Dataset for nucleotide sequence PreC of genotype E

[Download (right click)] [Edit] [Sequences] [Repertoires]

510 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

AM494692_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ491112_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
EU726953_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KF798275_PreC_P-E      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
X85274_PreC_P-E        atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KP856982_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KP856973_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KP857010_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctacttt
MG491180_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KF798305_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KP856998_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KF798259_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KF798270_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KF798298_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
EU726883_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactat
KP857001_PreC_P-E      atgcaactttttcacctctgcctaatcatctcgtgttcatgtcctactat
KP857011_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactrt
KP857055_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
HM363611_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AB219534_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AB915180_PreC_P-E      atgcaactttttcacctctgcctaatcacctcttgttcatgtcctactgt
GQ161825_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
HM363607_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctagtgt
AB219529_PreC_P-E      atgcaactttttcacctctgcctaatcatctcctgttcatgtcctactgt
MH580648_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MF772356_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
FN594761_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MH580645_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MF772359_PreC_P-E      atgcttctttttcacctctgcctaatcatctcttgttcatgtcctactgt
FN594748_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
HM363610_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
HM363565_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
HM363609_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgtgcatgtcatactgt
EU239220_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AB274979_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MF772357_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
FN545842_PreC_P-E      atgcractttttcacctctgcctartcatctcttgttcatgtcctayttt
MF772355_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
FN594766_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
FN594762_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
FN545823_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AB915178_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AB274977_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
FN594759_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
FN594758_PreC_P-E      atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgt
FN594760_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350161_PreC_P-E      atgcaactttttaacctttgcctaatcatctgttgttcatgtcctactgt
AF350164_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350127_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350139_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactct
AF350167_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgt
AF350134_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactct
AF350135_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactct
LT623851_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MF772361_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
HM363608_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgtgcatgtcatactgt
MF772358_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
HM363601_PreC_P-E      atgcaactttttcaccgctgcctaatcatctcttgttcatgtcctactgt
FN594765_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
FN594753_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350211_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
HM363606_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
HM363602_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
FN594751_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
FN594763_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KF849724_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AB219533_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
FJ349240_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
HM363599_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MT731872_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KF849728_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
HM363605_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
FN594756_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
HM363603_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AB194948_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161811_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
LT623843_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161786_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactct
FN594749_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AB274975_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
LT623847_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactct
MN507840_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
HM363598_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
HM363578_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctaatgt
AB274976_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KM606739_PreC_P-E      atgtaactttttcacctctgcctaatcatctcttgttcaggtcccactgt
HM363600_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161807_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161768_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
HM363597_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AM494691_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AB274984_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MH580626_PreC_P-E      atgcaactttttgacctctgcctaatcatctcttgttcatgtcctactgt
AM494695_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161823_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AB205188_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KU736913_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctacttt
KT749841_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
HM363566_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AB274982_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
HM363575_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
HM363576_PreC_P-E      atgcaactttttcacctctgcctaatcatttcttgttcatgtcctactgt
KF849726_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KF849720_PreC_P-E      atgcaactttttcacctctgcctaatcatctcgtgttcatgtcctactgt
LT623844_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KF849713_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AB201290_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KT192626_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KF849717_PreC_P-E      atgcaactttttgacctctgcctaatcatctcttgttcatgtcctactgt
KF849725_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AY935700_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
DQ060823_PreC_P-E      atgcaactttttgacctctgcctaatcatctcttgttcatgtcctactgt
MH464856_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KF849714_PreC_P-E      atgcaactttttcacctctgcctaatcatctmtkgttcwkgtcctactgt
KF849727_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KF849719_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KF849716_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
DQ060822_PreC_P-E      atgcaactttttgacctctgcctaatcatctcttgttcatgtcctactgt
KF922438_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KF922439_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AY738144_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AY738145_PreC_C-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AY738147_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AY738146_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KF849722_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
EU620071_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
JQ000009_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MN507841_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KF849715_PreC_P-E      atgttactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KF849723_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MF772354_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
DQ060824_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
DQ060825_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KF849721_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
LT623849_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
HM363604_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AM494791_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161783_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161824_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
LT623842_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KF849718_PreC_P-E      atgcaactttttcacctctgcctaatcatgtcttgttcatgtcctactgt
FN545827_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
FN545822_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161796_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161797_PreC_P-E      acgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
FN594752_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350187_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350184_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AB274980_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161757_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AB274985_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
FN545821_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161831_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AM494714_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350110_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
HM363587_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350208_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161773_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161802_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
EU239222_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MH725192_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350144_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
HM363595_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350176_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
LT623845_PreC_P-E      atgcaactttttcacctctgcctagtcatctctcgttcatgtcctactgt
KU736909_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161834_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350153_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350132_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350169_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350133_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350155_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgtacatgtcctactgt
AF350131_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350122_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350190_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350125_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350130_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MT731911_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KU736911_PreC_P-E      atgyaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AM494703_PreC_P-E      atgcaactttttcacctctgcctaatcatcttttgttcatgtcctactgt
AB274981_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161826_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350117_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161812_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161775_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350145_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350210_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350177_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350206_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350146_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350205_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350212_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350213_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350188_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350154_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgtacatgtcctactgt
MW082636_PreC_P-E      atgcaactttt---cctctgcctaatcatctcttgttcatgtcctactgt
AB106564_PreC_C-E      atgcaactttttgacctctgcctaatcatctcttgttcatgtcctactgt
MN507842_PreC_P-E      atgcaactttttgacctctgcctaatcatctcttgttcatgtcctactgt
GQ161755_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161835_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
FN594750_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161758_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161766_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161774_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
HM363594_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
HM363596_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350168_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AB205191_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AB091256_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MN967527_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AM494706_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MH580650_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AM494710_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AM494697_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AM494709_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
LT623848_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KM606738_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgt
GQ161820_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161803_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
EU239224_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
EU239217_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AB274978_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
EU239219_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
EU239223_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
HQ700551_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
HM363593_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350105_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
HM363569_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgtgcatgtcctactgt
HM363570_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350175_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MH725141_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161815_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AB201287_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350142_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350143_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KF170741_PreC_P-E      atgcaactttttcacccctgcctaatcatctcttgttcatgtcctactgt
GQ161785_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KU736892_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
HM363574_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161814_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AB201288_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161782_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161792_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
LT623846_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KU736904_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161762_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AM494711_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AM494698_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350182_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350123_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AB274973_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AY739674_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AY739675_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MH580633_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AB274974_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MH580631_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MH580632_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MH580652_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MH580624_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MH580629_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MH580646_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MH580649_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AB194947_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
HM363573_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MH580647_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MH580634_PreC_P-E      atgcaactttttcacctctgcctaatcatctctcgttcatgtcctactgt
MH580621_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MH580622_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MH580625_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MH580637_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MH580635_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MH580636_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350203_PreC_P-E      atgcaactttttcacctttgcctaatcatctcttgttcatgtcctactgt
DQ060830_PreC_P-E      atgcaactttttgacctctgcctaatcatctcttgttcatgtcctactgt
MF772360_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
HQ700550_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
HQ700552_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MF772362_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KU736912_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350112_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350137_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350107_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350103_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350109_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161760_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KU736893_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
HM363577_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161794_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161780_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AB205190_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161778_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161810_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KU736902_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AB201289_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AB915175_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AB274972_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161759_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MN507846_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161801_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161772_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161764_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161787_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161770_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161800_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161819_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161829_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161791_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161793_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161827_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MN507843_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MN507848_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161833_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161756_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161795_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KU736895_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KU736896_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MN507844_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MH725114_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
LT623850_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KU736901_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KU736900_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MH580640_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MH580641_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MH580617_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MH580628_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MH580644_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KU736897_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgt
KU736898_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgt
GQ161763_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161777_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
FJ349237_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
FJ349238_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AM494694_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AM494696_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AM494700_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161790_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161808_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AB205189_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
EU239221_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
DQ060826_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
DQ060827_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
DQ060828_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
DQ060829_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
HM363571_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MN967526_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MH725042_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MH725020_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MH725021_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
X75657_PreC_P-E        atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MN507845_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KU736910_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KU736894_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KU736891_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KF170742_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
JQ000008_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161832_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161771_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
FJ349226_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AB274969_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
HM363579_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
HM363580_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
HM363581_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MN507847_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MH918655_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KU736903_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KU736899_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161836_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161781_PreC_P-E      atgcatctttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161765_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161761_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
FN545841_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
FJ349239_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
