Dataset for nucleotide sequence P of genotype E

[Download (right click)] [Edit] [Sequences] [Repertoires]

476 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

GQ161775_P_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaagag------gca
MW679682_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
HM363611_P_P-E      atgcccctatcttatcaacacttccggagactactgttattagacgacgag------gca
LT623851_P_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgamgag------gca
MF772356_P_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaagag------gca
AB106564_P_C-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MN507842_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MF772355_P_P-E      atgcccctatcttatcaacacttcctgaaactactgttgttagacgaagag------gca
MZ962198_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MW455162_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161768_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
LT623842_P_P-E      atgcccctatcttatcaacwcttccggagamtactgttgttagacgaagag------gca
AB194948_P_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaagag------gca
GQ161820_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161826_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
AB274985_P_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaagag------gca
EU239224_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacggagag------gca
MN507847_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MW455165_P_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaagag------gca
GQ161785_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
AB274982_P_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaagag------gca
MW455163_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MN507844_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161823_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MZ962192_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161776_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161789_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161828_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161784_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161786_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161807_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161797_P_P-E      atgcccctatcttatcaacacttccggaaattactgttgttagacgaagag------gca
MZ962190_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161836_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161756_P_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaagag------gca
GQ161795_P_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaagag------gca
GQ161761_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161830_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MZ962196_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161755_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161835_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MW455164_P_P-E      atgcccctatcttatcaacacttccggagactactgttattagacgaagag------gca
GQ161773_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161802_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
AB091255_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MN507843_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161803_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161794_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MZ962194_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161834_P_P-E      atgcccctatcttatcaactcttccggagaatactgttgttagacgaagag------gca
KU736894_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161771_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgacgag------gca
KU736897_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgacgag------gca
KU736898_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgacgag------gca
MN507845_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
AB274976_P_P-E      atgcccctatcttatcaacacttccggagattactgttgttagacgaagag------gca
KU736895_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
KU736896_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
AB274971_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161817_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MN507846_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MZ962193_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
AM494696_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
AM494694_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
AM494700_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161812_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161782_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161792_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161814_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
FJ349237_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
FJ349238_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MW082636_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161832_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
KU736899_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161798_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161759_P_P-E      atgcccctatcttatcaacacttcctgagaatactgttgttagacgaagag------gca
GQ161772_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161787_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161764_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161801_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MZ962199_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161829_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161770_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161791_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161800_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161819_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161781_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161804_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161793_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161827_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
LT623843_P_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaagag------gca
FN594751_P_P-E      atgcccctatcttatcaacacttccggagcatactgttgttagacgaagag------gca
AB219533_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgacgag------gca
FN594750_P_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaagag------gca
AB219529_P_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaagag------gca
MN507841_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
JQ000008_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
JQ000009_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
KM606738_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
FN594749_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
KF849720_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
DQ060827_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
DQ060826_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
DQ060828_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
DQ060829_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
KF849715_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
AY738147_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
AY738144_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
AY738145_P_C-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
AY738146_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
FN594752_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
KF849723_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
KF849728_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
OM256457_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
AB201290_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
FN594763_P_P-E      atgcccctatcttatcaacacttccggagcatactgttgttagacgaagag------gca
KF170741_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
AB201289_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
AB915175_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
KF849724_P_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaaggg------gca
KF849716_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MH464856_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagagnnnnnngca
KF849726_P_P-E      atgcccctatcttatcatcacttccggagtgtactgttgttagacgaagag------gca
KF849717_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
DQ060822_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
DQ060823_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
KF849718_P_P-E      atgcccctatcttatcaacacttccggagtgtactgttattagacgaagag------gca
MH464855_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagagnnnnnngca
DQ060824_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
KF849714_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
DQ060825_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
KF849725_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
KF849719_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
KF849721_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
KF849713_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
KF849722_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MF772354_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
AY935700_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
KT192626_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
KF922438_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
KF922439_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
HM363610_P_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaagag------gca
HM363600_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
HM363592_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
HM363602_P_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaagac------gca
HM363585_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
HM363582_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
HM363583_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
HM363584_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
HM363601_P_P-E      atgcccctatcttatcaacacttcctgagattactgttgttagacgaagag------gca
HM363597_P_P-E      atgcccctatcttatccacacttccggaaactactgttgttagacgaagag------gca
HM363591_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
HM363590_P_P-E      atgcccctatcttatcaacacttcctgagaatactgttgttagacgaagag------gca
HM363588_P_P-E      atgcccctatcttatcaacacttcctgagaatactgttgttagacgaagag------gca
HM363589_P_P-E      atgcccctatcttatcaacacttcctgagaatactgttgttagacgaagag------gca
HM363604_P_P-E      atgcccctatcttatccacacttccggagaatgctgttgttagacgaagag------gca
HM363586_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
HM363587_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
HM363567_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
HM363568_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
EU239220_P_P-E      atgcccctatcttatcaacacttccggagattactgttattagacgaagag------gca
MZ962197_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
AB915180_P_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaagag------gca
AB274984_P_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaagag------gca
FN594762_P_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgacgag------gca
MZ962195_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
LT623844_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
HM363603_P_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaagag------gca
FN594753_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
