HBVdb

Dataset for nucleotide sequence P of genotype E

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
       *  * * **  *   *** **   * ***** *****              ***  *   *  * ** *  **
ATGCCCCTATCTTATCAACACTTCCGGAGAaTACTGTTGTTAGACGAAGAG------GCAGGTCCCCTAGAAGAAGAACT
                       t    c       a        c                        c     
                              t                                                 
                                                                                

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*****   *  *  **   *  **  *** **  *** *  *  **** ***  * *         *   *  ** ** *
CCCTCGCCTCGCAGACGAAGATCTCAATCGCCGCGTCGCAGAAGATCTCAATCTCCAGCTTCCCAATGTTAGTATTCCTT
     a         c                                     tg    agc            g 
                                                                                
                                                                                

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   * *  ********        * **  * ** *** *       *     ** **       * * ** * *     
GGACTCACAAGGTGGGAAATTTTACGGGGCTTTAcTCTTCTACTATACCTGTCTTTAATCCTAACTGGAAAACTCCATCT
       t                          t   a c   t t   a a      t  cg       c    t t 
                                                                            c   
                                                                                

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
** **    ** **  *  * ** **  *  *    *  ** *   ** * ** ** **  * ** **  *  ***   *
TTTCCTGATATTCATTTGCACCAGGAcATTATTAACAAATGTGAACAATTTGTAGGTCCTCTAACAGTAAATGAAAAACG
  c   a c            a       t      g           c  ct t             a 
                                                              g                 
                                                                                

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *  * *   *  *  ***** * *  ** *  **       ** ** **    **    ** ** ** *  **  * *
AAGATTAAACTTAGTCATGCCTGCTAGATTTTTTCCcATCTCTACgAAATATTTgCCCCTAGAGAAAGGTATAAAACCTT
 gc    tc  a                    t   g    a      c a  at g  t  g  g      t c 
         a                          a        t        t  t           c          
                                                                                

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* ** *      *  *  * ***** ***** **     * ** ***** *  **  * *** ***  **  * ******
ATTATCCAGAtAATGTAGTTAATCATTACTTCCAAACCAGACACTATTTACATACCCTATGGAAGGCGGGCATCTTATAT
 c     c  c   c              t     t                 tt t   g               
       t  g                                               g                     
          a                                                                     

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*   * *   *  *       ** *****    **    *  **     ******  *   ** * * **   ***** *
AAAAGaGAAACTACaCGTAGCGCCTCATTTTgTGGGTCACCTTATTCTTGGGAACAAGAgCTACATCATGGGGCTTTCTT
  gc g     gt c     t        c tg  t t   a              c  c            a     g 
              g                a                                                
                                                                                

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**   ** ** **    *    *** ** ***               *     **     * ***** ** **** *** 
GGACGGTCCCTCTCGAATG---GGGGAAGAATCATTCCACCACCAATCCTCTGGGATTTTTTCCCGACCACCAGTTGGAT
             a              a     g      t a      t                             
                                                                                
                                                                                

       650       660       670       680       690       700       710       720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
****  ***   ** ** ***       * ********    *****      * *    **        * * * ****
CCAGCATTCAGAGCAAACACCAGAAATCCAGATTGGGACCACAATCCCAACAAAGACCACTGGACaGAAGCCAACAAGGT
     g   ca   g  t   cac              tat        c      t        g cc           
                                                                 c              
                                                                                

       730       740       750       760       770       780       790       800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
******* *  * **  *  * **  *  *  * *  ** *      *  * **    *   * * *      **     
AGGAGTGGGAGCATTCGGGCCgGGGTTCACTCCCCCACACGGAGGCCTTTTGGGGTGGAGCCCTCAGGCTCAAGGCATGC
                 t   c        g            c    a c   t                  t
                     a              c                                           
                                                                                

       810       820       830       840       850       860       870       880
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
          **                              *    *      *   * *    **  * **       
TAAAAACATTGCCAGCAGATCCGCCTCCTGCCTCCACCAATCGGCAGTCAGGAAGGCAGCCTACCCCAATCACTCCACCT
agcct tgg     a  a             t        g     a                                 
                                                                                
                                                                                

       890       900       910       920       930       940       950       960
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
***** *  *  *     *      *     ** *          ** *   *   **  *                   
TTGAGAGACACTCATCCTCAGGCCATGCAGTGGAATTCCACAACaTTCCACCAAGCTCTGCAGGATCCCAGAGTAAGAGG
           g     c      g a  a       a  a g t  t      a    a   a      a-----a---
           c                                                          -g    -g  
                                                                                

       970       980       990      1000      1010      1020      1030      1040
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
             * *******     **  *  * *      *  * **      ***  *  * *   **  *** * 
CCTGTATtTTCCTGCTGGTGGCTCCAGTTCCGGAACAGTGAACCCTGTTCCGACTACTGCCTCaCTCATCTCGTCAATCT
-------c--                             a g                   t     a          
t     g-cc                                                                      
                                                                                

      1050      1060      1070      1080      1090      1100      1110      1120
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *   * *  *** *     *    *   ** *         * **      **     **** ** *   **   *  *
TCTCGAGGATTGGGGACCCTGCACCGAACATGGAAaGCATCACATCAGGATTCCTAGGACCCCTGCTCGTGTTACAGGCG
                  t               cga   t                             a         
                                                                                
                                                                                

      1130      1140      1150      1160      1170      1180      1190      1200
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
** **** *  * * * ***** ***   *** **  *** ** ***** * **** *****   *    ** ****** 
GGGTTTTTCTTGTTGACAAAAATCCTCACAATACCGCAGAGTCTAGACTCGTGGTGGACTTCTCTCAATTTTCTAGGGGG
  a                                                                g           a
                                                                                
                                                                                

      1210      1220      1230      1240      1250      1260      1270      1280
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
     * *  *    ***** ** **  * *  ** ** *  *  ***** ** *   ***   **       ** * **
AGCTCCCGTGTGTCTTGGCCAAAATTCGCAGTCCCCAAcCTCCAaTCACTCACCAACCTCTTGTCCTCCAATTTGTCCTG
 t            g                     t     g        t               g c   g    
 a            c                                                                 
                                                                                

      1290      1300      1310      1320      1330      1340      1350      1360
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
     *  * ****   *  *** ** **    * * *  ** ***** * ** * ***** ******* *  **  ***
GCTATCGCTGGATGTGTCTGCGGCGTTTTATCATCTTCCTCTTCATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTT
 t                                a                                             
                                                                                
                                                                                

      1370      1380      1390      1400      1410      1420      1430      1440
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* ** ** **   * ** **** **  *** * *     **  ** *  * *  *  *     **        *  * * 
CTGGACTATCAAGGTATGTTGCCCGTTTGTCCTCTAATTCCAGGATCATCAACCACCAGTACGGGACCCTGCCGAACCTG
           c                        c                    c            a       
                                                                                
                                                                                

      1450      1460      1470      1480      1490      1500      1510      1520
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*** **    * **     * ****      ***  **  **  *   * * **    *    ***   * *   **  *
CACGACTCTTGCTCAAGGAACCTCTATGTTTCCCTCATGTTGCTGTTCAAAACCTTCGGACGGAAATTGCACTTGTATTC
        c       a         ca           c       t            aa                  
                                                                                
                                                                                

      1530      1540      1550      1560      1570      1580      1590      1600
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 ****** ***** * ** *** * ***** ********  ******* ** ***** **   ** **  ** *******
CCATCCCATCATCATGGGCTTTCGGAAAATTCCTATGGGAGTGGGCCTCAGCCCGTTTCTCCTGGCTCAGTTTACTAGTG
                                                           t                  
                                                                                
                                                                                

      1610      1620      1630      1640      1650      1660      1670      1680
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*  * ** ** ********  **  ** *** ** **  * *****  * **  *************  ****  * *  
CCATTTGTTCAGTGGTTCGCCGGGCTTTCCCCCACTGTCTGGCTTTCAGTTATATGGATGATGTGGTATTGGGGGCCAAG
                   ta             t   t                                     g ga
                                                                                
                                                                                

      1690      1700      1710      1720      1730      1740      1750      1760
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 **   *  ** **  *  *  * * ***  **   ** ***** **  *  *  **** **  *  * **  *    **
TCTGTACAACATCTTGAGTCCCTTTATACCTCTGTTACCAATTTTCTTTTGTCTTTGGGTATACATTTAAATCCCAACAA
a          c      g          tg    g            c          c      c g   t t c   
                                                                        g a     
                                                                                

