HBVdb

Dataset for nucleotide sequence P of genotype E

[Download (right click)] [Alignment] [Repertoires]

359 sequence(s)

>gnl|hbvcds|AB091255_P_P-E Feature FT:CDS AB091255_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate ABI-129). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggccctctaacagtaaatgaaaaacgaagact
aaacttagttatgcctgctagattttttcccatcgctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgggctat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaacttcatgggttatgtaattggaagttggggatcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaatcggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggtcaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgatccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcgtctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB091256_P_P-E Feature FT:CDS AB091256_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate ABI-212). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaatttttcggggctttactcttctactatacctgtctttaatcctcactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccttatggaaggcgggcattttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgtctctctcatctcgtcaatcttctcgagga
ctggggaccctgcaccgaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgggctat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccattacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattgccacaggaacacatcagaatcaaaa
tcaaagactgtttcagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtctcttgggc
tttgctgcccctttcacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaacttatcgggacaga
taattctgttgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcggcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctgtcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB106564_P_C-E Feature FT:CDS AB106564_P_C-E of [Viruses] Hepatitis B Virus genotype E (isolate HBV-GA325). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagacgaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaaagaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaagccttattatc
cagataatctagttaatcattacttccaaaccagacactatttacacaccctatggaaggcgggcatcttatataaaaga
gaaactacacggtacgcctcattctgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaagcctctgggatgtgttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagacgccaacaaggtaggagtggg
agcatttgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgccaaaaacat
cgccagcagaaccgcctcctgcctccaccaagcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagcggaactccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
ggctcaaggaacctctatgtttccctcatgttgctgttcaaaacctgcggacggaaattgcacttgtacccccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatatcccctaaatttcatgggttatgtaattggaagttgggggtcattaccccaggaacacatcaaacaaaaaa
tcaaagactgttttagaaaactccctgtaacccggcctatagattggaaagcacgtcaaggaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcatgcattcaatccgggcaggctttcac
tttctcgccaacttacaaggcctttctgtgtcagcaatacatgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcctgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccctt
ctccgtctgccgttccggccgcccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB194947_P_P-E Feature FT:CDS AB194947_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CMR954). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatctccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctacctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaataaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctaggttttttcccctctctacgaaatatttacccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagg
gaaacgacacgtagcgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccgatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaatgt
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatctaaatcccaacaaaacaaaaag
atggggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcaaaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB194948_P_P-E Feature FT:CDS AB194948_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CMR936). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttccactatacctgtctttaatcctaactggaaaactccctcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaatttagttatgcctgctagattttttcccatctctacaaaatatttgccactagagaaaggtataaaaccttattatc
caaataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaacttcacggagcgcctcattttatgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agtgcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaaccaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttctgggggggagccctcaggctcaaggcatgctaacaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatcg
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggaagctcccgt
gtgtcgtggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcc
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaggtctgtacaa
caccttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacgaaaag
atggggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtatgcgtgtattcaatcgaagcaggctttcac
tttttcgccaacctacaaggcctttctgtgtaaacaatacctggacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctaccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcctggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB201287_P_P-E Feature FT:CDS AB201287_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Benin11). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtatcccttggactc
ccaaggtgggaaattttacggggctttactcttctactatacctgtatttaatcctaactggaaaactccatcttttcct
gatattcatttacaccaggacattattaacaaatgtgaacaatttgtaggtcccctaacagtaaatgaaaaacgaagatt
aaacttagttatgcctgctagattttttcccatctctacgaaatatttgcccctagagaagggtataaaaccttattatc
cagacaatgtagttaatcattacttccaagccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggttttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgcattacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaataccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaatcgtgggtcttctgggc
tttgctgctccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatcgaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggctataggccatcagcgcatgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactga
caattctgttgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgagaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgtccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggc
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB201288_P_P-E Feature FT:CDS AB201288_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Benin89). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaataaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcctatctctactaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagatctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccgcacggaggccttttggggtggagccctcaggctcagggcatgctaaaaacat
tgccagcagatccgcctcttgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggcaatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtctcttgggc
tttgctgccccttttacacaatgtggatatcctgctttgatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccgtcagcgcatgcgtggtacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccctt
ctccatctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB201289_P_P-E Feature FT:CDS AB201289_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Benin269). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatctttccct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagttatgcctgctagattttttcccatctctacgaaatatttgcctctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagtgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcatttgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaagaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcctgggggtctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB201290_P_P-E Feature FT:CDS AB201290_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Benin293). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaatttagtaatgcctgctagattttttcccatatctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacccgtagcgcctcattttgtgggtcaccttattcttgggaacacgagctacaccatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccaaaaatccagattgggaccacaatcccaacaaagaccactggaaagaagccaacaaggtaggagtggg
agcattcgggcctgggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccacctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagttcccgt
gtgtcttggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggtagttggggatcattaccacaagaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggctatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttttgtgtaaacaatatatggacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggccgcttgggggtctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB205129_P_P-E Feature FT:CDS AB205129_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HBV-G758-2). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacgggcctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaagacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaagggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaacgg
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccgacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacagcattccaccaagctctgcaggatcccaaagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgagccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaggcatcacatcaggattcctgggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccgatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaacg
atggggatattctcttaatttcatgggatatgtaattgggagttgggggtcattaccacaggaacacatccgaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtgttcaatcgaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacgga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB205188_P_P-E Feature FT:CDS AB205188_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HBV-GA283). Non-functional genomic sequence. [Hepadnaviridae] (length=2514 residues).
atgcccctatcgtatcaacacttcccgagaatactgttgttagacgaagaagcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagttatgcctgctagattttttcccaattctacaaaatatttgcccctagagaagggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagg
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccacctccaatccgctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagatgccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaagcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccgtgcagtggaattccacaacatttcaccaagctctgcaggatcccagagtacctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaaacatcacatcaggattcctaggacccctgctcgtattacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaagggacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtctggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccct
aaatttcatgggttatgtaattggaagttgggggtcattgccacaggaacacatcagaatgaaaatcaaagactgtttta
gaaaactccctgttaaccggcctattgattggaaagtctgtcaaagaattgtgggtcttttgggctttgctgcccctttt
acacaatgtggatatcctgctttaatgcctcggtatgcgtgtattcaatctaagcaggctttcactttctcgccaactta
caaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctg
atgcaacccccactggctggggcttggccataggccatcagcgcctgcgtggaacctttgtggctcctctgccgatccat
actgcggaactcctagccgcttgttttgctcgcagccggtctggagcgaaacttatcgggactgataattctgtcgttct
ctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacg
tcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttc
cagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgc
ttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB205189_P_P-E Feature FT:CDS AB205189_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HBV-G138). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaaggactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactctacctgtctttaatcctaactggaaaactccctcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcctatctctacaaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtggttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacaagtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccagggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccaacagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgtctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatccaaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtccttaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtctcttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcctggtctgt
gccaagtgtttgctgatgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggacaga
taattctgttgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtttcggggtcgcttggggatctttcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcgtctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB205190_P_P-E Feature FT:CDS AB205190_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HBV-G123). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcctatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cggataatgtggttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggactg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaactccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttctctcccccgcacggaggccttttggggtggagccctcaggctcaaggcatgttacaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaaggggcctgtttct
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcatcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
cgaggtatattgcccgtttgtcctctacttccaggatcagcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggggtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttctgttgtctttgggcatacagttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggcagttggggatcattaccacaggatcacattagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtctcttgggt
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggcctgt
gccaagtgtttgctgatgcaacccccactggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctctcggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB205191_P_P-E Feature FT:CDS AB205191_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HBV-G166). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccttcttttcct
gatattcatttgcaccaggatattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcctatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtggttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccagggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacag
tgccaacagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaatccaaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacattagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtctcttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcctggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgcggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccctctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB205192_P_P-E Feature FT:CDS AB205192_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HBV-G758). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacgggcctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaagacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaagggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaacga
ggaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacagcattccaccaagctctgcaggatcccaaagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgagccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccgatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaacg
atggggatattctcttaatttcatgggatatgtaattgggagttgggggtcattaccacaggaacacatccgaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtgttcaatcgaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacgga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctatatttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB219529_P_P-E Feature FT:CDS AB219529_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate UK1). Non-functional genomic sequence. [Hepadnaviridae] (length=2517 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttactgggctttattcttctactatacctgtctttaatcctaactggaaaactccctcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaagggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctctggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttatgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccaaaaatcctgattgggacaacaatcctaacatagaccactggacagaagccaacaaggtaggagtggg
agcatttgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcggatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaacacctgctggtgg
ctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctg
caccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaa
atcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggcca
aaattcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgc
ggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttg
cccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaac
ctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctt
tcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcc
gggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtcc
ctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattc
cctacatttcatgggttatgtaattggaagttgggggtcattaccacaagaacacatcagaatgaaaatcaaagaatgtt
ttagaaaactccctgttaaccgtcctattgattggaaagtctgtcaaagaattgtgggtcttttgggctttgctgcccct
tttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaac
ttacaaggcctttctgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttg
ctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatc
catactgcggaactcctagccgcttgttttgctcgcagccggtctggagcgaaacttatcgggactgataattctgtcgt
tctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtct
acgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgtttgggggtctatcgtccccttctccgtctgccg
ttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcactt
cgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB219533_P_P-E Feature FT:CDS AB219533_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate UK5). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatctttccct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttatgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccaaaaatccagattgggacaacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcatttgggccggggttcactcccccacacggaggccttctggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaaaaaacctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgggttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtcccaaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaagggacctctatgtttccctcatgttgctgtttaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcgcaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaa
catcttgaagccctttatacctctgttactaatttccttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctacatttcatgggttatgaaattggcagtttcgggtcattaccacaagaacacatcagaatgaaaa
tcaaggactgttttagaaaactcccagttaaccgacctattgattggaaagtatgtcaacgaattgtgggtcttttgggc
tttgccgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggactga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccctctcggggtcgcttgggggtctgtcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB274969_P_P-E Feature FT:CDS AB274969_P_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgtaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataagaga
gaaactacgcgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcgttc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
tgcattcgggccggggttcactcccccacacggaagccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttacgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaactaatcgggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctacgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccctctcggggtcgcttggggatctatcgtccccta
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB274970_P_P-E Feature FT:CDS AB274970_P_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctca
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gacattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaaattagtcatgcctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagg
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
cgagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatactaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgagccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccacaagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgtcgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaacg
atggggttattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtattcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtatacacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctttgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacgga
caattctgtcgtcctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB274971_P_P-E Feature FT:CDS AB274971_P_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactctactactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaaagaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaaaaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaacttcatgggttatgtaattggaagttgggggtcattaccacaagaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaatcggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttttgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcctgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB274973_P_P-E Feature FT:CDS AB274973_P_P-E of [Viruses] Hepatitis B Virus genotype E. Non-functional genomic sequence. [Hepadnaviridae] (length=2523 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaacgccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattctttcccatctctacaaaatatttgcccctagagaaaggtataaaaccctattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatgggaggcgggcatcttatataaaagg
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagatctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccacctccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggagcagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagttcagcaggatcacagagtaagaggcctgcctgc
tggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattgggg
accatgcaccgaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttg
acaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtct
tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgt
gtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggt
atgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccatgcagaacctgcacgactcttgctca
aggaacctctatgtttccctcatgttgctgttcaaaaccttcgggcggaaattgcacttgtattcccatcccatcatcat
gggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtgg
ttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtgcaacatctt
gagtccctttatacctctgttaccaattttcttttgtctttgggtatacatctaaatcccaacaaaacaaaaagatgggg
atattccctacatttcatgggttatgtaattggcagttgggggtcattaccacaggagcacattagaatgaaaatcaaag
actgttttagaaaactccctgttaacaggcctattgattggaaagtatgtcaaagaattgtaggtcttttgggctttgct
gccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctcagcaggctttcactttctc
gccgacttacaaggcctttctatgtaaccaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaag
tgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctg
ccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggactgataattc
tgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcct
ttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgt
ctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgt
gcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB274974_P_P-E Feature FT:CDS AB274974_P_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
aatattcatttgcaccaggatattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttacctctagagaaaggtattaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagg
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagatcactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctcctccaatcgtcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggcttcagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaagag
gtggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacattagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatatatgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcctgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccgaaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB274975_P_P-E Feature FT:CDS AB274975_P_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctaaatcgccgagtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaatttagtcatgcctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataagagg
gaaactacgcgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcgttc
aaagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
tgcattcgggccggggttcactcccccacacggaggccttttgggatggagccctcaggctcaaggcatgctaacaacat
tgccaacagatccgcctactgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatct
tcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcactcatctcgtcaatctcctcgagga
ttggggaccctgtaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttacgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccatttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttttgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacgga
taattctgtcgttctttcccggaaatatacatcattcccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccatctcggggtcgcttggggatctatcgtcccctc
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB274976_P_P-E Feature FT:CDS AB274976_P_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagattactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaatttttcggggctttactctactactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccttatggaaggcgggcatcttatataaaaga
gaaacttcacgtagcgcctcattttgcgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaaaaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttgggatggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgaacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaacttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctattaatcggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttttgtgtacacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
caattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB274977_P_P-E Feature FT:CDS AB274977_P_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagactactgttcttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaacctccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagttatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacacaccctatggaaggcgggcatcttatataagaga
gaaacttcacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcaatccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcacccccccacacggaggccttttggggtggagccctcaggctcaaggcatgctacaaacat
tgccagcaaatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccaaagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtaaaccctgttccgactactgtctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgtcgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttggggatcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
gttctcgccaacttacaaggcctttctgtgtaaacaataccagaaccttttccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatccttcccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctg
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcacctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB274978_P_P-E Feature FT:CDS AB274978_P_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaagacattattaacaagtgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaatttagtcatgcctgctagattttttcccatctctacgaaatatttaccactagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataagaga
gaaactacgcgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcgttc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
tgcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaacaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaacaggcctgtattt
tcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctacatttcatgggttacgtaattggaagttgggggtcattaccacaggaacacatcacactgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggctatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcctgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccta
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB274979_P_P-E Feature FT:CDS AB274979_P_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagattactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttgcggggctttactcttctactatacctgtctttaatcctcactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatc
cagatcatgtagttaatcattacttccaaaccagacactatttacataccttatggaaggcgggcatcttatataaaaga
gaaactacacatagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaaaaatcagtccaccaccaatcctctgggattttttcccgaccaccagttggatccagaattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctctggctcaaggcatgctaaaaacat
tgccagcaaatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagtc
actcatcctcaggccattcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatct
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacatgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattgccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgcccctttcacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaagctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcctggtttgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcgaaacttatcgggactga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcacacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB274980_P_P-E Feature FT:CDS AB274980_P_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgccgaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
aatattcatttgcaccaggacattgttaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaaagaagatt
aaacttagtaatgcctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaactagacactatttacataccctatggaaggcgggcatcttatataaaagg
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccgccaatcggcagtcaggcaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaggctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtttctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatattgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggttattccctaaatttcatgggttatgtaattggaagttggggatccttaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactcccggttaaccgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcacagcaggtctggagcaaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatccttcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB274981_P_P-E Feature FT:CDS AB274981_P_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcacaatgttagtattccttggactc
acaaggtgggaaattttgcggggctttactcttctactatacctgtctttaatcctaattggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctgacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctactaaatatttacccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatattatataagaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgagtgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcgttc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaacccaacgaggtaggagtgag
tgcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcacgctaaaaacat
tgccaacagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgaccct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttacgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccatttacacaatgtggatttcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtcaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcatagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggactga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctcggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccatctcggggtcgcttggggatctatcgtccccta
ctccgtctgccgttccacccgtccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB274982_P_P-E Feature FT:CDS AB274982_P_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcacaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcacttgcaccaggacattattaacaaatgtgaagaatttgtaggtcctctcacagtaaatgaaaaacgaagatt
aaatctagtcatgcctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
aaagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttgtggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggggtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtattcatttaaatcccaacaaaacaaaaag
atggggatactcccttaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactcccggttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtatgcatgtattcaatctaagcaggctttcac
tttttcgccaacttacaaggcctttctgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcctgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgtactctcccggaaatatacatcttttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccaaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB274984_P_P-E Feature FT:CDS AB274984_P_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=2505 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccgatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtttttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattatcaacaaatgtgagcaatttgtaggtcctttaacagtaaatgaaaaacgaagatt
aaacctagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagacaatgtagttaatcattacttccaaaccagacattatttgcataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttgggatggaaccctcaggctcaaggcatgcaaacaacat
tgccagcacggcggtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggccatgcagtgg
aattccacaacattccaccaagctctgcaggatcccagagtaaggggcctgcaattccctgctggtggctccagttccgg
aacagtgagccctgttccgactactgtctcacgcatctcgtcaatcttctcgaggattggggaccttgcaccgaacatgg
aaaacatcacatcaggattcctaggacccctgcgcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaata
ccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtc
cccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatca
tcttcctcttcatcctgctgctatgcctcatcttcttgttgggtcttctggactatcaaggtatgttgcccgtttgtcct
ctaattccaggatcatcaaacaccagtacaggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttcc
ctcatgttgctgttcaaaacctttggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcc
tatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttccccc
actgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgct
gttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattcccttaatttcat
gggttatgtaattggaagttgggggtcattaccacaggatcacatcagaatgaaaatcaaagactgttttagaaaactcc
ctgttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgt
ggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcacgttctcgccaacttacaaggcctt
tctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccc
ccactggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcccctgccgatccatactgcggaa
ctcctagccgcttgttttgctcgcagccggtctggagcgaaacttatcgggactgataattctgtcgttctctcccggaa
atatacatcatttccatggctgctaggctgtgctgccaactggatcctacgagggacgtcctttgtctacgtcccgtcag
cgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctcctgcgtctgccgttccagccgacc
acggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctct
gcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB274985_P_P-E Feature FT:CDS AB274985_P_P-E of [Viruses] Hepatitis B Virus genotype E. Non-functional genomic sequence. [Hepadnaviridae] (length=2523 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccactgttagtattccttggactc
acaaggtgggcaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattgacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcctatctctacaaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctgtggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaaaaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagatcactggacggaacccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcgggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccattcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgcctgc
tggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatatcgtcaatcttctcgaggattgggg
accctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttg
acaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtct
tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgt
gtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggt
atgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctca
aggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcat
gggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtgg
ttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatctt
gagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatgggg
atattccctaaacttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaag
actgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaacgaatcgtgggtcttttgggcttcgct
gccccttttacgcaatgtgggtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctc
gccaacttacaaggcctttttgtgtcaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaag
tgtttgctgatgcaacccccactggttggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcctctg
ccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattc
tgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcct
ttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtccccttctccgt
ctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgt
gcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB915175_P_P-E Feature FT:CDS AB915175_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SA1). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatctttccct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccacctccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcatttgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaaacctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcy
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaagaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgccgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB915177_P_P-E Feature FT:CDS AB915177_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SA3). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactattcctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccgtattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggcctgggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacgacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgaatactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctttgtttccctcatgttgctgctcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgtcgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttggggatcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccgccctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtactcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtataaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccaatgatctgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggac
agataattctgtcgttctctcgaggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgag
ggacgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccc
cttctccgtctgccgttccagccaaccacggggcgcacctctctttacgcggtctccccgtctgtaccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB915178_P_P-E Feature FT:CDS AB915178_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SA4). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttcctgagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccttagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcaatccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggwcagaagccaacaaggtaggagtggg
agcattcgggcctgggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagccaaccccaatcactccacctttgagagat
actccagtccaggccatgcagtggaattccaagacattccaccaagctctgcaggatmccagagtaagaggcctgtatct
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccttgcaccgaacatggagagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcctggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtgtccctcatgttgctgtttaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgtcgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttggggatcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggccaattgattggaaagtctgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtaytcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcacggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacgtctctttacgccgtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB915180_P_P-E Feature FT:CDS AB915180_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SA6). Non-functional genomic sequence. [Hepadnaviridae] (length=2511 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaagatctcaatcgccgcgtcgcaaaagatctcaatctcgaggtgcccaatgttagtattccttggacgc
acaaggtgggaaattttacgggactttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctttggaaggcgggcatcttatataagaga
gaaactacacgtagcgcctcattttttgggtcactttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcagtccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggcctgggctcactcccccacacggaggccttttggggtggagtcctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctactccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacgacattccaccaagctctgcaggatcccactcctgctggtggctccag
ttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccga
acatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctc
acaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattc
gcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtt
ttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtt
tgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctat
gtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaa
aattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctt
tcccccactgtctggctttcagttatatggatgatgtggtattgggggcgaggtctgtacaccatcttgagtccctttat
accgctgttaccaattttcttttgtctttgggtatacatttaaatcctaacaaaacaaaacgatggggatattccctcaa
tttcatgggttatgtcattggaagttgggggtcattgccacaagaacacatcagaatgaaaatcaaagaatgttttagaa
aacttcctgttaaccggcctattgattggaaagtctgccaaagaattgtgggtcttttgggctttgctgccccttttaca
caatgtggttatcctgctttgatgcctctgtatgcgtgtactcaatctaagcaggctttcactttctcgccaacttacaa
ggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatg
caacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatatt
gcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactgataattctgtcgttctctc
ccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgagagggacgtcctttgtctacgtcc
cgtcagcgctgaatccagcggacgacccgtctcggggtcgcttggggatctctcgtccccttctccgtctgccgttccag
ccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttc
acctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AM494689_P_P-E Feature FT:CDS AM494689_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR006). Non-functional genomic sequence. [Hepadnaviridae] (length=2517 residues).
atgcccctatcttatctacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttacaccaggacattattgacaaatgtgaacaatttgtaggtcccctaacagtaaatgaaaaacgaagatt
aaacttagttatgcctgctagattttttcccatctctacaaaatattttcccctagagaaaggcataaagccttattatc
ccgataatgtagttaatcattactttcaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaaccagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtcgagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcaatcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcaatggaattccacaacattccaccaagctctgcaggatcccatagtaartcctgctggtgg
ctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctg
caccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaa
atcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggcca
aaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgc
ggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttg
cccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaac
ctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctt
tcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcc
gggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtcc
ctttataccgctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattc
cctaaatttcatgggttatgtaattggaagttgggggtcattaccacaagaacacatcagattgaaaatcaaagactgtt
ttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcccct
tttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatcgaagcaggctttcactttctcgccaac
ttacaaggcctttttgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttg
ctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatc
catactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactgataattctgttgt
tctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtct
acgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccg
ttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcactt
cgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AM494690_P_P-E Feature FT:CDS AM494690_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR008). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctaatatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggcctgggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccgtttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctgaatttcatgggttatgtaattggaagttggggatcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaatcggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacgga
taattctgtcgttctctcacggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AM494691_P_P-E Feature FT:CDS AM494691_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR024). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttccaaatgttagtattccctggactc
acaaggtgggcaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgccactagagaaaggtataaaaccttattatc
ccgataatgtagttaatcattacttccaaaccagacactatttacataccctttggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcaatccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacatggaggccttttggggtggagccctcaggctcaaggcatgcwaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaaggggcctgtatct
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggagagcatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaagggacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttaggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgcagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggcgaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttacgtaattggaagttgggggtcattaccacaggaacacatccgaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggccttttgggt
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtcaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacgga
taattctgtcgtcctctcccgaaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtttacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagacccccgtga
>gnl|hbvcds|AM494692_P_P-E Feature FT:CDS AM494692_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR026). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagattactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttacaccaggacattattaacaaatgtgagcaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacaaaatattttcccctagagaaaggtataaaaccttattatc
ccgataatgtagttaatcattactttcaaaccagacactatttacataccctgtggaaggcgggcatcttatataaaaga
gaaaccacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggatttcttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggcattttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcaatcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatct
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatatcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggttatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtctgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttggggctcattaccacaagaacacatcagattgaaaa
tcaaagactgttttagaaaactccctgttaaccggcccattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccatgggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcttagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactga
taattctgttgttctctcccgaaaatatacatcatttccatggctgctaggctgtactgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AM494693_P_P-E Feature FT:CDS AM494693_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR039). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtgggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
ctgataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggtatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggcctgggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggttatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctgaatttcatgggttatgtaattggaagttggggatcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttttcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgt
gccaagtgtttgctgatgcaactcccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggacgga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctacgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcctggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AM494694_P_P-E Feature FT:CDS AM494694_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR047). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttccactatacctgtctttaatcctaactggaaaactccctattttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagttatgcctgctagattttttcccatctctacaaaatatttgccactagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggctcactcccccacacggaggccttctggggtggagtcctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatacagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
wtggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcc
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
gtggggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttttcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcctggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AM494695_P_P-E Feature FT:CDS AM494695_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR053). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagactactgttattagacacagaggcaggtccactagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgccactagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttgcataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggcctgggttcactcccccacacggagaccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgccttctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatct
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaatatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcaacaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaacctacggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggtgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctgaatttcatgggttatgtaattggaagttggggatcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttcgaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcatgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgcaaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctaccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcgaaacttatcgggacgga
taattctgtcgttctctcacggaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctrcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AM494696_P_P-E Feature FT:CDS AM494696_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR060). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttccactatacctgtctttaatcctaactggaaaactccctattttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagttatgcctgctagattttttcccatctctacaaaatatttgccactagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggctcactcccccacacggaggccttctggggtggagtcctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatacagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
gtggggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttttcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcctggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AM494697_P_P-E Feature FT:CDS AM494697_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR063). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttacaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacaaaatattttcccctagagaaaggtataaaaccttattatc
ccgataatgtagttaatcattactttcaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcgttc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcaatcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaaaaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctctaatttgtcctggctatcgtt
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttggggctcattaccacaagaacacatcagattgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctatatgcgtgtactcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccatgggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttattgggactga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AM494698_P_P-E Feature FT:CDS AM494698_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR066). Non-functional genomic sequence. [Hepadnaviridae] (length=2508 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctttggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
aaagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggcctgggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatccccctgctggtggctccagttc
cggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaaca
tggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcaca
ataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaattcgca
gtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttta
tcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
cctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtt
tccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaat
tcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcc
cccattgcctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacc
tctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctgaattt
catgggttatgtaattggcagttggggatcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaaaac
tccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaa
tgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggc
ctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgatgcaa
cccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcg
gaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacggataattctgtcgttctctcccg
gaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgt
cagcgctgaatcctgcggacgacccatctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccg
accacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacc
tctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AM494699_P_P-E Feature FT:CDS AM494699_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR082). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtcggtcctctaacagtaaatgaaaaacggagatt
aaacttagttatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggcctgggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaaaaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggctcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaagccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctgaatttcatgggttatgtaattggaagttggggatcattaccacaggaacacatcagaatgaaaa
tcacagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcactctaagcaggctttcat
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatactacgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AM494700_P_P-E Feature FT:CDS AM494700_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR083). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttccactatacctgtctttaatcctaactggaaaactccctattttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagttatgcctgctagattttttcccatctctacaaaatatttgccactagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggctcactcccccacacggaggccttctggggtggagtcctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatacagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcc
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
gtggggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttttcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcctggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AM494701_P_P-E Feature FT:CDS AM494701_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR097). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcctatctctacgaaatatttgcccttagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggcctgggttcactcccccacacggaggcctcttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctgaatttcatgggttatgtaattggaagttggggatcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcctgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacgga
taattctgtcgttctctcacggaaatatacatcgtttccatggctgctaggctgtgctgccaactggatccttcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggctctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AM494702_P_P-E Feature FT:CDS AM494702_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR106). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggcctgggttcactcccccacacggaggccttttggggtggagtcctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctgaatttcatgggttatgtaattggaagttggggatcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtactcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcacggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctacgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AM494703_P_P-E Feature FT:CDS AM494703_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR107). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctaaaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccatcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttacaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctttggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggccagaagccaacaaggtaggagtggg
agcattcgggcctgggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctgaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatct
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagaatctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgtttaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggcgaaatctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctgaatttcatgggttatgtaattggaagttggggatcattaccacaggaacacatcagaataaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtctgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctggacctttaccccgttgcccggcaacggcccggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggacgga
taattctgtcgttctctcacggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctacgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AM494704_P_P-E Feature FT:CDS AM494704_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR112). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtgggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
ctgataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggtatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggcctgggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcgtggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccattgcctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctgaatttcatgggttatgtaattggaagttggggatcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttttcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgt
gccaagtgtttgctgatgcaactcccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacgga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctacgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcctggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AM494705_P_P-E Feature FT:CDS AM494705_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR115). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggcaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
ccgataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agccttcgggccggggttcactcccccacatggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttacgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagaatgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggt
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcacgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgtcctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtttacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AM494706_P_P-E Feature FT:CDS AM494706_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR131). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggcataaaaccttattatc
cagataatgtagttaatcattactttcaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcaatcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctctctcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaargcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttggggctcattaccacaggaacacatcagattgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggctatcctgctttaatgcctctgtatgcgtgtactcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgttgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AM494707_P_P-E Feature FT:CDS AM494707_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR137). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcccaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccttagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggcctgggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgtcgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctgaatttcatgggttatgtaattggaagttggggatcattaccacaggaacacatcaaaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcctgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacgga
taattctgtcgttctctcacggaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctacgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AM494708_P_P-E Feature FT:CDS AM494708_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR138). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggcataaaaccttattatc
cagataatgtagttaatcattactttcaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggcctgggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctgaatttcatgggttatgtaattggaagttggggatcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtactcaatctaagcaggctttcac
tttctcgccgacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacgga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctacgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AM494709_P_P-E Feature FT:CDS AM494709_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR143). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttacaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaacgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacaaaatattttcccctagagaaaggtataaaaccttattatc
ccgataatgtagttaatcattactttcaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcaatcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgaccactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcactgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggttatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatataattggaagttggggctcattaccacaagaacacatcagattaaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtactcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccatgggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcgaaacttatcgggactga
taattctgttgttctctcccgaaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AM494710_P_P-E Feature FT:CDS AM494710_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR144). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttacaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacctagtcatgcctgctagattttttcccatctctacaaaatattttcccttagagaaaggtataaaaccttattatc
ccgataatgtagttaatcattactttcaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagcgctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggtcttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcaatcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgtctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggttatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttggggctcattaccacaagaacacatcagattgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcagagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccatgggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatacggcggaactcctagccgcttgttttgctcgcagcaggtctggagcgacacttatcgggactga
taattctgttgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccatctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AM494711_P_P-E Feature FT:CDS AM494711_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR146). Non-functional genomic sequence. [Hepadnaviridae] (length=2526 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctatctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaacaggacattatcaacaaatgtgaacaatttgtaggtcctttaacagtaaatgaaaaacgaagatt
aaatttagttatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaagggataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcatgccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcacwcccccacacggaggccttttggggtggagcccccaggctcaaggcatgctaaacactt
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaaactctgcaggatcccagagtaaggggcctgtatcc
tgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattg
gggaccttgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttg
ttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggaagctcccgtgtg
tcgtggccaaaattcgcagtccccaacctccagtcactcactaacctcttgtcctccaatttgtcctggctatcgctgga
tgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaa
ggtatgttgcccgtttgtcctctacttccaggatcatcaaccaccagcacgggaccctgccgaacctgcacgactcttgc
tcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcat
catgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcag
tggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacac
cttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatg
gggatattccctcaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagattaaaaatca
aagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggcttt
gctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcacttt
ctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgcc
aagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcctgcgtggaacctttgtggctcct
ctgccgatccatactgcggaactcctagccgcttgtttcgctcgcagcaggtctggagcgaaacttatcgggactgataa
ttctgttgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgagagggacgt
cctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctc
cgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccg
tgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AM494712_P_P-E Feature FT:CDS AM494712_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR150). Non-functional genomic sequence. [Hepadnaviridae] (length=2526 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggatattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacaaaatattttcctttagagaaaggtataaaaccttattatc
ccgataatgtagttaatcattactttcaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggatcacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgtttccaccaatcggcaatcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctctggccgtgcagtggaattccaaaacattccaccaagctctgcaggatcccagagtaaggggcctgtatcc
tgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattg
gggaccttgcaccgaacatggaaagcatcacatcarrattcctaggacccctgctcgtgttacaggcggggtttttcttg
ttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggaagctcccgtgtg
tcgtggccaaaattcgcagtccccaacctccagtcactcactaacctcttgtcctccaatttgtcctggctatcgctgga
tgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaa
ggtatgttgcccgtttgtcctctacttccaggatcatcaaccaccagcacgggaccctgccgaacctgcacgactcttgc
tcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcat
catgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcag
tggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacat
cttgagtccctttatactgctgttaccaattttcttatgtctttgggtatacatttaaatcccaacaaaacaaagagatg
gggatattcccttaatttcatgggttatgtaattggaagttggggctccttaccacaagaacacatcagattgaaaatca
aagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtctgttgggcttt
gctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtactcaatctaagcaggctttcacttt
ctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgcc
aagtgtttgctgatgcaacccccactggctggggcttggccatgggccatcagcgcctgcgtggaacctttgtggctcct
ctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactgataa
ttctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgt
cctttgtctacgtcccgtcagcgctgaaccctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctc
cgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccg
tgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AM494713_P_P-E Feature FT:CDS AM494713_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR154). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttaatcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gagactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggcctgggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcattcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaactaaaag
atggggatattccctgaatttcatgggttatgtaattggaagttggggatcattaccacaggaacacatcagaatgaaaa
tcaaagattgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctggacctttaccccgttgcccggcaacggcccggcctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcacggaaatacacgtcatttccatggctgctaggctgtgctgccaactggatcctacgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AM494714_P_P-E Feature FT:CDS AM494714_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR165). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccatcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacaaaatattttcctttagagaaaggtataaaaccttattatc
ccgataatgtagttaatcattactttcaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggatcacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgtttccaccaatcggcaatcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctctggccgtgcagtggaattccaaaacattccaccaagctctgcaggatcccagagtaagaggcctgtatcc
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaagattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagactgtacaa
catcttgagtccctttatactgctgttaccaattttcttatgtctttgggtatacatttaaatcccaacaaaacaaagag
atggggatattccctaaatttcatgggttatgtaattggaagttggggctcattaccacaagaacacatcagattgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtctgttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtactcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccatgggccatcagcgcctgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaaccctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AM494715_P_P-E Feature FT:CDS AM494715_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR171). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtgggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacraaatatttkcccytagagaaaggtataaaaccttattatc
cygataatgtagttaatcattacttycaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggttatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctgaatttcatgggttatgtaattggaagttggggatcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttttcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgt
gccaagtgtttgctgatgcaactcccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacgga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctacgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcctggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AM494717_P_P-E Feature FT:CDS AM494717_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR187). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggcataaaaccttattatc
cagataatgtagttaatcattactttcaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggcctgggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctgaatttcatgggttatgtaattggaagttggggatcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtactcaatctaagcaggctttcac
tttctcgccgacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacgga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctacgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY738144_P_P-E Feature FT:CDS AY738144_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate patient B, 7/98). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctct
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttacaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaaaggagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacccgtagcgcctcattttgtgggtcaccttattcttgggaacacgagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcgaacaccagaaatccagattgggaccacaatcccaacaaagatcactggacagcagccaacaaggtaggagtggg
agcattcgggcctgggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagggtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggacagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcggtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
cacggtatgttgcccgtttgtcctctaattccaggatcaccaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cggtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggtagttgggggtcattaccacaagaacacatcagattgaaaa
tcaaagactgttttagaaaacttcctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttaggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctatatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatatatgaccctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactccttgcagcttgttttgctcgcagcaggtctggagcgaaacttatcgggacgga
taattctgtcgttctctcccggaaatatacctcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctgtacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY738145_P_C-E Feature FT:CDS AY738145_P_C-E of [Viruses] Hepatitis B Virus genotype E (isolate patient B, 7/98). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctct
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttacaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaaaggagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacccgtagcgcctcattttgtgggtcaccttattctcgggaacacgagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcgaacaccagaaatccagattgggaccacaatcccaacaaagatcactggacagcagccaacaaggtaggagtggg
agcattcgggcctgggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagggtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggacagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
cacggtatgttgcccgtttgtcctctaattccaggatcaccaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cggtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggtagttgggggtcattaccacaagaacacatcagattgaaaa
tcaaagactgttttagaaaacttcctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttaggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctatatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatatatgaccctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagcaggtctggagcgaaacttatcgggacgga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctgtacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY738146_P_P-E Feature FT:CDS AY738146_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate patient B, 7/98). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctct
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttacaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaaaggagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacccgtagcgcctcattttgtgggtcaccttattcttgggaacgcgagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcgaacaccagaaatccagattgggaccacaatcccaacaaagatcactggacagcagccaacaaggtaggagtggg
agcattcgggcctgggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagggtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggacagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
cacggtatgttgcccgtttgtcctctaattccaggatcaccaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggtagttgggggtcattaccacaagaacacatcagattgaaaa
tcaaagactgttttagaaaacttcctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttaggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctatatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatatatgaccctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagcaggtctggagcgaaacttatcgggacgga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctgtacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY738147_P_P-E Feature FT:CDS AY738147_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate patient B, 10/98). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctct
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttattcttctactattcctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttacaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaaaggagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacccgtagcgcctcattttgtgggtcaccttattcttgggaacacgagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcgaacaccagaaatccagattgggaccacaatcccaacaaagatcactggacggcagccaacaaggtaggagtggg
agcattcgggcctgggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagggtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggacagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttaccatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
cacggtatgttgcccgtttgtcctctaattccaggatcaccaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggtagttgggggtcattaccacaagaacacatcagattgaaaa
tcaaagactgttttagaaaacttcctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttaggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctatatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatatatgaccctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagcaggtctggagcgaaacttatcgggacgga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctgtacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY739674_P_P-E Feature FT:CDS AY739674_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate patient P2). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctagctggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaaggtt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttacccctagagaaaggcataaaaccttactatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagg
gaaactacacgcagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggaccgaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgttacaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaactccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaatcccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctatacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtctgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcagtctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggttggggcttggccataggccatcagcgcctgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggaccga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY739675_P_P-E Feature FT:CDS AY739675_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate patient P2). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctagctggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaaggtt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttacccctagagaaaggcataaaaccttactatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagg
gaaactacacgcagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggaccgaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgttacaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaactccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccttgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaatcccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctatacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtctgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcagtctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggttggggcttggccataggccatcagcgcctgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggaccga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcctctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY935700_P_P-E Feature FT:CDS AY935700_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate TH-HBV-012). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacagggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaagggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacccgtagcgcctcattttgtgggtcaccttattcttgggaacacgagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcatttgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacct
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatct
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagactgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggtagttgggggtcattaccacaagaacacatcagattgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtgtgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctatatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatatatgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatagggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ060822_P_P-E Feature FT:CDS DQ060822_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 8510-91). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccttagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacccgtagcgcctcattttgtgggtcaccttattcttgggaacacgagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcgttc
agagcaaataccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcatttgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctacttccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggtagttgggggtcattaccacaagaacacatcagattgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctatatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatatatgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtgggacctttgtggct
cctctgccaatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacgga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctacgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ060823_P_P-E Feature FT:CDS DQ060823_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 8504-91). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttaatcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagacaatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataagaga
gaaactacccgtagcgcctcattttgtgggtcaccttactcttgggaacacgagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcatttgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattagtagttgggggtcattaccacaagaacacatcagattgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctatatgcttgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatatatgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggctataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaattggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtcccctt
ctccgtctgccgttccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ060824_P_P-E Feature FT:CDS DQ060824_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 0121-20). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtccactaacagtaaatgaaaaacgaagatt
aaatttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacccgtagcgcctcattttgcgggtcaccttattcttgggaacacgagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacaaaagccaacaaggtaggagtggg
agcattcgggcctgggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggtagttgggggtcattaccacaagaacacatcagattgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctatatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatatatgaacctttaccccgttgcacggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggcattcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatagggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccctctcggggtcgcttggggggctatcgtcccctt
ctccgtctgccgttccagccgacgacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ060825_P_P-E Feature FT:CDS DQ060825_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 0262-09). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacccgtagcgcctcattttgtgggtcaccttattcttgggaacacgagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcatttgggcctgggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaagacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggtagttgggggtcattaccacaagaacatatcagattgaaaa
tcaaagactgttttagaaaacttcctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctatatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatatatgaccctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccttcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgagaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccctctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ060826_P_P-E Feature FT:CDS DQ060826_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 0433-20). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttattcttctactatacctgtctttaatcctaactggaaaactctctcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaaattagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacccgtagcgcctcattttgtgggtcaccttattcttgggaacacgagctacatcatggggctttcttggacgg
tccctctcgaatgggggaaaaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggcctgggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcgggatttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccctcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggtagttggggatcattaccacaagaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatacgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatatatgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccaatccatacggcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggacaga
taattctgtcgttctctctcggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ060827_P_P-E Feature FT:CDS DQ060827_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 0317-04). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaaattagtcatgcctgctagattttttcccatctctacaaaatatttgcccctagagaaaggcataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacccgtagcgcctcattttttgggtcaccttattcttgggaacacgagctacatcatggggctttcttggacgg
tccctctcgaatgggggaaaaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggcctgggttcactcccccacacggaggccttttgggatggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcgggatttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgttatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggtagttggggatcattaccacaagaacacatcagaatgaaaa
tcaaagactgttttagaaaacttcctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatatatgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccatagccattcagcgcatgcgtggaacctttgtggct
cctctgcccatccatacggcggaactcctagccgcttgttttgctcgcagcaggtctggggcgaaacttatcgggacaga
taattctgtcgttctctctcggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtttacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ060828_P_P-E Feature FT:CDS DQ060828_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 0443-03). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaaattagtcatgcctgctagattttttcccatctctacaaaatatttgcccctagagaatggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacccgtagcgcctcattttgtgggtcaccatattcttgggaacacgagctacatcatggggctttcttggacgg
tccctctcgaatgggggaaaaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggcctgggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcgggatttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggtagttggggatcattaccacaagaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatatatgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccttcagcgcatgcgtggaacctttggggct
cctctgccaatccatacggcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggaccga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctctcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ060829_P_P-E Feature FT:CDS DQ060829_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 0350-03). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaaattagtcatgcctgctagattttttcccatctctacaaaatatttgcccctagagaatggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacccgtagcgcctcattttgtgggtcaccttattcttgggaacacgagctacatcatggggctttcttggacgg
tccctctcgaatgggggaaaaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggcctgggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcaaatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcgggatttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggtagttgggggtcattaccacaggaacacatcatacaaaaaa
tcaaagactgttttagaaaactgcctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatatatgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccttcagcgcatgcgtggaacctttgtggct
cctctgccaatccatacggcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggacaga
taattctgtcgttctctctcggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctctcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ060830_P_P-E Feature FT:CDS DQ060830_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 235-01). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgacgatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgagcaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagacaatgtagttaatcattacttccaaaccagacactatttacatactctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatccccaggccatgcagtggaattccacaacattccaccaagctctgcaagatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaggactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcacggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcctgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU239217_P_P-E Feature FT:CDS EU239217_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate G2451). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaatttagtcatgcctgctagattttttcccatctctacaaaatatttaccactagagaaaggtataaaaccttactatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctgtggaaggcgggcatcttatataagaga
gaaactacgcgtagcgcctcattttgtgggtcaccctattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcgttc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
tgcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaacaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgagcatggaaagcatcacatcaggattcctaggacccctgctcgggttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttacgtaattggaagttgggggtcattaccacaggaacacatcacactgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttactcaatgtggctatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcctgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccatctcggggtcgcttggggatctatcgtccccta
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU239218_P_P-E Feature FT:CDS EU239218_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate BD2). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtatcaaaccttattatc
cagataatgtggttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagg
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccacctccaatcctctgggattctttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagacgccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgcaaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagttcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgcagaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacattagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccatttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU239219_P_P-E Feature FT:CDS EU239219_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PW3). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagacgaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttattcttctactatacctgtctttaattctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatc
cagataatttagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
aaagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagacgccaacaaggtaggagtggg
agcatttgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctacaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccgaaacagtgaaccctgttccgactactgcctctctcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgcggccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaggcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaatcaatacatgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacgga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcggcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU239220_P_P-E Feature FT:CDS EU239220_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PW5). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagattactgttattagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaagacattattaacaaatgtgaacaatttgtaggtcctttaacagtaaatgaaaaacgaagatt
aaccttagtcatgcctgctaggttttttcccatctccacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagg
gaatcttcacgtagcgcctcattttgtgggtcgccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatctttccaccgtaaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggacaacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaagacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaattactccacctttgagagac
actcatcctcaggccgttcagtggaattccacaacattccaccaaaatctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccgggacagtgaaccctgttccgactactgcctcactcacctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagaatctagactcgtggtggacttctctcagttttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctcccatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctacttccaggatcatcgaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacggaaattgcacttgtactcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgcagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttataccgctgttactaattttcttttggctttgggcatacatttaaatcccaacaaaacaaaaag
gtggggttattccctcaatttcatgggttatataattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgcattcaatctaagcaggctttcac
tttctcgccaacttacaagacctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccttgggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggacgga
caattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcacctgccggt
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU239221_P_P-E Feature FT:CDS EU239221_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PW1). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccttcgtttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcctatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtggttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccagggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccaacagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggcaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcgcgtttgtcctctaattccaggatcatcgaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatctgtt
cggtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacca
catcttgagtccctttatacctctgttaccaattttcttgtgtctttgggcatacatttaaatccaaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacagaaccacatcagaaggaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtctcttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcctggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaacacttatcgggacgga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU239222_P_P-E Feature FT:CDS EU239222_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PW2). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttcctgagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaactttacggggctttactcttctactttacctgtctttaatcctaattggaaaactccatcttttcct
gacattcatttgcaccaggacatcattaacaaatgtgtacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctactaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcgtcttatataaaagg
gaaactacacgtagcgcctcattttatgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccacctccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtcgagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcagaatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgaccactgcctcactcatctcgtcaatcttctcgagga
ttggggaccttgcaccgaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtatcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgcagaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaagaacacattagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatataagcaggctttcac
tttctcgccaatttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagcaggtctggagcgaaacttatcgggacgga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctaaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcagtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU239223_P_P-E Feature FT:CDS EU239223_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PW4). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagacgaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttattcttctactatacctgtctttaattctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatc
cagataatttagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
aaagcaaacaccaaaaatccagattgggaccacaatcccaacaaagaccactggacagacgccaacaaggtaggagtggg
agcatttgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccggcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctacaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctctctcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggggtgggcctcagcccgtttctcctggctcaatttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgcggccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaggcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaatcaatacatgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacgga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcggcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU239224_P_P-E Feature FT:CDS EU239224_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate BD1). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacggagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagaactcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactctactactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggatattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgcgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcagtccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaacactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttctggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcaaatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcattacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
cgaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgtttaaagccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgttcctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaacttcatgggttacgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgtcaatcggcctgttgattggaaagtatgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttttgtgtacacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccatcggccatcagcgcatgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggaccga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgatccgtctcggggtcgcttgggggtctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU239226_P_P-E Feature FT:CDS EU239226_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PW6). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacattatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacgcgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcgttc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
tgcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcaaatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccatctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctacaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcactcatctcgccaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgctaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttacgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccatctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcgtctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|FJ349226_P_P-E Feature FT:CDS FJ349226_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate H6). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactgttcctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaacttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgccagattttttcccatctctactaaatatcttcccttagataaaggtataaaaccttattatc
ccgataatgtagttaatcattacttccaaaccagacattatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctccagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatatttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgtcgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttggggctcattaccacaggaacacatcagattgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtactcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccatctcggggtcgcttggggatttctcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|FJ349237_P_P-E Feature FT:CDS FJ349237_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C27). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccctcttttcct
gatattcatttgcaccaggacattattaacagatgtgagcaatttgtaggtcctttaacagtaaatgaaaaaagaagatt
aaacttagtcatgcctgctagattttttcccatctctacaaaatatttgccactagataaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcattttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaacaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaaccctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|FJ349238_P_P-E Feature FT:CDS FJ349238_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C65). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccctcttttcct
gatattcatttgcaccaggacattattaacaaatgtgagcaatttgtaggtcctttaacagtaaatgaaaaaagaagatt
aaacttagtcatgcctgctagattttttcccatctctacaaaatatttgccactagataaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaacaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggactga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaaccctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|FJ349239_P_P-E Feature FT:CDS FJ349239_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C74). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaatttagtcatgcctgctagattttttcccatcgttacaaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctacaaacat
tgccagcagatccgcctcctgcctccaccaatcggcaatcagggaggcagcctaccccaatcactccacctttgagagac
acgcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctacgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggtgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttgaatcctaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctacgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccctt
ctccgtctgccgttccaaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|FJ349240_P_P-E Feature FT:CDS FJ349240_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C89). Non-functional genomic sequence. [Hepadnaviridae] (length=2517 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gagattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcctatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
aagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
aaagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggtcagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccaccacattccaccaagctctgcaggatcccaaagtaactcctgctggtgg
ctccagttccggaacagtgaaccctgttccgactactgcctctctcatctcgtcaatcttctcgaggattggggaccctg
caccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaa
atcctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggagctcccgtgtgtcttggcca
aaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgc
ggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttg
cccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaac
ctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctt
tcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcc
gggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtcc
ctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattc
cctacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagattgaaaatcaaagactgtt
ttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcccct
tttacacaatgtggatatcctgctttaatgcctctgtatgcgtgcattcaatctaagcaggctttcactttctcgccaac
ttacaaggcctttctgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttg
ctgatgcaacccccactggctggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatc
catactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaacacttatcgggactgataattctgtcgt
tctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgagagggacgtcctttgtct
acgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccg
ttccaaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcacctgccggaccgtgtgcactt
cgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|FN545821_P_P-E Feature FT:CDS FN545821_P_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaatttagtcatgcctgctagattttttcccatctctactaagtatttacccctagacaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagg
gaaactacacgtagcgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggatcacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttgggttggagccctcaggctcagggcatgctgaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccaaagtaaaaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
tgatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaagggacctctwtgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgaggccctttatacctctgttactaattttcttttgtctttgggtatacatttaaataccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattgccacaggaacacatcaraatgaaaa
tcaaagactgttttagaaaactccctattaatcggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcagrtctggagcgaaacttatcgggacgga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgagaggga
cgtcctttgtttacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|FN545822_P_P-E Feature FT:CDS FN545822_P_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggacwc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaaagaagatt
aaacttagtcatgcctgccagattttttcctatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaagtcagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagatctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggatttttwcccgaccaccagttggatccagcattc
agggcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccgcacggaggccttttggggtggagccctcaggctcagggcatgcaaaaaacat
tgccagcagatccgcctcttgcctccaccaatcggaagtcaggaaggcagcctaccccaatcactccacctttgagagaa
actcatcctcaggccatgaagtggaattccacaacattccaccaagctctgcaggatcccagaataaaaggcctgtatct
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccttgcaccgaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccarcaaaacaaaaag
atggggatattcccttaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacattagaatgaaaa
tcaaagactgttttagaaaactccctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggtctcttgggc
tttgctgccccttttacacaatgtggatatcctgctttgatgcctctgtatgcrtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcamaacttatcgggactga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccctctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|FN545823_P_P-E Feature FT:CDS FN545823_P_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagamtgctgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagctgcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaagacattattaacaaatgtgaacaatttgtaggtcctttaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagg
gaaactacacgtagcgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccagggttcactcccccacacggaggccttttggggwggagccctcaggctcaaggcatgctaacaacgt
tgccagcaaatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattctacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatct
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttgggggccttgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcgtggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaatmggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtmaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|FN545827_P_P-E Feature FT:CDS FN545827_P_P-E of [Viruses] Hepatitis B Virus genotype E. Non-functional genomic sequence. [Hepadnaviridae] (length=2517 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcck
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtggttaatcattacttccaaaccagacactatttacataccctatggaaggcgggtatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggacmacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaacaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacagcattccaccaagctctgcaggatcccagagtaagtcctgctggtgg
ctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctg
caccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaa
atcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggcca
aaattcgcagtccccaacctccartcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgc
ggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttg
cccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaac
ctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctt
tcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcc
gggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggcsaagwctgtacaacatcttgagtcc
ctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattc
cctacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagattaaaaatcaaagactgtt
ttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcccct
tttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaac
ttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttg
ctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatc
catactgcggaactcctagccgcctgttttgctcgcagcaggtctggagcgaaacttatcggaactgataactctgtcgt
tctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtct
acgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccggctgccg
ttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcactt
cgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|FN545841_P_P-E Feature FT:CDS FN545841_P_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctcttacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtggttaatcattacttccaaaccagacactatttacataccctatggaaggcgggtatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaacaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacagcattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagattaaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtactcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcggaactga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccggctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccatctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|FN545842_P_P-E Feature FT:CDS FN545842_P_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtggttaatcattacttccaaaccagacactatttacataccctatggaaggcgggtatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatgggactttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatacagtggaattccacagcattccaccaagctctgcaggatcccagagtaaaaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccttgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcgtggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcaaattaaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcctggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccggctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccrtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|FN594748_P_P-E Feature FT:CDS FN594748_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne6). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagacgaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgagcaatttgttggtcctctaacagtaaatgaaaaacgaagatt
aaacttggtcatgcctgctaaattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagayaatctagttaatcattacttccaaaccagacactatttacrtaccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgggggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccaaaaatccagattgggaccacaatcccaacaaagaccactggacagacgccaacaaggtaggagtggg
agcatttgggccggggytcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcaaatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaatcccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagactgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttttgggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttataaggcctttctgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacgga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccctt
ctccgtctgccgttccarccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|FN594749_P_P-E Feature FT:CDS FN594749_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne8). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatctttccct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatttctacgaaatatttrcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctttggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgggggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcatttgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgcaaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgaagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattc
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtactctaattccaggatcatcaaccaccagtactggcctcaccagagcctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaagaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctcagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacatgaacctttaccccgttgcccggcaacggcccggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgyggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccctt
ctccgtctgccgttccagccgtccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|FN594750_P_P-E Feature FT:CDS FN594750_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne12). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttattcttctactataccggtctttaatcctaactggaaaactccatctttccct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaagacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgggggtcaccttattcttgggaacaagagctayatcatggggctttcttggaccg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccaaaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcatttgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccwcctttgagagac
actcatcctcaggccatgcagtggaattccaaaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatccggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggaagctcccgt
gtgtcgtggccaaaattcgcagtccccaatctccaatcactcactaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgttcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaagaacacatcagaatgaaaa
tcaaagactgttttaggaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtctcttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaarcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacatgaccctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgcaaactggatcctgcaaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|FN594751_P_P-E Feature FT:CDS FN594751_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne52H). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagcatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatctttccct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatacttgcccctagagaaaggtataaaaccttattatc
cagacaatgtagttaatcattacttccaaaccagacactatttacataccctatgggaggcgggtatcttatataaaaga
gaaactacacgtagcgcctcattttatgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctttgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaacaccat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatacagtggaattccaaaacattccaccaagctctgcaggatcccagagtaagaggccttcatty
ttccgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccttgcaccgaacatggaaagcatcacatcaggactcctaggacccctgcccgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttggcctggttatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttctggtgggatcttcaggactat
caaggtatgttgcgcgagtgtcctcaaactccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaagaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctatatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgctgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctttcgtcccctt
ctccgtctgccgttccgaccaaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcgtctgccggt
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|FN594752_P_P-E Feature FT:CDS FN594752_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne134). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatctttccct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttggtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgcagcgcctcattttgggggtcaccttattcttgggaacaagggctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccaaaaatccagattgggacaacaatcccaacaaagaccactggacagaagccaacgaggtaggagtggg
agcttttgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccaaagtaagaggcctgtatct
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagactgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaagaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatacagcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactga
taattctgtggttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccatctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|FN594753_P_P-E Feature FT:CDS FN594753_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne137). Non-functional genomic sequence. [Hepadnaviridae] (length=2514 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccaggttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttacaccaagacattattaacaaatgtgagcaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtatcgcctcattttgtgggtcaccttattcttgggaacaagagttacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctttgggattttttcccgaccaccagttggatccagcattc
aaagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccgctggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgcaaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaaagttccaccaagctctgcaggatcccaggcctcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccttgcac
cgaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagttyactagtgccatttgttcagtggttcgccggg
ctttcccccaytgtctggctttyagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtcccta
tatacatctgtgaccaatttccttttgtccttgggcatacatttaaatcccaacaaaacaaaaagatggggatattccct
aaatttcatgggttatgtgattggaagttggggatcattaccacaggaacacatcagagtgaaaatcaaagactgtttta
gaaaactccctgttaaccggcctcttgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcccctttt
acacaatgtggatatcctgctttaatgcctctgtatgcatgtattcaatctcggcaggctttcactttctcgccaactta
caaggcctttctgtataaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctg
atgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccat
actgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaccttatcgggactgataattctgtcgttct
ctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacg
tcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtccccttctccgtctgccgttc
cgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggwccgtgtgcacttcgc
ttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|FN594756_P_P-E Feature FT:CDS FN594756_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne250). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagattactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctagctggaaaactccatctttccct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaaggtt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagg
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatgggactttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccaacaatccagattgggaccacaatcccaacaaagaccactggaccgaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgttacaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaacaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacaggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggaaggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccaytgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaacaaaaaag
atggggatattccctgaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcagtctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcgaaacttatcgggacgga
taattctgtcgttctctcccgaaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|FN594758_P_P-E Feature FT:CDS FN594758_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne341). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttgtcaacgcttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctca
cctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttaatattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaactagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcmtggacgg
tccctctccaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcatttgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtmttt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaa
catcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttggggatcattaccacaggaacacatcagattgaaaa
tcaaagactgttttcgaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgagtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtcaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactga
taattctgtcgttctctcccggaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctacgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|FN594759_P_P-E Feature FT:CDS FN594759_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne342). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttgtcaacgcttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctca
cctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttaatattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaactagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctctcatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcatttgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtgcgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgtwaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttggggatcattaccacaggaacacatcagattgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcatgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactga
taattctgtcgtgctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccyctt
ctccgtctgccgttccgcccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|FN594760_P_P-E Feature FT:CDS FN594760_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne362). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttgtcaacgcttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctca
cctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttaatattccttggactc
acaaggtgggaaattttacggggctttactcttccactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaactagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctttgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagcaatccagattgggacgacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcggcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccaaaacattccaccaagctctgcaggatcccagagtaagaggcctgtmttt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggggctcccgt
gtgtcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgatggttcttctggactat
caaggaatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctsgctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaacacaaaaag
atggggatatcccccaaatttcatgggcaatgtaattggaagttgggggtctttaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaggcaggctttcac
tttttcgccaacttacaaggcctttctgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacgga
taattctgtcgtactctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccctt
ctccgtctgccgttccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|FN594761_P_P-E Feature FT:CDS FN594761_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne385). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagacgaactccctcg
cctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatctagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccaaaaatccagattgggaccacaatcccaacaaagaccactggacagacgccaacaaggtaggagtggg
agcatttgggccggggctcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccttgcaccgaacatggaaagcatcacatcaggattcctaagacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcgaaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgaacaa
catcttgagtccctttataccgctgtwaccaattttctgttgtctttgggtatacatttaaattccaacaaaacaaaaag
atggggatattccctgaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagattgaaaa
tcaaagactgttttagaaaactccctgttaatcggcctattgattggaaagtatgtcaaagaattgtgggtctgttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacagtacctgaacctttaccccgttgcccggcaacggcccggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacgga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccctt
ctccgtctgccgttccagccgwccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|FN594762_P_P-E Feature FT:CDS FN594762_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne439). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctgctatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaataaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttaatcctgcctgctagattttttcccatctctacgaaatatttacctctagagaaaggtataaaaccttattatc
cagataatctagttaatcactacttccaaacccgacactatttacataccctatgggaggcgggcatcttatataaaagg
gaaactacacgtagcgcctcattttgggggtcaccttattcttgggaacaagagctacatcatgggtctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
aaagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggaaaaaagccaacaaggtaggagtggg
agcattctggccggggctcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgctggatcccacagtaggaggcctgtcttc
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcgtggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgttcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttccctcactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaattccaacaaaacaaaaag
atggggatattccctgaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagattgaaaa
tcaaagactgttttagaaaactccctgttaatcggcctattgattggaaagtatgtcaaagaattgtgggtctgttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacagtacctgaacctttaccccgttgcccggcaacggcccggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactga
caattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctacgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccatctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|FN594763_P_P-E Feature FT:CDS FN594763_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne446). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagcatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatctttccct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatacttgcccctagagaaaggtataaaaccttattatc
cagacaatgtagttaatcattacttccaaaccagacactatttacataccctatgggaggcgggtatcttatataaaaga
gaaactacacgtagcgcctcattttatgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcatttgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttcc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaagaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctatatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|FN594765_P_P-E Feature FT:CDS FN594765_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne9447). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccgatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctygaatgggggaagaatcattccaccaccaatcctttgggattttttcccgaccaccagttggatccagcattc
aaagcaaacaccagmaatccagattgggatcacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
atcattcgggccggggttcactcccccacacggaggccttttggggtggagycctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactcctcctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatatcgtcaatcttctcgagga
ttggggaccttgcaccgaacatggaaagcatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgcctgtcctctaactccaggatcatcaaccaccagcacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtgtccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttmggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgaacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctacatttcatgggttatgtaattggaagttggggatccttrccacaggaccacatcagattgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcatgtattcaatctaagcaggctttcac
tttytcgccaacttacaaggcctttctgtttaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcctgcgtggaacctttatggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaccttatcgggaccga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggt
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|FN594766_P_P-E Feature FT:CDS FN594766_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne9449). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagacttctgttgttagacgaagaggcaggtcccctagaagaagaactccctca
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaactagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcatttggggggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctttgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggatcacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
atcattcgggccggggttcactcccccacacggaggccttttggggtggagycctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactcctcctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttcggactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcaccacatcaggattcctaggacccctgcacgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggaagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgtattttcatcttcctcttcatcctgctgctatgcctcatcttcttgttggatcttctggactat
caaggtatcttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggcatacatttaaatcccaacaaaacaaaaag
atggggatattccctacatttcatgggtaatgtaattggaagttggggatcattaccacaggaacacatcagattgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtctgtcagagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcatgtatccaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgcaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactga
taattctgtcgttctctcccggaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctacgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161755_P_P-E Feature FT:CDS GQ161755_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1694). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaatttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaacga
gaaactacatgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccacaaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactccccctcacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagtttcggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaacg
atggggatattccctacatttcatgggttatgtaattggaagttggggatcattaccacaggaccacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtatgcgtgtattcaagctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggaaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161756_P_P-E Feature FT:CDS GQ161756_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1684). Non-functional genomic sequence. [Hepadnaviridae] (length=2502 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagact
aaacttagttatgcctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaatcttattacc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctagaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaataccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggctcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgccacctgctggtggctccagttccggaac
agtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaaa
gcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaataccg
cagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtcccc
aacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatct
tcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctcta
cttccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctc
atgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctat
gggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccact
gtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgtt
accaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatggg
ttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttaggaaactccctg
ttaaccggcctattgattggaaagtatgtcaacgaatagtgggtcttttgggctttgctgccccttttacacaatgtggg
tatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttct
gtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccca
ctggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactc
ctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaata
tacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcgc
tgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccacg
gggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgca
cgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161757_P_P-E Feature FT:CDS GQ161757_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1156). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccgtggactc
acaaggtgggaaattttacggggctttactcttctactttacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgagcaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
gaacttagtcatgcctgctagattttttcccatctctacgaaatatttacccctagataaaggtataaaaccttattatc
cagagaatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtcgagccctcaggctcaaggcatgctaacaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatct
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaagattcctaggacccctgctcgggttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcgtggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactat
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccgt
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaccaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaggactgttttagaaaactcccagttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggt
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcctgttttgctcgcagccggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgcctactcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161758_P_P-E Feature FT:CDS GQ161758_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1506). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctatctttaatcctaactggaaaactccattttttcct
gacattcatttgcaccaggacattattaacagatgtgaacaatttgtaggtcctttaacagtaaatgaaaaacgaagatt
aaacttagttatgcctgctagattttttcccatctctacaaaatatttgcccctagagaaagggataaaaccttattatc
cagataatgtagttaatcattacttccaaactagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattacacaacattccaccaagctctgcaggatcccagagtaaaaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctacatttcatgggttatgtaattggaagttgggggtcattgccgcaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctttgtatgcgtgtattcaatctaagcaggctttcct
tttctcgccaacttacaaggcctttctgtgtaaccaatacatgaacctttaccccgttgcccggcaacggcctggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccatgggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggactga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggt
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161759_P_P-E Feature FT:CDS GQ161759_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU934). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttcctgagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagacctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctacaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatatttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaccaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|GQ161760_P_P-E Feature FT:CDS GQ161760_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1374). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcccctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tcccactcgaatggggaaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcgttc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacatggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcaaatccgcctcctgcctccaccatttggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgaattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcctggccaaaattcgcagtccccaacctccaatcactcactaacctcttgtcctccaatttgtcctggctatcgct
ggatgtatctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatcttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccatgccgaacctgcacgactct
tgctcaaggaacctctatgtttcccttatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaggactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcagtctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggacaga
taattctgtcgttctctcacggaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgcctactcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161761_P_P-E Feature FT:CDS GQ161761_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1033). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaatcttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctagaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
aaagcaaataccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccctacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtgagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcgggatttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcccattgattggaaagtatgtcaacgaatagtgggtcttttgggc
tttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttttcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatattgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161762_P_P-E Feature FT:CDS GQ161762_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU716). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacgggactttactcttctactatacctgtctttaatcctagctggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcccctaacagtaaatgaaaaaagaaggtt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttactatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagg
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaattattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
aaagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggaccgaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccgcacggaggccttttggggtggagccctcaggctcaaggcatgttacaaacat
tgccagcagatccccctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatct
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcacagaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgctgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgcgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcatgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatacagcggaactcctagccgcttgttttgctcgcagcaggtctggagcgacacttatcgggacaga
taattctgtcgttctctcccgaaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtccgcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggt
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161763_P_P-E Feature FT:CDS GQ161763_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1013). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaaagaagatt
aaacttagtcatgcctgctagattttttcccatctgtacgaaatatttgcccctagagaaaggtataaaaccttattatc
ccgataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcgtggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaatacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaatcggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatacgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggaccga
caattctgtcgttctctcccggaaatatacctcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161764_P_P-E Feature FT:CDS GQ161764_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1056). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtatcccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagaatctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaactgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggct
cctatgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctacgaggga
cgtcctttgtctacgtcccgtcggcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161765_P_P-E Feature FT:CDS GQ161765_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU952). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctgacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccatcaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacytgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccttacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tccaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcctggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcctgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggactggagcgaaacttatcgggactga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggatgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161766_P_P-E Feature FT:CDS GQ161766_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1671). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctatctttaatcctaactggaaaactccattttttcct
gacattcatttgcaccaggacattattaacagatgtgaacaatttgtaggtcctttaacagtaaatgaaaaacgaagatt
aaacttagttatgcctgctagattttttcccatctctacaaaatatttgcccctagagaaagggataaaaccttattatc
cagataatgtagttaatcattacttccaaactagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattacacaacattccaccaagctctgcaggatcccagagtaaaaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctacatttcatgggttatgtaattggaagttgggggtcattgccgcaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctttgtatgcgtgtattcaatctaagcaggctttcct
tttctcgccaacttacaaggcctttctgtgtaaccaatacatgaacctttaccccgttgcccggcaacggcctggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccatgggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggactga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggt
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161768_P_P-E Feature FT:CDS GQ161768_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU960). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttccaaatgttagtattccttggactc
acaaggtgggaaattttacagggctttattcttctactatacctgtctttaatcctaactggaaaactccttcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacctagtcatgcctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccaaaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggctcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagtagatccacctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatct
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggaagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctacttccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagactgtacaa
catcttgagtccatttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttggggctcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtatgcgtgcattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctatgtcaacaatacctgaacctttaccccgttgccaggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagctggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggccgcttggggatctctcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|GQ161769_P_P-E Feature FT:CDS GQ161769_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU865). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccattttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctgacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctcaacaaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccatcaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacctgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccttacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tccaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcctggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcctgcgcggaacctttgtggct
cctatgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacgga
taattctgtcgttctctcccggaaatatacatcttttccatggctgctaggatgtgctgccaactggatcctgcgaggga
cgtcctttgtttacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctttcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161770_P_P-E Feature FT:CDS GQ161770_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU927). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttgtagggggagctcccgt
gtgtcttggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctacatttcatgggttatataattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaacgaatcgtgggtcttttgggc
tttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtacacaatacctgaacctttaccccgttgcccggcaacggcccggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcctgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaccttatcgggacaga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161771_P_P-E Feature FT:CDS GQ161771_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU896). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcaaatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccggactttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctatgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcgtgcgcggaaccttcgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagccaaactcatcgggacaga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctacgaggga
cgtcctttgtctacgtcccgtcggcgctgaatcctgcggacgacccgtctcggggtcgcttggggctctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggc
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161772_P_P-E Feature FT:CDS GQ161772_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU873). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaaacctaactggaaaactccatcttttcca
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggaaggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaacgrattgtgggtcttttgggc
tttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtacacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggct
cctatgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcraaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161773_P_P-E Feature FT:CDS GQ161773_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1406). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctctactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggatcacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcaatggaattccacaacattccaccaaactctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgctccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgtcgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattctctacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaacaggcctattgattggaaagtttgtcaacgaatcgtgggtcttttgggc
tttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaaccttttccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggttggggcttggccataggccatcagcgcatgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgcaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161774_P_P-E Feature FT:CDS GQ161774_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1501). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctatctttaatcctaactggaaaactccattttttcct
gacattcatttgcaccaggacattattaacagatgtgaacaatttgtaggtcctttaacagtaaatgaaaaacgaagatt
aaacttagttatgcctgctagattttttcccatctctacaaaatatttgcccctagagaaagggataaaaccttattatc
cagataatgtagttaatcattacttccaaactagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattacacaacattccaccaagctctgcaggatcccagagtaaaaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctacatttcatgggttatgtaattggaagttgggggtcattgccgcaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctttgtatgcgtgtattcaatctaagcaggctttcct
tttctcgccaacttacaaggcctttctgtgtaaccaatacatgaacctttaccccgttgcccggcaacggcctggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccatgggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggactga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggt
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161775_P_P-E Feature FT:CDS GQ161775_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU754). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccgatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctaccatacctgtcttcaatcctaactggaaaactccatcttttcct
gatattcatttacaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccgcacggaggccttttggggtggagccctcaggctcaaggcatgctaacaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaacctctgcagaatcccagagtaagaggtcaggattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttcyctcaattttctagggggagctcccgt
gtgtcgtggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
cacggtatgttgcccgtttgtcctctaattccakgatcatcaaccaccagtacgggaccctgcmgaacctgcacgactcy
tgctcaaggmamctctatgtttccctcatgttgytgttcaaaaccttcggacggaaattgcacytgtattcccatcccat
catcatgggctttcgsaaaattcctatgggagtgggcctcagyccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatytaaayccycacaaaacaaaaag
atggggatattccctacatttcatgggttayrtaattggaagttgggggtcattrccacaggawcayatcrkaawgaaaa
tcaaarattgttttagaaaactycctrttaacmggcctattgattggaaagtatgtcaamgaattgtgggtctkttgggc
tttgcwgccccytttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagcmgcttgttttgctcgcagccggtctggagcaaaactcattgggactga
taattctgtcgtcctctctcggaaatatacctcctttccatggctgctaggctgtrctgccaactggatycttcgmggga
cgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggycgcttgggactctatcgtcccctt
ctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcacctgccgga
ccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|GQ161776_P_P-E Feature FT:CDS GQ161776_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1178). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactattcctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatc
cagaaaatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccgcacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctacaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctctctcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgctgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaacg
atggggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacattagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtatgcgtgtatccaatctaagcaggctttcac
tttctcaccgacttacaaggccttcctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaaccttcgtggct
cctatgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccgaaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161777_P_P-E Feature FT:CDS GQ161777_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU807). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaaagaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
ccgataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcgtggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaatacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctamatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaatcggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccwacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatacgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggaccga
caattctgtcgttctctcccggaaatatacctcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161778_P_P-E Feature FT:CDS GQ161778_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1035). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttccaaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgagcaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagacaatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgcaaaaatcat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggggtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaggactgttttagaaaactcccagttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcagtctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggacaga
taattctgtcgttctctcacggaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccctt
ctccgtctgccgttccagccgtccacggggcgcacctctctttacgcggtctccccgtctgtgcctactcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161779_P_P-E Feature FT:CDS GQ161779_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU557). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccattttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctgacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctcaacaaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagttaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccatcaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccggacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacctgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccttacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tccaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcctggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcctgcgcggaacctttgtggct
cctatgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacgga
taattctgtcgttctctcccggaaatatacatcttttccatggctgctaggatgtgctgccaactggatcctgcgaggga
cgtcctttgtttacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctttcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161780_P_P-E Feature FT:CDS GQ161780_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU50). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagatctccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaatcggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccagatctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggaccga
caattctgtcgttctctcccggaaatatacctcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161781_P_P-E Feature FT:CDS GQ161781_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU200). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagactactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggacaga
taattctgtcgttctctcccgaaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccattccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161782_P_P-E Feature FT:CDS GQ161782_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1489). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatc
cagagaatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
grarctacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgagccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcatattgattggaaagtatgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctatatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggccttcctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagcggcttgttttgctcgcagcaggtctggagcaaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccatctcggggtcgcttggggatctatcgtcccctt
ctctgtctgccgttccatccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161783_P_P-E Feature FT:CDS GQ161783_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU981). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaaaatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgagcaatttgtaggtcctttaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaagggataaaaccttattatc
cagacaatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgaagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagaattc
caagcaaacaccagaaatccagattgggatcacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagttccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcaatggaattccacaacattccaccaagctctgcaggatcccagagtaaaaggtctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcacaatgaaaa
tcaaggactgttttagaaacctccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatacgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacgga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161784_P_P-E Feature FT:CDS GQ161784_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU766). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactattcctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatc
cagaaaatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccgcacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctacaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctctctcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgctgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaacg
atggggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacattagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtatgcgtgtatccaatctaagcaggctttcac
tttctcaccgacttacaaggccttcctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggtcaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaaccttcgtggct
cctatgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccgaaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161785_P_P-E Feature FT:CDS GQ161785_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU758). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactctactactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacctagtcatgcctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaacccgacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaaaaatcagtccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacacccgaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggacggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcacgctacaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcaatggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatcc
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcctcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaacttcatgggttatgtaattggaagttgggggtcattgccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgtcaatcggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggt
tttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaagacctttttgtgtcaacaatacctgaacctttaccccgttgcccggcaacggtcaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtactgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcggcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161786_P_P-E Feature FT:CDS GQ161786_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1688). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggagttcatacggggctttactcttctactatacctgtctttaatcctaactggaaacctccatcttttcct
gatattcatttgcaccaggacattatttacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacaaaatatttgccactagagaagggtataaaaccttattatc
caggtaatgtagttaatcattacttccaaaccagacactatttacataccctatggcaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttgggatggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagttaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagttcactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtatgcatgtattcaatccaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctcagccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161787_P_P-E Feature FT:CDS GQ161787_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU841). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaaccctaactggaaaactccatcttttcca
gatattcatttgcaccaagacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaacggattgtgggtcttttgggc
tttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtatacacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggct
cctatgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161789_P_P-E Feature FT:CDS GQ161789_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1169). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactattcctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatc
cagaaaatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccgcacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctacaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctctctcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgctgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaacg
atggggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacattagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtatgcgtgtatccaatctaagcaggctttcac
tttctcaccgacttacaaggccttcctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaaccttcgtggct
cctatgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccgaaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161790_P_P-E Feature FT:CDS GQ161790_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1408). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttccaatctctacgaaatatttgcccctagagaaaggtataaaaccctattatc
cagacaatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggttaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggacctcaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaatacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttctgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcattcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacgga
taattctgtcgttctctctcggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161791_P_P-E Feature FT:CDS GQ161791_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU459). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
ccttgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctacatttcatgggttatataattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaacgaatcgtgggtcttttgggc
tttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtacacaatacctgaacctttaccccgttgcccggcaacggcccggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcctgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaccttatcgggacaga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161792_P_P-E Feature FT:CDS GQ161792_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU605). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatc
cagagaatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcatctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgagccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccgscctattgattggaaagtatgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctatatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggccttcctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagcggcttgttttgctcgcagcaggtctggagcaaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccatctcggggtcgcttggggatctatcgtcccctt
ctctgtctgccgttccatccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161793_P_P-E Feature FT:CDS GQ161793_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU932). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggttgtactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacaaaatatttgcccccagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtacacaatacctgaacctttaccccgttgcccggcaacggcctggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggct
cctatgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcgtctgccggg
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161794_P_P-E Feature FT:CDS GQ161794_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU846). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactctactactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagtgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaaaaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacacccgaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgcagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaacttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgtcaatcggcctcttgattggaaagtatgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtatgcatgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttttgtgtaaacaatacttgtacctttaccccgttgtccggcaacggcctggtctgt
gccaagtgtttgctgatgcaacccccactggttggggcttggccataggccatcagcgcatgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacgga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161795_P_P-E Feature FT:CDS GQ161795_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1558). Non-functional genomic sequence. [Hepadnaviridae] (length=2502 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagact
aaacttagttatgcctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaatcttattacc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctagaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaataccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggctcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgccacctgctggtggctccagttccggaac
agtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggaaa
gcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaataccg
cagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggccaaaattcgcagtcccc
aacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatct
tcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctcta
cttccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctctatgtttccctc
atgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattcctat
gggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccact
gtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgtt
accaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattccctaaatttcatggg
ttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttaggaaactccctg
ttaaccggcctattgattggaaagtatgtcaacgaatagtgggtcttttgggctttgctgccccttttacacaatgtggg
tatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttct
gtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccca
ctggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactc
ctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgtcgttctctcccggaaata
tacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcgc
tgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccgttccagccgaccacg
gggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgca
cgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161796_P_P-E Feature FT:CDS GQ161796_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1146). Non-functional genomic sequence. [Hepadnaviridae] (length=2517 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttccaaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagttaatgaaaaacgaagatt
aaacctagtcatgcctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcgtgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagtagatccacctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattacacaacattccaccaagctctgcaggatcccaaagtaagacctgctggtgg
ctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccttg
caccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaa
atcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggcca
aaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgc
ggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttg
cccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaac
ctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctt
tcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcc
gggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtcc
ctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaacgatggggatattc
cctaaatttcatgggttatgtaattggaagttgggggtcattaccacaagaacacatcagaatgaaaatcaaagactgtt
ttagaaaactccctgttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgcccct
tttacacaatgtgggtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaac
ttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgccaggcaacggscaggtctgtgccaagtgtttg
ctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatc
catactgcggaactcctagcagcctgtttcgctcgcagcaggtctggagcgcaacttatcgggacggataattctgtcgt
tctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtct
acgtcccgtcagcgctgaaccctgcggacgacccgtctcggggtcgcttggggatctctcgtccccttctccgtctgccg
ttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcactt
cgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161797_P_P-E Feature FT:CDS GQ161797_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1660). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggaaattactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacggtaaatgaaaaacgaagatt
aaacttaatcatgcctgctagattttttcccatctctacaaaatatttgcccttagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacatagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggagtttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagatcactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcccaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccaaaatcagaggcccgtatct
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtatgcatgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtcaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcgtgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtttacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161798_P_P-E Feature FT:CDS GQ161798_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1222). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggtatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtacgaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcgtaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctacatttcatgggttatgtaattggaagttggggatcattaccacaagaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtctgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtacacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161799_P_P-E Feature FT:CDS GQ161799_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU732). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatttccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttccaatctctacgaaatatttgcccctagagaaaggtataaaaccctattatc
cagacaatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggttaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggacctcaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaatacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttctgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcattcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacgga
taattctgtcgttctctctcggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161800_P_P-E Feature FT:CDS GQ161800_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1039). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctacatttcatgggttatataattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaacgaatcgtgggtcttttgggc
tttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtacacaatacctgaacctttaccccgttgcccggcaacggcccggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcctgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaccttatcgggacaga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161801_P_P-E Feature FT:CDS GQ161801_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU438). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacatgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaactagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggatggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggcatacatttaaatcccaacaaaacaaaaag
atggggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttrggc
tttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggct
cctatgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161802_P_P-E Feature FT:CDS GQ161802_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU921). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctctactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggatcacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcaatggaattccacaacattccaccaaactctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgctccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgtcgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattctctacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaacaggcctattgattggaaagtttgtcaacgaatcgtgggtcttttgggc
tttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaaccttttccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggttggggcttggccataggccatcagcgcatgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgcaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161803_P_P-E Feature FT:CDS GQ161803_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1700). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccacgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatttctacaaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatgggaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccaaaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccgtgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaaccttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcgtggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttgggtcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtgggtatccggctttaatgcctctgtatgcgtgtattcaatctaagaaggctttcac
tttctcgccaacttacaaggcctttctgtgtcaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggct
cctatgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggg
ccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|GQ161804_P_P-E Feature FT:CDS GQ161804_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1428). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctgtactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacaaaatatttgcccccagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtacacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161805_P_P-E Feature FT:CDS GQ161805_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1410). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttccaatctctacgaaatatttgcccctagagaaaggtataaaaccctattatc
cagacaatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggttaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggacctcaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaatacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttctgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcattcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacgga
taattctgtcgttctctctcggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161807_P_P-E Feature FT:CDS GQ161807_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1168). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacaaaatatttgcccttagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagtgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctagaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcggcccggggttcactcccccacacggaggccttttggggtcgagccctcaggctcaaggcatgctaagaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtgagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccttgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcgggatttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaccacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcccattgattggaaagtatgtcaacgcatcgtgggtcttttgggc
tttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttattgggaccga
caattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161808_P_P-E Feature FT:CDS GQ161808_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1398). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgagcaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagacaatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaatcat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaggactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggacaga
taattctgtcgttctctcacggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgcctactcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161810_P_P-E Feature FT:CDS GQ161810_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU852). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttccaaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgagcaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagacaatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgcwaaaatcat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggggtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaggactgttttagaaaactcccagttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcagtctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggacaga
taattctgtcgttctctcacggaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccctt
ctccgtctgccgttccagccgtccacggggcgcacctctctttacgcggtctccccgtctgtgcctactcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161811_P_P-E Feature FT:CDS GQ161811_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1361). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctatctttaatcctaactggaaaactccttcttttcct
gatattcatttgcaccaggacattattaagaaatgtgaacaatttgtaggtcctttaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacag
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatct
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgtcgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctgcatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgcygccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggackga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggt
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161812_P_P-E Feature FT:CDS GQ161812_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1577). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatc
cagagaatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgagccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtctgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaaggaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggccttcctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagcggcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccatctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccacccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|GQ161814_P_P-E Feature FT:CDS GQ161814_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU625). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgccaacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatc
cagagaatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgagccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctatatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggccttcctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagcggcttgttttgctcgcagcaggtctggagcaaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccatctcggggtcgcttggggatctatcgtcccctt
ctctgtctgccgttccatccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161815_P_P-E Feature FT:CDS GQ161815_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1241). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgagcaatttgtaggtcctttaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaagggataaaaccttattatc
cagacaatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccgtcaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagttccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccgatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtcattggaagttgggggtcattaccacaggaacacatcaaaatgaaaa
tcaaggactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggttatcctgctttgatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161816_P_P-E Feature FT:CDS GQ161816_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1214). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgttacaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcrtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgyggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggacgga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161817_P_P-E Feature FT:CDS GQ161817_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU630). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactctactactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaaaaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
aacattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgttggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaacttcatgggttatgtaattggaagttggggatcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttcgaaaactccctgttaatcggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttttgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcgtgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctaccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161818_P_P-E Feature FT:CDS GQ161818_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1520). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatttccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttccaatctctacgaaatatttgcccctagagaaaggtataaaaccctattatc
cagacaatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacrcgtagcgcctcattttgtgggttaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggacctcaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaatacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttctgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcattcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacgga
taattctgtcgttctctctcggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161819_P_P-E Feature FT:CDS GQ161819_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1062). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctacatttcatgggttatataattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaacgaatcgtgggtcttttgggc
tttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtacacaatacctgaacctttaccccgttgcccggcaacggcccggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcctgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaccttatcgggacaga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161820_P_P-E Feature FT:CDS GQ161820_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1089). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggmaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggycctctaacagtaaatgaaaaacgaagayt
aaacttagtyatgcctgctagattttttcccatckctacraaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccwcaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagmtctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaargcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcytggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatmttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggrctat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgtkaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctamayttcatgggttatgtaattggaagttggggrtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaycggcctattgattggaaagtatgtcaamgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggrtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggycaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggct
cctmtgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcraaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcmtttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcrgcgctgaatcctgcggacgayccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcrtctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161821_P_P-E Feature FT:CDS GQ161821_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1405). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatttccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttccaatctctacgaaatatttgcccctagagaaaggtataaaaccctattatc
cagacaatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggttaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggacctcaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaatacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttctgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcattcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacgga
taattctgtcgttctctctcggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccctt
ctccgtctgccgttcccgccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161822_P_P-E Feature FT:CDS GQ161822_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1086). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2522 residues).
tatcttatcaacaactccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgca
gacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggt
gggaaattttacggggctttactcttctactatacctgtatttaatcctaactggaaaactccatcttttcctgatattc
atttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaattta
gtcatgcctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatccagataa
tgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagagaaacta
cacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctct
cgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaa
acaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtgggagcattc
gggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgccagc
agatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatc
ctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatcttcctgct
ggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattgggga
ccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttga
caaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgt
ggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtg
tctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggta
tgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaa
ggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatg
ggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggt
tcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttg
agtctctttatacctctgttaccaattttcttttgtctttgggtatacatttgaatcctaacaaaacaaaaagatgggga
tattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaaga
ctgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctg
ccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcg
ccaacttacaaggcctttctgtgtaaacaatacctggacctttaccccgttgcccggcaacggcccggtctgtgccaagt
gtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgaggaacctttgtggctcctctgc
cgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcgaaacttatcgggacagataattct
gtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctt
tgtctacgtcccgtcagcgctgaatcctgcggacgacccatctcggggtcgcttggggatctatcgtccccttctccgtc
tgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtg
cacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161823_P_P-E Feature FT:CDS GQ161823_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU3397). Non-functional genomic sequence. [Hepadnaviridae] (length=2520 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacagatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagttatgcctgctagattttttcccatctctacaaaatatttgcccctagagaagggtataaaagcttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctgtggaaggcgggcatcttatataagaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctagaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaataccagaaatccagattgggaccacaatcccaacaaagaccactggaaggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggacggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaaaaggccctgctgg
tggctccagttccggaacagtgaaccctgttccgactactgtctcactcatctcgtcaatcttctcgaggattggggacc
ctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgaca
aaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttgg
ccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtc
tgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatg
ttgcccgtttgtcctctacttccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaagg
aacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatggg
ctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttc
gccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgag
tccctttatacctctgtgaccaattttcttttgtctttgggcatacatttaaatcccaacaaaacaaaaagatggggata
ttccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagact
gttttagaaaactccctgttaaccggcctattgattggaaagtctgtcaacgaatagtgggtcttttgggctttgctgcc
ccttttacacaatgtgggtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcaccttctcgcc
aacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgt
ttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccg
atccatactgcggaactcctagctgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataattctgt
cgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttg
tctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtccccttctccgtctg
ccgttccagccgcccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgca
cttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|GQ161824_P_P-E Feature FT:CDS GQ161824_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU893). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaaaatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgagcaatttgtaggtcctttaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaagggataaaaccttattatc
cagacaatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgaagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagaattc
caagcaaacaccagaaatccagattgggatcacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagttccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcaatggaattccacaacattccaccaagctctgcaggatcccagagtaaaaggtctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcacaatgaaaa
tcaaggactgttttagaaacctccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatacgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacgga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161825_P_P-E Feature FT:CDS GQ161825_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1769). Complete genome. [Hepadnaviridae] (length=2526 residues).