FN594765_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MF772358_P_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaagag------gca
MF772357_P_P-E      atgcccctatcttatccacacttccggaaactactgttattagacgaagag------tca
HM363599_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
HM363565_P_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaagag------gca
HM363566_P_P-E      atgcccctatcttatccacacttccggagactactgttgttagacgaagag------gca
AB274973_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
FN545822_P_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaagag------gca
GQ161831_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
HM363605_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
HM363606_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
FN594766_P_P-E      atgcccctatcttatcaacacttccggagacttctgttgttagacgaagag------gca
AM494711_P_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaagag------gca
HM363596_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MZ962189_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
FN594760_P_P-E      atgcccctatcttgtcaacgcttccggagaatactgttgttagacgaagag------gca
AB274981_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
AB205190_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161796_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgacgag------gca
HM363598_P_P-E      atgcccctatcttatcaacacttccggagattactgttgttagacgaagag------gca
GQ161825_P_P-E      atgcccctatcttatcaacacttccggagactactgttgttagaccaa---------gca
LT623847_P_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaagag------gca
EU239222_P_P-E      atgcccctatcttatcaacacttcctgagactactgttgttagacgaagag------gca
HM363608_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
FN545821_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
AB915178_P_P-E      atgcccctatcttatcaacacttcctgagactactgttgttagacgaagag------gca
AM494689_P_P-E      atgcccctatcttatctacacttccggagaatactgttgttagacgaagag------gca
GQ161762_P_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaagag------gca
AM494712_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
AM494714_P_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaagag------gca
AM494692_P_P-E      atgcccctatcttatcaacacttccggagattactgttgttagacgaagag------gca
AM494710_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
AM494709_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
AM494697_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MH580650_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
HM363607_P_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaagag------gca
AB274979_P_P-E      atgcccctatcttatcaacacttccggagattactgttgttagacgaagag------gca
AB205188_P_P-E      atgcccctatcgtatcaacacttcccgagaatactgttgttagacgaagaa------gca
FN594758_P_P-E      atgcccctatcttgtcaacgcttccggagaatactgttgttagacgaagag------gca
FN594759_P_P-E      atgcccctatcttgtcaacgcttccggagaatactgttgttagacgaagag------gca
MH580648_P_P-E      atgcccctatcttatcaacacttcctgagactactgttgttagacgaagag------gca
AB274977_P_P-E      atgcccctatcttatcaacacttccggagactactgttcttagacgaagag------gca
AB274975_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
LT623849_P_P-E      atgcccctatcttatcaacacttccggagamtactgttgttagacgaagag------gca
FN594748_P_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaagag------gca
MH580645_P_P-E      atgcccctatcttatcaacacttccggagactgctgttgttagatcaagag------gca
HM363572_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161757_P_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaagag------gca
FN594761_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
AM494691_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
KM606739_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MF772360_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
LT623845_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgargag------gca
LT623846_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
AB201287_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
HM363594_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
AB274980_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
KU736913_P_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaagag------gca
GQ161760_P_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaagag------gca
MN507840_P_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaagag------gca
HM363595_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
AM494695_P_P-E      atgcccctatcttatcaacacttccggagactactgttattagacacagag------gca
FJ349240_P_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaagag------gca
GQ161758_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161766_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161774_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT426115_P_P-E      atgcccctgtcttatcaacacttccggagaatactgttgttagacgaagag------gca
HM363579_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
HM363580_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
HM363581_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
KT749841_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
AB091256_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MH580626_P_P-E      atgcccctatcttatcaacacttccggagacttctgttgttagacgaagag------gca
FJ349226_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MN967526_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
AM494703_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
KU736902_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
KF170742_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MK720631_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MK720632_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MK321264_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
KU736904_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
AM494699_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
AM494698_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
AM494715_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
AM494693_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
AM494704_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
KU736910_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
KU736911_P_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaagag------gca
KU736905_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
KU736912_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
KU736906_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
KU736907_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
KU736908_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
KU736903_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
KU736909_P_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaagag------gca
AM494713_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
AM494701_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
AM494707_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
AM494690_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
AM494708_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
AM494717_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MN967529_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
AM494702_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MN967528_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MW679683_P_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaagag------gca
FN594756_P_P-E      atgcccctatcttatcaacacttccggagattactgttgttagacgaagag------gca
EU239221_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
HM363609_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
HM363593_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
FN545823_P_P-E      atgcccctatcttatcaacacttccggagamtgctgttgttagacgaagag------gca
AB274970_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
X75657_P_P-E        atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MH580631_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MH580632_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MH580652_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
AB205189_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
AB205129_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
AB205192_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
AB274978_P_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgacgag------gca
EU239217_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
EU239219_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
EU239223_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
KU736901_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgacgag------gca
GQ161783_P_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaagag------gca
GQ161824_P_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaagag------gca
FN545842_P_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaagag------gca
FN545827_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
FN545841_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MH580614_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MH580615_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MH580616_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MH580618_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MH580619_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MH580620_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MH580623_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MH580651_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MH918655_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MH580630_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
AY739674_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
AY739675_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MW455161_P_P-E      atgcccctatcttatcaacacttcctgagaatactgttgttagacgaagag------gca
FJ349239_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
KU736891_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
KU736892_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
AB915177_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
LT623850_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
AB201288_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
HQ700551_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MZ962191_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MN967527_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
AB205191_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427116_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427114_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427115_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427113_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427124_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427112_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427120_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427117_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427122_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427119_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427110_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427136_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427135_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427137_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427132_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427130_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427128_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427111_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427148_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427146_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427144_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427131_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427129_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427127_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427133_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427134_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427142_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427118_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgcagag------gca