EU239226_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AM494713_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AM494705_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AM494702_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AM494701_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AM494689_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KU736906_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KU736907_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KU736908_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161769_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161779_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AM494707_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MH580630_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MN967529_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AM494690_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AM494693_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AM494699_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AM494704_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AM494708_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AM494712_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AM494715_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AM494717_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161816_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
HM363572_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KU736905_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
KX186584_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MH580614_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MH580615_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MH580616_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MH580618_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MH580619_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MH580620_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MH580623_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MH580651_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MK321264_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MK720631_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MK720632_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MN967528_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AB274971_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161776_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161784_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161789_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161798_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161804_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161817_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
GQ161828_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AB091255_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
HM363583_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
HM363584_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350114_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350180_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350181_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350219_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350220_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350207_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350209_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MH725010_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MH725024_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350198_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350199_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
HM363585_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
MH580638_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AB205129_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AB205192_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
HM363582_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
HM363590_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
HM363588_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
HM363589_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgc
HM363567_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
HM363568_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
HM363586_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
HM363591_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
HM363592_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AB274970_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350215_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350151_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350126_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350214_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350218_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350204_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350197_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350166_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350149_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350183_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350159_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350160_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350202_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350179_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350172_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350150_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350200_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350201_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350115_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350116_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350140_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350141_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350111_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350101_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350191_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350186_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350136_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350113_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350173_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350185_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350147_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350128_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350106_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350104_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350100_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350216_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350217_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350165_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350189_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350171_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350118_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350170_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350178_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350162_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350163_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350099_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350102_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350119_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350174_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350192_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350193_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350194_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350195_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350196_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350108_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350138_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350152_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350120_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350121_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350148_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350124_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350158_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350156_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
AF350157_PreC_P-E      atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgt
                       * *   *****   **  ****** ***  *   ** *  ***  * *  

AM494692_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacc
GQ491112_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgatc
EU726953_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttaggacatggacattgacc
KF798275_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
X85274_PreC_P-E        tcaagcctccaagctgtgccttgggtggctttagggcatggacattgatc
KP856982_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttaggacatggacattgacc
KP856973_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttaggacatggacattgacc
KP857010_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
MG491180_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacctcgacc
KF798305_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacc
KP856998_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacc
KF798259_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KF798270_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KF798298_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
EU726883_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacg
KP857001_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
KP857011_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
KP857055_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttaggacatggacattgacc
HM363611_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttaggacatggacatcgacc
AB219534_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttaggacatggacattgacc
AB915180_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgatc
GQ161825_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggaccttgacc
HM363607_PreC_P-E      tcaagcatccaagatgtcccttgggtggctttagggcatggacatcgacc
AB219529_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacc
MH580648_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttaggacatggacattgacc
MF772356_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
FN594761_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttaggacatggacatygacc
MH580645_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttaggacatggacatcgacc
MF772359_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttaggacatggacattgacc
FN594748_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttaggacatggacattgacc
HM363610_PreC_P-E      tcaagcctcccagctgtcccttgggtggctttagggcatggacatcgacc
HM363565_PreC_P-E      tcaagcctccacgctgtgccttgggtggctttagggcatggacatcgacc
HM363609_PreC_P-E      tcaagccttcaagctgtgccttgggtggctttaggacatggacattgacc
EU239220_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacc
AB274979_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacc
MF772357_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttgggacatggacattgacc
FN545842_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
MF772355_PreC_P-E      tcaagcctccaagcagtgccttgggtggctttaggacatggacatcgacc
FN594766_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
FN594762_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacc
FN545823_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttrgggcatggacatcgacc
AB915178_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttgggacatggacattgacc
AB274977_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttaggacatggacattgacc
FN594759_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttaggacatggacattgacc
FN594758_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
FN594760_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttaggrcatggacattgacc
AF350161_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350164_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350127_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350139_PreC_P-E      tcaagcctgcaagctgtgccttgggtggctttggggcatggacattgacc
AF350167_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacc
AF350134_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350135_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
LT623851_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttaggacatggacattgacc
MF772361_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacc
HM363608_PreC_P-E      tcaagccttcaagctgtgccttgggtggctttaggacatggacattgacc
MF772358_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttaggacatggacattgacc
HM363601_PreC_P-E      tcaagccttcaagctgtgccttgggtggctttaggacatggacattgacc
FN594765_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
FN594753_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacc
AF350211_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
HM363606_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggtcattgacc
HM363602_PreC_P-E      tcaagcctccaagctgtgccttgggtgtctttagggcatggtcattgacc
FN594751_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacc
FN594763_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacc
KF849724_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttaggacatggacattgacc
AB219533_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacc
FJ349240_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgatc
HM363599_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttaggacatggacattgacc
MT731872_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttaggacatggacattgacc
KF849728_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttaggacatggacattgacc
HM363605_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttaggacatggacattgacc
FN594756_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
HM363603_PreC_P-E      tcaagccttcaagctgtgccttgggtggctttaggacatggacattgacc
AB194948_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacc
GQ161811_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacatygacc
LT623843_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacc
GQ161786_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacc
FN594749_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
AB274975_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
LT623847_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttgggacatggacattgacc
MN507840_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttgggacatggacattgacc
HM363598_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttaggacatggacattgacc
HM363578_PreC_P-E      tcaagcctccaagttgtgccttgggtggctttagggcatggacattgacc
AB274976_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggatattgacc
KM606739_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
HM363600_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttaggacatggacatcgacc
GQ161807_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttaggacatggacattgacc
GQ161768_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttaggacatggacattgacc
HM363597_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
AM494691_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacc
AB274984_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttaggacatggacattgacc
MH580626_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttgggacatggacattgacc
AM494695_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttgggacatggacattgacc
GQ161823_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacc
AB205188_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KU736913_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
KT749841_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttaggacatggacattgacc
HM363566_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttaggacatggacattgacc
AB274982_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttaggacatggacattgacc
HM363575_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
HM363576_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KF849726_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
KF849720_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggtcatcgacc
LT623844_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
KF849713_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AB201290_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KT192626_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KF849717_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KF849725_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AY935700_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
DQ060823_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MH464856_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KF849714_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KF849727_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KF849719_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KF849716_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
DQ060822_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KF922438_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttaggacatggacattgacc
KF922439_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttaggacatggacattgacc
AY738144_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AY738145_PreC_C-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AY738147_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AY738146_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KF849722_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
EU620071_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttgggacatggacattgacc
JQ000009_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MN507841_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KF849715_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KF849723_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MF772354_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
DQ060824_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
DQ060825_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KF849721_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
LT623849_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
HM363604_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AM494791_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
GQ161783_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttaggacatggacattgacc
GQ161824_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttaggacatggacattgacc
LT623842_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttrggacatggacattgacc
KF849718_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
FN545827_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttaggrcatggacattgacc
FN545822_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttaggacatggacatcgacc
GQ161796_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
GQ161797_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttgggacatggacattgacc
FN594752_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttaggacatggacattgacc
AF350187_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttaggacatggacattgacc
AF350184_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
AB274980_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
GQ161757_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
AB274985_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
FN545821_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacc
GQ161831_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
AM494714_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttgggacatggacattgacc
AF350110_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttaggacatggacattgacc
HM363587_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttaggacatggacattgacc
AF350208_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
GQ161773_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttaggacatggacattgacc
GQ161802_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttaggacatggacattgacc
EU239222_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
MH725192_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350144_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttaggacatggacattgacc
HM363595_PreC_P-E      tcaagcctccaagatgtcccttgggtggctttggggcatggacattgacc
AF350176_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
LT623845_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttaggacatggacattgacc
KU736909_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttrgggcatggacatygacc
GQ161834_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacc
AF350153_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350132_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350169_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350133_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350155_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350131_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350122_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350190_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350125_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350130_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MT731911_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttaggacatggacattgacc
KU736911_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacatygacc
AM494703_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AB274981_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
GQ161826_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350117_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
GQ161812_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttaggacatggacattgacc
GQ161775_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
AF350145_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttaggacatggacattgacc
AF350210_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350177_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
AF350206_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350146_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350205_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350212_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350213_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350188_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350154_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MW082636_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AB106564_PreC_C-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MN507842_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
GQ161755_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
GQ161835_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
FN594750_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttaggacatggacattgacc
GQ161758_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
GQ161766_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
GQ161774_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
HM363594_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
HM363596_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
AF350168_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgact
AB205191_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AB091256_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MN967527_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AM494706_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MH580650_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AM494710_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AM494697_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AM494709_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
LT623848_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttgggrcatggacattgacc
KM606738_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacc
GQ161820_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
GQ161803_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttgggacatggacattgacc
EU239224_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
EU239217_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacc
AB274978_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
EU239219_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
EU239223_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
HQ700551_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
HM363593_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttgggacatggacattgacc
AF350105_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