atgcccctatcttatcaacacttccggagactactgttgttagaccaagcaggtcctatagaagaagaactccctcacct
cgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcaca
aggtgggaaattttacggggctttactcttcttctatacctgtctttaatcctaactggaaaactccatcttttcctgat
attcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagattaaa
cttagtcatgcctgctagattttttcccatctctacgaaatatttacctctagagaaaggtataaaaccttattatccag
ataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagggaa
actacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtcc
ctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcaaa
gcaaacaccagaagtccagattgggaccacaatcccaacaaagatcactggacagaagccaacaaggtaggagtgggagc
attcgggccggggttcactccaccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacattgc
cagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacact
catcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaaaaggcctgtattttcc
tgctggtggctccagttccggaacagtgaaccctgttccgactactgcatcactcatctcgtcaatcttctcgaggattg
gggaccttgcaccgaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttg
ttgacaaaaatcctcaaaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtg
tcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctgga
tgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaa
ggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgc
tcaaggaacctctatgtttccctcatgttgctgttcaaaacctacggacggaaattgcacttgtattcccatcccatcat
catgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcag
tggttcgccgggctttcccccactgtctggcttttagttatatggatgatgtggtattgggggccaaatctgtacaacac
cttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatg
gggatattctctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatca
aagactgttttagaaaactccctgttaaccgtcctattgattggaaagtatgtcaaagaattgtgggtcttttgggcttt
gctgccccttttacacaatgtggatatcctgctttaatgcctctgtattcatgtattcaatctaagcaggctttcacttt
ctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgcc
aagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcct
ctaccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacagataa
ttctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgt
cctttgtctacgtcccgtcggcgctgaatcctgcggacgacccgtctcggggtcgcctggggatctatcgtccccttctc
cgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccg
tgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161826_P_P-E Feature FT:CDS GQ161826_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU607). Non-functional genomic sequence. [Hepadnaviridae] (length=2511 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacctagtcatgcctgctagattttttcccatctctacaaaatatttgcccctcgagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggatggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggaaccctcaggctcaaggcatgctaaaaacat
tgccagtagatccacctcctgcctccaccaagcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccattcctgctggtggctccag
ttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcaccga
acatggaaagcatcacatcaggattcctaggacccctgcacgtgttacaggcggggtttttcttgttgacaaaaatcctc
acaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagttcccgtgtgtcttggccaaaattc
gcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtt
ttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgggctatcaaggtatgttgcccgtt
tgtcctctaattccaggatcatcaaccaccagaacgggaccctgccgaacctgcacgactcttgctcaaggaacctctat
gtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaa
aattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgccgggctt
tcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttat
acctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaagaagatggggatattccctaca
cttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgttttagaa
aactccctgttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttaca
caatgtgggtatcckgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaa
ggcctttttgtgtaaacaatacctgaacctttaccccgttgccaggcaacggccaggtctgtgccaagtgtttgctgatg
caacccccactggctggggcttggctataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatact
gcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggacagataattctgtcgttctctc
ccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcc
cgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtccccttctccgtctgccgttccgg
ccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttc
acctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161827_P_P-E Feature FT:CDS GQ161827_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU180). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggttgtactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacaaaatatttgcccccagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtacacaatacctgaacctttaccccgttgcccggcaacgggctggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggct
cctatgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggg
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161828_P_P-E Feature FT:CDS GQ161828_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1399). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactattcctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatc
cagaaaatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccgcacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctacaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctctctcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgctgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaacg
atggggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacattagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtatgcgtgtatccaatctaagcaggctttcac
tttctcaccgacttacaaggccttcctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaaccttcgtggct
cctatgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccgaaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161829_P_P-E Feature FT:CDS GQ161829_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU719). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttctgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggrtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtacacaatacctgaacctttaccccgttgcccggcaacggcccggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcctgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaccttatcgggacaga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161830_P_P-E Feature FT:CDS GQ161830_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1365). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaaattagtcatgcctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaatcttattatc
cagataatgtagttaatcattacttccaaactagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctagaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaataccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcggaccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtctgtcaacgtatagtgggtcttttgggc
tttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcctgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161831_P_P-E Feature FT:CDS GQ161831_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU779). Non-functional genomic sequence. [Hepadnaviridae] (length=2517 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
gaacttagtcatgcctgctagattttttcccatctctacaaaatatttacccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccacaccagacactatttacataccctatggaaggcgggcatcttatataaaagg
gaaacttcacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgagcaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaacaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
acgcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtgagacctgctggtgg
ctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatctcctcgaggattggggaccctg
caccgaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaa
atcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggcca
aaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggcaatcgctggatgtgtctgc
ggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggtccttctggactatcaaggtatgttg
cccgtttgtcctctaattccaggatcatcaactaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaac
ctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctt
tcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcc
gggctttcccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatctggagtcc
ctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggttattc
cctacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaagactgtt
ttagaaaactccctgttaaccggcctattgattggaaagtatgtccaagaattgtgggtcttttgggctttgctgcccct
tttacacaatgcggatatcctgctttaatgccgctgtattcrtgtattcaatctaagcaggctttcactttctcgctaac
ttacaagacctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccagatctgtgccaagtgtttg
ctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatc
catactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaccttatcgggacagataattctgtcgt
tctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtct
acgtcccgtcggcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccg
ttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgcctactcatctgccggaccgtgtgcactt
cgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161832_P_P-E Feature FT:CDS GQ161832_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1091). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattatcaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacaaaatatttgccactagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
atgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaataaaacaaaaag
atggggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcaaaatgaaaa
tcaaagactgttttagaaaactccctgttaatcggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
gttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggttggggcttggccatcggccatcagcgcatgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161833_P_P-E Feature FT:CDS GQ161833_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU489). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacaactccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtatttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaatttagtcatgcctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcgtggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttgaatcctaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctggacctttaccccgttgcccggcaacggcccggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgaggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccatctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161834_P_P-E Feature FT:CDS GQ161834_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1128). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaactcttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaacctccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctggaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccaaaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaccaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatccccagcccatgcagtggaattccacaacattccaccaagctcttcaggatcccagagtaagaggcctgtatct
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcgtggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctctgggtatacatttaaatcccaacaaaacaaaaag
atggggatattcactacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaacgcattgtgggtcttttgggc
tttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtatacacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggct
cctatgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctaccgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161835_P_P-E Feature FT:CDS GQ161835_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU925). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaatttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaacga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccacaaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactccccctcacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagtttcggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaacg
atggggatattccctacatttcatgggttatgtaattggaagttggggatcattaccacaggaccacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtatgcgtgtattcaagctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|GQ161836_P_P-E Feature FT:CDS GQ161836_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1051). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggccctctaacagtaaatgaaaaacgaagact
aaacttagttatgcctgctagattttttcccatcgctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaaaaggcctgtatct
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgacga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgataaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcctcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaacttcatgggttatgtaattggaagttgggggtcattgccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgtcaatcggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggt
tttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggcttttac
tttctcgccaacttacaaggcctttttgtgtaaacaatacctgaacctttaccccgttgcccggcaacggtcaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcggcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccggccaaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HM363565_P_P-E Feature FT:CDS HM363565_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A186). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagacgaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccattgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctcactggaaaactccatcttttcct
gatattcatttgcaccaggatattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaaattagtcatgcctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctttggaaggcgggcatcttatataaaagg
gaaactacacgtagcgcctcattttttgggtcaccttatccttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcaatccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccaaaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccgccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggaccccagagtaaggggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccttgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaattccgaagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggccggaaattgcacttgtactcccatcccat
catcatgggctttcggaaaatacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaatcggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttgatgcctctgtatgcgtgtattcaatctaagcaggcttttac
gttctcgccaacttacaaggcctttctgtgtcaacaataccggaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctaccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttattgggacgga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaaccctgcggacgacccgtcccggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctttgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HM363566_P_P-E Feature FT:CDS HM363566_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IBL1082). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatccacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatccccactggaaaactccatcttttcct
gatattcatttgcaccaggacattattgacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttacccttagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagg
gaaactgcacgtagtgcctcattttttgggtcaccatattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
acagcgaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaaccaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccttgcactgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
cagggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccatgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgaacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccgacaaaacaaaaag
atggggatattccctgaatttcatgggttatgtaattggaagttgggggtcattaccacaagaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaatcggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcatgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtcaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctaccgatccatactgcggaactcctagccgcctgttttgctcgcagcaggtctggagcgaaacttattgggacgga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtcacggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccggccgtctacgggtcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HM363567_P_P-E Feature FT:CDS HM363567_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C16). Non-functional genomic sequence. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaatttcacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacctagtcatgcctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatc
ctgataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagg
gaaactacacgtagcgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctggattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctacagttcatgggttatgtaattggaagttgggggtcattaccacaggatcacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaatcggcctattgattggaaagtatgtcaacgaattgtgggtctgttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcatgtattcaatccaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctggcagcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatctacatcatttccatggctgctaggctgtgctgccaactggctcctgccaggga
cgtccttggtatacgtgcagtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggataaaccatcccctt
ctccgtctgccgttccggccgaccacgcggcgcacctctctttacgcggtctcccagtctgtgccttctcatccgccgga
ccgtgagcacttcgcttcaccttcgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HM363568_P_P-E Feature FT:CDS HM363568_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C98). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaatttcacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacctagtcatgcctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatc
ctgataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagg
gaaactacacgtagcgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagttcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaattccaacaaaacaaaaag
atggggatattccctacagttcatgggttatgtaattggaagttgggggtcattaccacaggatcacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaatcggcctattgattggaaagtatgtcaaagaattgtgggtctgttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcatgtattcaatccaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctggcagcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtcttggggtcgcttggggatctaccgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HM363569_P_P-E Feature FT:CDS HM363569_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A51). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctaaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaattctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaaagaagatt
aaatttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccaggcactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcagacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaataaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttggggatcattaccacaggaacacatcagattgaaaa
tcaaaaactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgcaccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcacttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HM363570_P_P-E Feature FT:CDS HM363570_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A85). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctaaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaattctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaaagaagatt
aaatttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccaggcactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaataaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttggggatcattaccacaggaacacatcagattgaaaa
tcaaaaactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgcaccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcacttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HM363571_P_P-E Feature FT:CDS HM363571_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V16). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagacaatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagattgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcccctgtatgcgtgtactcaatctaagcaggctttcac
tttctcgccaacttacaagacctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaacacttatcgggactga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctacgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctttcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HM363572_P_P-E Feature FT:CDS HM363572_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V5). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgcgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaattatttacccctagataaaggtataaaaccttattacc
cagataatgtagttaatcattacttccaaacgagacactatttacataccctatggaaggcgggcatcttatataaaagg
gaaactacacgtagcgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggtcagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgttaaaaacgt
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagatgcctgtatct
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaagattcctaggacccctgctcgtgttacaggcggggtttttc
tcgttgacaaaaaccctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcgtggccaaaattcgcagtccccaacctccaatcactcaccaatctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatctaaatcccaacaaaacaaaaag
atggggatattctctaaatttcatgggttatgtaattggaagttgggggtcattaccccaggaacacatcagattgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcccctgtatgcgtgtactcaatctaagcaggctttcac
tttctcgccaacttacaagacctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaacacttatcgggactga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctacgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctttcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HM363573_P_P-E Feature FT:CDS HM363573_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V3). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctctactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttacaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttggtcatgcctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagg
gaaacgacacgtagcgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaatgt
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatattctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatctaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggatcacatcaaaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggacaga
taattctgttgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctctcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HM363574_P_P-E Feature FT:CDS HM363574_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V70). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatccacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcccctcacagtaaatgaaaaacgacgatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcacacccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggtctgtattt
tcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcagacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcaaaatgaaaa
tccaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccgacaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttattgggactga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccctt
ctccgtctgccgttccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HM363575_P_P-E Feature FT:CDS HM363575_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V30). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccaggttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttaattatgcctgctagattttttcccatctctacgaaatatttacccctggagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagg
gaaactacacgtagcgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
cgagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggtttactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcc
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatgccaacaaaacaaaaag
atggggatattctctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttataaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaccttatcgggacaga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagacctccgtga
>gnl|hbvcds|HM363576_P_P-E Feature FT:CDS HM363576_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V43). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccaggttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttaattatgcctgctagattttttcccatctctacgaaatatttacccctggagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagg
gaaactacacgtagcgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
cgagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggtttactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
cacggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatgccaacaaaacaaaaag
atggggatattctctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttataaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaccttatcgggacaga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HM363577_P_P-E Feature FT:CDS HM363577_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C19). Non-functional genomic sequence. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaagacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttacccctagagaaaggtatcaaaccttattatc
cagataatgtagttaatcattacttccaaactagacactatttacataccctatggaaggcgggcatcttatataaaagg
gaaactacacgtagcgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccaacagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctctagtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatgccaacaaaacaaaaag
atggggatattctctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctttgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccgacaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HM363578_P_P-E Feature FT:CDS HM363578_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IBL802). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccactgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagttaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaactagacactatttacataccctatggaaggcgggcatcttatataaaagg
gaaactacacgtagcgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcatttgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagat
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatct
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatgccaacaaaacaaaaag
atggggatattctctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtttacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccatcgtga
>gnl|hbvcds|HM363579_P_P-E Feature FT:CDS HM363579_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A32). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
ataaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcccctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccttatggaaggcgggcatcttatataaaagg
gaaactacacgtagcgcctcattttttggttcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccagggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgcaaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
ccctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgt
gtgtcttggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaattccaacaaaacaaaaag
atggggatattccctaaattttatgggttatgtaattggaagttgggggtcattaccacaggatcacatccgaatgaaaa
tcaaagactgttttagaaaactcccagttaatcggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgagtattcaatctaagcaagctttcac
tttctcgccaacttacaaggccttcctgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatttatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtaccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HM363580_P_P-E Feature FT:CDS HM363580_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A79). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
ataaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcccctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccttatggaaggcgggcatcttatataaaagg
gaaactacacgtagcgcctcattttttggttcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccagggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgcaaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
ccctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaattccaacaaaacaaaaag
atggggatattccctaaattttatgggttatgtaattggaagttgggggtcattaccacaggatcacatccgaatgaaaa
tcaaagactgttttagaaaactcccagttaatcggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaagctttcac
tttctcgccaacttacaaggccttcctgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatttatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtaccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HM363581_P_P-E Feature FT:CDS HM363581_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A84). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
ataaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcccctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccttatggaaggcgggcatcttatataaaagg
gaaactacacgtagcgcctcattttttggttcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccagggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgcaaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
ccctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgt
gtgtcttggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaattccaacaaaacaaaaag
atggggatattccctaaattttatgggttatgtaattggaagttgggggtcattaccacaggatcacatccgaatgaaaa
tcaaagactgttttagaaaactcccagttaatcggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaagctttcac
tttctcgccaacttacaaggccttcctgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatttatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HM363582_P_P-E Feature FT:CDS HM363582_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IBL314). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
ataaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctcttacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagg
gaaactacacgtagcgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgcaaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgtcgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaattcccacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttggggatcattaccacaggatcacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaatcggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacgcaatgtggatatcctgctttaatgcctatctatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttgcccataggccatcagcgcatgcctggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtagttctctcccgaaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggccgcttggggatctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HM363583_P_P-E Feature FT:CDS HM363583_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V137). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
ataaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctcttacggtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatattttcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagg
gaaactacacgtagcgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgcacataacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaaaaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaattccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttggggatcattaccacaggatcacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaatcggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacgcaatgtggatatcctgctttaatgcctatctatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggccgcttggggatctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HM363584_P_P-E Feature FT:CDS HM363584_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V129). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
ataaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaacctccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctcttacggtaaatgaaaaacggagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatattttcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagg
gaaactacacgtagcgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgcacataacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
acgcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaaaaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccacgtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaattccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttggggatcattaccacaggatcacatcagattgaaaa
tcaaagactgttttagaaaactccctgtcaatcggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacgcaatgtggatatcctgctttaatgcctatctatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggccgcttggggatctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctggggcttctcatctgccgga
ccgtgtgcacttcccttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HM363585_P_P-E Feature FT:CDS HM363585_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IBL1455). Non-functional genomic sequence. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
ataaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcatcaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatc
cagacaatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagg
gaaactacacgtagcgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtcttt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggcatacatttaaattccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggatcacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaatcggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccctttacgcaatgtggatatcctgctttaatgcctatatatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaccctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HM363586_P_P-E Feature FT:CDS HM363586_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A227). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacgggactttactcttctactatacctgtctttaatcctaactggaaaactccgtcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatc
ctgataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagg
gaaactacacgtagcgcctcattttttggttcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccactaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacaaaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaacaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaaaattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggcatacatttaaattccaacaaaacaaaaag
atggggatattccctccagttcatgggttatgtaattggaagttgggggtcattaccacaggatcacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaatcggcctattgattggaaagtatgtcaaagaattgtgggtctgttgggc
tttgctgccccttttacacaatgtggatatcctgctttgatgcctctgtatgcatgtattcactctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccggccgcccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcgtctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HM363587_P_P-E Feature FT:CDS HM363587_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V195). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagttatgcctgctagattttttcccatttctacgaaatatttacccctagagaaaggtataaaaccttattatc
ctgataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagg
gaaactacacgtagcgcctcattttttgggacaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggacaacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacatggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaaga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaattccgacaaaacaaaaag
atggggatattccctacagttcatgggttatgtaattggaagttgggggtcattaccacaggatcacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaatcggcctattgattggaaagtatgtcaaagaattgtgggtctgttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacagtacatgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcctgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtagcatggagaccaccgtga
>gnl|hbvcds|HM363588_P_P-E Feature FT:CDS HM363588_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A100). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttcctgagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccgtggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatc
cagagaatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagg
gaaactacacgtagcgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaccaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacgtcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaatttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccttgccgcacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgtcgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttgaattccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaatcggcctattgattggaaagtatgtcaaagaattgtgggtctgttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcctggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacgga
taattctgtcgttctctcccgcaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HM363589_P_P-E Feature FT:CDS HM363589_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A178). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttcctgagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccgtggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaagttagtcatgcctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatc
cagagaatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagg
gaaactacacgtagcgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaccaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcaatggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacgtcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccttgccgcacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgtcgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttgaattccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacattagaatgaaaa
tcaaagactgttttagaaaactccctgttaatcggcctattgattggaaagtatgtcaaagaattgtgggtctgttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaacacttatcgggacgga
taattctgtcgttctctcccgcaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtggcttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HM363590_P_P-E Feature FT:CDS HM363590_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V119). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttcctgagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatc
cagagaatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagg
gaaactacacgtagcgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaccaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggaaggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgtcgggctttcccccactgtctggctttcagttacatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttgaattccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaga
tcaaagactgttttagaaaactccctgttaatcggcctattgattggaaagtatgtcaaagaattgtgggtctgttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacgga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcggcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatccgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HM363591_P_P-E Feature FT:CDS HM363591_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A114). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatc
cagagaatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagg
gaaactacacgtagcgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccacaaatcctctgggattttttcccgatcatcagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaccaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaattccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaattccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaatcggcctattgattggaaagtatgtcaaagaattgtgggtctgttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcgaaacttatcgggacgga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggatgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcggcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HM363592_P_P-E Feature FT:CDS HM363592_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A153). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactttacctgtctttaaccctaactggaaaactccatcttttcct
gatattcatttgcaccaagacattattaacaaatgtgaacaatttgtgggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatc
ctgataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagg
gaaactacgcgtagcgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggatagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctatattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgacact
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacataaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaattccaacaaaacaaaaag
atggggatattccctacagttcatgggttatgtaattggaagttggggatcattaccacaggatcatatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaatcggcctattgattggaaagtatgtcaaagaattgtgggtctgttgggc
tttgctgccccttttacacaatgtggatatcctgctttactgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaccttatcgggacgga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcggcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggt
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HM363593_P_P-E Feature FT:CDS HM363593_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IBL1577). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatc
ctgagaatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagg
gaaactacacgtagcgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
acgcatcctcaggccatgcagtggaattccaaaacattccaccaagctctacaggaccccagagtaagaggcctgtatct
tcctgctggtggctctcattccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaattccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggatcacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaatcgtcctattgattggaaagtatgtcaaagaattgtgggtctgttgggc
tttgctgccccctttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatgtatcgtcccctt
ctccgtctgccgttccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|HM363594_P_P-E Feature FT:CDS HM363594_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V157). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccttcttttcct
gatattcatttgcaccaggacattattaaaaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagttatgcctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctttggaaggcgggcatcttatataaacgg
gaaactacacgtagcgcctcattttttgggtcaccttattcttgggaacaagacctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggacccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccgggattcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccccctcctgcctccaccaatcggcagtcaggaaggctgcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacatttcaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccttgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaattccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaatcggcctattgattggaaagtatgtcaaagaattgtgggtctcttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactga
taattctgtcgttctctcccggaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctacgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctaccgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HM363595_P_P-E Feature FT:CDS HM363595_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IBL1219). Non-functional genomic sequence. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaattggaaaactccttcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagttatgcctgctagattttttcccatctctacaaaatatttacccctagagaaaggtataaaaccttattatc
cagatgaggtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagg
gaaactacacgtagcgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccattggacagaagccaacaaggtaggagtggg
agcattcgggccgggattcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcacgccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacatttcaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcacagaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgg
gtgtcttggccaaaattcgcagtcccaaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaacaaaaa
tcaaagactgttttagaaaactccctgttaatcggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HM363596_P_P-E Feature FT:CDS HM363596_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V87). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaactagacactatttacataccctatggaaggcgggcgtcttatataaaagg
gaaactacacgtagcgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatct
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaagaaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaattccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttaggaaactccctgttaaccggcctatagattggaaagtctgtcaaagaattgtgggtcttttgggt
tttgctgccccttttacacaatgtggatatcctgctttaatgcctttgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcctggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctgtcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgggctgccaactggatcctgggaggga
cgtcctttgtctacgtcccgtcagcgctgaatcgtgcggacgacccgtctcggggtcgcttgggggtctctcgtcccctt
ctccgtctggcgttccggccgaccacggggcgcacctctctttacccgggctccccgtctggggcttctcatctggcgga
ccgggtggacttcgcttcacctctggacgtcacatggagaccacggtga
>gnl|hbvcds|HM363597_P_P-E Feature FT:CDS HM363597_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A112). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatc
cagagaatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagg
gaaaccacacgtagcgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccacaaatcctctgggattttttcccgatcatcagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaccaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggaagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaattccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcacggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaattccaccaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaatcggcctattgattggaaagtatgtcaaagaattgtgggtctgttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcgaaacttatcgggacgga
taattctgtcgttctctcccggaaatatacatcatttccatgggtgctaggatgtgctgccaactggatcctgggaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctggggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccgggcgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccatcgtga
>gnl|hbvcds|HM363598_P_P-E Feature FT:CDS HM363598_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V15). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagattactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaataaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattacc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagg
gaaactacacgtagcgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggactg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccatcagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttgggatggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggatgtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaatctccaatcacttaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtcagcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaagaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaattccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaatcggcctattgattggaaagtatgtcaaagaattgtgggtctgttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctatgtaaacagtacctgaacctttaccccgttgcccggcaacggcccggtctat
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaccttatcgggactga
taattctgtagttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgggaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtggacttcgcttcacctctgcacgtcgcatggagaccatcgtga
>gnl|hbvcds|HM363599_P_P-E Feature FT:CDS HM363599_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V144). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccttcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgcagatt
aaaattagttatgcctgctagattttttcccatctctacaaaatatttacccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaacgg
gaaactacacgtagcgcctcattttttggttcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaataccaaaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccgggattcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccaccattgagagac
actcatcctcaggccatgcagtggaattccacaacatttcaccaagctctgcaggatcccagagtaagaggcctgtatct
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccatgcaccgaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggatcctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggctaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaattcccacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattacctcaggaacacatcagaacgaaaa
tcaaagactgttttagaaaactccctgttaatcggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggcttttac
tttctcgccaacttacaaggcctttctgtgtcaacaatatctgaacctttaccccgttgctcggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactgatcgggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtccttcgtctacgtcccgtcagtggtgaatcctggggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggg
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HM363600_P_P-E Feature FT:CDS HM363600_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C8). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccacgtcgcagaagatctcaatctccagcttcccgatgttagtattccttggactc
ataaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatatctacgaaatatttccccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagg
gaaactacacgtagcgcctcattctttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcacccccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctacaccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattcaacaacattccaccaaactctgcagaatcccagagtaacaggcctgtatcc
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattcccggatcatcaaccaccagtacgggaccctgccgaacatgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaattccaacaaaacaaaaag
atggggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaggatcacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaatcggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccctttacacaatgtggatatcctgctttaatgcctatatatgcgtgtattcactctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtcaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccattggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgttgttctctcccggaaatatacatcatttccatgggtgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccatctcggggtcgcttggggatatatcgtcccctt
ctccgtctgccgttccggccgtccacggggcgcacctctctttacccggtctccccgtctgtgccttctcatctgccggt
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HM363601_P_P-E Feature FT:CDS HM363601_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IBL911). Non-functional genomic sequence. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttcctgagattactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccgtggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaaattagtcatgcctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatc
cagagaatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagg
gaaactacacgtagcgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaccaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggcggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctactccaatcactccacctttgagagac
actcatcctcaggctatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatct
tcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacgtcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccttgccgcacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgtcgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttgaattccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgtttcagaaaactccctgttaatcggcccattgattggaaagtatgtcaaagaattgtgggtctgttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgccgctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgcacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgctgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacgga
caattctgtcgttctctcccgcaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HM363602_P_P-E Feature FT:CDS HM363602_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A231). Non-functional genomic sequence. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagacgcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacgggactttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctcttacagtaaatgaaaaacgaagatt
aaacttagttatgcctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatc
ctgataatgtagttaatcattacttccaaaccagacactatttacataccctttggaaggcgggcatcttatataaaagg
gaaactacacgtagcgcctcattttttggttcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccactaccaatcctctggggtttttacccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttctggggtggagccctcaggctcaaggcatgctaacaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccaaagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcacgcatctcgtcaatcttctcgagga
ttggggaccttgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttc
tcgttgataaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggcatacatttaaattccaacaaaacaaaaag
atggggatattccctccagttcatgggttatgtaattggaagttgggggtcattaccacaggatcacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaatcggcctattgattggaaagtatgtcaaagaattgtgggtctgttgggc
tttgctgccccttttacacaatgtggatatcctgctttgatgcctctgtatgcatgtattcactctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacgga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgagaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttatcatccgccgga
ccgtgtgcacttcgcttcacctttgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HM363603_P_P-E Feature FT:CDS HM363603_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IBL1274). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccactgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctcactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcccctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctctggaaggcgggcatcttatataaacgg
gaaactacacgtagcgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccaaaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgccaaaaacat
tgccatcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtacgaggcctgtatct
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaaccatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctacgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtcttgggggcgaggtctgtacac
catcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaattccaacaaaacaaaaag
atggggatattctctaaatttcatgggttatgtaattggaagttggggatcattaccacaggaacacatcagagtgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgactggaaagtatgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtcaacaatacctgaacctttaccccgttgcccggcaacggccaggtctat
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtgact
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
caattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctacgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgtccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggg
ccgtgtgcacttcgcttcacctctccacgtcgcatggaaaccaccgtga
>gnl|hbvcds|HM363604_P_P-E Feature FT:CDS HM363604_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A28). Non-functional genomic sequence. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatccacacttccggagaatgctgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccgtggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaaagaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttacccttagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagg
gaaactacacgtagcgcctcattttttggttcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccacccctcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgcaaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggaagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggtctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaattccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaccacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaatcggcctattgattggaaagtagttcagagaattgtgggtctgttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtcaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctggcagcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatctacatcatttccatggctgctaggctgtgctgccaactggctcctgccaggga
cgtccttggtatacgtgcagtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggataaaccatcccctt
ctccgtctgccgttccggccgaccacgcggcgcacctctctttacgcggtctcccagtctgtgccttctcatccgccgga
ccgtgagcacttcgcttcaccttcgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HM363605_P_P-E Feature FT:CDS HM363605_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C58). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccaggttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatatccatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaaattagtcatgcctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatc
cagagaatgtagttaatcattacttccaaaccagacactatttacatactctatggaaggcgggcatcttatataaaagg
gaaactacacgtagcgcctcattttttgggtcaccttattcttgggaacaagacctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgatcaccagttggatccagcattc
agagcaaacaccagaaatccagattgggatcacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
acgcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatct
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcctcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaattccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaccacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaatcggcccattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgccgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgcattcaatctaagcaggcttttac
tttctcgccaacttacaaggcctttctgtgtacacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttattgggactga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtatacgtcccgtcagcgctgaatcctgcggacgacccatctcggggtcgcttggggatctaccgtcccctt
ctccgtctgccgttccagccgtccacggggcgcacctctctttacgcggtctccccgtttgtgccttatcatccaacgga
ccgtgtgcacttcgcttcacctttccacgtcgcatggaaaccaccgtga
>gnl|hbvcds|HM363606_P_P-E Feature FT:CDS HM363606_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V64). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatctccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaacgaaaaacgaagatt
aaacttagtcatgcctgctagattctttcccatctcaacgaaatatttgcccttagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaacgg
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaaaaatcattccacctccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccgcacggaggccttttggggtcgagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccttgcaccgaacatggaaagcatcacatccggattcctaggacccctgctcgtattacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
cagggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatccaaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcactaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtcggtctattgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtcaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggacaga
taattctgtcgttctctcccgaaaatatacttcatttccatggctgctaggctgtgctgccaactggctcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttatcatccgccggt
ccgtgtgcacttcgcttcacctctccacgtcgcatggagaccacagtga
>gnl|hbvcds|HM363607_P_P-E Feature FT:CDS HM363607_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C78). Non-functional genomic sequence. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgccgatctcaatcgccgcgtcgcagaagatctcaatctccatcttcccactgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagttatgcctgctagattttttcccatctctacgaaatatttacccctggagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataagagg
gaaactacacgtagcgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
cgagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggtttactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgttaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatacagtggaattccacaacattccaccaagctctgcaggatcccagagtaaaaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcatcactcatatcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatgccaacaaaacaaaaag
atggggatattctctaaatttcatgggttatgtaattggaagttggggatcattaccacaggaacacatcaaaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtacgcgtgtattcaatctaagcaggctttcac
tttttcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggcaatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgttgttctctcccggaaatatacatcatttccatgggtgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccatctcggggtcgcttggggatatatcgtcccctt
ctccgtctgccgttccggccgtccacggggcgcacctctctttacccggtctccccgtctgtgccttctcatctgccggt
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HM363608_P_P-E Feature FT:CDS HM363608_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A212). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttactatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggatcacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttctggggtggagccctcaggctcaaggcatgctaaaaacat
tgccaacagatccgcctcctgcctccatcaagcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccagaacatttcaccaagctctgcaggatcccagagtaagaggcctgtatct
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgtctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtcggcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaacagaacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgattccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgcgatttgct
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctattaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattctctaaatttcatgggttatgtaattggaagttgggggtcattaccacaagaacacataagatcaaaaa
tcaaagactgttttagaaaactccctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtactcaatctaagcaggctttcac
tttctcgccaacatacaaggcctttctgtgtcaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HM363609_P_P-E Feature FT:CDS HM363609_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A58). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcttaacttgaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcccctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatatctacgaaatattcgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaacgg
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccacctccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
aacattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggaatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcaccacatccggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaatttgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggcatacatttaaatccaaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgtcaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcctgcgtggaacctttgtggct
cctctgccgatccatattgcggaactcctagccgcttgttttgctcgcagcaggtctggggcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgca
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HM363610_P_P-E Feature FT:CDS HM363610_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C113). Non-functional genomic sequence. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacagggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttaatcatgcctgctagattttatcccatctctacgaaatacttacccctagagaaaggtataaaaccttattatc
cagagaatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagg
gaaactacacgtagcgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcagtccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacacccgaaatccagattgggatcacaatcccaccaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctccaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
acgcatcctcaggccatgcagtggaattccacaacattccacaaagctctgcaggatcccagagtaagaggcctgtatct
tcctgctggtggctccagttcaggaaaagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgtcgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaattccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgtcaatcggcctattgattggaaagtatgtcaaagaattgtgggtctgttgggc
tttgctgccccttttacgcaatgtggatatcctgctttaatgcctttgtatgcgtgtattcaatctaagcaggctttcac
tttttcgccaacttacaaggcctttctgtgtcaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggcaatcagcgcatgcgtggaacctttgtggct
cctctgccgacccaaacggcgaaactcctagccgcttgtttggctcgcagcaggtctggagcgaaatttatcgggacgca
aaattcggtcgttctctccaggaaaaatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HM363611_P_P-E Feature FT:CDS HM363611_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A67). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctggaagaagaactccctcg
cctcgcagacgaagacctcaatcgccgcgtcgcagaagatctcaatctccatcttcccaatgttagtattccttggactc
acaaggtgggaaactttacggggctttactcttctactatacctgtctttaatcctaactggcaaactccatcttttcct
gatattcatttgcaccaggacattgttaacaaatgtgaacaatttgtaggtcctttaacagtaaatgaaaaacgaagatt
aaatctagtcatgcctgctagattttttcccaactctacgaaatatttacccctagacaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaactagacactatttacataccctttggaaggcgggcatcttatataagagg
gaaactacacgtagcgcttcattctttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacag
tccctctcgaatgggggaagaatcagtctaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagcccgcaggctcaaggcacgcaaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccgatcactccacctttgagagac
acgcatcctcaggccatgcagtggaattccaaaacattccaccaagctctacaggaccccagagtaagaggcctgtatct
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttaggaaactccctgttaatcggcctattgattggaaagtgtgtcaaagaattgtgggtctattgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcatgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcctgcgtggaaactttgtggct
cctctgccgatccatactgcggaactcctggctgcttgttttgctcgcagcaggtctggggcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgagaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccct
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtggcttcacatctgccggt
ccgtggggacttcccttcacctctgcacgtctcatggcgcccaccgtga
>gnl|hbvcds|HQ700550_P_P-E Feature FT:CDS HQ700550_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate E_Mad_A032a). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgacgatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacatcattaacaaatgtgaacaatttgtaggacctctaacagtaaatcaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagacaatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggagggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatccaaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggacggcagcctaccccaatcactccacctttgagagac
actcatccccaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatcgaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaagatcacatcagaatgaaaa
tcaaggactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcctgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccatctgtgccttctcgtctgccggc
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HQ700551_P_P-E Feature FT:CDS HQ700551_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate E_Mad_F017A). Non-functional genomic sequence. [Hepadnaviridae] (length=2514 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccaacttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaagcgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagacaatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagctttc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatcctcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
cgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttccctcactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggcatacatttaaatcccaacaaaacaaaaagatggggatattccct
aaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaatcaaggactgtttta
gaaaactccctgttaatcggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcccctttt
acacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaactta
caaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctg
atgcaacccccactggctggggcttggccatcggccatcagcgcctgcgcggaacctttgtggctcctctgccgatccat
actgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactgataattctgtcgttct
ctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacg
tcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtccccttctccgtctgccgttc
cagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgc
ttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|HQ700552_P_P-E Feature FT:CDS HQ700552_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate E_Mad_030). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgacgatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacatcattaacaaatgtgaacaatttgtaggacctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagacaatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatccaaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggacggcagcctaccccaatcactccacctttgagagac
actcatccccaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaagatcacatcagaatgaaaa
tcaaggactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcctgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccatctgtgccttctcgtctgccggc
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|JQ000008_P_P-E Feature FT:CDS JQ000008_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate S1). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
ataaggtgggaaattttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttacaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaaattagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactaccagtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggcctgggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgataaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggmcggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttttacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggtagttgggggtcattaccacaagaacacatcagatcgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatacgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatatatgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggcattcagcgcatgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggaccga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|JQ000009_P_P-E Feature FT:CDS JQ000009_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate S2). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggcctc
ataaggtgggaaattttacgggtctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaaattagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
ccgataatgtagttaatcattacttccaaaccagacactatttacataccctgtggaaggcgggcatcttatataaaaga
gaaactacccgtagcgcctcattttgtgggtcaccttattcttgggaacacgagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggcctgggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgataaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacttgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattggggaccaagtctgtacaa
catcttgagtccctttttacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggtagttgggggtcattaccacaagaacacatcagatcgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatacgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatatatgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccattggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctttcccggaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|KF170741_P_P-E Feature FT:CDS KF170741_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SDAC_047). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatcccaacccccccccttggagtattccttccactc
acaaggtgggaaattttacggggctttattcttctactattcctgtctttaatcctaactggaaaactccatctttccct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcatttgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggcttttagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttcagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctacatttcatgggttatgtaattggaagttggggatcattaccacaagaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaacttctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgtttgggggtctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|KF170742_P_P-E Feature FT:CDS KF170742_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SDAC_125). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcacaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaagggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacatactctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggcctgggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaaactctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcckggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttggggatcattaccacaggaacacattagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcacggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaaccctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtrccttctcatctgccggc
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|KF849713_P_P-E Feature FT:CDS KF849713_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA277). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacccgtagcgcctcattttgtgggtcaccttattcttgggaacacgagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggcctgggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcaatttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggtagttgggggtcattaccacaagaacacatcagattgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctatatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatatatgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|KF849714_P_P-E Feature FT:CDS KF849714_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA439). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacggagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtggttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacccgtagcgcctcattttgtgggtcaccttattcttgggaacacgagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcatttgggcctgggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgtt
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggtagttgggggtcattaccacaagaacacatcagattgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcagagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctatatgcatgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatatatgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatagggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcggcgctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggc
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|KF849715_P_P-E Feature FT:CDS KF849715_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA445). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtaaaaaaccttattatc
cagataatgtakttaatcattacttccaaaccagacactatttacataccttatggaaggcgggcatcttatataaaaga
gaaactacmcgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcatttgggcckgggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgcaaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcctcaatcttctcgagga
ctggggaccctgcaccgaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgtcgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggtagttgggggtcattaccacaagaacacatcagattgaaaa
tcaaagactgttttagaaagctccctgttaaccggcctattgattggaaagtatgtcagagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctctatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatatatgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatagggacaga
taattctgtygtcctctcccggaaatacacatcatttccatggctgctaggatgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|KF849716_P_P-E Feature FT:CDS KF849716_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA278). Non-functional genomic sequence. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaamgmagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacmcgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggcctgggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggacagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttccgacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggtagttgggggtcattaccacaagaacacatcagattgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttaggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctatatgcgtgttttcaatctaagaaggctttcac
tttctcgccaacttacagggccttttttagtaaacaataaatgaacctttaccccgttgcccggcaacggtcaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaamttawcgggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|KF849717_P_P-E Feature FT:CDS KF849717_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA504). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacacaccctatggaaggcgggtatcttatataaaaga
gaaactacccgtagcgcctcattttgtgggtcaccttattcttgggaacacgagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggcctgggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctgaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggcaatgcagtggaattccacaacattccaccaaactctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccgggacagtaaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaaaatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggtagttgggggtcattaccacaagaacacatcagattgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctatatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatatatgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcggcgctgaatcctgcggacgacccctctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggg
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|KF849718_P_P-E Feature FT:CDS KF849718_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA72). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagtgtactgttattagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacatactctatggaaggcgggcatmttatataaaaga
gaaactacccgtagcgcctcattttgtgggtcaccttattcttgggaacamgagctacatcatggggctttcttggrcgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggcctgggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgtctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggtagttgggggtcattaccacaagaacacatcagattgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagatttgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctatatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatatatgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccctctcggggtcgcttgggggtctctcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|KF849719_P_P-E Feature FT:CDS KF849719_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA154). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaacga
gaaactacccgtagcgcctcattttgtgggtcaccttattcttgggaacacgagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggcctgggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaaccaaaag
atggggatattccctaaatttcatgggttatgtaattggtagttgggggtcattaccacaagaacacatcagattgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctatatgcgtgcattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatatatgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatagggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccctctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccgaccgactacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|KF849720_P_P-E Feature FT:CDS KF849720_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA265). Non-functional genomic sequence. [Hepadnaviridae] (length=2526 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctcttacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgccccttgagaagggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacccgtagcgcctcattttgtgggtcaccttattcttgggaacacgagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
aaagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacgaggtaggagtggg
agcatttgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaacaacct
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagyggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatcc
tgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattg
gggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttg
ttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtg
tcttggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctgga
tgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaa
ggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgc
tcacggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcat
catgggctttcggaaaattcctatgggagtgggcctcagcccgtttcttatggttcagtttactagtgccatttgttcag
tggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacat
cttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatg
gggatattccctaaatttcatgggttatgtcattggtagttgggggtcattaccccargaacacatcagattgaaaatca
aagactgtttcagaaaactccctgtaacccggcctattgattggaaagyaygtcarrgaattgtgggtcttttgggcttt
gctgccccttttacacaatgtggatatcctgctttaatgcctctatatgcgtgtattcaatctaagcaggctttcacttt
ctcgccaacttacaaggcctttctgtgtaaacaatatatgaacctttaccccgttgcccggcaacggccaggtctgtgcc
aagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcctgcgtggaacctttgtggctcct
ctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttattgggacggataa
ttctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgt
cctttgtctacgtcccgtcagcgctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtcccctcctc
cgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccg
tgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|KF849721_P_P-E Feature FT:CDS KF849721_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA379). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacccgtagcgcctcattttgtgggtcaccttattcttgggaacacgagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggcctgggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcacaccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgt
gtgtcttggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaactgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggtagttgggggtcattaccacaagaacacatcagattgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctatatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatatatgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatagggactga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggt
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|KF849722_P_P-E Feature FT:CDS KF849722_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA386). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacccgtagcgcctcattttgtgggtcaccttattcttgggaacacgagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggcctgggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatataattggtagttgggggtcattaccacaagaacacatcagattgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgcattaatgcctctatatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatatatgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatagggacaga
taattctgtcgttctctcccggaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcggcgctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|KF849723_P_P-E Feature FT:CDS KF849723_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA173). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
gaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtattaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacccgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcatttgggcctggggtcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatactaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgtctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggaagctcccgt
gtgtcttggccaaaattcgcagtccccaatctccaatcactcactaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatggggttgggcctcagcccgtttctcatggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaa
catcttgagtctctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggtagttgggggtcattaccacaagaacacatcagattgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctatatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacagcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|KF849724_P_P-E Feature FT:CDS KF849724_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA274). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaaggggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacccgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccatcagttggatccagcattc
agagcaaacaccagaaatccagattgggatcacaatcccaacaaagaccactggacagaagcaaacaaggtaggagtggg
agcattcgggcctgggttcactcccccacacggaggccttttggggtggagccctcaggctcacggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaaccccaacaaaacaaaaag
atggggatattctctaaatttcatgggttatgtaattggtagttgggggtcattaccacaagaacacatcagattgaaaa
tcaaagaatgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctatatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgcgtaatcaatatatgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatagggacgga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtactgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccctctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|KF849725_P_P-E Feature FT:CDS KF849725_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA399). Non-functional genomic sequence. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttattcttcttctatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacccgtagcgcctcattttgtgggtcaccttattcttgggaacacgagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccaaaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcatttgggccggggttcactcccccacacggaggccttgtggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttcaggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgtgaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatactccctaaatttcatgggttatgtaattggtagttgggggtcattaccacaagaacacatcagattgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctatatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatatatgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|KF849726_P_P-E Feature FT:CDS KF849726_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA417). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcatcacttccggagtgtactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagttatgcctgctagattttttcccatctctacgaaatatttgcctctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacccgtagcgcctcattttgtgggtcaccttattcttgggaacacgagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcatttgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatct
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctcaatttcatgggttatgtaattggtagttgggggtcattaccacaagaacacatcagattgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtctgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctatatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaccaatatatgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcggaactga
taattctgtcgttctctcccggaaatacacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggc
ccgtgtgcacttcgcttcacctctacacgtcgcatggagaccaccgtga
>gnl|hbvcds|KF849728_P_P-E Feature FT:CDS KF849728_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA423). Non-functional genomic sequence. [Hepadnaviridae] (length=2517 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccactgttagtattccttggactc
acaaggtgggaaattttacggggctttattcttctactattcctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaaattagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataagaga
gaaactacccgtagcgcctcattttgtgggtcaccttattcttgggaacacgagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
aaagcaaacaccagaaatccagattgggatcacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggcctgggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatcctaacaacat
tgccagcagatccgcctcctccctccaccaatcggcagtcaggaaggcagcccaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccaaagcaaaacctgctggtgg
ctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggtccctg
caccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaa
atcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggcca
aaattcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgc
ggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttg
cccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaac
ctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctt
tcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcc
gggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtcc
ctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattc
cctaaatttcatgggttatgtaattggtagttgggggtcattaccacaagaacacatcagattgaaaatcaaagactgtt
ttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcccct
tttacacaatgtggatatcctgctttaatgcctctatatgcgtgtattcaatctaagcaggctttcactttctcgccaac
ttacaaggcctttctgtgtaaccaatatatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttg
ctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatc
catactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatagggacagataattctgtcgt
tctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtct
acgtcccgtcagcgctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtccccttctccgtctgccg
ttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcactt
cgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|KF922438_P_P-E Feature FT:CDS KF922438_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PO04v1). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacccgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcatttgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcaaatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgcagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaagaacacatcagattgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctatatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatatatgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatagggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccctctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|KF922439_P_P-E Feature FT:CDS KF922439_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PO04v2). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttccccatgttagtattccttggactc
acaaggtgggaaattttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacccgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcatttgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcaaatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgcagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaagaacacatcagattgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctatatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatatatgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatagggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccctctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|KM606738_P_P-E Feature FT:CDS KM606738_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Cuba27a). Non-functional genomic sequence. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttattcttctactatacctgtctttaatcctaattggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaaattagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacccgtagcgcctcattttgtgggtcaccttattcttgggaacacgagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agctttcgggcctgggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcttccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgaattt
tcctgctggtggctccagttccggaacagtgaaccatgttccgactactgtctcactcatctcgtcaatcttctcgagga
ttggggaccttgcaccgaacatggaaagcattacatcaggattcctaggacccctgctcgtgttacaggcgggatttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggaagctcccgt
gtgtcttggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcgaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgtgaccaattttcttttgtctttgggtatacatataaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggtagttgggggtcattaccacaagaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcccattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatatatgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatacggcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|KM606739_P_P-E Feature FT:CDS KM606739_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Cuba32a). Non-functional genomic sequence. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccatagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgagcaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagtgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgcaaacaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatct
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcgtctcgagga
ttggggaccttgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgtaaccaattttcttttgtctttgggcatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattgccacaggaacacatcagaatgaaaa
tcaaggactgttttagaaaactcccagttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccatgggccatcagcgcatgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacgga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccctt
ctccgtctgccgttccaaccgtccacggggcgcacctctctttacgcggtctccccgtctgtgcctactcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|KT192626_P_P-E Feature FT:CDS KT192626_P_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttccccatgttagtattccttggactc
acaaggtgggaaattttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacccgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcatttgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcaaatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaagaacacatcagattgaaaa
tcaaagactgttttagaaaactccctgttaatcggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctatatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatatatgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
caattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccctctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|KT749841_P_P-E Feature FT:CDS KT749841_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate FL11). Non-functional genomic sequence. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccttcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagacaatgtagttaatcattacttccaaactagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacccgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagcaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgcaaaaaacat
tgccagcagatccgcctactgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatct
tcctgctggtggctccagttccggaacagtgaaccctgttccgaatactgcctctctcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcgtggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtatgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgtaaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggctattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcaaaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgactggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtcaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggct
ccgctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtttacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|KU736891_P_P-E Feature FT:CDS KU736891_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Egypt_1). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccgtggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaccaaatgtgaacaatttgtaggtccactaacagtaaatgaaaaacgaagatt
aaaattagtcatgcctgctagattttttcccatctctacgaaatattggcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggtatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggcctgggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacatttcaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgtcgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttggggatcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtactcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccattggccatcagcgcmtgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctctcggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgtccacggggcgcacctctctttacgcggtctccccgtctgtaccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|KU736892_P_P-E Feature FT:CDS KU736892_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Egypt_2). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccgtggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaccaaatgtgaacaatttgtaggtccactaacagtaaatgaaaaacgaagatt
aaaattagtcatgcctgctagattttttcccatctctacgaaatattggcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggtatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggcctgggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacatttcaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccytgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgtcgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttggggatcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtactcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccattggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctctcggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgtccacggggcgcacctctctttacgcggtctccccgtctgtaccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|KU736893_P_P-E Feature FT:CDS KU736893_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Ethiopia_3). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacraagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattgacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggcctgggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctgacaacat
tgccagcaaatccgcctcctgcttccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgtcgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttggggatcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggacgga
taattctgtcgttctctctcggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtaccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|KU736894_P_P-E Feature FT:CDS KU736894_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Liberia_1). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaagacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaatttagtcatgcctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatatttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttgaatcctaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaagacctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctat
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacgga
taattctgtcgtcctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccatctcggggtcgcttgggggtctctcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|KU736895_P_P-E Feature FT:CDS KU736895_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Liberia_2). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactctactactatacctgtctttaatcctcactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaaaaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtattacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaacttcatgggttatgtaattggaagttgggggtcattaccacaggaccacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaatcggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttttgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggcg
cctctgccgatccatacggcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctttcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|KU736896_P_P-E Feature FT:CDS KU736896_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Liberia_3). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactctactactatacctgtctttaatcctcactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaaaaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtattacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctatacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaacttcatgggttatgtaattggaagttgggggtcattaccacaggaccacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaatcggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttttgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggcg
cctctgccgatccatacggcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctttcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|KU736897_P_P-E Feature FT:CDS KU736897_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Liberia_4). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactctactactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaatttagtcatgcctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatc
ctgataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaaaaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcgttc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctgaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaaactctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaacttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcaaaatgaaaa
tcaaagactgttttagaaaactccctgttaatcggcctattgattggaaagtgtgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttttgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatccttcgaggga
cgtcctttgtcttcgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|KU736898_P_P-E Feature FT:CDS KU736898_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Liberia_5). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactctactactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaatttagtcatgcctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatc
ctgataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaaaaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcgttc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctgaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaaactctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaacttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcaaaatgaaaa
tcaaagactgttttagaaaactccctgttaatcggcctattgattggaaagtgtgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttttgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatccttcgaggga
cgtcctttgtcttcgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|KU736899_P_P-E Feature FT:CDS KU736899_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Liberia_6). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagttatgcctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcaaatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagtttcggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacgaaaag
atggggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtatgcgtgtattcaatcaaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaccttatcggaacrga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|KU736900_P_P-E Feature FT:CDS KU736900_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Somalia_2). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccgtggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgcgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttccccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctctggaaggcgggcatcttatataaaaga
gaaactacacatagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggcctgggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttggggatcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccccgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttattgggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtaccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|KU736901_P_P-E Feature FT:CDS KU736901_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_1). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctcttacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatatctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttgcataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacag
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccagcaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgccttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgacact
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagattaaaaa
tcaaagattgttttagaaaactccctgtcaaccgacctattgattggaaagtatgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccatgggccatcagcgcctgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcgaaacttatcgggactga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|KU736902_P_P-E Feature FT:CDS KU736902_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_12). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
ataaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggatattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacaaaatatttgcccctggagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggatcacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggcctgggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggttatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattcccttaatttcatgggttatgtaattggaagttggggatcattaccacaggaacacatcaaaatgaaaa
tcaaagactgtttcagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcacggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtttacgtcccgtcagcgctgaatcctgcggacgacccatctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtaccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|KU736903_P_P-E Feature FT:CDS KU736903_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_13). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagttatgcctgctagattttttcccatctctacgaaatatttgcccctggagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggcctgggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaattactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggttatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttggggatcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagacttgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtactcaatccaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcacggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|KU736904_P_P-E Feature FT:CDS KU736904_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_16). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagaactcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaattctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctggagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcttcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggcctgggttcactcccccacacggaggccttctggggtggagccctcaggctcaaggcatgcaaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttggggatcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaamgaattgtaggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatccaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcacggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctrtcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggg
ccgtgtgcacttcgcttcacctctgcacgtcgcatggaraccaccgtga
>gnl|hbvcds|KU736905_P_P-E Feature FT:CDS KU736905_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_17). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaagggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggcctgggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctgaatttcatgggttatgtaattggaagttggggatcattaccacaggatcacatcagaatgaaaa
tcaaagattgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacgcaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgt
gccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcttagcagcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcacggaaatatacatcatttccatggctgctaggctgtgctgccaattggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|KU736906_P_P-E Feature FT:CDS KU736906_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_2). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctactaaatatttgcccctagagaagggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggcctgggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcgrcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctgaatttcatgggttatgtaattggaagttggggatcattaccacaggaacacatcagaatgaaaa
tcaaagattgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgt
gccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcaacgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcttagcagcttgttttgctcgcagcaggtctggagcaaaacttatcgggacaga
taattctgtcgttctctcacggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|KU736907_P_P-E Feature FT:CDS KU736907_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_3). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctactaaatatttgcccctagagaagggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggcctgggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctgaatttcatgggttatgtaattggaagttggggatcattaccacaggaacacatcagaatgaaaa
tcaaagattgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgt
gccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcaacgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcttagcagcttgttttgctcgcagcaggtctggagcaaaacttatcgggacaga
taattctgtcgttctctcacggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|KU736908_P_P-E Feature FT:CDS KU736908_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_5). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctactaaatatttgcccctagagaagggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggcctgggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctgaatttcatgggttatgtaattggaagttggggatcattaccacaggaacacatcagaatgaaaa
tcaaagattgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgt
gccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcaacgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcttagcagcttgttttgctcgcagcaggtctggagcaaaacttatcgggacaga
taattctgtcgttctctcacggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|KU736909_P_P-E Feature FT:CDS KU736909_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_6). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctggagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggcctgggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaacaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccytgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttggggatcmttaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtactcaatccaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcacggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|KU736910_P_P-E Feature FT:CDS KU736910_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_8). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaagggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacatactctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcgtggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggcctgggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctgaatttcatgggttatgtaattggaagttggggatcattaccacaggaacacatcagaatgaaaa
tcaaagattgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtacgcgtgtactcactctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgt
gccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcttagcagcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcacggaaatatacctcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|KU736911_P_P-E Feature FT:CDS KU736911_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_9). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaagggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacatactctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcgtggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggcctgggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaagaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggcsaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctgaatttcatgggttatgtaattggaagttggggatcattaccacaggaacacatcagaatgaaaa
tcaaagattgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtacgcgtgtactcactctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgt
gccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcttagcagcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcacggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|KU736912_P_P-E Feature FT:CDS KU736912_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_4). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctactaaatatttgcccctagagaagggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggcctgggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttyagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctgaatttcatgggttatgtaattggaagttggggatcattaccacaggaacacatcagaatgaaaa
tcaaagattgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgt
gccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcaacgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcttagcagcttgttttgctcgcagcaggtctggagcaaaacttatcgggacaga
taattctgtcgttctctcacggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|KU736913_P_P-E Feature FT:CDS KU736913_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_7). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccamtgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaaagaagatt
aaacttagtcatgcctgctagattttttcccatctctacaaaatatttgcccctagagaagggtataaaaccttattatc
cagataatgtagttaatcattacttccaaacaagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatgggcctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaycagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggcctgggttcactccmccacacggaggccttttggggtggagtcctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcacgccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatat
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcgtggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctyagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgcacaa
caccttgagtccctttatacttctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctgaatttcatgggttatgtaattggaagttggggatcattaccacaggaacacatcagaatgaaaa
tcaaagattgtttcagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtactcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgt
gccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggacgga
taattctgtcgtyctctcacggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|KX186584_P_P-E Feature FT:CDS KX186584_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Eafr). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|LT623842_P_P-E Feature FT:CDS LT623842_P_P-E of [Viruses] Hepatitis B Virus genotype E. Non-functional genomic sequence. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacwcttccggagamtactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttccaaatgttagyattccttggactc
acaaggtgggaaattttacrgggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgccccyagasaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctttggsaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggacaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcgrcagtcaggraggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccayaacattccaccaagctctgcaggatcccagagtaagaggcctgtatct
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcarttttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgttwccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgaggccctttatacctctgtgaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctacatttcatgggttatgtaattggaagttggggatcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtgggtatcctgctttaatgcctctgtatgcgtgtattcaatccaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgcggatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctacgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccrgccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|LT623843_P_P-E Feature FT:CDS LT623843_P_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccakgacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctttggaaggsgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttathcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccwccaatccgctgggaktttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccattggacagaagccaacaaggtaggagtggg
agcatttgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcaratccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggtcatgcartggaattccacaacattccgccaagctctgcaggatcccagagtaagarrcctgwatcy
tcytgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccttgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtattacaggaggggtttttc
tygttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcgtggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtcctcmaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactyt
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggcatacatttaaatcccaacaaaacaaaaag
atggggatattccctacacttcatgggttatataattggaagttgggggtcattaccacaagaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctatatgcgtgtattcaatctaagcaggctttcac
tttttcgccaacttacaaggcctttctgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
ccgctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacgga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtactgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgtttgggggtctmtcgtcccctt
ctccgtctgccgttccagccgtccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|LT623844_P_P-E Feature FT:CDS LT623844_P_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcratcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
aatattcatctgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagttatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggcataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagcgctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggcctgggktcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctacaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccacaaagctctgcaggatcccagagtaagaggcctgtatct
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccytgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggmggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctamttccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccattgtctggctttcagttatatggatgatgtggtattgggggccaagwctgtacaa
catcttgagtccctttatacctctgtkaccaattttcttttgtctttgggtatacatttaaatcccaccaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatccgaatgaaaa
tcaaagactgttttagaaaactccctgttaataggcctattgattggaaggtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgcgtrcacaatacatgaccctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacgga
taattctgtcgttctctcccggaaatatacatcrtttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatccagcggacgacccgtctcggggtcgcttgggggtctatcgtcccctt
ctccgtctgctgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcgtctgccggt
ccgtgtgcacttcgcttcacctctgcacgtcgcatggaraccaccgtga
>gnl|hbvcds|LT623845_P_P-E Feature FT:CDS LT623845_P_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgargaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtacatgaaaaacgaagatt
aaatttagtcatgcctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaacaacat
tgccagcaaatccgcctcctgcctccaccaatcggcagtcaggaaggcagccwaccccaatcactccacctttgagagac
actcatcctcaggccatgcartggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatta
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcarttttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccratttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgmtatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctacatttcatgggttacgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaggactgttttagaaaactccctgttaaccgacctattgattggaaagtmtgtcaaagaattgtgggtcttttgggc
tttgctgccccctttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttayaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccwggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctrcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|LT623846_P_P-E Feature FT:CDS LT623846_P_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcacctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctagctggaaaactccatcttttcct
aatattcatttacaccaggacattattaacaaatgtgaacaattcgtaggtccgctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagacaatgtagttaatcattacttccaaacaagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattctgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggtcagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccttaaattttatgggttatgtaattggaagttgggggtcattgccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcgt
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaccttatcgggacgga
taattctgtcgttctctcccggaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcggcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctttcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggt
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|LT623847_P_P-E Feature FT:CDS LT623847_P_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gaaattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagaccaggtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatatagaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaaaaatcattccaccaccaatcctctgggattctttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccamtcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcartggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatct
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccttgcaccgaacatggaaaacatyacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatmttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacgcaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctattaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcmttaccacaggaacacatcagaatgaaaa
tcaaagaytgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaacgaattgtgggtctgttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcctgcgcggagcctttgtgact
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacgga
taattctgtcgttctctcccggaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctacgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccatctcggggtcgcttggggatctctcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcayctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|LT623848_P_P-E Feature FT:CDS LT623848_P_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagacgatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccwtcctttcct
gatattcatttgcatcaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagacaatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcktggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccaytgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttgatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacctacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccacgggctggggcttggctataggccatcagcgcatgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggaccga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|LT623849_P_P-E Feature FT:CDS LT623849_P_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagamtactgttgttagacgaagaggcaggtcccctagaagaagaactccctcs
cctcscagacgaagatctcaatcgccgcgtcscagaagatctcaatctccascttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gmtattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttaccactagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataagaga
gaaaccacgcgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcgttc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
tgcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacwg
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcktggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
camggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccaytgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
caycttgagtccctttatacctctgtkaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttacgtaattggaagttgggggtcattaccacaggaacacatcacactgaaaa
tcaaagactgttttagaaacctccctgttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggctatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccgcaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccatctcggggtcgcttggggatctatcgtccccta
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|LT623850_P_P-E Feature FT:CDS LT623850_P_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctcactggaaacctccatcttttcct
gatattcatttgcaccaggaccttattaacaaatgtgaacaatttgtaggtcctctgacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccttatggaaggcgggcattttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagaataagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaggcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtctcttgggc
tttgctgcccctttcacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgrgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatacgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatactgcgcggga
cgtcctttgyctacgtcccgtcagcgctgaatcccgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|LT623851_P_P-E Feature FT:CDS LT623851_P_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgamgaggcaggwcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggatttactcttctactatacctacctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacatcattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaarttartcrtgcctgctagattttttcccatctctacgaaatatctgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatgggaggcgggtatcttatataaaaga
gaaactacacgtagcgcctcattttrtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcaktccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
cgagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctraaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcargccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatatcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagaatctagactcgtggtggacttctctcagttttctaggggaagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctttcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcwtgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgctatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggcgccaggtctgtgcaa
caccttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttggggatcattaccgcaagaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtctgtcaacgaatcgtgggtcttttgggc
tttgctgccccttttacgcaatgtggatatcctgctttaatgcctctgtatgcrtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgygtaaacaatacttgaacctttaccccgttgctcggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaacattatcgggacgga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcrgcactgaatcctgcggacgacccgtcccggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgwccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcayctgccgga
ccgtgtgcacttcgcttcacctctgtacgtcgcatggagaccaccgtga
>gnl|hbvcds|MF772354_P_P-E Feature FT:CDS MF772354_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 1067). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacccgtagcgcctcattttgtgggtcaccttattcttgggaacacgagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcatttgggccggggttcacacccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaacttcatgggttatgtgattggtagttgggggtcattaccacaagaccacatcagattgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctatatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatatatgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatagggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtcccctt
ctccgtctgccgttccaaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|MF772355_P_P-E Feature FT:CDS MF772355_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 488). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttcctgaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttattcttcttctatacctgtctttaatcctaactggaaaactccttcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtcaatgaaaaaagaagatt
aaaattagtcatgcctgctagattttttcccatctctacgaagtatttgcccctagagaagggtataaaaccttattatc
cagataatgtagttaatcattacttccaaactagacactatttrcataccctatggaaggcgggcatcttatataaaaga
gaaacttcccgtagcgcctcattttgtgggtcaccttactcttgggaacacgagatacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagccaacaccagaaatccagattgggaccacaatcccaacaaagatcactggacagaagccaacaaggtaggagtggg
agcatttgggccggggttcactccaccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacct
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcccaccccaatcacgccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccaaagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaamcctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccttgtaccgaacatggagagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgttgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggcaaaatctgtacaa
catcttgaggccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaagag
atggggatattccctaaatttcatgggttatgtaattggtagttggggatcattaccgcaagaacacatcagattgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtgtgtcaacgaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatttcctgctttaatgcctctatatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggcctggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatctgcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatagggactga
taattcggtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctacgaggga
cgtcctttgtttacgtcccgtcagcgctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|MF772356_P_P-E Feature FT:CDS MF772356_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 1834). Non-functional genomic sequence. [Hepadnaviridae] (length=2517 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccatcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaagcgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cggaaaatgtagttaatcattacttccaaaccagacactatttacataccctttggaaggcgggcatcttatataagaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccactaccaatcctttgggagtttttcccgaccaccagttggatccagcattc
agagcaaacaccagcaatccagattgggatcacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggcctgggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgttaaaaacat
tgccagcagatccgccgcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgagatggaatgccacaacattccaccaagctctgcaggatcccaaagtaagtcctgctggtgg
ctccagttccggaacagtaaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccatg
caccgaacatggaaagcatcacatcaggattcccagaacccctgcgcgtgttacaggcggggttttccttgttgacaaaa
atcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggaagctcccgtgtgtcgtggcca
aaattcgcagttcccaatctccaatcactcaccaacctcttgtcctccgatttgtcctggctatcgttggatgtgtctgc
ggcgttttatcatctccctcttcatcctgctgctatgcctcatcttctggttggttcttctggactatcaaagtatcttg
cccgtttgtcctctaattccaggatcctcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaac
ctctatgttnccctcatgttgctgttcaaaaccttcggaaggaaattgcacttgtattcccatcccatcatcatgggctt
tcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcc
gggctttcccccactgtctggcttttagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtcc
ctttataccgctgtaactaattttcttttgtctttgggcatacatttaaatcccaacaaaaccaaaagatggggatattc
cctaaatttcatgggttatgtaattggaagttgggggtcattaccccaggaacacatcagaatgaaaatcaaggactgtt
ttagaaaactccctgttaatcggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcccct
tttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaac
ttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttg
ctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacctttatggctcctctgccgatc
cataccgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactgataattctgtcgt
tctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtct
acgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtccccttctccgtctgccg
ttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcactt
cgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|MF772357_P_P-E Feature FT:CDS MF772357_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 222). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatccacacttccggaaactactgttattagacgaagagtcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccgatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttccactatacctatctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgagcaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccagctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagacaacgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatgggactttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctctaccaatcggcagtcaaaaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccttgcatcgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagttcccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcc
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggcaaagtctgcgcaa
catcttgagtccatttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaggactgttttagaaaactcccagttaatcggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaataccaggacctttaccccgttgcccggcaacggcccggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcgtgcgcggaacctttgtggct
cctttgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacgga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggttgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|MF772358_P_P-E Feature FT:CDS MF772358_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 2255). Non-functional genomic sequence. [Hepadnaviridae] (length=2517 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggccccctagaggaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaagggtataaaaccttattatc
cagacaatgtagttaatcattacttccaaaccagacactatttacataccctttggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctttgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggcctgggctcactcccccacacggaggtcttttggggtggagccctcaggctcaaggcatgttaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcacgccacctttgagagac
acccatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagtcctgctggtgg
ctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaagattggggtccctg
caccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaa
atcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggcca
aaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgc
ggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttg
cccgtttgtcctctgattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaac
ctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccgtcatcatgggctt
tcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcc
gggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaggtctgttcaacatcttgaagcc
ctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaaggtggggatattc
cctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaccacatcaggatgaaaatcaaagactgtt
ttagaaaactccctgttaaccggcctattgattggaaagtatgccaacgaattgtgggtcttttgggctttgctgcccct
tttacacaatgtggctatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaac
ttacaaggcctttctgtgtaaacaatacctgaccctttaccccgttgcccggcaacggccagggctgtgccaagtgtttg
ctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggcgcctttgtggctcctctgccgatc
catactgcggaactcctagctgcttgttttgctcgcagcnggtctggagcgaaacttatcgggactgataattctgtcgt
tctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtct
acgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccg
ttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcactt
cgcttcacctctgcacgtcgcatggaggccaccgtga
>gnl|hbvcds|MF772360_P_P-E Feature FT:CDS MF772360_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 666). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
ataaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgtagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagacaatgtggttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagtgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtatct
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgtcgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattgccacaggaacacatcagaatgaaaa
tcaaggactgttttagaaaactcccagttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccatgggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgtttcgctcgcagcaggtctggagcgaaacttatcgggacgga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccctt
ctccgtctgccgttccaaccgtccacggggcgcacctctctttacgcggtctccccgtctgtgcctactcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|MF772362_P_P-E Feature FT:CDS MF772362_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 960). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gacattcatttgcaccaggacatcattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagacaatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctttgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggcctgggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgttaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaggactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaccctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcctctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtaccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|MH464855_P_P-E Feature FT:CDS MH464855_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate MA133). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagagnnnnnngcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattcctt
ggactcacaaggtgggaaattttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatct
tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacg
aagattaaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaacctt
attatccagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatat
aaaagagaaactacccgtagcgcctcattttgcgggtcaccttattcttgggaacacgagctacatcatggggctttctt
ggacggtccctctcgaatgnnnggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggat
ccagcattcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggt
aggagtgggagcatttgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgc
taaaaacattgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacct
ttgagagacactcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagagg
cctgtattttcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatct
tctcgaggattggggaccctgcaccgaacatggaaggcatcacatcaggattcctaggacccctgctcgtattacaggcg
gggtttttcttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
agctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctg
gctatcgctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttctt
ctggactatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctg
cacgactcttgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattc
ccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtg
ccatttgttcagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaa
aacaaaaagatggggatattccctaaatttcatgggttatgtaattggtagttgggggtcattaccacaagaacacatca
gattgaaaatcaaagactgttttagaaaactccctgttaatcggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgccccttttacacaatgtggatatcctgctttaatgcctctatatgcgtgtattcaatctaagca
ggctttcactttctcgccaacttacaaggcctttctgtgtaaacaatacatgaacctttaccccgttgcacggcaacggc
caggtctgtgccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttat
cgggacagataattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcc
tgcgagggacgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccctctcggggtcgcttgggggtctgt
cgtccccttctccgtctgccgttccagccgacgacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|MH464856_P_P-E Feature FT:CDS MH464856_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate MA134). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagagnnnnnngcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattcctt
ggactcacaaggtgggaaattttacggggctctattcttctactatacctgtctttaatcctaactggaaaactccatct
tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacg
aagattaaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaagggtataaaacctt
attatccagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatat
aaaagagaaactacccgtagcgcctcattttgtgggtcaccttattcttgggaacacgagctacatcatggggctttcgt
ggacggtccctctcgaatgnnnggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggat
ccagcattcagagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggt
aggagtgggagcatttgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgc
taaaaaccttgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacct
ttgagagacactcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagagg
cctgtattttcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatct
tctcgaggattggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgcgttacaggcg
gggtttttcttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
agctcccgtgtgtcttggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctg
gctatcgctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttctt
ctggactctcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacatg
cacgactcttgctcaaggaacctctttgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattc
ccatcccatcatcatgggctttcggaaaattcctatgggtgtgggcctcagcccgtttctcctggctcagtttactagtg
ccatttgttcagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttatacttctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaa
aacaaaaagatggggatattccctaaatttcatgggttatgtaattggtagttgggggtcattaccacaagaacatatca
gattgaaaatcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtgtgtcaaagaattgtgggt
cttttgggctttgctgccccttttacacaatgtggatatcctgctttaatgcctctatatgcgtgtattcaatctaagca
ggctttcactttctcgccaacttacaaggcctttctgtgtaaacaatatatgaacctttaccccgttgcccggcaacggc
caggtctgtgccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctaccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttat
agggacggataattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcc
tgcgagggacgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccctctcggggtcgcttgggggtctat
cgtccccttctccgtctgccgttccagccgtccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
cctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|MH580614_P_P-E Feature FT:CDS MH580614_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 177). Non-functional genomic sequence. [Hepadnaviridae] (length=2526 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtggttaatcattacttccaaaccagacactatttacataccctatggaaggcgggtatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccaacagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacagcattccaccaagctctgcaggatcccagagtaagaggcctgtatcc
tgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattg
gggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttg
ttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtg
tcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctgga
tgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaa
ggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgc
tcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcat
catgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcag
tggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacat
cttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatg
gggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagattaaaaatca
aagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggcttt
gctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtactcaatctaagcaggctttcacttt
ctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgcc
aagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcct
ctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcggaactgataa
ttctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgt
cctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctgtcgtccccttctc
cgactgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccg
tgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|MH580615_P_P-E Feature FT:CDS MH580615_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 188). Non-functional genomic sequence. [Hepadnaviridae] (length=2526 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtggttaatcattacttccaaaccagacactatttacataccctatggaaggcgggtatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccaacagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacagcattccaccaagctctgcaggatcccagagtaagaggcctgtatcc
tgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattg
gggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttg
ttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtg
tcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctgga
tgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaa
ggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgc
tcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcat
catgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcag
tggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacat
cttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatg
gggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagattaaaaatca
aagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggcttt
gctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtactcaatctaagcaggctttcacttt
ctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgcc
aagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcct
ctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcggaactgataa
ttctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgt
cctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctgtcgtccccttctc
cgactgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccg
tgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|MH580616_P_P-E Feature FT:CDS MH580616_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 190). Non-functional genomic sequence. [Hepadnaviridae] (length=2526 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtggttaatcattacttccaaaccagacactatttacataccctatggaaggcgggtatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccaacagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacagcattccaccaagctctgcaggatcccagagtaagaggcctgtatcc
tgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattg
gggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttg
ttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtg
tcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctgga
tgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaa
ggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgc
tcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcat
catgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcag
tggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacat
cttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatg
gggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagattaaaaatca
aagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggcttt
gctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtactcaatctaagcaggctttcacttt
ctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgcc
aagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcct
ctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcggaactgataa
ttctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgt
cctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctgtcgtccccttctc
cgactgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccg
tgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|MH580617_P_P-E Feature FT:CDS MH580617_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 193). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaacaccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagttaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacag
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgtctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggctatgtaattggaagttgggggtcattaccacaagaacacatcagattgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtactcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcggcgctgaatcctgcggacgacccatctcggggtcgcttggggatttatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggt
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|MH580618_P_P-E Feature FT:CDS MH580618_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 199). Non-functional genomic sequence. [Hepadnaviridae] (length=2526 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtggttaatcattacttccaaaccagacactatttacataccctatggaaggcgggtatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccaacagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacagcattccaccaagctctgcaggatcccagagtaagaggcctgtatcc
tgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattg
gggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttg
ttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtg
tcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctgga
tgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaa
ggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgc
tcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcat
catgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcag
tggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacat
cttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatg
gggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagattaaaaatca
aagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggcttt
gctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtactcaatctaagcaggctttcacttt
ctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgcc
aagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcct
ctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcggaactgataa
ttctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgt
cctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctgtcgtccccttctc
cgactgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccg
tgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|MH580619_P_P-E Feature FT:CDS MH580619_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 200). Non-functional genomic sequence. [Hepadnaviridae] (length=2526 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtggttaatcattacttccaaaccagacactatttacataccctatggaaggcgggtatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccaacagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacagcattccaccaagctctgcaggatcccagagtaagaggcctgtatcc
tgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattg
gggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttg
ttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtg
tcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctgga
tgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaa
ggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgc
tcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcat
catgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcag
tggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacat
cttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatg
gggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagattaaaaatca
aagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggcttt
gctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtactcaatctaagcaggctttcacttt
ctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgcc
aagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcct
ctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcggaactgataa
ttctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgt
cctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctgtcgtccccttctc
cgactgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccg
tgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|MH580620_P_P-E Feature FT:CDS MH580620_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 201). Non-functional genomic sequence. [Hepadnaviridae] (length=2526 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtggttaatcattacttccaaaccagacactatttacataccctatggaaggcgggtatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccaacagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacagcattccaccaagctctgcaggatcccagagtaagaggcctgtatcc
tgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattg
gggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttg
ttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtg
tcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctgga
tgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaa
ggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgc
tcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcat
catgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcag
tggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacat
cttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatg
gggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagattaaaaatca
aagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggcttt
gctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtactcaatctaagcaggctttcacttt
ctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgcc
aagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcct
ctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcggaactgataa
ttctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgt
cctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctgtcgtccccttctc
cgactgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccg
tgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|MH580621_P_P-E Feature FT:CDS MH580621_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 209). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagttatgcctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagg
gaaacgacacgtagcgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagccttc
agagcaaacaccaaaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaatgt
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaataactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatctaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcaaaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagacttgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcaaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaacttatcgggacaga
taattccgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|MH580622_P_P-E Feature FT:CDS MH580622_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 210). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagttatgcctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagg
gaaacgacacgtagcgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagccttc
agagcaaacaccaaaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaatgt
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatctaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcaaaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagacttgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcaaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaacttatcgggacaga
taattccgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|MH580623_P_P-E Feature FT:CDS MH580623_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 232). Non-functional genomic sequence. [Hepadnaviridae] (length=2526 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtggttaatcattacttccaaaccagacactatttacataccctatggaaggcgggtatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccaacagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacagcattccaccaagctctgcaggatcccagagtaagaggcctgtatcc
tgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattg
gggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttg
ttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtg
tcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctgga
tgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaa
ggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgc
tcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcat
catgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcag
tggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacat
cttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatg
gggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagattaaaaatca
aagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggcttt
gctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtactcaatctaagcaggctttcacttt
ctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgcc
aagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcct
ctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcggaactgataa
ttctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgt
cctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctgtcgtccccttctc
cgactgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccg
tgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|MH580624_P_P-E Feature FT:CDS MH580624_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 226). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactacacctatctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaataaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttaccgctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagg
gaaacgacacgtagcgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccccacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaatgt
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatctaaatcccaacaaaacaaaacg
atggggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcaaaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaagctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcctggggatctatcgtcccctt
ctccgtctgccgttccagccgtccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|MH580625_P_P-E Feature FT:CDS MH580625_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 239). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagttatgcctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagg
gaaacgacacgtagcgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagccttc
agagcaaacaccaaaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaatgt
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaataactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatctaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcaaaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagacttgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcaaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaacttatcgggacaga
taattccgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|MH580626_P_P-E Feature FT:CDS MH580626_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 240). Non-functional genomic sequence. [Hepadnaviridae] (length=2517 residues).
atgcccctatcttatcaacacttccggagacttctgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccgtattatc
cagataatgtagttaatcattacttccaaaccagacactatttacatactctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagcactcaggctcaaggcatgctaacaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
acccatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccaaagtaaatcctgctggtgg
ctccagtttcggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccttg
caccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaa
atcctcacaataccgaagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcttggcca
aaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgc
ggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttg
cccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgctcaaggaac
ctctatgtttccctcatgttgctgtttaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctt
tcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcc
gggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggcaaagtctgtacaacatcttgagtcc
ctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatggggatattc
cctaaatttcatgggttatgtaattggaagttttgggtcattaccacaggaacacatcagattaaaaatcaaagactgtt
ttagaaaactccctgttaatcggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcccct
tttacacaatgcggatatcctgctttaatgccgctgtatgcgtgtattcaatctaagcaggctttcactttctcgccaac
ttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttg
ctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatc
catactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactgataattctgtcgt
tctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtct
acgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccttctccgtctgccg
ttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcactt
cgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|MH580628_P_P-E Feature FT:CDS MH580628_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 304). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaacaccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagttaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacaaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacag
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgtctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggctatgtaattggaagttgggggtcattaccacaagaacacatcagattgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtactcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcggcgctgaatcctgcggacgacccatctcggggtcgcttggggatttatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggt
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|MH580629_P_P-E Feature FT:CDS MH580629_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 306). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctatctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaataaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttaccgctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagg
gaaacgacacgtagcgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccccacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaatgt
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgacttctgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatctaaatcccaacaaaacaaaacg
atggggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcaaaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaagctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcctggggatctatcgtcccctt
ctccgtctgccgttccagccgtccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|MH580630_P_P-E Feature FT:CDS MH580630_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 310). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggcaattttacggggctttactcttctactattcctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattatcaacaaatgtgaacaatttgtaggtcctttaacagtaaatgaaaaacgaaggtt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagacctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaaactctgcaagatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcgccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaatcctaacaaaacaaaaag
atggggatattccttaaatttcatgggttatgtaattggaagttggggatcattaccacaggaacacatcagattgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatacgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggtcaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgaacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|MH580631_P_P-E Feature FT:CDS MH580631_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 333). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggccctctaacagtaaatgaaaaaagacgatt
aaacttagtcatgcctgctagattttttcccatctctacaaaatatttacccctagagaagggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagg
gaaactacacgtagcgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctagaatgggggaagaattattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccaaaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacgt
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaattccaacaaaacaaaaag
atggggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggt
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtcaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaaccctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcgtctgccggt
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|MH580632_P_P-E Feature FT:CDS MH580632_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 334). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggccctctaacagtaaatgaaaaaagacgatt
aaacttagtcatgcctgctagattttttcccatctctacaaaatatttacccctagagaagggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagg
gaaactacacgtagcgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctagaatgggggaagaattattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccaaaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacgt
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaattccaacaaaacaaaaag
atggggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggt
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtcaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaaccctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcgtctgccggt
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|MH580633_P_P-E Feature FT:CDS MH580633_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 398). Non-functional genomic sequence. [Hepadnaviridae] (length=2514 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactttacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaacgacacgtagcgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacgt
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaactgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggggaccctgcac
ggaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtgtcgtggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatctgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactattgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcg
gaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatctaaatcccaacaaaacaaaaagatggggatattccct
aaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcaaaatgaaaatcaaagactgtttta
gaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcccctttt
acacaatgtggatatcctgctttaatgcctctgtatacgtgtattcaatataagcaggctttcactttctcgccaactta
caaggcctttctgtgtcaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctg
atgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccat
actgcggaactcctagccgcttgttttgctcgcagccggtctggagcaacacttatcgggacagataattctgtcgttct
ctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacg
tcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtccccttctccgtctgccgttc
cagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgc
ttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|MH580634_P_P-E Feature FT:CDS MH580634_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 400). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactttacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaacgacacgtagcgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaatgt
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcacggaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatctgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatctaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcaaaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatacgtgtattcaatataagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtatttgctgatgcaacccccactggttggggcttggccataggccatcagcgcgtgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaacacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|MH580635_P_P-E Feature FT:CDS MH580635_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 401). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactttacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaacgacacgtagcgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaatgt
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcacggaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatctgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatctaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcaaaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatacgtgtattcaatataagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtatttgctgatgcaacccccactggttggggcttggccataggccatcagcgcgtgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaacacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|MH580636_P_P-E Feature FT:CDS MH580636_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 402). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactttacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaacgacacgtagcgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaatgt
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcacggaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatctgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatctaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcaaaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatacgtgtattcaatataagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtatttgctgatgcaacccccactggttggggcttggccataggccatcagcgcgtgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaacacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|MH580637_P_P-E Feature FT:CDS MH580637_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 408). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagttatgcctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagg
gaaacgacacgtagcgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagccttc
agagcaaacaccaaaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaatgt
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatctaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcaaaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagacttgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcaaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaacttatcgggacaga
taattccgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|MH580638_P_P-E Feature FT:CDS MH580638_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 416). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattcacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagttatgcctgctagattttttcccatctctacgaaatatttacccctggagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagg
gaaactacacgtagcgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
cgagcaaacacccgaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggtttactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtcccaaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacaactcc
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacaattaaatgccaacaaaacaaaaag
atggggatattcactaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaataccagtacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|MH580640_P_P-E Feature FT:CDS MH580640_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 438). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagctgcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtccgctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtatcaaaccttattatc
cagataatgtagttaatcattacttccaaacccgacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattctaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
acgcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtctttaccacaggaacacatcaaattgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttattgggactga
taattctgttgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttagggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|MH580641_P_P-E Feature FT:CDS MH580641_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 439). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagctgcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtccgctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtatcaaaccttattatc
cagataatgtagttaatcattacttccaaacccgacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattctaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
acgcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtctttaccacaggaacacatcaaattgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttattgggactga
taattctgttgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttagggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|MH580644_P_P-E Feature FT:CDS MH580644_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 458). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaacaccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagttaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacag
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactctacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagcgaaccctgttccgactactgtctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggctatgtaattggaagttgggggtcattaccacaagaacacatcagattgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcggcgctgaatcctgcggacgacccgtctcggggtcgcttggggatttatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggt
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|MH580645_P_P-E Feature FT:CDS MH580645_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 472). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagactgctgttgttagatcaagaggcaggtcctctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagctccccgatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctgacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttacctctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcaggcatcttatataaaagg
gaaacgacacgtagcgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaacccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaatgt
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctgcaatcactcaccaacctcttgtcctccaacttgtcctggctttcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcccctaattccaagatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatctaaatcccaacaaaacaaaaag
gtggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcaaaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggataccctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaacacttatcgggactga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatccttcgcggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctgtcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggt
ccgtgtgcacttcgcgtcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|MH580646_P_P-E Feature FT:CDS MH580646_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 476). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctatctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaataaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagg
gaaacgacacgtagcgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccccacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaatgt
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatctaaatcccaacaaaacaaaacg
atggggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcaaaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaagctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcctggggatctatcgtcccctt
ctccgtctgccgttccagccgtccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|MH580647_P_P-E Feature FT:CDS MH580647_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 490). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaacgacacgtagcgcctcattttttgggtcaccttattcttgggaacaagagctacatcatgggactttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaatgt
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatctaaatcccaataaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcaaaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|MH580648_P_P-E Feature FT:CDS MH580648_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 522). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttcctgagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagacgatctcaatctccatcttcccaatgttagtattccgtggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttccc
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaaattagtcctgcctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagg
gaaacgacacgtagcgcctcattttttgggtcaccttattcttgggaacaagagctacatcatgggactttcttggacgg
ttcctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
aaagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacacaggccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaatgt
tgccagcagatcctcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctctggccgtgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgttgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatctaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttggggatcattaccacaggaacacattaaaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcatgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtcaacaataccggaacctttaccccgttgcccggcaacggcctggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagctcaacttatcgggactga
taattctgttgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|MH580649_P_P-E Feature FT:CDS MH580649_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 523). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctatctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaataaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttacccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagg
gaaacgacacgtagcgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccccacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaatgt
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatctaaatcccaacaaaacaaaacg
atggggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcaaaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaagctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcctggggatctatcgtcccctt
ctccgtctgccgttccagccgtccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|MH580650_P_P-E Feature FT:CDS MH580650_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 619). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttacaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacaaaatattttcccctagagaaaggtataaaaccttattatc
ccgataatgtagttaatcattactttcaaaccagacactatttacataccctttggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcaatcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcggtggaattccccaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttggggctcattaccacaagaacacatcagattgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctatatgcgtgtactcaatctaagcaggctttcac
tttttcgccaacttacaaggcttttctgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccatgggccatcagcgtatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcaacgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|MH580651_P_P-E Feature FT:CDS MH580651_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 623). Non-functional genomic sequence. [Hepadnaviridae] (length=2526 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtggttaatcattacttccaaaccagacactatttacataccctatggaaggcgggtatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccaacagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacagcattccaccaagctctgcaggatcccagagtaagaggcctgtatcc
tgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgaggattg
gggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttg
ttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgtgtg
tcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctgga
tgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaa
ggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactcttgc
tcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcat
catgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcag
tggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacat
cttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaagatg
gggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagattaaaaatca
aagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggcttt
gctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtactcaatctaagcaggctttcacttt
ctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgcc
aagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcct
ctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcggaactgataa
ttctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgt
cctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctgtcgtccccttctc
cgactgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccg
tgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|MH580652_P_P-E Feature FT:CDS MH580652_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 668). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggccctctaacagtaaatgaaaaaagacgatt
aaacttagtcatgcctgctagattttttcccatctctacaaaatatttacccctagagaagggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagg
gaaactacacgtagcgcctcattttttgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctagaatgggggaagaattattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccaaaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacgt
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaattccaacaaaacaaaaag
atggggatattccctacatttcatgggttatgtaattggaagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggt
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtcaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaaccctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcgtctgccggt
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|MH918655_P_P-E Feature FT:CDS MH918655_P_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaaccctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaaattagtcatgcctgctagattttttcccatctctactaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaagg
gagactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagatctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccacctccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccattggacagaagccaacaaggtaggagtggg
agcattcgggccggggtttactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggtctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggcagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaagactgttttagaaaacttcctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctatatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgcaaacaatacctgaacctttaccccgttgcccggcaacggcctggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcacggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcctggggatctatcgtcccctt
ctccgtctaccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|MK321264_P_P-E Feature FT:CDS MK321264_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 1332). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccattttttcct
gacattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaagggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggcctgggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaactaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttggggatcattaccacaggaacacattagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtactcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgntgcccggcaacggccaggtctnt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcacggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaancctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtaccttctcgtctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagacccccgtga
>gnl|hbvcds|MK720631_P_P-E Feature FT:CDS MK720631_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate p1332_RCA). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccattttttcct
gacattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaagggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggcctgggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaactaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttggggatcattaccacaggaacacattagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtactcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcacggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaaccctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtaccttctcgtctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagacccccgtga
>gnl|hbvcds|MK720632_P_P-E Feature FT:CDS MK720632_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate p1332_CL). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccattttttcct
gacattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaagggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacagaagccaacaaggtaggagtggg
agcattcgggcctgggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaactaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttggggatcattaccacaggaacacattagaatgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtactcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggacaga
taattctgtcgttctctcacggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaaccctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtaccttctcgtctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagacccccgtga
>gnl|hbvcds|MN507840_P_P-E Feature FT:CDS MN507840_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 3816_HBVe_GC). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgtagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccgatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcctctagagaaaggtataaaaccctattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggtatcttatataaaaga
gaaactgcacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttttcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctacttccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctctgtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcctaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgttattggtagttgggggtcattaccacaggaacacatcagaatgaaaa
tcaaggactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtctcttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaccctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgcggct
cctctgccgatccatactgcggaactcctggccgcttgttttgctcgcagcaggtctggagcgaaacttatcggaactga
taattctgtcgttctctcccggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccctt
ctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|MN507841_P_P-E Feature FT:CDS MN507841_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 7032_HBVe_GC). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggcctc
ataaggtgggaaattttacgggtctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaacgaagatt
aaaattagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatc
ccgataatgtagttaatcattacttccaaaccagacactatttacataccctgtggaaggcgggcatcttatataaaaga
gaaactacccgtagcgcctcattttgtgggtcaccttattcttgggaacacgagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccagcaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaaaaaacctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctttgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgccgaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcccttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttccgttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatattccctaaatttcatgggttatgtaattggaagttgggggtcattaccacaagaacacatcagatcgaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatacgtgtattcaatctaagcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatatatgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatagggacaga
taattctgtcgttctctcccggaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtcccctt
ctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|MN507842_P_P-E Feature FT:CDS MN507842_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 1048_ocHBVe_GC). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagacgaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcctctaacagtaaatgaaaaaagaagatt
aaacttagtcatgcctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaagccttattatc
cagataatctagttaatcattacttccaaaccagacactatttacacaccctatggaaggcgggcatcttatataaaaga
gaaactacacggtacgcctcattctgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccacctccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccaaaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaacat
tgccagcagatccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagac
actcatcctcaggccatgcagtggaattccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattt
tcctgctggtggctccagttccggaacagtgaaccctgttccgactactgcctcactcatctcgtcaatcttctcgagga
ttggggaccctgcaccgaacatggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctaatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagtacgggaccctgcagaacctgcacgactct
tgctcaaggaacctctatgtttccctcatgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccat
catcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
cagtggttcgccgggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaa
catcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaaaag
atggggatatcccctaaatttcatgggttatgtaattggaagttgggggtcattaccccaggaacacatcaaacaaaaaa
tcaaagactgttttagaaaactccctgttaaccggcctattgattggaaagtatgtcaaggaattgtgggtcttttgggc
tttgctgccccttttacacaatgtggatatcctgctttaatgcctctgtatgcatgcattcaatccgggcaggctttcac
tttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgt
gccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcctgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggacgga
taattctgtcgttctctctcggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgaggga
cgtcctttgtctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccctt
ctccgtctgccgttccggccgcccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|MN507843_P_P-E Feature FT:CDS MN507843_P_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 1969_ocHBVe_GC). Complete genome. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactc
acaaggtgggaaattttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcct
gatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggccctctaacagtaaatgaaaaacgaagatt
aaacttagttatgcctgctagattttttcccatcgctacgaaatatttgcccctagagaaaggtataaaaccttattatc
cagataatgtagttaatcattacttccaaaccagacactatttacataccctatggaaggcgggcatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacgg
tccctctcgaatgggggaagaatcattccacctccaatcctctgggattttttcccgaccaccagttggatccagcattc
agagcaaacaccaaaaatccagattgggaccacaatcccaacaaagaccactggacggaagccaacaaggtaggagtggg
agcattcgggccggggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgctaaaaac