HBVdb

Dataset for nucleotide sequence P of genotype E

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
       **** * **  *   *** **   * ***** *****              **** *   *  * ** *  **
ATGCCCCTATCTTATCAACACTTCCGGAGAaTACTGTTGTTAGACGAAGAG------GCAGGTCCCCTAGAAGAAGAACT
                       t  a c       a        c                        c     
                              t                                                 
                                                                                

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
***** ***  *  **   *  **  *** **  *** *  *  **** ***  * *    *    *   *  ** ** *
CCCTCGCCTCGCAGACGAAGATCTCAATCGCCGCGTCGCAGAAGATCTCAATCTCCAGCTTCCCAATGTTAGTATTCCTT
     a         cc                                      tg g  agc            g 
     t                                                                          
                                                                                

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   * *  ********        * **  * ** *** *       *     ** **       * * ** * *     
GGACTCACAAGGTGGGAAATTTTACGGGGCTTTAcTCTTCTACTATACCTGTCTTTAATCCTAACTGGAAAACTCCATCT
       t        c            c  t   a c   t t   a        t  cgt      c    t t 
                                                                            c   
                                                                                

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
** **    ** **  *  * ** **  *  *    *  ** *   ** * ** ** **  * ** **  *  ***   *
TTTCCTGATATTCATTTGCACCAGGACATTATTAACAAATGTGAACAATTTGTAGGTCCTCTAACAGTAAATGAAAAACG
  c   a c            a     g t      g        g  c  ct t             a 
                                                              g                 
                                                                                

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *  * *   *  *  ******* *  ** * ***       ** ** **    **    ** ** ** *  **  * *
AAGATTAAAcTTAGTcATGCCTGCTAGATTTTTTCCCATCTCTACgAAATATTTgCCCCTAGAGAAAGGTATAAAACCTT
gc gc    tc  a                    t  tg    a        a  at g  t  g  c  c   t c 
         a                          a  a     t        t  t           g          
                                                                                

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* ** *      *  *  ******* ***** **     * ** ***** *  **  * *** ***  **  * ******
ATTATCCAGAtAATGTAGTTAATCATTACTTCCAAACCAGACACTATTTACATACCCTATGGAAGGCGGGCATCTTATAT
 c  c  c  c   c              t     tc             c  tt t   g               
       t  g                                               g                     
          a                                                                     

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*   * *   *  *       ** *****    **    *  **  *  ******  *   ** * ****** ***** *
AAAAGaGAAACTACaCGTAGCGCCTCATTTTgTGGGTCACCTTATTCTTGGGAACAAGAGCTACATCATGGGGCTTTCTT
  gc g     gt c     t        c tg  t t   a              c  t            a     g 
              g                ac                          c                    
                                                                                

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
** * ** ** **    **   *** ** ***    *          *   ****     * ***** ** ******** 
GGACGGTCCCTCTCGAATG---GGGGAAGAATCATTCCACCACCAATCCTCTGGGATTTTTTCCCGACCACCAGTTGGAT
             a              a   t g      t a      t                   t         
                                  a                                             
                                                                                

       650       660       670       680       690       700       710       720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
****  ***   ** ** ***   *  ** ********    *****   ** ***    ***       * * * ****
CCAGCATTCAGAGCAAACACCAGAAATCCAGATTGGGACCACAATCCCAACAAAGACCACTGGACaGAAGCCAACAAGGT
     g   ca   g  t   cac              tat        c      t       ag cc           
     c                                                           c              
                                                                                

       730       740       750       760       770       780       790       800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
******* *  * **  *  * **  *  * ** *  ** **     *  ****    *   * * *****  ** *   
AGGAGTGGGAGCATTcGGGCCgGGGTTCACTCCCCCACACGGAGGCCTTTTGGGGTGGAGCCCTCAGGCTCAAGGCATGC
                 t   c        g  t         c    a c   t           g      t
                     a              c                                           
                                                                                

       810       820       830       840       850       860       870       880
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
          ***                             *    *      **  *** ** ** ** **     * 
TAAAAACATTGCCAGCAGATCCGCCTCCTGCCTCCACCAATCGGCAGTCAGGAAGGCAGCCTACCCCAATCACTCCACCT
agcct tgg     a  a    a        t        g     a      c                   g      
       c                                                                        
                                                                                