HM363569_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
HM363570_PreC_P-E      tcaagcctccaagctgtcccttgggtggctttggggcatggacattgacc
AF350175_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
MH725141_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
GQ161815_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgatc
AB201287_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgatc
AF350142_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350143_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KF170741_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
GQ161785_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttaggacatggacattgacc
KU736892_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacatagacc
HM363574_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
GQ161814_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacatygacc
AB201288_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
GQ161782_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
GQ161792_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
LT623846_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KU736904_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttrgggcatggacattgacc
GQ161762_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
AM494711_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgatc
AM494698_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350182_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350123_PreC_P-E      tcaagccttcaagctgtgccttgggtggctttggggcatggacattgacc
AB274973_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AY739674_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AY739675_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MH580633_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AB274974_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
MH580631_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MH580632_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MH580652_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MH580624_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MH580629_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MH580646_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MH580649_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AB194947_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
HM363573_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MH580647_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MH580634_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MH580621_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MH580622_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MH580625_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MH580637_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MH580635_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MH580636_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350203_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
DQ060830_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgatc
MF772360_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
HQ700550_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
HQ700552_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MF772362_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KU736912_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttrgggcatggacattgatc
AF350112_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350137_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350107_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350103_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350109_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
GQ161760_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KU736893_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
HM363577_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
GQ161794_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
GQ161780_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AB205190_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
GQ161778_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
GQ161810_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KU736902_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacatagacc
AB201289_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AB915175_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AB274972_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
GQ161759_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MN507846_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
GQ161801_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
GQ161772_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
GQ161764_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
GQ161787_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
GQ161770_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
GQ161800_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
GQ161819_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
GQ161829_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
GQ161791_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
GQ161793_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
GQ161827_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MN507843_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MN507848_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
GQ161833_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgatc
GQ161756_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
GQ161795_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KU736895_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KU736896_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MN507844_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MH725114_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
LT623850_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KU736901_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KU736900_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MH580640_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MH580641_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MH580617_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MH580628_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MH580644_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KU736897_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KU736898_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
GQ161763_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
GQ161777_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
FJ349237_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
FJ349238_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AM494694_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AM494696_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AM494700_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
GQ161790_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
GQ161808_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AB205189_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
EU239221_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
DQ060826_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
DQ060827_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
DQ060828_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
DQ060829_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
HM363571_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttaggacatggacattgacc
MN967526_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MH725042_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttgggacatggacattgacc
MH725020_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MH725021_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
X75657_PreC_P-E        tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MN507845_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KU736910_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KU736894_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgatc
KU736891_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacatagacc
KF170742_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
JQ000008_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
GQ161832_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
GQ161771_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
FJ349226_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AB274969_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
HM363579_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
HM363580_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
HM363581_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MN507847_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MH918655_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KU736903_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KU736899_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
GQ161836_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
GQ161781_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
GQ161765_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
GQ161761_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
FN545841_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgatc
FJ349239_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgatc
EU239226_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AM494713_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgatc
AM494705_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AM494702_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AM494701_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AM494689_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KU736906_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgatc
KU736907_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgatc
KU736908_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgatc
GQ161769_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
GQ161779_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AM494707_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MH580630_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MN967529_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AM494690_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AM494693_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AM494699_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AM494704_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AM494708_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AM494712_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AM494715_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AM494717_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
GQ161816_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
HM363572_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KU736905_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
KX186584_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MH580614_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MH580615_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MH580616_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MH580618_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MH580619_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MH580620_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MH580623_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MH580651_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MK321264_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MK720631_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MK720632_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MN967528_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AB274971_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
GQ161776_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
GQ161784_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
GQ161789_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
GQ161798_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
GQ161804_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
GQ161817_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
GQ161828_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AB091255_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
HM363583_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
HM363584_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350114_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350180_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350181_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350219_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350220_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350207_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
AF350209_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
MH725010_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
MH725024_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350198_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350199_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
HM363585_PreC_P-E      tcaagcctcccagctgtgccttgggtggctttagggcatggacattgacc
MH580638_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AB205129_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AB205192_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
HM363582_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
HM363590_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
HM363588_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
HM363589_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
HM363567_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
HM363568_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
HM363586_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
HM363591_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
HM363592_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AB274970_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350215_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350151_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350126_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350214_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350218_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350204_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgacc
AF350197_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350166_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350149_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350183_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350159_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350160_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350202_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350179_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttgggacatggacattgacc
AF350172_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350150_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350200_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350201_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350115_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350116_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350140_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacc
AF350141_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacc
AF350111_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350101_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350191_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350186_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350136_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350113_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgact
AF350173_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350185_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350147_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350128_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350106_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350104_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttagggcatggacattgatc
AF350100_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350216_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350217_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350165_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350189_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350171_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350118_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350170_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350178_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350162_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgatc
AF350163_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgatc
AF350099_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350102_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350119_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350174_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350192_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350193_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350194_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350195_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350196_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350108_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350138_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350152_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350120_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350121_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350148_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350124_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350158_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350156_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
AF350157_PreC_P-E      tcaagcctccaagctgtgccttgggtggctttggggcatggacattgacc
                       ****** * *  *  ** ********* **** ** *****   * **  

AM494692_PreC_P-E      cttataaagaatttggagcttctgtggatttactctcgtttttgccttct
GQ491112_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
EU726953_PreC_P-E      cttataaagaatttggagcttctgtgcagttactctcgtttttgccttct
KF798275_PreC_P-E      cttataaagaatttggagcgactgtggagttactctcatttttgccttct
X85274_PreC_P-E        cttataaagaatttggagcttctgtggagttactatcgtttttgcctaat
KP856982_PreC_P-E      cttataaagaatttggagcttctgtggagttactctcgtttttgcctact
KP856973_PreC_P-E      cttataaagaatttggagcttctgtggagttactctcgtttttgcctcag
KP857010_PreC_P-E      cttataaagaatttggagcttctgtggagttactctcgtttttgccttct
MG491180_PreC_P-E      cttataaagaatttggagctagtgtggagttactctcgtttttgcctggt
KF798305_PreC_P-E      cttataaagaatttggagcttctgtggagttactctcgtttttgccttct
KP856998_PreC_P-E      cttataaagaatttggagctactatagagttactctcgtttttgccttct
KF798259_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
KF798270_PreC_P-E      cttataaagaatttggagctaccgtggagttactctcgtttttgccttct
KF798298_PreC_P-E      cttataaagaatttggagctaccgtggagttactctcgtttttgccttct
EU726883_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
KP857001_PreC_P-E      cttataaagaatttggagcttctgtggagttactctcgtttttgccttct
KP857011_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
KP857055_PreC_P-E      cttataaagaatttggagcttctgtggagttactctcatttttgccttct
HM363611_PreC_P-E      cttataaagaatttggagcttccgtggagttactctcttttttgcctact
AB219534_PreC_P-E      cttataaagaatttggagcttctgtggagttactctcgtttttgcctact
AB915180_PreC_P-E      cttataaagaatttggagctactgtggagttaatctcgtttttgcctagt
GQ161825_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgcctggt
HM363607_PreC_P-E      cttataaagaatttggagcttccgtggagttactctcgtttttgccttct
AB219529_PreC_P-E      cttataaagaatttggagctactttgcagttactctcgtttttgcctggt
MH580648_PreC_P-E      cttataaagaatttggagctactgtcgagttactctcgtttttgcctcct
MF772356_PreC_P-E      cttataaagaatttggagcttctgtggagttactctcgtttttgcctcct
FN594761_PreC_P-E      cttataaagaatttggagctwctgkggagttactctcgtttttgccttct
MH580645_PreC_P-E      cttataaagaatttggagcttctgtcgagttactctcgtttttgccttct
MF772359_PreC_P-E      cttataaagaattaggagctactgtggagttactctcgtttttacataat
FN594748_PreC_P-E      cttataaagaatttggagcttccgtggagttactctcgtttttgccttct
HM363610_PreC_P-E      cttataaagaatttggagcttctgtggagttactctcgtttttgcctcct
HM363565_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgcctctt
HM363609_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
EU239220_PreC_P-E      cttataaagaatttggagctactgtggagttactctcttttttgcctggt
AB274979_PreC_P-E      cttataaagaatttggagcgactgtgcagttactctcgtttttgcctggt
MF772357_PreC_P-E      cttataaagaatttggagctactgttgagttactctcttttttgcctgct
FN545842_PreC_P-E      cttataaagaatttggagctactgtsgagttactctcatttttgcctggt
MF772355_PreC_P-E      cttataaagaatttggagcttctgtggagttactctcttttttgccttct
FN594766_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccktct
FN594762_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
FN545823_PreC_P-E      cttataaagaatttggagctaccgtggagttactctcgtttttgccttct
AB915178_PreC_P-E      cttataaagaatttggagcttctgtggagttactctcgtttttgccttct
AB274977_PreC_P-E      cttataaagaatttggagctactgtagagttactctcgtttttgcctact
FN594759_PreC_P-E      cttataaagaatttggagcttctgtgsagytactctcgtttttgccttct
FN594758_PreC_P-E      cttataaagaatttggagctacagtggagttactctcgtttttgccttct
FN594760_PreC_P-E      cttataaagaatttggagctagtgtggagttactctcgtttttgccttct
AF350161_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350164_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350127_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350139_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350167_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350134_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350135_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
LT623851_PreC_P-E      cttataaagaatttggagcttctgtggagttactctcgtttttgccttct
MF772361_PreC_P-E      cttataaagaatttggagctactgtggagttactctcttttttgccttct
HM363608_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
MF772358_PreC_P-E      cttataaagaatttggagcttctgtggagttactctcttttttgccggct
HM363601_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgcctgcc
FN594765_PreC_P-E      cttataaagaatttggagcttcygtggagttactctcktttttgccgtct
FN594753_PreC_P-E      cttataaagaatttggagcttccgtggagttactctcgtttttgccttct
AF350211_PreC_P-E      cttataaagaatttggagcttctgtggagttactctcgtttttgccttct
HM363606_PreC_P-E      cctataaagaatttggagctactgtggagttactctcgtttttgccttcc
HM363602_PreC_P-E      cttataaagaatttggcgcttctgtggagttactctcgtttttgccttcc
FN594751_PreC_P-E      cttataaagaatttggagctastgtggagttactctcgtttttgccgtct
FN594763_PreC_P-E      cttataaagaatttggagctagtgtggagttactctcgtttttgccttct
KF849724_PreC_P-E      cttataaagaatttggagctactgtggagttactctcttttttgccttct
AB219533_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgcctact
FJ349240_PreC_P-E      cttataaagaatttggagctactgtggagttactctcttttttgcctcct
HM363599_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgcctact
MT731872_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgcctcct
KF849728_PreC_P-E      cttataaagaatttggagcttctgtggagttactctcgtttttgccttct
HM363605_PreC_P-E      cttataaagaatttggagctactgtggagttactctcttttttgccttct
FN594756_PreC_P-E      cttataaagaatttggagcttctgtggagttactctcgtttttgccttct
HM363603_PreC_P-E      cttataaagaatttggagctagtgtggagttactctcgtttttgccttct
AB194948_PreC_P-E      cttataaagaatttggagcttctgtggacttactctcgtttttgcctgcc
GQ161811_PreC_P-E      cttataaagaatttggagcttctgtggagttactctcttttttgccttct
LT623843_PreC_P-E      cttataaagaatttggagcttctgtggagttactctcgtttttgccttct
GQ161786_PreC_P-E      cttataaagaatttggagcttctgtggagttactctcgtttttgccttct
FN594749_PreC_P-E      cttataaagaatttggagcttctgtggagttactctcgtttttgccttct
AB274975_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgcctgtt
LT623847_PreC_P-E      cttataaagaatttggagctactgtgcagttactctcgtttttgcctcct
MN507840_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgcctcat
HM363598_PreC_P-E      cttataaagaatttggaggtactgtggagttactctcgtttttgccttct
HM363578_PreC_P-E      cttataaagaatttggagcttctgtggagttactctcgtttttgccttct
AB274976_PreC_P-E      cttataaagaatttggagctactgtggagttgctctcgtttttgcctact
KM606739_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgcctgct
HM363600_PreC_P-E      cttataaagaatttggagcttctgtggagttactctcgtttttgccttcc
GQ161807_PreC_P-E      cgtataaagaatttggagcttctgtggagttactctcgtttttgccttct
GQ161768_PreC_P-E      cttataaagaatttggagcttctgtggagttactctcgtttttgccttct
HM363597_PreC_P-E      cttataaagaatttggagcttctgtggagttactctcgtttttgccttct
AM494691_PreC_P-E      cttataaagagtttggagctactgtggagttactctcgtttttgcctaat
AB274984_PreC_P-E      cttataaagaatttggagcttctgtggagttactctcgtttttgcctgct
MH580626_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AM494695_PreC_P-E      cttataaagaatttggagcttctgttgagttactctcgtttttgccttct
GQ161823_PreC_P-E      cttatgaagaatttggagctactgtggagttactctcgtttttgccttct
AB205188_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
KU736913_PreC_P-E      cttataaagaatttggagctwstgtggagttgctctcgtttttgccttct
KT749841_PreC_P-E      tttataaagaatttggagctactgtggagttactctcgtttttgcctact
HM363566_PreC_P-E      cttataaagaatttggagcttctgtggagttactctcgtttttgccttct
AB274982_PreC_P-E      cttataaagaatttggagcttctgtggagttactctcgtttttgccttct
HM363575_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
HM363576_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
KF849726_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
KF849720_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
LT623844_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
KF849713_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AB201290_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
KT192626_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
KF849717_PreC_P-E      cgtataaagaatttggagctactgtggagttactctcgtttttgccttct
KF849725_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AY935700_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
DQ060823_PreC_P-E      cttataaagaatttggagctactgtggagttactctcatttttgccttct
MH464856_PreC_P-E      cttataaaggatttggagctactgtggagttactctcgtttttgccttct
KF849714_PreC_P-E      cttataaagaatttggagctactgtggagttacyctcgtttttgccttct
KF849727_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
KF849719_PreC_P-E      cttataaagaatttggagctactgtggagttcctctcgtttttgccttct
KF849716_PreC_P-E      cgtataaagaatttggagctactgtggagttactctcgtttttgccttct
DQ060822_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
KF922438_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
KF922439_PreC_P-E      cttataaagaatttggagcttctgtggagttactctcgtttttgccttct
AY738144_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AY738145_PreC_C-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AY738147_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AY738146_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
KF849722_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
EU620071_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
JQ000009_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
MN507841_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
KF849715_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
KF849723_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
MF772354_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
DQ060824_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
DQ060825_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
KF849721_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
LT623849_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgcctwct
HM363604_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AM494791_PreC_P-E      ctcataaagaatttggagctactgtggagttactctcgtttttgccttct
GQ161783_PreC_P-E      cttataaagaatttggagcttctgtggagttactctcgtttttgccttct
GQ161824_PreC_P-E      cttataaagaatttggagcttctgtggagttactctcgtttttgccttct
LT623842_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
KF849718_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttcy
FN545827_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
FN545822_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
GQ161796_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
GQ161797_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
FN594752_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350187_PreC_P-E      cttataaagaatttggagcttctgtggagttactctcctttttgccttct
AF350184_PreC_P-E      cttataaagaatttggagcttctgtggagttactctcgtttttgccttct
AB274980_PreC_P-E      cttataaagaatttggagcttctgtggagttactctcgtttttgcctgct
GQ161757_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgcctact
AB274985_PreC_P-E      cttataaagaatttggagcttccgtggagttactctcgtttttgccttct
FN545821_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
GQ161831_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AM494714_PreC_P-E      cttataaagaatttggagctagtgtggagttactctcgtttttgccttct
AF350110_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
HM363587_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350208_PreC_P-E      cttataaagaatttggagctactgtggagttactctcatttttgcctaat
GQ161773_PreC_P-E      cttataaagaatttggagcttctgtggagttactctcgtttttgccttct
GQ161802_PreC_P-E      cttataaagaatttggagcttctgtggagttactctcgtttttgccttct
EU239222_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
MH725192_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350144_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
HM363595_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttcc
AF350176_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
LT623845_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
KU736909_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
GQ161834_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350153_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350132_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350169_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350133_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350155_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350131_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350122_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350190_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350125_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350130_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
MT731911_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
KU736911_PreC_P-E      cttataaagaatttggagctactgtgsagttactctcgtttttgccttct
AM494703_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AB274981_PreC_P-E      cttataaagaatttggagctactgtcgagttactctcgtttttgccttct
GQ161826_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350117_PreC_P-E      cttataaagaatttggagccactgtggagttactctcgtttttgccttct
GQ161812_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
GQ161775_PreC_P-E      cttataaagaatttggagcttctgtggagttactctcgtttttgccttct
AF350145_PreC_P-E      cttataaagaatttggagctactgtgcagttactctcgtttttgccttct
AF350210_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350177_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350206_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350146_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350205_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350212_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350213_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350188_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350154_PreC_P-E      cttataaagaatttggagctactgtggagtcactctcgtttctgccttct
MW082636_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttcg
AB106564_PreC_C-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
MN507842_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
GQ161755_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
GQ161835_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
FN594750_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
GQ161758_PreC_P-E      cttataaagaatttggagctactgtggagttactctcttttttgccttct
GQ161766_PreC_P-E      cttataaagaatttggagctactgtggagttactctcttttttgccttct
GQ161774_PreC_P-E      cttataaagaatttggagctactgtggagttactctcttttttgccttct
HM363594_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
HM363596_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350168_PreC_P-E      cttataaagaatttggagcttctgtggagttactctcgtttttgccttct
AB205191_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttcc
AB091256_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
MN967527_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AM494706_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
MH580650_PreC_P-E      cttataaagaatttggagctactgaggagttactctcgtttttgccttct
AM494710_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AM494697_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AM494709_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
LT623848_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
KM606738_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
GQ161820_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
GQ161803_PreC_P-E      cttataaagaatttggagctactgaggagttactctcgtttttgccttct
EU239224_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccgtct
EU239217_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AB274978_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
EU239219_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
EU239223_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
HQ700551_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
HM363593_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttcg
AF350105_PreC_P-E      cttataaagaatttggagctactgaggagttactctcgtttttgccttct
HM363569_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
HM363570_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350175_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
MH725141_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
GQ161815_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AB201287_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350142_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350143_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
KF170741_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
GQ161785_PreC_P-E      cttataaagaatttggagctactgtggagttgctctcgtttttgccttct
KU736892_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
HM363574_PreC_P-E      cttataaagaatttggagctactgtggaattactctcgtttttgccttct
GQ161814_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AB201288_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
GQ161782_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
GQ161792_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
LT623846_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
KU736904_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
GQ161762_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AM494711_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AM494698_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350182_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350123_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AB274973_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AY739674_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AY739675_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
MH580633_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AB274974_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
MH580631_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
MH580632_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
MH580652_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
MH580624_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
MH580629_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
MH580646_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
MH580649_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AB194947_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
HM363573_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
MH580647_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
MH580634_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
MH580621_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
MH580622_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
MH580625_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
MH580637_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
MH580635_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
MH580636_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350203_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
DQ060830_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
MF772360_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
HQ700550_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
HQ700552_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
MF772362_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
KU736912_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350112_PreC_P-E      cttataaagaatttggagctactgtggagatactctcgtttttgccttct
AF350137_PreC_P-E      cttataaagaatttggagctactgaggagttactctcgtttttgccttct
AF350107_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350103_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350109_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
GQ161760_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
KU736893_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
HM363577_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
GQ161794_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
GQ161780_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AB205190_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
GQ161778_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
GQ161810_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
KU736902_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AB201289_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AB915175_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AB274972_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
GQ161759_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
MN507846_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
GQ161801_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
GQ161772_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
GQ161764_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
GQ161787_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
GQ161770_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
GQ161800_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
GQ161819_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
GQ161829_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
GQ161791_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
GQ161793_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
GQ161827_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
MN507843_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
MN507848_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
GQ161833_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
GQ161756_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
GQ161795_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
KU736895_PreC_P-E      cttataaagaatttggagctactgtggagttactctygtttttgccttct
KU736896_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
MN507844_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
MH725114_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
LT623850_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
KU736901_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
KU736900_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
MH580640_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
MH580641_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
MH580617_PreC_P-E      cttataaagaatttggagctactgtggagttactctcatttttgccttct
MH580628_PreC_P-E      cttataaagaatttggagctactgtggagttactctcatttttgccttct
MH580644_PreC_P-E      cttataaagaatttggagctactgtggagttactctcatttttgccttct
KU736897_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
KU736898_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
GQ161763_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
GQ161777_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
FJ349237_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
FJ349238_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AM494694_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttcc
AM494696_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttcc
AM494700_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttcc
GQ161790_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
GQ161808_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AB205189_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
EU239221_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
DQ060826_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
DQ060827_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
DQ060828_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
DQ060829_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
HM363571_PreC_P-E      cttataaagaatttggagcttctgtggagttactctcgtttttgccttct
MN967526_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
MH725042_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
MH725020_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
MH725021_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
X75657_PreC_P-E        cttataaagaatttggagctactgtggagttactctcgtttttgccttct
MN507845_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
KU736910_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
KU736894_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
KU736891_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
KF170742_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
JQ000008_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
GQ161832_PreC_P-E      cttataaagaatttggagctactgtggagttactctcttttttgccttct
GQ161771_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
FJ349226_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AB274969_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
HM363579_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
HM363580_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
HM363581_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
MN507847_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
MH918655_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
KU736903_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
KU736899_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
GQ161836_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
GQ161781_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
GQ161765_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
GQ161761_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
FN545841_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
FJ349239_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
EU239226_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AM494713_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AM494705_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AM494702_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AM494701_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AM494689_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
KU736906_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
KU736907_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
KU736908_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
GQ161769_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
GQ161779_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AM494707_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
MH580630_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
MN967529_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AM494690_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AM494693_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AM494699_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AM494704_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AM494708_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AM494712_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AM494715_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AM494717_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
GQ161816_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
HM363572_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
KU736905_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
KX186584_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
MH580614_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
MH580615_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
MH580616_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
MH580618_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
MH580619_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
MH580620_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
MH580623_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
MH580651_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
MK321264_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
MK720631_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
MK720632_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
MN967528_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AB274971_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
GQ161776_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
GQ161784_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
GQ161789_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
GQ161798_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
GQ161804_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
GQ161817_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
GQ161828_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AB091255_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
HM363583_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
HM363584_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350114_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350180_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350181_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350219_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350220_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350207_PreC_P-E      cttataaagaatttggagctactgtggagttactctcatttttgccttct
AF350209_PreC_P-E      cttataaagaatttggagctactgtggagttactctcatttttgccttct
MH725010_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
MH725024_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350198_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350199_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
HM363585_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttcc
MH580638_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AB205129_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccgtct
AB205192_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccgtct
HM363582_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
HM363590_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
HM363588_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
HM363589_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
HM363567_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
HM363568_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
HM363586_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
HM363591_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
HM363592_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AB274970_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350215_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgttttggccttct
AF350151_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350126_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350214_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350218_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttcc
AF350204_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350197_PreC_P-E      cttataaagaatttggagccactgtggagttactctcgtttttgccttct
AF350166_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350149_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350183_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350159_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350160_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350202_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350179_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350172_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350150_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350200_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350201_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350115_PreC_P-E      cttataaagaatttggagctactgaggagttactctcgtttttgccttct
AF350116_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350140_PreC_P-E      cttataaagaatttggagctacagtggagttactctcgtttttgccttct
AF350141_PreC_P-E      cttataaagaatttggagctacagtggagttactctcgtttttgccttct
AF350111_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350101_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350191_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350186_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350136_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350113_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350173_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350185_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350147_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350128_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350106_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350104_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350100_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350216_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350217_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350165_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350189_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350171_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350118_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350170_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350178_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350162_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350163_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350099_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350102_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350119_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350174_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350192_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350193_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350194_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350195_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350196_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350108_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350138_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350152_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttcc
AF350120_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350121_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350148_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350124_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350158_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350156_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
AF350157_PreC_P-E      cttataaagaatttggagctactgtggagttactctcgtttttgccttct
                          ** ***  ** ** *         *       *  ***   *     

AM494692_PreC_P-E      gacttctttccttcggttcgagatctcctagacactgccttagctctgta
GQ491112_PreC_P-E      gacttctttccttcggttcgagatctcctagacactgcctcagctctgta
EU726953_PreC_P-E      gacttctttccttcaatacgagatcttctagataccgccgcagctctgta
KF798275_PreC_P-E      gatttctttccgtctgtacgagatcttctagataccgccgcagctctata
X85274_PreC_P-E        gacttctatccttcagtaagagatcttctagataccgcctcagctctata
KP856982_PreC_P-E      gacttctttccttcagtacgagatcttctagatactgcctcagctctgta
KP856973_PreC_P-E      gacttctttccttcagtacgcgatcttctagataccgcctcagctctgta
KP857010_PreC_P-E      gacttctttccttccgtacgagatcttctagataccgcctcagctctgtt
MG491180_PreC_P-E      gacttctttccttccgtacgagatcttctagataccgcctcagctctgta
KF798305_PreC_P-E      gacttctttccttcagtacgagatctgctagataccgccgcagctctgta
KP856998_PreC_P-E      gacttctatccgtcagtacgagatcttctagataccgcctcagctctgta
KF798259_PreC_P-E      gacttctttccttcagtacgagatctccttgataccgcctcagctctgta
KF798270_PreC_P-E      gacttctttccttcagtacgagatcttctagataccgcctcagctctgta
KF798298_PreC_P-E      gacttctttccttcagtacgagatcttctagataccgcctcagctctgta
EU726883_PreC_P-E      gacttctttccttcagtacgagatcttctagataccgcctcagctctgta
KP857001_PreC_P-E      gacttctttccttcagtacgagatcttctagataccgccgcagctctgta
KP857011_PreC_P-E      gacttctttccttccgcacgagatcttctagataccgcctcagctctgta
KP857055_PreC_P-E      gacttctttccttcggtacgagatcttctagataccgcctcagccctgta
HM363611_PreC_P-E      gacttctatccttccgtaagagatcttctagataccgcctcagctctgtt
AB219534_PreC_P-E      gacttctttccttccgtaagagatcttctagataccgcctccgctctgtt
AB915180_PreC_P-E      gacttctttccttckgtacgagatctactagataccgcctcagctctgtt
GQ161825_PreC_P-E      gacttctttccttcagtaagagatcttctatataccgcctcagctctgta
HM363607_PreC_P-E      gatttctttccttcagtaagagatattatagatactgcctcaggtttgtt
AB219529_PreC_P-E      gatttctttccttcagtaagagatcttctagataccgcctcagctctgtt
MH580648_PreC_P-E      gacttctttccttcagtaaaagatcttctagataccatctcagctctgtt
MF772356_PreC_P-E      gacttctttccttcagtaaaagatcttctagataccgcctcagctctatt
FN594761_PreC_P-E      gacttctttccttcagtaagagatctactagataccgcctcagctctctg
MH580645_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgtt
MF772359_PreC_P-E      gacttctttccttcactaagagatcttctagataccgcctcagctctgta
FN594748_PreC_P-E      gacttctatccttcagtaagagatcttctagataccgcctcagctctcta
HM363610_PreC_P-E      gatttctttccttcagtaagagatcttctggataccgccgcagctttgtt
HM363565_PreC_P-E      gacttctttccttcagtaaaagatcttctagataccgcctcagctctata
HM363609_PreC_P-E      gacttctttccttcagtaagagatcttttggtaaccgctccggctcggaa
EU239220_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgccacagctctgta
AB274979_PreC_P-E      gaattctttccttcagtaagagatcttctagataccgcctcagctctgta
MF772357_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgtt
FN545842_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcccaagctctgtt
MF772355_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctctgctctgta
FN594766_PreC_P-E      gacttctttccttcagtaaaagatcttctagataccgcctcagctctgta
FN594762_PreC_P-E      gacttctttccttccgtaagagatcttctagataccgcctcagctctctt
FN545823_PreC_P-E      gacttctttccttcrgtaaragatctcctagataccgcctcagctctgtt
AB915178_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AB274977_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctttgta
FN594759_PreC_P-E      gacttctttccttcagtaagagatctcctagataccgcctcagctctgta
FN594758_PreC_P-E      gacttctttccttcagtaaaagatcttctagataccgcctcagctctgta
FN594760_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350161_PreC_P-E      gacttctttccttcagttcgagatcttctagatactgcctcagctctgta
AF350164_PreC_P-E      gacttctttccttccgttcgagatcttctagatactgcctcagctctgta
AF350127_PreC_P-E      gacttctttccttcagttcgagatcttctagatactgcctcagctctgta
AF350139_PreC_P-E      gacttctttccttccgttcgagatctcctagatactgcctcagctctgta
AF350167_PreC_P-E      gacttctttccttccgttcgagatctcctagatactgcctcagctctgta
AF350134_PreC_P-E      gacttctttccttccgttcgagatctcctagatactgcctcagctctgta
AF350135_PreC_P-E      gacttctttccttccgttcgagatctcctagatactgcctcagctctgta
LT623851_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgccacagctctgta
MF772361_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcggctctgtt
HM363608_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgtt
MF772358_PreC_P-E      gacttctatccttcagtaaaagatcttctagattccgccacagctctgtt
HM363601_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcttcagctctgtt
FN594765_PreC_P-E      gacttctttccttcagtaaaagatcttctagataccgcctcagctctgta
FN594753_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350211_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
HM363606_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctttgta
HM363602_PreC_P-E      gacttctttccttcagtaagagatcttatagataccgcctcagctttgta
FN594751_PreC_P-E      gatttctttccgtcagtaagagatcttctagataccgcctcagctctgta
FN594763_PreC_P-E      gatttctttccttcagtaagagatcttctagataccgcctcagctctgta
KF849724_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctctgctctgtt
AB219533_PreC_P-E      gatttctttccttcagtaagagatcttctagataccgcctcagctctgta
FJ349240_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgccaaagctctgtt
HM363599_PreC_P-E      gacttctttccttcagtaagagatcttctagatactgcatcagctctgtt
MT731872_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgccaaagctctgtt
KF849728_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctctgctttgtt
HM363605_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcatcagctctgta
FN594756_PreC_P-E      gacttctttccttcagtaagagatcttctagatacagcctcagctctgta
HM363603_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcccaagctctgta
AB194948_PreC_P-E      gacttctttccttcagtaagagatcttctagatactgcctcagctctgta
GQ161811_PreC_P-E      gacttctttccttcagcaagagatcttctagatacygcctcagctctgta
LT623843_PreC_P-E      gatttctttccttcagtaagagatcttctagataccgccagagctctgtt
GQ161786_PreC_P-E      gacttctttccttcagtaagagatcttctagataccggcccagctctgta
FN594749_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcaactctgta
AB274975_PreC_P-E      gacttctatccttcagtaagagatcttctagataccgcctcagctctgtt
LT623847_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
MN507840_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
HM363598_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctttgta
HM363578_PreC_P-E      gacttctttccttcagtgagagatcttctagataccgcctcagctctgtt
AB274976_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
KM606739_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgtt
HM363600_PreC_P-E      gacttctttccttcagtaagagatcttctagatactgcctcagctctgtt
GQ161807_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
GQ161768_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcatcagctctgta
HM363597_PreC_P-E      gacttctttccttcaataagagatcttctagataccgcctcagctctgta
AM494691_PreC_P-E      gacttctttccttccgtaagagatcttctagataccgcctcagctctgta
AB274984_PreC_P-E      gacttctatccttcagtaaaagatcttctagataccgcctcagctctgta
MH580626_PreC_P-E      gacttttttccttcagtaagagatcttctagataccgcctcagctctgta
AM494695_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctccgctctgta
GQ161823_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AB205188_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
KU736913_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
KT749841_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
HM363566_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AB274982_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
HM363575_PreC_P-E      gacttctttccttcagtaagagatcttctagatactggctcatctctgta
HM363576_PreC_P-E      gacttctttccttcagtaagagatcttctagatactggctcatctctgtg
KF849726_PreC_P-E      gacttctttccgtcagtaagagaccttctagataccgcctctgctctgta
KF849720_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctctgctctgta
LT623844_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
KF849713_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctctgctctgta
AB201290_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctctgctctgta
KT192626_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctctgctctgta
KF849717_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctctgctctgta
KF849725_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctctgctctgta
AY935700_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctctgctctgta
DQ060823_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctctgctctgta
MH464856_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctctgctctgta
KF849714_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctctgctctgta
KF849727_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctctgctctgta
KF849719_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctctgctctgta
KF849716_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctctgctctgta
DQ060822_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctccgctctgta
KF922438_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctctgctctgta
KF922439_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctctgctctgta
AY738144_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctctgctctgta
AY738145_PreC_C-E      gacttctttccttcagtaagagatcttctagataccgcctctgctctgta
AY738147_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctctgctctgta
AY738146_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctctgctctgta
KF849722_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctctgctctgta
EU620071_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctctgctctgta
JQ000009_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
MN507841_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
KF849715_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctctgctctgta
KF849723_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctctgctctgta
MF772354_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctctgctctgta
DQ060824_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctctgctctgta
DQ060825_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctctgctctgta
KF849721_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctctgctctgta
LT623849_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
HM363604_PreC_P-E      gacttctttccttcaataagagatcttctagataccgcctcagctctctt
AM494791_PreC_P-E      gacttctttccgtccgtaagagatcttctagataccgcctcagctctgta
GQ161783_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctcta
GQ161824_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctcta
LT623842_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
KF849718_PreC_P-E      gacttctttccttcagtaagagatcttytagataccgcctctgctctgta
FN545827_PreC_P-E      gacttctttccttcagtaaragatcttctagataccgcctcagctctgta
FN545822_PreC_P-E      gacttctttccttcagttagagatcttctagataccgcctcagctctgtt
GQ161796_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
GQ161797_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
FN594752_PreC_P-E      gatttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350187_PreC_P-E      gacttctttccttccataagagatcttctagataccgcctcagctctgta
AF350184_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AB274980_PreC_P-E      gacttctwtccgtcagtaaaagatcttctagataccgcctcagctctgta
GQ161757_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AB274985_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
FN545821_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
GQ161831_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AM494714_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350110_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
HM363587_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350208_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctttgta
GQ161773_PreC_P-E      gacttctttccttcaataagagatcttctagataccgcctcagctctgta
GQ161802_PreC_P-E      gacttctttccttcaataagagatcttctagataccgcctcagctctgta
EU239222_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
MH725192_PreC_P-E      gacttctttccttccgtaagagatcttctagataccgcctcagctctgta
AF350144_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
HM363595_PreC_P-E      gacttctttccttcagtaagagatcttatagatactgcctcagctttgta
AF350176_PreC_P-E      gacttctttccttcagtaagagatcttcttgataccgcctcagctctgta
LT623845_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
KU736909_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
GQ161834_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350153_PreC_P-E      gacttctttccttcagtacgagatctcctagataccgcctcagctctgta
AF350132_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctttgta
AF350169_PreC_P-E      gacttctttccttcagtacgagatcttctagataccgcctcagctctgta
AF350133_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctttgta
AF350155_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350131_PreC_P-E      gacttctttccttcagtgagagatcttctagataccgcctcagctctgta
AF350122_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctttgta
AF350190_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctttgta
AF350125_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctttgta
AF350130_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctttgta
MT731911_PreC_P-E      gacttctttccttcagtaagagatcttctagatacagcctcagctctgta
KU736911_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AM494703_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AB274981_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctttgtt
GQ161826_PreC_P-E      gacttctttccttcagtaaaagatcttctatataccgcctcagctctgta
AF350117_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgtt
GQ161812_PreC_P-E      gacttctttccttcagtaagagatcttttagattccgcatcagctatgtt
GQ161775_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350145_PreC_P-E      gacttctttccgtcagtaagagatcttctagataccgcctcagctctgtt
AF350210_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350177_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350206_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350146_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350205_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350212_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350213_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350188_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350154_PreC_P-E      gacttctttccttcagtacgagatcttctagataccgcctcagctctgta
MW082636_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AB106564_PreC_C-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctcta
MN507842_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctcta
GQ161755_PreC_P-E      gacttctttccttcagtaagggatcttctagataccgcctcagctttgta
GQ161835_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctttgta
FN594750_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
GQ161758_PreC_P-E      gacttctttccttcagtaaaagatcttctagataccgcctcagctctgta
GQ161766_PreC_P-E      gacttctttccttcagtaaaagatcttctagataccgcctcagctctgta
GQ161774_PreC_P-E      gacttctttccttcagtaaaagatcttctagataccgcctcagctctgta
HM363594_PreC_P-E      gacttctttccttcagtaagagctcttctagataccgcctcagctctgtt
HM363596_PreC_P-E      gacttctttccttcagtaagagctcttctagataccgcctcagctctgtt
AF350168_PreC_P-E      gacttctttccttcagtaagggatcttctagataccgcctcagctctgta
AB205191_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AB091256_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
MN967527_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AM494706_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
MH580650_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AM494710_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AM494697_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AM494709_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
LT623848_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
KM606738_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctccgctctgta
GQ161820_PreC_P-E      gacttctttcattcagtaagagatcttctagataccgcctcagctctgta
GQ161803_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
EU239224_PreC_P-E      gacttctttccttcagtaagggatcttctagataccgcctcagcactgta
EU239217_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AB274978_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
EU239219_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctcta
EU239223_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctcttta
HQ700551_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
HM363593_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgtt
AF350105_PreC_P-E      gacttctttccttcagtaagagatcttcttgataccgcctccgctctgta
HM363569_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
HM363570_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350175_PreC_P-E      gacttctttccttcagtaagagatcttcttgataccgcctccgctctgta
MH725141_PreC_P-E      gacttctttccttcaataagagatcttctagataccgcctcagctctgta
GQ161815_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctcta
AB201287_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350142_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctttgta
AF350143_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctttgta
KF170741_PreC_P-E      gatttctttccttcagtaagagatcttctagataccgcctcagctctgta
GQ161785_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
KU736892_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
HM363574_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
GQ161814_PreC_P-E      gacttctttcattcagtaagagatcttctagataccgcctcagctctgta
AB201288_PreC_P-E      gacttctttccttcggttagagatcttctagataccgcctcagctctgta
GQ161782_PreC_P-E      gatttctttccttcagtaagagatcttctagataccgcctcagctctgta
GQ161792_PreC_P-E      gatttctttccttcagtaagagatcttctagataccgcctcagctctgta
LT623846_PreC_P-E      gacttctttccttcagtaagagatcttctagatacagcctcagctctgta
KU736904_PreC_P-E      gacttytttccttcagtaagagatcttctagataccgcctcagctctgta
GQ161762_PreC_P-E      gacttctttcattcagtaagagatcttctagataccgcctcagctctgta
AM494711_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AM494698_PreC_P-E      gacttttttccttcagtaagagatcttctagataccgcctcagctctgta
AF350182_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350123_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AB274973_PreC_P-E      gacttctttccttcagtaaaagatcttctagataccgcctcagctctgta
AY739674_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AY739675_PreC_P-E      gacttctttccttcagtaaaagatcttctagataccgcctcagctctgta
MH580633_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AB274974_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
MH580631_PreC_P-E      gacttttttccttcagtaagagatcttctagataccgcctcagctctgta
MH580632_PreC_P-E      gacttttttccttcagtaagagatcttctagataccgcctcagctctgta
MH580652_PreC_P-E      gacttttttccttcagtaagagatcttctagataccgcctcagctctgta
MH580624_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
MH580629_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
MH580646_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
MH580649_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AB194947_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
HM363573_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctttgta
MH580647_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
MH580634_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
MH580621_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
MH580622_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
MH580625_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
MH580637_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
MH580635_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
MH580636_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350203_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
DQ060830_PreC_P-E      gacttctttccttcagtaagagatcttctagatactgcctcagctctgta
MF772360_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
HQ700550_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
HQ700552_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
MF772362_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
KU736912_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350112_PreC_P-E      gacttctttccttcagtaagagatcttcttgataccgcctccgctctgta
AF350137_PreC_P-E      gacttctttccttcagtaagagatcttcttgataccgcctccgctctgta
AF350107_PreC_P-E      gacttctttccttcagtaagagatcttcttgataccgcctccgctctgta
AF350103_PreC_P-E      gacttctttccttcagtaagagatcttcttgataccgcctccgctctgta
AF350109_PreC_P-E      gacttctttccttcagtaagagatcttcttgataccgcctccgctctgta
GQ161760_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
KU736893_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctcttta
HM363577_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
GQ161794_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
GQ161780_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AB205190_PreC_P-E      gacttctttccttcagttagagatcttctagataccgcctcagctctgta
GQ161778_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
GQ161810_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
KU736902_PreC_P-E      gacttttttccttcagtaagagatcttctagataccgcctcagctctgta
AB201289_PreC_P-E      gatttctttccttcagtaagagatcttctagataccgcctcagctctgta
AB915175_PreC_P-E      gatttctttccttcagtaagagatcttctagataccgcctcagctctgta
AB274972_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
GQ161759_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
MN507846_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
GQ161801_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
GQ161772_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
GQ161764_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
GQ161787_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
GQ161770_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
GQ161800_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
GQ161819_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
GQ161829_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
GQ161791_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
GQ161793_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctcta
GQ161827_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctcta
MN507843_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
MN507848_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
GQ161833_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
GQ161756_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
GQ161795_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
KU736895_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
KU736896_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
MN507844_PreC_P-E      gacttctttcattcagtaagagatcttctagataccgcctcagctctgta
MH725114_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
LT623850_PreC_P-E      gacttctttccttccgtaagagatcttctagataccgcctcagctctgta
KU736901_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
KU736900_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
MH580640_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
MH580641_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
MH580617_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
MH580628_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
MH580644_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
KU736897_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
KU736898_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
GQ161763_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
GQ161777_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
FJ349237_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
FJ349238_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AM494694_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AM494696_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AM494700_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
GQ161790_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
GQ161808_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AB205189_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
EU239221_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
DQ060826_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctccgctctgta
DQ060827_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctccgctctgta
DQ060828_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctccgctctgta
DQ060829_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctccgctctgta
HM363571_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
MN967526_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
MH725042_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
MH725020_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
MH725021_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
X75657_PreC_P-E        gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
MN507845_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
KU736910_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
KU736894_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
KU736891_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
KF170742_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
JQ000008_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctctgctctgta
GQ161832_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
GQ161771_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
FJ349226_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AB274969_PreC_P-E      gacttctttccttcagtaagagatctgctagataccgcctcagctctgta
HM363579_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
HM363580_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
HM363581_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
MN507847_PreC_P-E      gacttctttcattcagtaagagatcttctagataccgcctcagctctgta
MH918655_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
KU736903_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
KU736899_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
GQ161836_PreC_P-E      gacttctttcattcagtaagagatcttctagataccgcctcagctctgta
GQ161781_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
GQ161765_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
GQ161761_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
FN545841_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
FJ349239_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
EU239226_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AM494713_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AM494705_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AM494702_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AM494701_PreC_P-E      gacttctttccttcagtaagagatcttttagataccgcctcagctctgta
AM494689_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
KU736906_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
KU736907_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
KU736908_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
GQ161769_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
GQ161779_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AM494707_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
MH580630_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
MN967529_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AM494690_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AM494693_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AM494699_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AM494704_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AM494708_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AM494712_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AM494715_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AM494717_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
GQ161816_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
HM363572_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
KU736905_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
KX186584_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
MH580614_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
MH580615_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
MH580616_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
MH580618_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
MH580619_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
MH580620_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
MH580623_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
MH580651_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
MK321264_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
MK720631_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
MK720632_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
MN967528_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AB274971_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
GQ161776_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
GQ161784_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
GQ161789_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
GQ161798_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
GQ161804_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
GQ161817_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
GQ161828_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AB091255_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
HM363583_PreC_P-E      gacttctttccgtcagtaagagatcttctagatactgcctccgcgctgta
HM363584_PreC_P-E      gacttctttccgtcagtaagagatcttctagatactgcctccgcgctgta
AF350114_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctctgctctgta
AF350180_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350181_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350219_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350220_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350207_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctttgta
AF350209_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctttgta
MH725010_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
MH725024_PreC_P-E      gacttctttccttcaataagagatcttctagataccgcctcagctctgta
AF350198_PreC_P-E      gacttctttccttcagttcgagatcttctagataccgcctcagctctgta
AF350199_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
HM363585_PreC_P-E      gacttctttccttcagtaagagatcttctagatactgcctcagctctgta
MH580638_PreC_P-E      gacttctttccttcagtaagagatcttctagatactgcctcagctctgta
AB205129_PreC_P-E      gacttctttccgtcagttagagatcttctagataccgcctcagctctgta
AB205192_PreC_P-E      gacttctttccgtcagttagagatcttctagataccgcctcagctctgta
HM363582_PreC_P-E      gacttctttccgtcagtaagagatcttctagatactgcctcagctctgta
HM363590_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
HM363588_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcttcagctctgta
HM363589_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcttcagctctgta
HM363567_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
HM363568_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
HM363586_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctttgta
HM363591_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
HM363592_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AB274970_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350215_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350151_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350126_PreC_P-E      gacttttttccttcagtaagagatcttctagataccgcctcagctctgta
AF350214_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350218_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350204_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350197_PreC_P-E      gacttctttccgtcagtaagagatcttctagataccgcctcagctctgta
AF350166_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350149_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350183_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350159_PreC_P-E      gacttctttccttcagtaagagatcttctagatactgcctcagctctgta
AF350160_PreC_P-E      gacttctttccttcagtaagagatcttctagatactgcctcagctctgta
AF350202_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350179_PreC_P-E      gacttctttccttcagttagagatcttctagataccgcctcagctctgta
AF350172_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350150_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350200_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350201_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350115_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350116_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350140_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350141_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350111_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350101_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350191_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350186_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350136_PreC_P-E      gacttctttccttcagtacgagatcttctagataccgcctcagctctgta
AF350113_PreC_P-E      gacttctttccgtcagtaagagatcttctagataccgcctcagctctgta
AF350173_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350185_PreC_P-E      gacttctttccttcagtaagagatcttctagatactgcctcagctctgta
AF350147_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350128_PreC_P-E      gacttctttccttcagtacgagatcttctagataccgcctcagctctgta
AF350106_PreC_P-E      gacttctttccttctgtaagagatcttctagataccgcctcagctctgta
AF350104_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350100_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350216_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350217_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350165_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350189_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350171_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcttcagctctgta
AF350118_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350170_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350178_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350162_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350163_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350099_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350102_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350119_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350174_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350192_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350193_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350194_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350195_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350196_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350108_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350138_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350152_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctata
AF350120_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctata
AF350121_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctata
AF350148_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctata
AF350124_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctata
AF350158_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350156_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
AF350157_PreC_P-E      gacttctttccttcagtaagagatcttctagataccgcctcagctctgta
                       ** ** * **  **       *   *  *     *               

AM494692_PreC_P-E      tcgggatgccttagagtctcctgagcattgctcacctcatcatacagcac
GQ491112_PreC_P-E      tcgggatgccttagagtctcctgagcattgctcacctcaccatacagcac
EU726953_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcagctcaccatactgcac
KF798275_PreC_P-E      tcgggatgcgttagaatctcctgagcattgttcacctcaccatactgcac
X85274_PreC_P-E        tcgggaagccttagaatctcctgagcattgttcacctcaccatactgcac
KP856982_PreC_P-E      tcgggatgccttagaatctcctgagcattgtacacctcaccatactgcac
KP856973_PreC_P-E      tcggcaagccttagaatctcctgagcattgttcacctcaccatactgcaa
KP857010_PreC_P-E      tcgggatgccttagagtctcctgagcattgctcacctcaccatactgcac
MG491180_PreC_P-E      ccgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
KF798305_PreC_P-E      tcgggatgccttagaatctcctgagcattgtacacctcaccatactgcac
KP856998_PreC_P-E      tcgggaagccttagaatctcaggatcattgctcacctcaccatactgcac
KF798259_PreC_P-E      tcgggaagccttagaatctcctgagcattgttcacctcatcatactgcac
KF798270_PreC_P-E      tcgggaagccttagaatctcctgagcattgttcacctcaccatactgcac
KF798298_PreC_P-E      tcgggatgccttagaatcgcctgagcattgttcacctcaccatactgcac
EU726883_PreC_P-E      tcgggaagctttagaatctcctgagcattgctcacctcaccacactgcac
KP857001_PreC_P-E      tcgggaagctttagaatctcctgagcattgctcacctcaccatactgcac
KP857011_PreC_P-E      tcgggaagccttagagtctcctgagcattgctcacctcaccatactgcac
KP857055_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcatcatactgcaa
HM363611_PreC_P-E      tagggatgccttggaatctcctgagcattgttcacctcaccatactgcac
AB219534_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
AB915180_PreC_P-E      tcgggatgccttagaatcttctgagcattgctcacctcaccacactgcac
GQ161825_PreC_P-E      tcgggatgccttagaatctcctgagcattgctcacctcatcatactgcac
HM363607_PreC_P-E      tcgggatgccttcgaatctcttgagcattgttcaccttaccatactgcac
AB219529_PreC_P-E      tcgggatgccttagaatctcctgagcattgtacccctcaccatactgcgc
MH580648_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcaa
MF772356_PreC_P-E      tcgggatgccttggaatcaggtgaacattgctcaccgcaccacactgcac
FN594761_PreC_P-E      tcggggtgccttagaatctcctgagcattgttcacctcaccatactgctc
MH580645_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
MF772359_PreC_P-E      tcgggatgccttagaatctcctgaacactgctcaccgcaccacactgcac
FN594748_PreC_P-E      tcgggatgccttagaatcttctgagcattgttcaactcaccctgctgcac
HM363610_PreC_P-E      tcgggatgccttcgaatctcctgagcattgtacacctcaccatactgcac
HM363565_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
HM363609_PreC_P-E      ccggaatgccttagaatttcctgagcattgttcaactcaacctaccgcaa
EU239220_PreC_P-E      tcgggatgccttagaatctcctgagcattgctcacctcaccatactgcac
AB274979_PreC_P-E      tcgggaagccttagaatctcctgagcattgtacacctcatcacacggcac
MF772357_PreC_P-E      tcgggatgccttagaatctcctgaacatttttcaccgcaccacactgcac
FN545842_PreC_P-E      tcgggatgctttagaatctcctgagcattgttcacctcatcacactgcac
MF772355_PreC_P-E      tcgggatgccttagaatcttctgagcattgttcagctcaccatactgcac
FN594766_PreC_P-E      tagggatgccttgaaatctcctgagcattgttcmcctcaccacactgcac
FN594762_PreC_P-E      tcgggatgccttagaatctcctgagcattgctcacctcaccatagtgcac
FN545823_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
AB915178_PreC_P-E      tcgggatgccatagaatctccggagcattgttcacctcaccacacggcac
AB274977_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
FN594759_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacytcacaccactgcac
FN594758_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcccytcaccacactgcac
FN594760_PreC_P-E      tcgggatgccttggaatctcctgagcattgttcccytcaccacactgcac
AF350161_PreC_P-E      tcgggatgccttagaatctcctgagcattgctcacctcaccatacagcac
AF350164_PreC_P-E      tcgggatgccttagaatctcctgagcattgctcacctcaccatacagcac
AF350127_PreC_P-E      ccgggatgccttagaatctcctgagcattgctcacctcaccatacagcac
AF350139_PreC_P-E      ccgggatgccttagaatctcctgagcattgctcacctcaccatacagcac
AF350167_PreC_P-E      ccgggatgccttagaatctcctgagcattgctcacctcaccatacagcac
AF350134_PreC_P-E      ccgggatgccttagaatctcctgagcattgctcacctcaccatacagcac
AF350135_PreC_P-E      ccgggatgccttagaatctcctgagcattgctcacctcaccatacagcac
LT623851_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
MF772361_PreC_P-E      tcggcatgacttagaatctcctgaacattgttcaccgcaccacactgcac
HM363608_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccccaccacactgcac
MF772358_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
HM363601_PreC_P-E      tcgggatgccttagaatctcctgagcattgtacacctcaccatactgcac
FN594765_PreC_P-E      tcgggatgccttggaatcttctgagcattgttcacctcaccacactgcac
FN594753_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgccc
AF350211_PreC_P-E      tcgggatgccttggaatctcctcaacatcattcaccacaccacactgcac
HM363606_PreC_P-E      tcgggatgccttggaatctcctgagcattggtcacctcaccatactgcac
HM363602_PreC_P-E      tcgggatgccttcgaatctcctgagcattgttcacctcaccatactgcac
FN594751_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacytcaccctgctgcwc
FN594763_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcacaatactgcac
KF849724_PreC_P-E      tcgggatgccttagaatctcctgagcattgtacacctcaccatactgcac
AB219533_PreC_P-E      tcgggatgccttagaatcttctcagcattgttcacctcaccatactgcac
FJ349240_PreC_P-E      tcgggatgccttggaatctcctgagcattgttcacctcaccacactgcac
HM363599_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
MT731872_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
KF849728_PreC_P-E      tcgggatgccttagaatcacctgagcattgttcacctcaccatactgcac
HM363605_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
FN594756_PreC_P-E      tcgtgatgccttggaatctcctgagcattgttcacctcaccatactgcac
HM363603_PreC_P-E      tcgggatgccttagaatcttctgagcattgttcacctcaccatactgcac
AB194948_PreC_P-E      tcgggatgccttagaatctcatgagcattgttcaccgcaccacactgcac
GQ161811_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacacggcac
LT623843_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
GQ161786_PreC_P-E      tcgggatgccttagaatctcctgagcattgtacaccgcaccacactgcac
FN594749_PreC_P-E      tcgggatgccttagaatctcctccgcattgttcaccctcacatactgcwc
AB274975_PreC_P-E      tcgggatgccttacaatctcctgagcattgttcacctcaccacactgcac
LT623847_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
MN507840_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacacggcac
HM363598_PreC_P-E      tcgggatgccttagaatctcctgagcattgcacacctcaccatactgcac
HM363578_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcagctcaccatactgctc
AB274976_PreC_P-E      tcgggatgccttagaatctcctcagcattgttcaccgcaccacactgcac
KM606739_PreC_P-E      tcgggatgccttagaatctcctgtacatgtttcaccgcaccacactgcac
HM363600_PreC_P-E      tcgggatgccttagaaggtcctgagcattgtacacctcaccatactgcac
GQ161807_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacaccgcac
GQ161768_PreC_P-E      tcgagatgccttagaatctcctgagcattgttcaccgcaccacactgcac
HM363597_PreC_P-E      tcgggatgccttagaatctcctgagcattgtacacatcaccatactgcaa
AM494691_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgctc
AB274984_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
MH580626_PreC_P-E      tcgggatgccttagaatcttctgagcattgctcacctcaccacactgcac
AM494695_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
GQ161823_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacacggcac
AB205188_PreC_P-E      tcgagatgccttggaatctcctgagcattgttcacctcaccatactgcac
KU736913_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
KT749841_PreC_P-E      tcgggatgccttagaatcgcctgaacattgttcaccgcaccacactgcac
HM363566_PreC_P-E      tcgggatgccttagaatctcctgagcatgtttcacatcaccatactgcac
AB274982_PreC_P-E      tcgggatgccttagaatctcctgagcatagttcaccgcatcacactgcac
HM363575_PreC_P-E      tggggatgccttacaatctcctgagcattgttcacctcaccatactgcac
HM363576_PreC_P-E      tggggatgccctagaatctcctgagcattgttcacctcaccatactgaac
KF849726_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
KF849720_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
LT623844_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
KF849713_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
AB201290_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgccc
KT192626_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
KF849717_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
KF849725_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
AY935700_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
DQ060823_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
MH464856_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
KF849714_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
KF849727_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
KF849719_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
KF849716_PreC_P-E      tcgggatgccttaaaatctcctgagcattgttcacctcaccatactgcac
DQ060822_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
KF922438_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
KF922439_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
AY738144_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
AY738145_PreC_C-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
AY738147_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
AY738146_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
KF849722_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatacggcac
EU620071_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
JQ000009_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
MN507841_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
KF849715_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
KF849723_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
MF772354_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
DQ060824_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
DQ060825_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
KF849721_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
LT623849_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaycacactgcac
HM363604_PreC_P-E      ccgggatgccttggaatctcctgatcattgctcacctcaccatactgcac
AM494791_PreC_P-E      tcgggatgccttagaatctcctgagcattggtcacctcaccactctgcaa
GQ161783_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
GQ161824_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
LT623842_PreC_P-E      tcgggatgccttagaatctcctgagcatytttcaccgcaccacactgcac
KF849718_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
FN545827_PreC_P-E      tagggatgccttggaatctcctgagcattgttcacctcaccacactgcac
FN545822_PreC_P-E      tcgggatgccttagaatctcctgagcaytgttcacctcaccacacggcac
GQ161796_PreC_P-E      tcgggatgccttagaatctcctgagcattgctcaccgcaccacactgcac
GQ161797_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcaa
FN594752_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcatctycacatctgccac
AF350187_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcaa
AF350184_PreC_P-E      tcgagatgccttggaatctcctgagcattgttcacctcatcatactgcac
AB274980_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcatcatactgcac
GQ161757_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
AB274985_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
FN545821_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
GQ161831_PreC_P-E      tcgggatgccttagaatctcctgagcattgctcacctcaccatactgcac
AM494714_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
AF350110_PreC_P-E      tcgggatgccttagaatctcctgaacattgtacaccgcaccacactgcac
HM363587_PreC_P-E      tcgggatgccttagaatctcctgagcattgtacccctcaccatactgcac
AF350208_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
GQ161773_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
GQ161802_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
EU239222_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
MH725192_PreC_P-E      tcgggatgcgttggaatctcccgagcattgttcatctcaccacactgcac
AF350144_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
HM363595_PreC_P-E      tcgggatgccttcgaatctcctgagcattgttcaccttaccatactgcac
AF350176_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
LT623845_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
KU736909_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
GQ161834_PreC_P-E      tcgggatgccttagaatctcctgagcatggttcaccgcaccacactgcac
AF350153_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
AF350132_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacacggctc
AF350169_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatacagctc
AF350133_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccatacggctc
AF350155_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccatacggctc
AF350131_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacacggctc
AF350122_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgctc
AF350190_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacacggctc
AF350125_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacacggctc
AF350130_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacacggctc
MT731911_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcgcctcaccatactgcac
KU736911_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
AM494703_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
AB274981_PreC_P-E      tcgggatgccttagaatctccagagcattgttcacctcaccacactgcac
GQ161826_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
AF350117_PreC_P-E      tcgggatgccttagaatctcctgagcatggttcaccgcaccacactgcac
GQ161812_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
GQ161775_PreC_P-E      tcgggatgccttagaatctcctgagcatgtttcaccgcaccacactgcac
AF350145_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
AF350210_PreC_P-E      tcgagatgccttagaatctcctgaacattgttcacctcaccacacggcac
AF350177_PreC_P-E      tcgagatgccttagaatctcctgagcattgttcacctcaccacacggcac
AF350206_PreC_P-E      tcgagatgccttagaatctcctgagcattgttcacctcaccacacggcac
AF350146_PreC_P-E      tcgagatgccttagaatctcctgagcattgttcaccttaccacacggcac
AF350205_PreC_P-E      tcgagatgccttagaatctcctgagcattgttcacctcaccacacggcac
AF350212_PreC_P-E      tcgagatgccttagaatctcctgagcattgttcacctcaccacacggcac
AF350213_PreC_P-E      tcgagatgccttagaatctcctgagcattgttcacctcaccacacggcac
AF350188_PreC_P-E      tcgagatgccttagaatctcctgagcattgttcacctcaccacacggcac
AF350154_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
MW082636_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
AB106564_PreC_C-E      tcgggatgccttagaatctcctgagcattgctcacctcaccatactgcac
MN507842_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcatcacactgcac
GQ161755_PreC_P-E      tggggatgccttagaatctcctgagcattgttcgccgcaccacactgcac
GQ161835_PreC_P-E      tcgggatgccttagaatctcttgagcattgttcaccgcaccacactgcac
FN594750_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctycacatactgcac
GQ161758_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacacggcac
GQ161766_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacacggcac
GQ161774_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacacggcac
HM363594_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
HM363596_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
AF350168_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgctc
AB205191_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccccaccacacggcac
AB091256_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacacagcac
MN967527_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
AM494706_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
MH580650_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcatcacactgcac
AM494710_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
AM494697_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
AM494709_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
LT623848_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
KM606738_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccataccgcac
GQ161820_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaycgcaccacactgcac
GQ161803_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
EU239224_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
EU239217_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgctc
AB274978_PreC_P-E      ccgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
EU239219_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
EU239223_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
HQ700551_PreC_P-E      tcgggatgccttggaatctcctgaacattgttcaccgcaccacactgcac
HM363593_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
AF350105_PreC_P-E      tcgggatgccttagaatctcctgagcatcgttcaccgcaccacactgcac
HM363569_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
HM363570_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
AF350175_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
MH725141_PreC_P-E      tcgggaggccttagaatctccggaccattgttcacctcaccatacagcac
GQ161815_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
AB201287_PreC_P-E      tcgggatgccttagaatctcctgaacattgttctcctcaccatacagcac
AF350142_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
AF350143_PreC_P-E      tcgggatgctttagaatctcctgagcattgttcacctcaccatactgcac
KF170741_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
GQ161785_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcagcgcaccacactgcac
KU736892_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
HM363574_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
GQ161814_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
AB201288_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacacggcac
GQ161782_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
GQ161792_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
LT623846_PreC_P-E      tcgggatgccttagaatctccggaacattgttcaccgcaccacactgcac
KU736904_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
GQ161762_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
AM494711_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcatcacactgcac
AM494698_PreC_P-E      tcgggatgccttagaatctcctgagcattgctcacctcaccacactgcac
AF350182_PreC_P-E      tcgggatgctttagaatctcctgagcattgttctccgcaccacactgcac
AF350123_PreC_P-E      tcgggaagccttagaatctcctgagcattgttcacggcaccacattgcac
AB274973_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
AY739674_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
AY739675_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
MH580633_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
AB274974_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
MH580631_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
MH580632_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
MH580652_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
MH580624_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
MH580629_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
MH580646_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
MH580649_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
AB194947_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
HM363573_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
MH580647_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
MH580634_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
MH580621_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
MH580622_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
MH580625_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
MH580637_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
MH580635_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
MH580636_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
AF350203_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgctc
DQ060830_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
MF772360_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
HQ700550_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
HQ700552_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
MF772362_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
KU736912_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
AF350112_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
AF350137_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
AF350107_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgaaccacactgcac
AF350103_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
AF350109_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
GQ161760_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
KU736893_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcatcacactgcac
HM363577_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
GQ161794_PreC_P-E      tcgggatgccttagaatctcatgagcattgttcaccgcaccacactgcac
GQ161780_PreC_P-E      tcgrgatgccttagaatctcctgagcattgttcacctcaccacacggcac
AB205190_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacacggcac
GQ161778_PreC_P-E      tcgggatgccttagaatctcctgaacattgctcaccgcaccacactgcac
GQ161810_PreC_P-E      tcgggatgccttagaatctcctgaacattgctcaccgcaccacactgcac
KU736902_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgctc
AB201289_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
AB915175_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
AB274972_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
GQ161759_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
MN507846_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacacggcac
GQ161801_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
GQ161772_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
GQ161764_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
GQ161787_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
GQ161770_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
GQ161800_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
GQ161819_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
GQ161829_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
GQ161791_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
GQ161793_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
GQ161827_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
MN507843_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
MN507848_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
GQ161833_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
GQ161756_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcat
GQ161795_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
KU736895_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
KU736896_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
MN507844_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
MH725114_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
LT623850_PreC_P-E      tcgggatgccttagaatctcctgagcactgttcacctcaccacacggcac
KU736901_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
KU736900_PreC_P-E      tcgggatgccttagaatctcctgagcattgctcacctcaccacactgcac
MH580640_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgctc
MH580641_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgctc
MH580617_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
MH580628_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
MH580644_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
KU736897_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
KU736898_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
GQ161763_PreC_P-E      tcgggatgccttagaatctcctgagcattgctcaccgcaccacactgcac
GQ161777_PreC_P-E      tcgggatgccttagaatctcctgagcattgctcaccgcaccacactgcac
FJ349237_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
FJ349238_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
AM494694_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
AM494696_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
AM494700_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
GQ161790_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
GQ161808_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
AB205189_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccccaccacacggcac
EU239221_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccccaccacacggcac
DQ060826_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccataccgcac
DQ060827_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccataccgcac
DQ060828_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccataccgcac
DQ060829_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccataccgcac
HM363571_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
MN967526_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
MH725042_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
MH725020_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
MH725021_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
X75657_PreC_P-E        tcgggatgccttagagtctcctgagcattgttcacctcaccacactgcac
MN507845_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
KU736910_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
KU736894_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
KU736891_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacckcaccacactgcac
KF170742_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
JQ000008_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
GQ161832_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
GQ161771_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
FJ349226_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
AB274969_PreC_P-E      tcgggatgcattagaatctcctgagcattgttcacctcaccacactgcac
HM363579_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
HM363580_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
HM363581_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
MN507847_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
MH918655_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
KU736903_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
KU736899_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
GQ161836_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
GQ161781_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
GQ161765_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacacggcac
GQ161761_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
FN545841_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacacggcac
FJ349239_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
EU239226_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
AM494713_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
AM494705_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
AM494702_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
AM494701_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
AM494689_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
KU736906_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
KU736907_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
KU736908_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
GQ161769_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacaccgcac
GQ161779_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacaccgcac
AM494707_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
MH580630_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
MN967529_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
AM494690_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
AM494693_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
AM494699_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
AM494704_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
AM494708_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
AM494712_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
AM494715_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
AM494717_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
GQ161816_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
HM363572_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
KU736905_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
KX186584_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
MH580614_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
MH580615_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
MH580616_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
MH580618_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
MH580619_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
MH580620_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
MH580623_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
MH580651_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
MK321264_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
MK720631_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
MK720632_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
MN967528_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccacactgcac
AB274971_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
GQ161776_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
GQ161784_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
GQ161789_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
GQ161798_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
GQ161804_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
GQ161817_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
GQ161828_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
AB091255_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
HM363583_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
HM363584_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
AF350114_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
AF350180_PreC_P-E      tcgggatgctttagaatctcctgagcattgttctccgcaccacactgcac
AF350181_PreC_P-E      tcgggatgctttagaatctcctgagcattgttctccgcaccacactgcac
AF350219_PreC_P-E      tcgggatgccttagaatcgcctgaacattgttcaccgcaccacactgcac
AF350220_PreC_P-E      tcgggatgccttagaatcgcctgaacattgttcaccgcaccacactgcac
AF350207_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
AF350209_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
MH725010_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
MH725024_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
AF350198_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcacctcaccatactgcac
AF350199_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcacctcaccatactgcac
HM363585_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
MH580638_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
AB205129_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
AB205192_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
HM363582_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
HM363590_PreC_P-E      tcgggatgccttagaatctcctgagcattgtacacctcatcatactgcac
HM363588_PreC_P-E      tcgggatgccttagaatctcctgagcattgtacacctcaccatactgcac
HM363589_PreC_P-E      tcgggatgccttagaatctcctgagcattgcacacctcaccatactgcac
HM363567_PreC_P-E      tcgggatgccttagaatctcctgagcattgtacacctcaccatactgcac
HM363568_PreC_P-E      tcgggatgccttagaatctcctgagcattgtacacctcaccatactgcac
HM363586_PreC_P-E      tcgggatgccttagaatcgcctgagcattgtacacctcaccatactgcac
HM363591_PreC_P-E      tcgggatgccttagaatctcctgagcattgtacacctcaccatactgcac
HM363592_PreC_P-E      tcgggatgccttagaatctcctgagcattgtacacctcaccatactgcac
AB274970_PreC_P-E      tcgggatgccttagaatctcctgagcattgctcacctcaccatactgcac
AF350215_PreC_P-E      tcgggatgccttagaatctcctgagcattgctcacctcaccatactgcaa
AF350151_PreC_P-E      tcgggatgccttagaatctcctgagcattgctcacctcaccatactgcac
AF350126_PreC_P-E      tcgggatgccttagaatctcctgagcattgctcacctcaccatactgcac
AF350214_PreC_P-E      tcgggatgccttagaatctcctgagcattgctcacctcaccatactgcac
AF350218_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
AF350204_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcatcacactgcac
AF350197_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
AF350166_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
AF350149_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
AF350183_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
AF350159_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcatcacactgcac
AF350160_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcatcacactgcac
AF350202_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
AF350179_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
AF350172_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcatcacactgcac
AF350150_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
AF350200_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcacctcaccatactgcac
AF350201_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
AF350115_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
AF350116_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
AF350140_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
AF350141_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
AF350111_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
AF350101_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
AF350191_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
AF350186_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcacctcaccacacggcac
AF350136_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
AF350113_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
AF350173_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
AF350185_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcatcacactgcac
AF350147_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
AF350128_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
AF350106_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
AF350104_PreC_P-E      tcgggatgccttagaatctcctgagcattgttcaccgcaccacactgcac
AF350100_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgctc
AF350216_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
AF350217_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
AF350165_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcacctcaccacactgcac
AF350189_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccatactgcac
AF350171_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
AF350118_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
AF350170_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
AF350178_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
AF350162_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
AF350163_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
AF350099_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
AF350102_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
AF350119_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
AF350174_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
AF350192_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
AF350193_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
AF350194_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
AF350195_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
AF350196_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
AF350108_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
AF350138_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
AF350152_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
AF350120_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
