctacttttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttc
cttccgtacgagatcttctagataccgcctcagctctgtttcgggatgccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagcaatattatgctggggggaattaatgactttagctacctgggtgggtggaaatttggacga
tccaacatccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacc
tttcttgtctcatgtttggaagagaagtagtcgtagagtatttggtgtctttcggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttrttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagamgatctcaatctcgggaaccycaatgttag
>gnl|hbvcds|KP857011_PreC_P-E Feature FT:CDS KP857011_PreC_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactrttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgcacgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagcaattttgtgctggggggacctaatgactctagctacctgggtgggtggaaatttggaaga
tccaggatccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcaca
tttcttgtctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttaa
>gnl|hbvcds|KP857055_PreC_P-E Feature FT:CDS KP857055_PreC_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgccttctgacttctttc
cttcggtacgagatcttctagataccgcctcagccctgtatcgggatgccttagaatctcctgagcattgttcacctcat
catactgcaatcaggcaagcagttctttgctggggggacttaatgtctctagctacctgggtgggtgttaatttggaaga
tcaagcatctagagacctaatagtcagttatgtcaacaataatatgggcctaaagttcaggcaactattgtggtttcaca
tttcttgtctcacttttggaagagaaatagtcatagagtatttggtgtccttcggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcatcacttccggaaactactgttcttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|KT192626_PreC_P-E Feature FT:CDS KT192626_PreC_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggatctagtagtcagttatgtcaatactaatatgggactaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaactgtcattgagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttccccatgttag
>gnl|hbvcds|KT749841_PreC_P-E Feature FT:CDS KT749841_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate FL11). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacctttataaagaatttggagctactgtggagttactctcgtttttgcctactgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatcgcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtggtaatttggagga
tccagcatccagggatctagtagtcagttatgtcaatactactattggccttaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagatatcgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KU736891_PreC_P-E Feature FT:CDS KU736891_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Egypt_1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacatagacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacckcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatcaagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KU736892_PreC_P-E Feature FT:CDS KU736892_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Egypt_2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacatagacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggatgtaatgaatctagctacctgggtgggtgtaaatttggaaga
tccagtatcaagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctacagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KU736893_PreC_P-E Feature FT:CDS KU736893_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Ethiopia_3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctttatcgggatgccttagaatctcctgagcattgttcacctcat
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacraagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KU736894_PreC_P-E Feature FT:CDS KU736894_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Liberia_1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactaaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcttaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KU736895_PreC_P-E Feature FT:CDS KU736895_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Liberia_2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctygtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctatgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacttagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KU736896_PreC_P-E Feature FT:CDS KU736896_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Liberia_3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctatgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacttagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KU736897_PreC_P-E Feature FT:CDS KU736897_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Liberia_4). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagacccccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KU736898_PreC_P-E Feature FT:CDS KU736898_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Liberia_5). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagacccccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KU736899_PreC_P-E Feature FT:CDS KU736899_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Liberia_6). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctgaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KU736900_PreC_P-E Feature FT:CDS KU736900_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Somalia_2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgctcacctcac
cacactgcactcaggcaagccattctgtgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KU736901_PreC_P-E Feature FT:CDS KU736901_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgttggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgttatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KU736902_PreC_P-E Feature FT:CDS KU736902_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_12). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacatagacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttttttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgctctcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgttatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KU736903_PreC_P-E Feature FT:CDS KU736903_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_13). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtaaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KU736904_PreC_P-E Feature FT:CDS KU736904_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_16). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttrgggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttytttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggaacttatgactctagctacytgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtaaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagaactcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KU736905_PreC_P-E Feature FT:CDS KU736905_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_17). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KU736906_PreC_P-E Feature FT:CDS KU736906_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KU736907_PreC_P-E Feature FT:CDS KU736907_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KU736908_PreC_P-E Feature FT:CDS KU736908_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_5). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KU736909_PreC_P-E Feature FT:CDS KU736909_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_6). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttrgggcatggacatygacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggacctaatgamtctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtaaatactmatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaacygtcatagagtatttggtgtcttttggagtgtggattcgcactcctmcagct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KU736910_PreC_P-E Feature FT:CDS KU736910_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_8). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacttagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttctkgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KU736911_PreC_P-E Feature FT:CDS KU736911_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_9). Complete genome. [Hepadnaviridae] (length=639 residues).
atgyaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacatygacccttataaagaatttggagctactgtgsagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggacctaatgtctctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacttagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcttagagtatttggtgtcttttggagtgtggattcgcactcctcaagct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KU736912_PreC_P-E Feature FT:CDS KU736912_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_4). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttrgggcatggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggatataatgactatakctacctgggtkggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KU736913_PreC_P-E Feature FT:CDS KU736913_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_7). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctacttttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagctwstgtggagttgctctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggacytaatgaatctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatrtgggcctaaagttcagrcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtmgtagagtatttggtgtcttttggagtgtggattcgcactcctryagct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccamtgttag
>gnl|hbvcds|KX186584_PreC_P-E Feature FT:CDS KX186584_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Eafr). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|LT623842_PreC_P-E Feature FT:CDS LT623842_PreC_P-E of [Viruses] Hepatitis B Virus genotype E. Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttrggacatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcatytttcaccgcac
cacactgcactcaggcaagccattctttgttggggggatctaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatgtgggcctmaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctacagct
tatagaccasyaaatgcccctatcttatcaacwcttccggagamtactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttccaaatgttag
>gnl|hbvcds|LT623843_PreC_P-E Feature FT:CDS LT623843_PreC_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgatttctttc
cttcagtaagagatcttctagataccgccagagctctgtttcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggacctaatgtycctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgttaatactaatatgggactaaagttcaggcaattattgtggtttcaca
tttcttgcctcacttttggaagagaaaccgtcgtagagtatttggtatcttttggagtgtggattcgcactcctccagct
tataggccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|LT623844_PreC_P-E Feature FT:CDS LT623844_PreC_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctgtgctggggggatgtaatgaatttagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcggttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcratcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|LT623845_PreC_P-E Feature FT:CDS LT623845_PreC_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctctcgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgcaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagacaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgargaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|LT623846_PreC_P-E Feature FT:CDS LT623846_PreC_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagatacagcctcagctctgtatcgggatgccttagaatctccggaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccasct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcacctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|LT623847_PreC_P-E Feature FT:CDS LT623847_PreC_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactcttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccttataaagaatttggagctactgtgcagttactctcgtttttgcctcctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgytggggggatataatgaatatagctacctgggtgggtgctaatttggaaga
tcaaacatccagggacctagtagtcagttatgtcaatactaatatgggcataaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaagtagtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|LT623848_PreC_P-E Feature FT:CDS LT623848_PreC_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggrcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatccagagacctagtagtcagttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcmtagagtatttggtgtcttttggagtgtggattcgcactcctcmagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagacgatctcaatctccagcttcccaatgttag
>gnl|hbvcds|LT623849_PreC_P-E Feature FT:CDS LT623849_PreC_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcctwctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcay
cacactgcactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatrtgggcctaaagttcaggcaattattgtggtttcata
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcscactcctcmagct
tatagaccaccaaatgcccctatcttatcaacacttccggagamtactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcscctcscagacgaagatctcaatcgccgcgtcscagaagatctcaatctccascttcccaatgttag
>gnl|hbvcds|LT623850_PreC_P-E Feature FT:CDS LT623850_PreC_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcactgttcacctcac
cacacggcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|LT623851_PreC_P-E Feature FT:CDS LT623851_PreC_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgccacagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccatamtatgctggggggaactaatgactctagctacctgggtgggtgcaaatttggamga
tccagcatccagggacctrgtagtcagttatgttaayactaatatgggcctaaagttcagacaattactrtggtttcaca
tttcttgtctcacttttggaagagaagtcgtcctagagtatttggtgtcttttggagtgtggattcgcactcctccacct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgamgaggcaggwcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MF772354_PreC_P-E Feature FT:CDS MF772354_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 1067). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MF772355_PreC_P-E Feature FT:CDS MF772355_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 488). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagcagtgccttgggtggct
ttaggacatggacatcgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctctgctctgtatcgggatgccttagaatcttctgagcattgttcagctcac
catactgcactcaggcaagccattctttgctggggagatttaatgtccctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagctatgtcaacactaatatgggcctaaagkttaggcaattattgtggtttcaca
tttcttgcctcacttttggaagagacgtcgtcctagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tataggccaccaaatgcccctatcttatcaacacttcctgaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MF772356_PreC_P-E Feature FT:CDS MF772356_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 1834). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcctcctgacttctttc
cttcagtaaaagatcttctagataccgcctcagctctatttcgggatgccttggaatcaggtgaacattgctcaccgcac
cacactgcactcaggcatgcctttctttgctggggggacttaatgtctctagctacttgggtgggtgttaatttggaaga
tcaagcatccagagaccaagtagtcagttatgtcaacactaatatgggactaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagacaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccatcttcccaatgttag
>gnl|hbvcds|MF772357_PreC_P-E Feature FT:CDS MF772357_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 222). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccttataaagaatttggagctactgttgagttactctcttttttgcctgctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtttcgggatgccttagaatctcctgaacatttttcaccgcac
cacactgcactcaggcaagccattctttgctggggggacttaatgtctctagctacctgggtgggtgttaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggccttaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctatagct
tatagaccacaaaatgcccctatcttatccacacttccggaaactactgttattagacgaagagtcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccgatgttag
>gnl|hbvcds|MF772358_PreC_P-E Feature FT:CDS MF772358_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 2255). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccggctgacttctatc
cttcagtaaaagatcttctagattccgccacagctctgtttcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggacttaatgaatctagctacctgggtgggtgttaatttggaaga
tcaagcatccagagacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggttccaca
cttcttgtatcacgtttggaagagaaaccgtagtagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggccccctagagg
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MF772359_PreC_P-E Feature FT:CDS MF772359_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 335). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcttctttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaattaggagctactgtggagttactctcgtttttacataatgacttctttc
cttcactaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacactgctcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggcgccaatttggaaga
tccagcatccagggacctagtagtcaattatgttaattctcatatgggcataaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaactgtcctagagtatttggtgtcttttggagtgtggattcgcactcctccacct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacaacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccactgttag
>gnl|hbvcds|MF772360_PreC_P-E Feature FT:CDS MF772360_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 666). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccgttctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcctagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MF772361_PreC_P-E Feature FT:CDS MF772361_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 801). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcggctctgtttcggcatgacttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggtggtaatttggaaga
tcaagcatccagagacctagtagtcaattatgtcaatattaatgtgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagataccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcaaaagatctcaatctccagcttccaaatgttag
>gnl|hbvcds|MF772362_PreC_P-E Feature FT:CDS MF772362_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 960). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaaga
tccagcatccagagacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MG491180_PreC_P-E Feature FT:CDS MG491180_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate ShrSan59CC). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=632 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacctcgacccttataaagaatttggagctagtgtggagttactctcgtttttgcctggtgacttctttc
cttccgtacgagatcttctagataccgcctcagctctgtaccgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagcaattctgtgctggggggaattaatgactctagctacctgggtgggtggtaatttggaaga
cccaacatccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcaca
tttcttgtcttacttttggaagagaaacagttattgaatatttggtgtctttcggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctccatctcggggatctca
>gnl|hbvcds|MH464856_PreC_P-E Feature FT:CDS MH464856_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate MA134). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaaggatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcttaaagttcaggcaattattgtggtttcaca
tttcttctctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagagnnnnnngcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaat
gttag
>gnl|hbvcds|MH580614_PreC_P-E Feature FT:CDS MH580614_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 177). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580615_PreC_P-E Feature FT:CDS MH580615_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 188). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580616_PreC_P-E Feature FT:CDS MH580616_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 190). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580617_PreC_P-E Feature FT:CDS MH580617_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 193). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcagacaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580618_PreC_P-E Feature FT:CDS MH580618_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 199). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580619_PreC_P-E Feature FT:CDS MH580619_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 200). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580620_PreC_P-E Feature FT:CDS MH580620_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 201). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580621_PreC_P-E Feature FT:CDS MH580621_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 209). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagttagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaactgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tacagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580622_PreC_P-E Feature FT:CDS MH580622_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 210). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagttagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaactgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tacagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580623_PreC_P-E Feature FT:CDS MH580623_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 232). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580624_PreC_P-E Feature FT:CDS MH580624_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 226). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagttagttatgttaatactaatatgggactaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaactgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tacagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580625_PreC_P-E Feature FT:CDS MH580625_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 239). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagttagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaactgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tacagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580626_PreC_P-E Feature FT:CDS MH580626_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 240). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttgacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttttttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatcttctgagcattgctcacctcac
cacactgcactcaggcaagccattctttgctggggagatctaatgaatctaggaacctgggtgggtggaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaacatgggcctaaagttcagacaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcaagct
tatagaccaccaaatgcccctatcttatcaacacttccggagacttctgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580628_PreC_P-E Feature FT:CDS MH580628_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 304). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcagacaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580629_PreC_P-E Feature FT:CDS MH580629_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 306). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagttagttatgttaatactaatatgggactaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaactgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tacagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580630_PreC_P-E Feature FT:CDS MH580630_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 310). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccgccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580631_PreC_P-E Feature FT:CDS MH580631_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 333). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttttttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggaactaatgactctagccacctgggtgggggtaaatttggaaga
tccagcatccagggacctagtagttagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tacagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580632_PreC_P-E Feature FT:CDS MH580632_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 334). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttttttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggaactaatgactctagccacctgggtgggggtaaatttggaaga
tccagcatccagggacctagtagttagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tacagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580633_PreC_P-E Feature FT:CDS MH580633_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 398). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagttagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtcttacttttgggagagaaactgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcaagct
tacagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580634_PreC_P-E Feature FT:CDS MH580634_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 400). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctctcgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagttagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtcttacttttggaagagaaactgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tacagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580635_PreC_P-E Feature FT:CDS MH580635_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 401). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagttagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtcttacttttggaagagaaactgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tacagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580636_PreC_P-E Feature FT:CDS MH580636_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 402). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagttagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtcttacttttggaagagaaactgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tacagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580637_PreC_P-E Feature FT:CDS MH580637_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 408). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagttagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaactgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tacagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580638_PreC_P-E Feature FT:CDS MH580638_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 416). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagatactgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggaactaatgactctggctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagttagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580640_PreC_P-E Feature FT:CDS MH580640_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 438). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgctctcaggcaagccattctttgctggggggaactaatgactctagccacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagctgcccaatgttag
>gnl|hbvcds|MH580641_PreC_P-E Feature FT:CDS MH580641_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 439). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgctctcaggcaagccattctttgctggggggaactaatgactctagccacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagctgcccaatgttag
>gnl|hbvcds|MH580644_PreC_P-E Feature FT:CDS MH580644_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 458). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcagacaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580645_PreC_P-E Feature FT:CDS MH580645_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 472). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacatcgacccttataaagaatttggagcttctgtcgagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtttcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggaattaatgactctagctacctgggtgggtgcaaatttggaaga
tccaggatccagggaactagtagttagttatgtcaatactcatatgggcctaaagttcaggcaattaatgtggtttcaca
tttcttgtctcacttttggaagagaacttgtcgtagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tacagaccacaaaatgcccctatcttatcaacacttccggagactgctgttgttagatcaagaggcaggtcctctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagctccccgatgttag
>gnl|hbvcds|MH580646_PreC_P-E Feature FT:CDS MH580646_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 476). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagttagttatgttaatactaatatgggactaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaactgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tacagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580647_PreC_P-E Feature FT:CDS MH580647_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 490). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagttagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaactgtcatagagtatttggtatcttttggagtgtggattcgcactcctccagct
tacagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580648_PreC_P-E Feature FT:CDS MH580648_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 522). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagctactgtcgagttactctcgtttttgcctcctgacttctttc
cttcagtaaaagatcttctagataccatctcagctctgtttcgggatgccttagaatctcctgagcattgttcacctcac
catactgcaatcaggcaagccattctttgctgggggaaccttatgaatctagctacctgggtgggtgtaaatttggaaga
tcaagcatccagggacctagtagttagttatgtcaatactaatatgggcctacagttcaggcaattattgtggtttcaca
tgtcttgtatcatttttggaagggaaactgtcttagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tacagaccaccaaatgcccctatcttatcaacacttcctgagactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagacgatctcaatctccatcttcccaatgttag
>gnl|hbvcds|MH580649_PreC_P-E Feature FT:CDS MH580649_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 523). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagttagttatgttaatactaatatgggactaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaactgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tacagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580650_PreC_P-E Feature FT:CDS MH580650_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 619). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgaggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcat
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaacttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcagacaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580651_PreC_P-E Feature FT:CDS MH580651_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 623). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580652_PreC_P-E Feature FT:CDS MH580652_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 668). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttttttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggaactaatgactctagccacctgggtgggggtaaatttggaaga
tccagcatccagggacctagtagttagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tacagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH725010_PreC_P-E Feature FT:CDS MH725010_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SA-263). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggaactaatgactctagccacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaactattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttga
>gnl|hbvcds|MH725020_PreC_P-E Feature FT:CDS MH725020_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SA-298). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggagaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtaagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgctag
>gnl|hbvcds|MH725021_PreC_P-E Feature FT:CDS MH725021_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SA-311). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggagaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtaagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH725024_PreC_P-E Feature FT:CDS MH725024_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SA-321). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcaataagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggaactaatgactctagccacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaactattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|MH725042_PreC_P-E Feature FT:CDS MH725042_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SA-387). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggagaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtaagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH725114_PreC_P-E Feature FT:CDS MH725114_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SA-870). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggagaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtaagttatgtcaatactaacatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtcttacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgccgaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH725141_PreC_P-E Feature FT:CDS MH725141_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SA-1227). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcaataagagatcttctagataccgcctcagctctgtatcgggaggccttagaatctccggaccattgttcacctcac
catacagcactcaggcaagccattctttgctggggggaattaatgactctagccacctgggtgggtggaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaactattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|MH725192_PreC_P-E Feature FT:CDS MH725192_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SA-1435). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtaagagatcttctagataccgcctcagctctgtatcgggatgcgttggaatctcccgagcattgttcatctcac
cacactgcactcaggcaagccattctttgctggggagacctaatgtctctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtaagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcttagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagctccccaatgttag
>gnl|hbvcds|MH918655_PreC_P-E Feature FT:CDS MH918655_PreC_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatcaagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MK321264_PreC_P-E Feature FT:CDS MK321264_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 1332). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MK720631_PreC_P-E Feature FT:CDS MK720631_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate p1332_RCA). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MK720632_PreC_P-E Feature FT:CDS MK720632_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate p1332_CL). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MN507840_PreC_P-E Feature FT:CDS MN507840_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 3816_HBVe_GC). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcctcatgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacacggcactcaggcaagccattctttgctggggggatgtaatgaatctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctggtagtcggttatgtcaatactaatatgggcctaaagttcagacaattattgtggtttcaca
cttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccacct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgtagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccgatgttag
>gnl|hbvcds|MN507841_PreC_P-E Feature FT:CDS MN507841_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 7032_HBVe_GC). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggcttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MN507842_PreC_P-E Feature FT:CDS MN507842_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 1048_ocHBVe_GC). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttgacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctctatcgggatgccttagaatctcctgagcattgttcacctcat
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
cccagcatccagagacctagtagtcagttatgtcaatactaatatgggactaaagttcaggcaattattgtggtttcaca
tttcttgtctcactttgggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcccactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
acgaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MN507843_PreC_P-E Feature FT:CDS MN507843_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 1969_ocHBVe_GC). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggggtaaatttggaaga
tccagcatccagggacctagtggtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MN507844_PreC_P-E Feature FT:CDS MN507844_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 2504_ocHBVe_GC). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
attcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaataataatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccacct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MN507845_PreC_P-E Feature FT:CDS MN507845_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 2547_ocHBVe_GC). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacttagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MN507846_PreC_P-E Feature FT:CDS MN507846_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 2506_ocHBVe_GC). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcac
cacacggcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggggtaaatttggaaga
tccagcatccagggacctagtggtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtacttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MN507847_PreC_P-E Feature FT:CDS MN507847_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 2664_HBVe_GC). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
attcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagagacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MN507848_PreC_P-E Feature FT:CDS MN507848_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 6778_HBVe_GC). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcac
cacactgcactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggggtaaatttggaaga
tccagcatccagggacctagtggtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|X75657_PreC_P-E Feature FT:CDS X75657_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Bas). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcac
cacactgcactcaggcaagccattctttgctggggagaactaatgactctagctacctgggtgggtgtaaatttggaaga
tccagcatccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcaca
tttcttgtctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|X85274_PreC_P-E Feature FT:CDS X85274_PreC_P-E of [Viruses] Hepatitis B Virus genotype E (isolate patient Tedde'89). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgatccttataaagaatttggagcttctgtggagttactatcgtttttgcctaatgacttctatc
cttcagtaagagatcttctagataccgcctcagctctatatcgggaagccttagaatctcctgagcattgttcacctcac
catactgcactcaggcaagcaattctttgctggggggacttaatgactctagctacctgggtgggtggtaatttggaaga
tccaacatccagggacgtagtagtcagttatgttaacactaatgtgggccttaagttcaggcaactattgtggtttcaca
tttcttgtctcacttttggaagagaaactgtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
© 1998-2020Legal notice