       890       900       910       920       930       940       950       960
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
***** *  ** *     *      *     ** *          ** *   *   **  *                   
TTGAGAGACACTCATCCTCAGGCCATGCAGTGGAATTCCACAACATTCCACCAAGCTCTGCAGGATCCCAGAGTAAGAGG
           g     c      g a  a       a  a g    t      a    a  aa      a-----a---
                                                                      -g    -g  
                                                                            c   

       970       980       990      1000      1010      1020      1030      1040
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
             * ********    **  *  * **  *  * ***** **   ***  ** * *   **  *** * 
CCTGTATttTCCTGCTGGTGGCTCCAGTTCCGGAACAGTGAACCCTGTTCCGACTACTGCCTCACTCATCTCGTCAATCT
-------c--                           a                   t     a          
t      -cc                                                                      
                                                                                

      1050      1060      1070      1080      1090      1100      1110      1120
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *** * ** ***** ** **    **  ** *    **  ** **   * ***    ******** **  ******* *
TCTCGAGGATTGGGGACCCTGCACCGAACATGGAAAGCATCACATCAGGATTCCTAGGACCCCTGCTCGTGTTACAGGCG
                  t     g         cga   t                             a         
                                                                                
                                                                                

      1130      1140      1150      1160      1170      1180      1190      1200
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
** **** ** ***** ***** ***** *** **  *** ********************* **** * ** ****** 
GGGTTTTTCTTGTTGACAAAAATCCTCACAATACCGCAGAGTCTAGACTCGTGGTGGACTTCTCTCAATTTTCTAGGGGG
  a                                     a                          g           a
                                                                                
                                                                                

      1210      1220      1230      1240      1250      1260      1270      1280
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   *****  *  * *********** ** ** ** ** ** ** ***** ** ** **** ******  *  ** ****
AGCTCCCGTGTGTCTTGGCCAAAATTCGCAGTCCCCAAcCTCCAaTCACTCACCAACCTCTTGTCCTCCAATTTGTCCTG
 tt           g           t           t     g        t               g cc       
 a            c                                                                 
                                                                                

      1290      1300      1310      1320      1330      1340      1350      1360
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*   *** * ***** ** ******* **  *** * **************** * ***** ******* *  **  ***
GCTATCGCTGGATGTGTCTGCGGCGTTTTATCATCTTCCTCTTCATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTT
 t     t                          a                                             
                                                                                
                                                                                

      1370      1380      1390      1400      1410      1420      1430      1440
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* ** ** **   * ** **** **  *** * *     **  ****  * *  *  *     **        *  * **
CTGGACTATCAAGGTATGTTGCCCGTTTGTCCTCTAATTCCAGGATCATCAACCACCAGTACGGGACCCTGCCGAACCTG
           c                        c          cc          c           ta       
                                                                                
                                                                                

      1450      1460      1470      1480      1490      1500      1510      1520
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*** **    * **     * ****      **** *** ** **   *** **    *    *** *** * ****  *
CACGACTCTTGCTCAAGGAACCTCTATGTTTCCCTCATGTTGCTGTTCAAAACCTTCGGACGGAAATTGCACTTGTATTC
        c         g                    c       t                                
                                                                                
                                                                                

      1530      1540      1550      1560      1570      1580      1590      1600
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
******* ***** ******** * ***** ********  ******* ** ***** **   ** **  ** *******
CCATCCCATCATCATGGGCTTTCGGAAAATTCCTATGGGAGTGGGCCTCAGCCCGTTTCTCCTGGCTCAGTTTACTAGTG
                                                           t                  
                                                                                
                                                                                

      1610      1620      1630      1640      1650      1660      1670      1680
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*  * ** ** ********  ** ******* ** **  * *****  * **  *************  ****  * *  
CCATTTGTTCAGTGGTTCGCCGGGCTTTCCCCCACTGTCTGGCTTTCAGTTATATGGATGATGTGGTATTGGGGGCCAAG
                   ta             t   t                                   g ga
                                  y                                             
                                                                                

      1690      1700      1710      1720      1730      1740      1750      1760
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 **   *  ** **  *  *  * * ***  **   ** ***** **  ** *  **** ** **  * **  *    **
TCTGTACAACATCTTGAGTCCCTTTATACCTCTGTTACCAATTTTCTTTTGTCTTTGGGTATACATTTAAATcCCAACAA
a   a      c      g          tg    g  t         c          c      c g   t t  t  
                                                                        g a     
                                                                                