AF350121_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
AF350148_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
AF350124_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
AF350158_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
AF350156_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
AF350157_PreC_P-E      tcgggatgccttagaatctcctgaacattgttcaccgcaccacactgcac
                         *    *   *  *          **     *                 

AM494692_PreC_P-E      tcaggcaagcgattctttgctggggggaattaatgactctagctacctgg
GQ491112_PreC_P-E      tcaggcaagcgattctttgctggggggaattaatgactctagctacctgg
EU726953_PreC_P-E      tcaggcaagcaattctgtgctggggggacttaatgtccctggctacctgg
KF798275_PreC_P-E      tcaggcaagcaattctttgctggggagaactaatgactctagctacctgg
X85274_PreC_P-E        tcaggcaagcaattctttgctggggggacttaatgactctagctacctgg
KP856982_PreC_P-E      tcaggcaagcaattctgtgctggggggaattaatgactctagctacctgg
KP856973_PreC_P-E      tcaggcaagcaattttgtgctggggggaattaatgactctagctacctgg
KP857010_PreC_P-E      tcaggcaagcaatattatgctggggggaattaatgactttagctacctgg
MG491180_PreC_P-E      tcaggcaagcaattctgtgctggggggaattaatgactctagctacctgg
KF798305_PreC_P-E      tcaggcaagcatttctttgctggggtgaattaatgactctagctacctgg
KP856998_PreC_P-E      tcaggcaagcaattctctgctggggggaactaatgaatctagctacctgg
KF798259_PreC_P-E      tcaggcaagcaatcctttgctggggggagctaatgactctagctacctgg
KF798270_PreC_P-E      tcaggcaagcaattctttgctggggggaattaatgactctagctacctgg
KF798298_PreC_P-E      tcaggcaagcaattctttgctggggggaactaatgactctagctacctgg
EU726883_PreC_P-E      tcaggcaagcaattctctgctggggggaactaatgactctagctacttgg
KP857001_PreC_P-E      tcaggcaagcaattctgtgctggggggaactaatgactctagctacctgg
KP857011_PreC_P-E      tcaggcaagcaattttgtgctggggggacctaatgactctagctacctgg
KP857055_PreC_P-E      tcaggcaagcagttctttgctggggggacttaatgtctctagctacctgg
HM363611_PreC_P-E      tcaggcaagccattctttgctggggggacctaatgactctagctacctgg
AB219534_PreC_P-E      tcaggcaagccattctttgctggggagaattaatgtctctagctacctgg
AB915180_PreC_P-E      tcaggcaagccgttctttgctggggggatataatgaatatagctacctgg
GQ161825_PreC_P-E      tcaggcaagccattctttgctggggagatgtaatgaatttagctacctgg
HM363607_PreC_P-E      tcaggcaagccattctttgctggggggaattaatgactctagctacctgg
AB219529_PreC_P-E      tcaggcaagtcattctttgctggggagacctaatgaatctagctacctgg
MH580648_PreC_P-E      tcaggcaagccattctttgctgggggaaccttatgaatctagctacctgg
MF772356_PreC_P-E      tcaggcatgcctttctttgctggggggacttaatgtctctagctacttgg
FN594761_PreC_P-E      tcaggcaagccattctttgctggggggatcttatgaacctagctacctgg
MH580645_PreC_P-E      tcaggcaagccattctttgctggggggaattaatgactctagctacctgg
MF772359_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
FN594748_PreC_P-E      tcaggcaagccattctttgctggggggacctaatgaatctaggtacctgg
HM363610_PreC_P-E      tcaggcaagccattctttgctggggggaacttatgactctagctacctgg
HM363565_PreC_P-E      tcaggcaagccattctttgctggggggacctaatgaatttagccacctgg
HM363609_PreC_P-E      tcaggccaagccttttttgctggggggaactaatgactctagctacctgg
EU239220_PreC_P-E      tcaggcaggccattctttgctggggggaactaatgactctagctacatgg
AB274979_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgacactagctacttgg
MF772357_PreC_P-E      tcaggcaagccattctttgctggggggacttaatgtctctagctacctgg
FN545842_PreC_P-E      tcaggcaagccattctttgctggggggacctaatgtctctagctacctgg
MF772355_PreC_P-E      tcaggcaagccattctttgctggggagatttaatgtccctagctacctgg
FN594766_PreC_P-E      tcaggcaagcaattctttgctggggggacctaatgaatctagctacctgg
FN594762_PreC_P-E      tcaggcaagccgttctttgctggggggacctaatgaatctagctacctgg
FN545823_PreC_P-E      tcaggcaagccattctttgctggggggamytaaygamtctagctacctgg
AB915178_PreC_P-E      tcaggcaagccattatttgctggggagacctaatgtctctagctacctgg
AB274977_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactttagctacctgg
FN594759_PreC_P-E      tcaggcaagcccttctttgctggggggacctaatgaatctagctacctgg
FN594758_PreC_P-E      tcaggcaagccattctttgctggggggacctaatgaatctagctacctgg
FN594760_PreC_P-E      tcaggcaagccattctttgctggggggacctaatgaatctagctacctgg
AF350161_PreC_P-E      taaagcaagctattctttgctggggggaactaatgactctagctacctgg
AF350164_PreC_P-E      tcaggcaagctattctctgctggggggaactaatgactctagctacctgg
AF350127_PreC_P-E      taaggcaagccattctttgctggggggaactaatgactctagctacctgg
AF350139_PreC_P-E      ttaggcaagctattctttgctggggggaactaatgactctagctacctgg
AF350167_PreC_P-E      taaggcaagctattctctgctggggggaactaatgactctagctacctgg
AF350134_PreC_P-E      taaggcaagctattctctgctggggggaactaatgactctagctacctgg
AF350135_PreC_P-E      taaggcaagctattctttgctggggggaactaatgactctagctacctgg
LT623851_PreC_P-E      tcaggcaagccatamtatgctggggggaactaatgactctagctacctgg
MF772361_PreC_P-E      tcaggcaagccattctttgctggggggacctaatgactctagctacctgg
HM363608_PreC_P-E      tcaggcaagccattctttgctggggggatgtaatgaatctagctacctgg
MF772358_PreC_P-E      tcaggcaagccattctttgctggggggacttaatgaatctagctacctgg
HM363601_PreC_P-E      tcaggcaagccattctttgttggggggaactaatgactctagctacctgg
FN594765_PreC_P-E      tcaggcaagccattctttgctggggggacctaatgtctctagctacctgg
FN594753_PreC_P-E      tcaggcaagccattctttgctggggggatgtaatgaatatggctacatgg
AF350211_PreC_P-E      tcaggcaagccattctttgctggggggacctaatgtctctagctacctgg
HM363606_PreC_P-E      tcaggcacgtcattctttgctggggggacctaatgactctagctacctgg
HM363602_PreC_P-E      tcaggcaagccattctttgctggggggatttaatgaatctagctacctgg
FN594751_PreC_P-E      tcaggcaagccattctctgctggggggacctaatgaatctagctacctgg
FN594763_PreC_P-E      tcaggcaagccattctttgctggggggacctaatgaatctagctacctgg
KF849724_PreC_P-E      tcaggcaagccgttctttgctggggagaattaatgaatctagctacctgg
AB219533_PreC_P-E      tcaggcaagccattctttgctggggggatataatgactatagctacntgg
FJ349240_PreC_P-E      tcaggcaagccattctttgctggggggacctaatgactctagctacctgg
HM363599_PreC_P-E      tcaggcaagccattctttgctggggggacctaatgactctagctacctgg
MT731872_PreC_P-E      tcaggcaagccattctttgctggggggatctaatgactctagctacctgg
KF849728_PreC_P-E      tcaggcaagccattctttgctggggtgatgtaatgaatctagcgacatgg
HM363605_PreC_P-E      tcaggcaagccattctttgctggggggaattaatgactctagctacctgg
FN594756_PreC_P-E      tcaggcaagccattctttgctggggggacataatgaatatagctacctgg
HM363603_PreC_P-E      tcaggcaagccattctttgctggggggacctaatgtccctaggtacctgg
AB194948_PreC_P-E      tcaggcaagccatactttgctggggggacctaatgtctctagctacctgg
GQ161811_PreC_P-E      tcaggcaagccattctttgctggggggaattaatgactctagctacctgg
LT623843_PreC_P-E      tcaggcaagccattctttgctggggggacctaatgtycctagctacctgg
GQ161786_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
FN594749_PreC_P-E      tcaggcaagccgttctttgctggggggatgtaatgaatctagctaccggg
AB274975_PreC_P-E      tcaggcaagccattctttgctggggggacgtaatgaatctagctacctgg
LT623847_PreC_P-E      tcaggcaagccattctttgytggggggatataatgaatatagctacctgg
MN507840_PreC_P-E      tcaggcaagccattctttgctggggggatgtaatgaatctagctacctgg
HM363598_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
HM363578_PreC_P-E      tcaggcaagccgttctttgctggggggagctaatgactctagctacctgg
AB274976_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
KM606739_PreC_P-E      tcaggcaagccattctttgctggggggatgtaatgtctctagctacctgg
HM363600_PreC_P-E      tcaggcaagccattatttgctggggggaactaatgactctagctacctgg
GQ161807_PreC_P-E      tcaggcaagccattctttgctggggggatctaatgactctagctacctgg
GQ161768_PreC_P-E      tcaggcaagccattctttgctggggggatgtaatgaatttagctacctgg
HM363597_PreC_P-E      tcaggcaagccattatttgctggggggaactaatgaatctagctacctgg
AM494691_PreC_P-E      tcaggcaagctattctttgctggggggacctaatgactctagctacctgg
AB274984_PreC_P-E      tcaggcaagccattctttgctggggggacctaatgaatctagctacctgg
MH580626_PreC_P-E      tcaggcaagccattctttgctggggagatctaatgaatctaggaacctgg
AM494695_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
GQ161823_PreC_P-E      tcaggcaagccattctttgctggggggacctaatgaatctaggcacctgg
AB205188_PreC_P-E      tcaggcaggccattctttgctggggggacctaatgaatctaggtacctgg
KU736913_PreC_P-E      tcaggcaagccattctttgctggggggacytaatgaatctagctacctgg
KT749841_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
HM363566_PreC_P-E      tcaggcaagccattctttgctggggggatataatgaatatagctacctgg
AB274982_PreC_P-E      tcaggcaagccattctttgctggggggacttaatgtctctagctacctgg
HM363575_PreC_P-E      tcaggcaagccattctttgctggggggaattaatgactctagctacctgg
HM363576_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
KF849726_PreC_P-E      tcaggcaagccattatttgctggggagaattaatgactctagctacctgg
KF849720_PreC_P-E      tcaggcaagccattctttgctggggagaattaatgactctagctacctgg
LT623844_PreC_P-E      tcaggcaagccattctgtgctggggggatgtaatgaatttagctacctgg
KF849713_PreC_P-E      tcaggcaagccattctttgctggggrgaaytaatgactctagctacctgg
AB201290_PreC_P-E      tcaggcaagtcattctttgctggggagacctaatgactctagctacctgg
KT192626_PreC_P-E      tcaggcaagccattctttgctggggagaattaatgactctagctacctgg
KF849717_PreC_P-E      tcaggcaagccattctttgctggggagaattgatgactctagctacctgg
KF849725_PreC_P-E      tcaggcaagcctgtctttgctggggagatgtaatgaatctagctacctgg
AY935700_PreC_P-E      tcaggcaagccattctttgctggggagatgtaatgtctctagctacctgg
DQ060823_PreC_P-E      tcaggcaagccattctttgctggggagaattaatgactctagctacctgg
MH464856_PreC_P-E      tcaggcaagccattctttgctggggagaattaatgactctagctacctgg
KF849714_PreC_P-E      tcaggcaagccattctttgctggggagaattaatgactctagctacctgg
KF849727_PreC_P-E      tcaggcaagccattctttgctggggagaattaatgacgctagctacctgg
KF849719_PreC_P-E      tcaggcaagccattctttgctggggagaattaatgactctagctacctgg
KF849716_PreC_P-E      tcaggcaagccattctttgctggggagaattaatgactctagctacctgg
DQ060822_PreC_P-E      tcaggcaagccattctttgctggggagaattaatgactctagctacctgg
KF922438_PreC_P-E      tcaggcaagccattctttgctggggagaattaatgactctagctacctgg
KF922439_PreC_P-E      tcaggcaagccattctttgctggggagaattaatgactctagctacctgg
AY738144_PreC_P-E      tcaggcaagccattttgtgctggggagaattaatgactctagctacctgg
AY738145_PreC_C-E      tcaggcaagccattttgtgctggggagaattaatgactctagctacctgg
AY738147_PreC_P-E      tcaggcaagccattttgtgctggggagaattaatgactctagctacctgg
AY738146_PreC_P-E      tcaggcaagccattttgtgctggggagaattaatgactctagctacctgg
KF849722_PreC_P-E      tcaggcaagccattctttgctggggagaattaatgactctagctacctgg
EU620071_PreC_P-E      tcaggcaagccattctttgctggggagaattaatgactctagctacctgg
JQ000009_PreC_P-E      tcaggcaagccattctttgctggggagaattaatgactctagctacctgg
MN507841_PreC_P-E      tcaggcaagccattctttgctggggagaattaatgactctagctacctgg
KF849715_PreC_P-E      tcaggcaagctattctttgctggggagaattaatgactctagctacctgg
KF849723_PreC_P-E      tcaggcaagctattctttgctggggagaattaatgactctagctacctgg
MF772354_PreC_P-E      tcaggcaagccattctttgctggggagaattaatgactctagctacctgg
DQ060824_PreC_P-E      tcaggcaagccattctttgctggggagaattaatgactctagctacctgg
DQ060825_PreC_P-E      tcaggcaagccattctttgctggggagaattaatgactctagctacctgg
KF849721_PreC_P-E      tcaggcaagccattctttgctggggagaattaatgactctagctacctgg
LT623849_PreC_P-E      tcaggcaagccattctttgctggggggacctaatgactctagctacctgg
HM363604_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
AM494791_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
GQ161783_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
GQ161824_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
LT623842_PreC_P-E      tcaggcaagccattctttgttggggggatctaatgactctagctacctgg
KF849718_PreC_P-E      tcaggcaagycattctttgctggggagaactaatgactctagctacctgg
FN545827_PreC_P-E      tcaggcaagccmttctttgctggggggacctaatgaatctagctacctgg
FN545822_PreC_P-E      tcaggcaagccattctttgctggggggacctaatgactctagctacctgg
GQ161796_PreC_P-E      tcaggcaagccattctttgctggggggacctaatgaatctaggtacctgg
GQ161797_PreC_P-E      tcaggcaagccattatttgctggggggaactaatgactctagctacctgg
FN594752_PreC_P-E      tcaggcaagccattctttgctggggggatgtaatgaacctagcaacctgg
AF350187_PreC_P-E      tcaggcaagccattctttgctggggggaattaatgaatctagctacctgg
AF350184_PreC_P-E      tcaggcatgccgttctttgctggggggacctaatgactctagctacctgg
AB274980_PreC_P-E      tcaggcaagccattctttgctggggggacctaatgactctagctacctgg
GQ161757_PreC_P-E      tcaggcaagccattctttgctggggggacctaataactctaagtacctgg
AB274985_PreC_P-E      tcaggcaagccattctttgctggggggagttaatgactctagctacctgg
FN545821_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
GQ161831_PreC_P-E      tcaggcaagccattctttgctggggggacctaatgaatctagctacctgg
AM494714_PreC_P-E      tcaggcaagccattctttgctggggggacttaatgaatctagctacctgg
AF350110_PreC_P-E      tcaggcaagccattctgtgctggggggacctaatgagtctagctacctgg
HM363587_PreC_P-E      tcaggcaagtcattctttgctggggggacctaatgactctagctacctgg
AF350208_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
GQ161773_PreC_P-E      tcaggcaagccattctttgctggggggaacttatgactctagctacctgg
GQ161802_PreC_P-E      tcaggcaagccattctttgctggggggaacttatgactctagctacctgg
EU239222_PreC_P-E      tcaggcaagccattctttgttggggggaccttatgactctagctacctgg
MH725192_PreC_P-E      tcaggcaagccattctttgctggggagacctaatgtctctagctacctgg
AF350144_PreC_P-E      tcaggcaagccattctttgctggggggacttaatgtctctaggtacctgg
HM363595_PreC_P-E      tcaggcaagccattctttgctggggggaattaatgactctagctacctgg
AF350176_PreC_P-E      tcaggcaagccgttctttgctggggggacttaatgtctctagctacctgg
LT623845_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
KU736909_PreC_P-E      tcaggcaagccattctttgctggggggacctaatgamtctagctacctgg
GQ161834_PreC_P-E      tcaggcaagccattctttgctggggggacttaatgactctagctacctgg
AF350153_PreC_P-E      ttaggcaagccattctttgctggggggaattaatgactctagctacctgg
AF350132_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
AF350169_PreC_P-E      tcaggcaagccattctttgctggggggaattaatgactctagctacctgg
AF350133_PreC_P-E      tcaggcaagccattctttgctggggggaattaatgactctagctacctgg
AF350155_PreC_P-E      tcaggcaagccattctttgctggggggaattaatgactctagctacctgg
AF350131_PreC_P-E      tcaggcaagccattctttgctggggggaattaatgactctagctacctgg
AF350122_PreC_P-E      tcaggcaagccattctttgctggggggaattaatgactctagccacctgg
AF350190_PreC_P-E      tcaggcaagccattctttgctggggggaattaatgactctagccacctgg
AF350125_PreC_P-E      tcaggcaagccattctttgctggggggaattaatgactctagctacctgg
AF350130_PreC_P-E      tcaggcaagccattctttgctggggggaattaatgactctagctacctgg
MT731911_PreC_P-E      tcaggcaagccattctttgctggggggacctaatgtctctggctacctgg
KU736911_PreC_P-E      tcaggcaagccattctttgctggggggacctaatgtctctagctacctgg
AM494703_PreC_P-E      tcaggcaagccattctttgctggggggatgtaatgactctagccacctgg
AB274981_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
GQ161826_PreC_P-E      tcaggcaagccattctttgctggggggacttaatgaatctagcgacctgg
AF350117_PreC_P-E      tcaggcaagccatactttgctggggggacctaatgactctagctacctgg
GQ161812_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
GQ161775_PreC_P-E      tcaggcaagccattctttgctggggggacctaatgactctagctacctgg
AF350145_PreC_P-E      tcaggcaagccattctttgctggggggaattaatgactctagctacctgg
AF350210_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
AF350177_PreC_P-E      tcaggcaagccattctttgctggggggatctaatgactctagctacctgg
AF350206_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
AF350146_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
AF350205_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
AF350212_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
AF350213_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
AF350188_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
AF350154_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
MW082636_PreC_P-E      tcaggcaagccattctttgctggggggacctaatgaatctaggtacctgg
AB106564_PreC_C-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
MN507842_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
GQ161755_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgtctctagctacctgg
GQ161835_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgtctctagctacctgg
FN594750_PreC_P-E      tcaggcaagccattctttgctggggggaccttatgtctctagctacctgg
GQ161758_PreC_P-E      tcaggcaagccattctttgctggggggacctgatgactctagctacctgg
GQ161766_PreC_P-E      tcaggcaagccattctttgctggggggacctgatgactctagctacctgg
GQ161774_PreC_P-E      tcaggcaagccattctttgctggggggacctgatgactctagctacctgg
HM363594_PreC_P-E      tcaggcaagccattatttgctggggggaactaatgactctagctacctgg
HM363596_PreC_P-E      tcaggcaagccattatttgctggggggaactaatgactctagctacctgg
AF350168_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
AB205191_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
AB091256_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
MN967527_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
AM494706_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
MH580650_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
AM494710_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
AM494697_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
AM494709_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
LT623848_PreC_P-E      tcaggcaagccattctttgctggggggacctaatgactctagctacctgg
KM606738_PreC_P-E      tcaggcaagccattctttgctggggagacctaatgactctagctacctgg
GQ161820_PreC_P-E      tcaggcaagccattctttgctggggggaastaatgactytagctacctgg
GQ161803_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
EU239224_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
EU239217_PreC_P-E      tcaggcaagccattctttgctggggggacttaatgactctagctacctgg
AB274978_PreC_P-E      tcaggcaagccattctttgctggggggacctaatgactctagctacctgg
EU239219_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
EU239223_PreC_P-E      tcaggcaagccattctttgctggggggatataatgactatagctacctgg
HQ700551_PreC_P-E      tcaggcaagccattctttgctggggggacctaatgactctagctacctgg
HM363593_PreC_P-E      tcaggcaagccattctttgctggggggaattaatgactctagctacctgg
AF350105_PreC_P-E      tcaggcaagccatactttgctggggggaactaatgactctagctacctgg
HM363569_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
HM363570_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
AF350175_PreC_P-E      tcaggcaagccattgtttgctggggggatataatgactctagctacctgg
MH725141_PreC_P-E      tcaggcaagccattctttgctggggggaattaatgactctagccacctgg
GQ161815_PreC_P-E      tcaggcaagccattctttgctggggggamctaatgactctagctacctgg
AB201287_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
AF350142_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagccacctgg
AF350143_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagccacctgg
KF170741_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
GQ161785_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
KU736892_PreC_P-E      tcaggcaagccattctttgctggggggatgtaatgaatctagctacctgg
HM363574_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
GQ161814_PreC_P-E      tcaggcaagccattctttgctggggggatctaatgactctagctacctgg
AB201288_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
GQ161782_PreC_P-E      tcaggcaagccattctttgctggggggatctaatgactctagctacctgg
GQ161792_PreC_P-E      tcaggcaagccattctttgctggggggatctaatgactctagctacctgg
LT623846_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
KU736904_PreC_P-E      tcaggcaagccattctttgctggggggaacttatgactctagctacytgg
GQ161762_PreC_P-E      tcaggcaagccattctttgctggggggacctaatgtctctagctacctgg
AM494711_PreC_P-E      tcaggcaagccattctttgctggggggacctaatgactctagctacctgg
AM494698_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
AF350182_PreC_P-E      tcaggcaagccattctttgctggggggacctaatgactctagctacctgg
AF350123_PreC_P-E      tcaggcaagctattctttgctggggggaactgatgactctagctacctgg
AB274973_PreC_P-E      tcaggcaagccattctttgctggggggacctaatgaatctagctacctgg
AY739674_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
AY739675_PreC_P-E      tcaggcaagccattctttgctggggggacctaatgactctagctacctgg
MH580633_PreC_P-E      tcaggcaagccattctttgctggggggacctaatgactctagctacctgg
AB274974_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
MH580631_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagccacctgg
MH580632_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagccacctgg
MH580652_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagccacctgg
MH580624_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
MH580629_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
MH580646_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
MH580649_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
AB194947_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
HM363573_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
MH580647_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
MH580634_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
MH580621_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
MH580622_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
MH580625_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
MH580637_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
MH580635_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
MH580636_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
AF350203_PreC_P-E      tcaggcaagccattctgtgctggggggacctaatgactctagctacctgg
DQ060830_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
MF772360_PreC_P-E      tcaggcaagccgttctttgctggggggaactaatgactctagctacctgg
HQ700550_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
HQ700552_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
MF772362_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
KU736912_PreC_P-E      tcaggcaagccattctttgctggggggatataatgactatakctacctgg
AF350112_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
AF350137_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
AF350107_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
AF350103_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
AF350109_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
GQ161760_PreC_P-E      tcaggcaagccattctttgctggggggacttaatgactctagctacctgg
KU736893_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
HM363577_PreC_P-E      tcaggcaagccattctttgctggggggagctaatgactctagctacctgg
GQ161794_PreC_P-E      tcaggcaagctattctttgctggggggaactaatgactctagctacctgg
GQ161780_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
AB205190_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
GQ161778_PreC_P-E      tcaggcaagccattctttgctggggggacctaatgactctagctacctgg
GQ161810_PreC_P-E      tcaggcaagccattctttgctggggggacctaatgactctagctacctgg
KU736902_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
AB201289_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
AB915175_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
AB274972_PreC_P-E      tcagggaagcgattctttgctggggggaactaatgactctagctacctgg
GQ161759_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagccacctgg
MN507846_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
GQ161801_PreC_P-E      tcaggcaagccattctttgctggggggaagtaatgactctagctacctgg
GQ161772_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
GQ161764_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactttagctacctgg
GQ161787_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
GQ161770_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
GQ161800_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
GQ161819_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
GQ161829_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
GQ161791_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
GQ161793_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
GQ161827_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
MN507843_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
MN507848_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
GQ161833_PreC_P-E      tcaggcaagccattctttgctggggggacctaatgactctagctacctgg
GQ161756_PreC_P-E      tcaggcaagccattctttgctggggggacctaatgtctctagctacctgg
GQ161795_PreC_P-E      tcaggcaagccattctttgctggggggacctaatgtctctagctacctgg
KU736895_PreC_P-E      tcaggcaagccattctatgctggggggaactaatgactctagctacctgg
KU736896_PreC_P-E      tcaggcaagccattctatgctggggggaactaatgactctagctacctgg
MN507844_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
MH725114_PreC_P-E      tcaggcaagccattctttgctggggagaactaatgactctagctacctgg
LT623850_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
KU736901_PreC_P-E      tcaggcaagccattctttgttggggggaactaatgactctagctacctgg
KU736900_PreC_P-E      tcaggcaagccattctgtgctggggggaactaatgactctagctacctgg
MH580640_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagccacctgg
MH580641_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagccacctgg
MH580617_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
MH580628_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
MH580644_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
KU736897_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
KU736898_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
GQ161763_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
GQ161777_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
FJ349237_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
FJ349238_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactctagctacctgg
AM494694_PreC_P-E      tcaggcaagccattctttgctggggggaactaatgactc