      1770      1780      1790      1800      1810      1820      1830      1840
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
        * ***** **  *     * ** *****  *    *** *  ***  ** **  * ** **  * *  **  
AACAAAAAGATGGGGATATTCCCTAaATTTCATGGGTTATGTAATTGGAAGTTGGGGgTCATTACCACAgGAACACATCA
       c g           tt gc c  t        ca              a   g  g   t     tc
                        t  g                           c        c     c       
                        c                                                       

      1850      1860      1870      1880      1890      1900      1910      1920
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
     ** ***    * *****  * ** ** **  * *   * *   * ** ***** *     *   *  * *  ** 
GAatgAAAATCAAAGACTGTTTTAGaAAACTCCCTGTTAAcCGGCCTATTGATTGGAAAGTATGTCAAaGAATTGTGGGT
a tca        g  t      g     t   c  ta a  c              c     gc gc c      
c c                                                          g           a      
                                                                                

      1930      1940      1950      1960      1970      1980      1990      2000
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**  * ** ** ** ** ** ** ** ***** ** *  ** ** **  ****    **  *  *    **        *
CTtTTGGGCTTTGCTGCCCCTTTTACACAATGTGGaTATCCTGCTTTAATGCCTCTgTATGCGTGTATTCAATCTAAGCA
   a  t           c     g        g                a a   a  c cc  ggac g   
                                 c                  t              c  g     
                                                                                

      2010      2020      2030      2040      2050      2060      2070      2080
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *****    ** ** *  *  ** * * * **  *       ** **      ***** ***** **   *  * *** 
GGCTTTCACTTTCTCGCCAACTTACAAGGCCTTTCTGTGTaAACAATAccTGAACCTTTACCCCGTTGCCCGGCAACGGC
        t   t  a  g         a    ct a a ccc     ta  gc                         t
                                                                                
                                                                                

      2090      2100      2110      2120      2130      2140      2150      2160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *   * ******** ***** ** ***** *** * ** *** ***** *  * * *   *  **    *  *    *
CaGGTCTGTGCCAAGTGTTTGCTGATGCAACCCCCACTGGCTGGGGCTTGGCCaTAGGCCATCAGCGCATGCGtGGAACC
 c                       c              t            t g   at       c a  c      
 t                                                     c            g t         
                                                                                

      2170      2180      2190      2200      2210      2220      2230      2240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
     * * **    *  * ***       *** ****  *  *    ***** ***  **** *  **** **     *
TTTGTGGCTCCTCTGCCGATCCA---TACTGCGGAACTCCTAGCCGCTTGTTTTGCTCGCAGCaGGTCTGGAGCgAAACT
  c         a a              g         t  a  c               c       g  a cc  
                                            g                                   
                                                                                

      2250      2260      2270      2280      2290      2300      2310      2320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
    ** **  * ** ** ** ** ** **  * **    *   * ** ****** **** ** **  **** ** *** 
TATCGGGACaGATAATTCTGTCGTTCTCTCcCGGAAATATACATCaTTTCCATGGCTGCTAGGCTGTGCTGCCAACTGGA
c  a  a   c        t  c      a        c  c                 a                
   t                                     g                                  
                                                                              

      2330      2340      2350      2360      2370      2380      2390      2400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* **    *********** *  * *** * ***     * ** *  * ****** ** *   **** *   * **    
TCCTGCGAGGGACGTCCTTTGTCTACGTCCCGTCAGCGCTGAATCCTGCGGACGACCCgTCTCGGGGTCGCTTGGGGaTC
    aa                t           g        c              c        c   c     g t
    t                                                     a                     
                                                                                

      2410      2420      2430      2440      2450      2460      2470      2480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   * **  *   *    **    * **   *  * *** * *  ** * * * *** * * *****  * **   **  
TaTCGTCCCCTTCTCCGTCTGCCGTTCCaGCCGACCACGGGGCGCACCTCTCTTTACGCGGTCTCCCCGTCTGTGCCTTC
 cc        a     a          ga  at                                  a     t   
 g                                                                        a     
 t                                                                              

      2490      2500      2510      2520      2530      2540 
....:....|....:....|....:....|....:....|....:....|....:....|.
 *  *   **  *** * * ***** * ******    ****   ****   **   ****
TCATCTGCCGGACCGTGTGCACTTCGCTTCACCTCTGCACGTCGCATGGAGACCACCGTGA
  gc c     t                      t               a          
           g                                                 
           c                                                 
© 1998-2022Legal notice