      1770      1780      1790      1800      1810      1820      1830      1840
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
    *   * ***** **  *     * ** *****  *    *** * ****  ** **  * ** **  * ** **  
AACAAAAAGATGGGGATATTCCCTaaATTTCATGGGTTATGTAATTGGaAGTTGGGGgTCATTACCACAgGAaCACATCA
   t  gc g     t     tt gc c  t      ca       t        a   g  g   t     tc
                        t  g                    c        c        c     c       
                        c                                                       

      1850      1860      1870      1880      1890      1900      1910      1920
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
     ** ***    * *****  * ** ** **  * *   * *   * ** ***** *     *   *  * *  ** 
gAaTGAAAATCAAAGACTGTTTTAGAAAACTCCCTGTTAAcCGGCCTATTGATTGGAAAGTATGTCAAaGAATTGTGGGT
a tca      c g  t      g     t   c  ta a  c              c     gc gc c      
c ca            a                                            g           a      
                                                                                

      1930      1940      1950      1960      1970      1980      1990      2000
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**  * ** ** ** ** ** ** ** ***** ** *  ** ** **  ****    **  *  *    **        *
CTTTTGGGCTTTGCTGCCCCTTTTACACAATGTGGaTATCCTGCTTTAATGCCTCTgTATGCGTGTAtTCAATCTAAGCA
   a  t           c     g        g                t a   a  c cc  ggac g   
                                 c                  a c            c  g     
                                                                                

      2010      2020      2030      2040      2050      2060      2070      2080
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *****    ** ** *  *  ** * * * **  *       ** **   *  ***** ***** **   *  ***** 
GGCTTTCACTTTCTCGCCAACTTACAAGGCCTTTCTGTGTAAACAATAccTGAACCTTTACCCCGTTGCCCGGCAACGGC
      t tg  t  a  g         a    ct a a ccc  g  ta  gc               t         t
                                                                                
                                                                                

      2090      2100      2110      2120      2130      2140      2150      2160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *   * ******** ***** ** ***** ***** ** ********* *  * * *  **  **    *  **   *
CaGGTCTGTGCCAAGTGTTTGCTGATGCAACCCCCACTGGCTGGGGCTTGGCCATAGGCCATCAGCGCaTGCGtGGAACC
ac                       c              t            g   at   a   c t  c      
 t                                                     c            g a         
                                                       t                        

      2170      2180      2190      2200      2210      2220      2230      2240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**   * * **    *  * ***       *** ****  * ** ** ***** ***  **** *  **** **     *
TTTGTGGCTCCTCTGCCGATCCA---TACTGCGGAACTCCTAGCCGCTTGTTTTGCTCGCAGCAGGTCTGGAGCgAAACT
  c         a a  a           g         t g  a  c               c       g  accc  
                                            g                                   
                                                                                

      2250      2260      2270      2280      2290      2300      2310      2320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *  ** **  * ** ** ** ** ** **  * **    **  * ** ****** **** ** **  **** ** *** 
TATCGGGACaGATAATTCTGTCGTTCTCTCcCGGAAATATACATCaTTTCCATGGCTGCTAGGCTGTGCTGCCAACTGGA
c  a  a   c     c  t  c      a         c                 a   a            
   t                         c           g                                  
                                                                              

      2330      2340      2350      2360      2370      2380      2390      2400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* **    *********** *  * *** * ***     * ** *  * ****** ** *   **** *   * **    
TCCTGCGAGGGACGTCCTTTGTCTACGTCCCGTCAGCGCTGAATCCTGCGGACGACCCgTCTCGGGGTCGCTTGGGGaTC
    aa                t           g        c              c        c   c     g t
    t                                                     a                    a
                                                                                

      2410      2420      2430      2440      2450      2460      2470      2480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   * *** *  **    **    * **   *  * *** * *  ** * * * *** * * *****  * **   **  
TaTCGTCCCCTTCTCCGTCTGCCGTTCCaGCCGACCACGGGGCGCACCTCTCTTTACGCGGTCTCCCCGTCTGTgCCTTC
 cc        a     a          ga  at                   g              a     tg  
 g                               c                                        a     
 t                                                                              

      2490      2500      2510      2520      2530      2540 
....:....|....:....|....:....|....:....|....:....|....:....|.
 *  *   **  *** * * ***** * ******    ****  *****   **   ****
TCATCTGCCGGaCCGTGTGCACTTCGCTTCACCTCTGCACGTCGCATGGAGACCACCGTGA
  gc c     t                      t               a   c      
           g                                                 
           c                                                 
© 1998-2020Legal notice