MT427125_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427139_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427138_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427172_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427170_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427169_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427168_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427167_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427165_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427164_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427162_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427161_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427159_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427158_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427157_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427155_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427150_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427149_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427147_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427145_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427152_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427173_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427154_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427174_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427175_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427176_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427151_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427143_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427141_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427126_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427123_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427177_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427178_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427179_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427121_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427156_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427198_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427199_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427195_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427194_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427192_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427191_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427190_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427189_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427188_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427186_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427184_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427183_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427182_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427181_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427185_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427180_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427171_P_P-E      atgcccctaacttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427166_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427163_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427160_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427140_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427187_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427193_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427196_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427197_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427200_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427201_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MT427153_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MH580638_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161822_P_P-E      -------tatcttatcaacaactccggagaatactgttgttagacgaagag------gca
GQ161833_P_P-E      atgcccctatcttatcaacaactccggagaatactgttgttagacgaagag------gca
HM363574_P_P-E      atgcccctatcttatccacacttccggagaatactgttgttagacgaagag------gca
AB274974_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
HM363575_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
HM363576_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
AB194947_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MH580624_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MH580629_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MH580646_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MH580649_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
HM363578_P_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaagag------gca
HM363577_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161815_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161765_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161769_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161779_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MH580617_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgacgag------gca
MH580628_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgacgag------gca
MH580644_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgacgag------gca
AM494706_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
AB274969_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
LT623848_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MF772362_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
EU239218_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
AM494705_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
HQ700550_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
HQ700552_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161821_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161818_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161790_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161805_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161799_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
EU239226_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
KU736893_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161811_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MH580640_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MH580641_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
HM363569_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
HM363570_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161778_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161810_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161808_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MH580633_P_P-E      atgcccctatcttatcaacacttccggagactactgttgttagacgaagag------gca
MH580634_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MH580635_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MH580636_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
HM363573_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
HM363571_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
KU736900_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161763_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161777_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MH580621_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MH580625_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MH580622_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MH580637_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MN507848_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
DQ060830_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
MH580647_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161816_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
GQ161780_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
KX186584_P_P-E      atgcccctatcttatcaacacttccggagaatactgttgttagacgaagag------gca
                           *  * * **  *   *** **   * ***** *****              **

GQ161775_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MW679682_P_P-E      ggtcccctagaagaagaactccctcccctcccagacgaagatctcaatcgccgcgtcgca
HM363611_P_P-E      ggtcccctggaagaagaactccctcgcctcgcagacgaagacctcaatcgccgcgtcgca
LT623851_P_P-E      ggwcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MF772356_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AB106564_P_C-E      ggtcccctagaagacgaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MN507842_P_P-E      ggtcccctagaagacgaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MF772355_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MZ962198_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MW455162_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161768_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
LT623842_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AB194948_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161820_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161826_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AB274985_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgca
EU239224_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagaactcaatcgccgcgtcgca
MN507847_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MW455165_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161785_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AB274982_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MW455163_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MN507844_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161823_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MZ962192_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161776_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161789_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161828_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161784_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161786_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
GQ161807_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161797_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MZ962190_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161836_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161756_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161795_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161761_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161830_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MZ962196_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161755_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161835_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MW455164_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161773_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161802_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AB091255_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MN507843_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161803_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccacgtcgca
GQ161794_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MZ962194_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161834_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
KU736894_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161771_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
KU736897_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
KU736898_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MN507845_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AB274976_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
KU736895_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
KU736896_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AB274971_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161817_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MN507846_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MZ962193_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AM494696_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AM494694_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AM494700_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161812_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161782_P_P-E      ggtcccctagaagaagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgca
GQ161792_P_P-E      ggtcccctagaagaagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgca
GQ161814_P_P-E      ggtcccctagaagaagaactccctcgcctcgccaacgaagatctcaatcgccgcgtcgca
FJ349237_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
FJ349238_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MW082636_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161832_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
KU736899_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161798_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161759_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161772_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161787_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161764_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161801_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MZ962199_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161829_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161770_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161791_P_P-E      ggtcccctagaagaagaactccctcgccttgcagacgaagatctcaatcgccgcgtcgca
GQ161800_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161819_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161781_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161804_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161793_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161827_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
LT623843_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
FN594751_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AB219533_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
FN594750_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AB219529_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MN507841_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
JQ000008_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
JQ000009_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
KM606738_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
FN594749_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
KF849720_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
DQ060827_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
DQ060826_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
DQ060828_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
DQ060829_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
KF849715_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AY738147_P_P-E      ggtcccctagaagaagaactccctctcctcgcagacgaagatctcaatcgccgcgtcgca
AY738144_P_P-E      ggtcccctagaagaagaactccctctcctcgcagacgaagatctcaatcgccgcgtcgca
AY738145_P_C-E      ggtcccctagaagaagaactccctctcctcgcagacgaagatctcaatcgccgcgtcgca
AY738146_P_P-E      ggtcccctagaagaagaactccctctcctcgcagacgaagatctcaatcgccgcgtcgca
FN594752_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
KF849723_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
KF849728_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
OM256457_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AB201290_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
FN594763_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
KF170741_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AB201289_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AB915175_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
KF849724_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
KF849716_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MH464856_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
KF849726_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
KF849717_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
DQ060822_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
DQ060823_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
KF849718_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MH464855_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
DQ060824_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
KF849714_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
DQ060825_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
KF849725_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
KF849719_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
KF849721_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
KF849713_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
KF849722_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MF772354_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AY935700_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
KT192626_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
KF922438_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
KF922439_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
HM363610_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
HM363600_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccacgtcgca
HM363592_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
HM363602_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
HM363585_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
HM363582_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
HM363583_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
HM363584_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
HM363601_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
HM363597_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
HM363591_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
HM363590_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
HM363588_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
HM363589_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
HM363604_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
HM363586_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
HM363587_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
HM363567_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
HM363568_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
EU239220_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MZ962197_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AB915180_P_P-E      ggtcccctagaagaagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgca
AB274984_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
FN594762_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MZ962195_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
LT623844_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcratcgccgcgtcgca
HM363603_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
FN594753_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
FN594765_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MF772358_P_P-E      ggccccctagaggaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MF772357_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
HM363599_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
HM363565_P_P-E      ggtcccctagaagacgaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
HM363566_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AB274973_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
FN545822_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161831_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
HM363605_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
HM363606_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatctccgcgtcgca
FN594766_P_P-E      ggtcccctagaagaagaactccctcacctcgcagacgaagatctcaatcgccgcgtcgca
AM494711_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
HM363596_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MZ962189_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
FN594760_P_P-E      ggtcccctagaagaagaactccctcacctcgcagacgcagatctcaatcgccgcgtcgca
AB274981_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AB205190_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161796_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
HM363598_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161825_P_P-E      ggtcctatagaagaagaactccctcacctcgcagacgaagatctcaatcgccgcgtcgca
LT623847_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
EU239222_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
HM363608_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
FN545821_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AB915178_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AM494689_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161762_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AM494712_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AM494714_P_P-E      ggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AM494692_P_P-E      ggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AM494710_P_P-E      ggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AM494709_P_P-E      ggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AM494697_P_P-E      ggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MH580650_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
HM363607_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgccgatctcaatcgccgcgtcgca
AB274979_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AB205188_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
FN594758_P_P-E      ggtcccctagaagaagaactccctcacctcgcagacgcagatctcaatcgccgcgtcgca
FN594759_P_P-E      ggtcccctagaagaagaactccctcacctcgcagacgcagatctcaatcgccgcgtcgca
MH580648_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AB274977_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AB274975_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctaaatcgccgagtcgca
LT623849_P_P-E      ggtcccctagaagaagaactccctcscctcscagacgaagatctcaatcgccgcgtcsca
FN594748_P_P-E      ggtcccctagaagacgaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MH580645_P_P-E      ggtcctctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
HM363572_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161757_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
FN594761_P_P-E      ggtcccctagaagacgaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgca
AM494691_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
KM606739_P_P-E      ggtcccatagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MF772360_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
LT623845_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
LT623846_P_P-E      ggtcacctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AB201287_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
HM363594_P_P-E      ggtcccctagaagaagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgca
AB274980_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcc
KU736913_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161760_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MN507840_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgtagatctcaatcgccgcgtcgca
HM363595_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AM494695_P_P-E      ggtccactagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
FJ349240_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161758_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161766_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161774_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT426115_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
HM363579_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
HM363580_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
HM363581_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
KT749841_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AB091256_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MH580626_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
FJ349226_P_P-E      ggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MN967526_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AM494703_P_P-E      ggtcccctaaaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
KU736902_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
KF170742_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MK720631_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MK720632_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MK321264_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
KU736904_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagaactcaatcgccgcgtcgca
AM494699_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AM494698_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AM494715_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AM494693_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AM494704_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
KU736910_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
KU736911_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
KU736905_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
KU736912_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
KU736906_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
KU736907_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
KU736908_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
KU736903_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
KU736909_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AM494713_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AM494701_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AM494707_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AM494690_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AM494708_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AM494717_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MN967529_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AM494702_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MN967528_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MW679683_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
FN594756_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
EU239221_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
HM363609_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
HM363593_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
FN545823_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AB274970_P_P-E      ggtcccctagaagaagaactccctcacctcgcagacgaagatctcaatcgccgcgtcgca
X75657_P_P-E        ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MH580631_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MH580632_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MH580652_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AB205189_P_P-E      ggtcccctagaagaaggactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AB205129_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AB205192_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AB274978_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
EU239217_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
EU239219_P_P-E      ggtcccctagaagacgaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
EU239223_P_P-E      ggtcccctagaagacgaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
KU736901_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161783_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161824_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
FN545842_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
FN545827_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
FN545841_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MH580614_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MH580615_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MH580616_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MH580618_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MH580619_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MH580620_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MH580623_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MH580651_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MH918655_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MH580630_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AY739674_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AY739675_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MW455161_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
FJ349239_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
KU736891_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
KU736892_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AB915177_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
LT623850_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AB201288_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
HQ700551_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MZ962191_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MN967527_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AB205191_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427116_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427114_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427115_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427113_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427124_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427112_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427120_P_P-E      ggtcccctagaagaagaactccctcgcctagcagacgaagatctcaatcgccgcgtcgca
MT427117_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427122_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427119_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427110_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427136_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427135_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427137_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427132_P_P-E      ggtcccctagaagaagaactccctcggctcgcagacgaagatctcaatcgccgcgtcgca
MT427130_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427128_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427111_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427148_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427146_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427144_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427131_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427129_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427127_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427133_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427134_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427142_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427118_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427125_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427139_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427138_P_P-E      ggtcccctagaagaagaactccctcggatcgcagacgaagatctcaatcgccgcgtcgca
MT427172_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427170_P_P-E      gctcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427169_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427168_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427167_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427165_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427164_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427162_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427161_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427159_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427158_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427157_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427155_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427150_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427149_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427147_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427145_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427152_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427173_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427154_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427174_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427175_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427176_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427151_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427143_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427141_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427126_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427123_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427177_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427178_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427179_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427121_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427156_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427198_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427199_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427195_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427194_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427192_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427191_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427190_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427189_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427188_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427186_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427184_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427183_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427182_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427181_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427185_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427180_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427171_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427166_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427163_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427160_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427140_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427187_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427193_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427196_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427197_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427200_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427201_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MT427153_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MH580638_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161822_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161833_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
HM363574_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AB274974_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
HM363575_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
HM363576_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AB194947_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatctccgcgtcgca
MH580624_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MH580629_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MH580646_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MH580649_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
HM363578_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
HM363577_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161815_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161765_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161769_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161779_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MH580617_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MH580628_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MH580644_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AM494706_P_P-E      ggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AB274969_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
LT623848_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MF772362_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
EU239218_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AM494705_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
HQ700550_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgacgatctcaatcgccgcgtcgca
HQ700552_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgacgatctcaatcgccgcgtcgca
GQ161821_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161818_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161790_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161805_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161799_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
EU239226_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
KU736893_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacraagatctcaatcgccgcgtcgca
GQ161811_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MH580640_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MH580641_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
HM363569_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctaaatcgccgcgtcgca
HM363570_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctaaatcgccgcgtcgca
GQ161778_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161810_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161808_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MH580633_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MH580634_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MH580635_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MH580636_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
HM363573_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
HM363571_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
KU736900_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161763_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161777_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MH580621_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MH580625_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MH580622_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MH580637_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MN507848_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
DQ060830_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgacgatctcaatcgccgcgtcgca
MH580647_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161816_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
GQ161780_P_P-E      ggtcccctagaagaagatctccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
KX186584_P_P-E      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
                    *  *   *  * ** *  *******   *  *  **   *  **  *** **  *** * 

GQ161775_P_P-E      gaagatctcaatctccagcttcccgatgttagtattccttggactcacaaggtgggaaat
MW679682_P_P-E      gaagatctcaatctccaccttcccaatgttagtattccttggactcacaaggtgggaaat
HM363611_P_P-E      gaagatctcaatctccatcttcccaatgttagtattccttggactcacaaggtgggaaac
LT623851_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MF772356_P_P-E      gaagatctcaatctccatcttcccaatgttagtattccttggactcacaaggtgggaaat
AB106564_P_C-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MN507842_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MF772355_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MZ962198_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MW455162_P_P-E      gaagatctcaatctccagcttcccactgttagtattccttggactcacaaggtgggaaat
GQ161768_P_P-E      gaagatctcaatctccagcttccaaatgttagtattccttggactcacaaggtgggaaat
LT623842_P_P-E      gaagatctcaatctccagcttccaaatgttagyattccttggactcacaaggtgggaaat
AB194948_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161820_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggmaat
GQ161826_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
AB274985_P_P-E      gaagatctcaatctccagcttcccactgttagtattccttggactcacaaggtgggcaat
EU239224_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MN507847_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MW455165_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161785_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
AB274982_P_P-E      gaagatctcaatctccagcttcacaatgttagtattccttggactcacaaggtgggaaat
MW455163_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MN507844_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161823_P_P-E      gaagatctaaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MZ962192_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161776_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161789_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161828_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161784_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161786_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggagtt
GQ161807_P_P-E      gaagatctaaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161797_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MZ962190_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161836_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161756_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161795_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161761_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161830_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MZ962196_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161755_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161835_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MW455164_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161773_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161802_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
AB091255_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MN507843_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161803_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161794_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MZ962194_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161834_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
KU736894_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161771_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
KU736897_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
KU736898_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MN507845_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
AB274976_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
KU736895_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
KU736896_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
AB274971_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161817_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MN507846_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MZ962193_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
AM494696_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
AM494694_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
AM494700_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161812_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161782_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161792_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161814_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
FJ349237_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
FJ349238_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MW082636_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161832_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
KU736899_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161798_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161759_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161772_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161787_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161764_P_P-E      gaagatctcaatctccagcttcccaatgttagtatcccttggactcacaaggtgggaaat
GQ161801_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MZ962199_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161829_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161770_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161791_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161800_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161819_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161781_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161804_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161793_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161827_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
LT623843_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
FN594751_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
AB219533_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
FN594750_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
AB219529_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MN507841_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggcctcataaggtgggaaat
JQ000008_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
JQ000009_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggcctcataaggtgggaaat
KM606738_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
FN594749_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
KF849720_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
DQ060827_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
DQ060826_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
DQ060828_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
DQ060829_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
KF849715_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
AY738147_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
AY738144_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
AY738145_P_C-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
AY738146_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
FN594752_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
KF849723_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
KF849728_P_P-E      gaagatctcaatctccagcttcccactgttagtattccttggactcacaaggtgggaaat
OM256457_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
AB201290_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
FN594763_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
KF170741_P_P-E      gaagatctcaatcccaacccccccccttggagtattccttccactcacaaggtgggaaat
AB201289_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
AB915175_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
KF849724_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
KF849716_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MH464856_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
KF849726_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
KF849717_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
DQ060822_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
DQ060823_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
KF849718_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MH464855_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
DQ060824_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
KF849714_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
DQ060825_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
KF849725_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
KF849719_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
KF849721_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
KF849713_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
KF849722_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MF772354_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
AY935700_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
KT192626_P_P-E      gaagatctcaatctccagcttccccatgttagtattccttggactcacaaggtgggaaat
KF922438_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
KF922439_P_P-E      gaagatctcaatctccagcttccccatgttagtattccttggactcacaaggtgggaaat
HM363610_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
HM363600_P_P-E      gaagatctcaatctccagcttcccgatgttagtattccttggactcataaggtgggaaat
HM363592_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
HM363602_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
HM363585_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
HM363582_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
HM363583_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
HM363584_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
HM363601_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccgtggactcacaaggtgggaaat
HM363597_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
HM363591_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
HM363590_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
HM363588_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccgtggactcacaaggtgggaaat
HM363589_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccgtggactcacaaggtgggaaat
HM363604_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccgtggactcacaaggtgggaaat
HM363586_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
HM363587_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
HM363567_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
HM363568_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
EU239220_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MZ962197_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
AB915180_P_P-E      aaagatctcaatctcgaggtgcccaatgttagtattccttggacgcacaaggtgggaaat
AB274984_P_P-E      gaagatctcaatctccagcttcccgatgttagtattccttggactcacaaggtgggaaat
FN594762_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MZ962195_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
LT623844_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
HM363603_P_P-E      gaagatctcaatctccagcttcccactgttagtattccttggactcacaaggtgggaaat
FN594753_P_P-E      gaagatctcaatctccaggttcccaatgttagtattccttggactcacaaggtgggaaat
FN594765_P_P-E      gaagatctcaatctccagcttcccgatgttagtattccttggactcacaaggtgggaaat
MF772358_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MF772357_P_P-E      gaagatctcaatctccagcttcccgatgttagtattccttggactcacaaggtgggaaat
HM363599_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
HM363565_P_P-E      gaagatctcaatctccagcttcccattgttagtattccttggactcacaaggtgggaaat
HM363566_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
AB274973_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
FN545822_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggacwcacaaggtgggaaat
GQ161831_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
HM363605_P_P-E      gaagatctcaatctccaggttcccaatgttagtattccttggactcacaaggtgggaaat
HM363606_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
FN594766_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
AM494711_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
HM363596_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MZ962189_P_P-E      gaagatctcaatctccagcttccaaatgttagtattccttggactcacaaggtgggaaat
FN594760_P_P-E      gaagatctcaatctccagcttcccaatgttaatattccttggactcacaaggtgggaaat
AB274981_P_P-E      gaagatctcaatctccagcttcacaatgttagtattccttggactcacaaggtgggaaat
AB205190_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161796_P_P-E      gaagatctcaatctccagcttccaaatgttagtattccttggactcacaaggtgggaaat
HM363598_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161825_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
LT623847_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
EU239222_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaac
HM363608_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
FN545821_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
AB915178_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
AM494689_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161762_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
AM494712_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
AM494714_P_P-E      gaagatctcaatctccatcttcccaatgttagtattccttggactcacaaggtgggaaat
AM494692_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
AM494710_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
AM494709_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
AM494697_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MH580650_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
HM363607_P_P-E      gaagatctcaatctccatcttcccactgttagtattccttggactcacaaggtgggaaat
AB274979_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
AB205188_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
FN594758_P_P-E      gaagatctcaatctccagcttcccaatgttaatattccttggactcacaaggtgggaaat
FN594759_P_P-E      gaagatctcaatctccagcttcccaatgttaatattccttggactcacaaggtgggaaat
MH580648_P_P-E      gacgatctcaatctccatcttcccaatgttagtattccgtggactcacaaggtgggaaat
AB274977_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
AB274975_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
LT623849_P_P-E      gaagatctcaatctccascttcccaatgttagtattccttggactcacaaggtgggaaat
FN594748_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MH580645_P_P-E      gaagatctcaatctccagctccccgatgttagtattccttggactcacaaggtgggaaat
HM363572_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161757_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccgtggactcacaaggtgggaaat
FN594761_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
AM494691_P_P-E      gaagatctcaatctccagcttccaaatgttagtattccctggactcacaaggtgggcaat
KM606739_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MF772360_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
LT623845_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
LT623846_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
AB201287_P_P-E      gaagatctcaatctccagcttcccaatgttagtatcccttggactcccaaggtgggaaat
HM363594_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
AB274980_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
KU736913_P_P-E      gaagatctcaatctccagcttcccamtgttagtattccttggactcacaaggtgggaaat
GQ161760_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MN507840_P_P-E      gaagatctcaatctccagcttcccgatgttagtattccttggactcacaaggtgggaaat
HM363595_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
AM494695_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
FJ349240_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161758_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161766_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161774_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT426115_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
HM363579_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
HM363580_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
HM363581_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KT749841_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
AB091256_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MH580626_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
FJ349226_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MN967526_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
AM494703_P_P-E      gaagatctcaatctccatcttcccaatgttagtattccttggactcacaaggtgggaaat
KU736902_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KF170742_P_P-E      gaagatctcaatctccagcttcacaatgttagtattccttggactcacaaggtgggaaat
MK720631_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MK720632_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MK321264_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
KU736904_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
AM494699_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
AM494698_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
AM494715_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
AM494693_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
AM494704_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
KU736910_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
KU736911_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
KU736905_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
KU736912_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
KU736906_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
KU736907_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
KU736908_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
KU736903_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
KU736909_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
AM494713_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
AM494701_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
AM494707_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
AM494690_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
AM494708_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
AM494717_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MN967529_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
AM494702_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MN967528_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MW679683_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
FN594756_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
EU239221_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
HM363609_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
HM363593_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
FN545823_P_P-E      gaagatctcaatctccagctgcccaatgttagtattccttggactcacaaggtgggaaat
AB274970_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
X75657_P_P-E        gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
MH580631_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MH580632_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MH580652_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
AB205189_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
AB205129_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
AB205192_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
AB274978_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
EU239217_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
EU239219_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
EU239223_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
KU736901_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161783_P_P-E      gaaaatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161824_P_P-E      gaaaatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
FN545842_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
FN545827_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
FN545841_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MH580614_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MH580615_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MH580616_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MH580618_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MH580619_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MH580620_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MH580623_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MH580651_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MH918655_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MH580630_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggcaat
AY739674_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
AY739675_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MW455161_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
FJ349239_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
KU736891_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccgtggactcacaaggtgggaaat
KU736892_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccgtggactcacaaggtgggaaat
AB915177_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
LT623850_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
AB201288_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
HQ700551_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MZ962191_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MN967527_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
AB205191_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427116_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427114_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427115_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427113_P_P-E      gaagatctcaatctccagcttaacaatgttagtattccttggactcacaaggtgggaaat
MT427124_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427112_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427120_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427117_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427122_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427119_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427110_P_P-E      gaagatctcaatttccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427136_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427135_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427137_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427132_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427130_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427128_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427111_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427148_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427146_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427144_P_P-E      gaagatctcaatttccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427131_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427129_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427127_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427133_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427134_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427142_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427118_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427125_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427139_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427138_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427172_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427170_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427169_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427168_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427167_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427165_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427164_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427162_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427161_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427159_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427158_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427157_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427155_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427150_P_P-E      gaagatctcaatttccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427149_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427147_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427145_P_P-E      gaagatctcaatttccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427152_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427173_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427154_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427174_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427175_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427176_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427151_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427143_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427141_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427126_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427123_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427177_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427178_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427179_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427121_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427156_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427198_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427199_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427195_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427194_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427192_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427191_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427190_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427189_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427188_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggacacacaaggtgggaaat
MT427186_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427184_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427183_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427182_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427181_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427185_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427180_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427171_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427166_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427163_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427160_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427140_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427187_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427193_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427196_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427197_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427200_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427201_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MT427153_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MH580638_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161822_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161833_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
HM363574_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
AB274974_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
HM363575_P_P-E      gaagatctcaatctccaggttcccaatgttagtattccttggactcacaaggtgggaaat
HM363576_P_P-E      gaagatctcaatctccaggttcccaatgttagtattccttggactcacaaggtgggaaat
AB194947_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MH580624_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MH580629_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MH580646_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MH580649_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
HM363578_P_P-E      gaagatctcaatctccagcttcccactgttagtattccttggactcacaaggtgggaaat
HM363577_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161815_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161765_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161769_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161779_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MH580617_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MH580628_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MH580644_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
AM494706_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
AB274969_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
LT623848_P_P-E      gacgatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MF772362_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
EU239218_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
AM494705_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggcaat
HQ700550_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
HQ700552_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161821_P_P-E      gaagatctcaatttccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161818_P_P-E      gaagatctcaatttccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161790_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161805_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161799_P_P-E      gaagatctcaatttccagcttcccaatgttagtattccttggactcacaaggtgggaaat
EU239226_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
KU736893_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161811_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MH580640_P_P-E      gaagatctcaatctccagctgcccaatgttagtattccttggactcacaaggtgggaaat
MH580641_P_P-E      gaagatctcaatctccagctgcccaatgttagtattccttggactcacaaggtgggaaat
HM363569_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
HM363570_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161778_P_P-E      gaagatctcaatctccagcttccaaatgttagtattccttggactcacaaggtgggaaat
GQ161810_P_P-E      gaagatctcaatctccagcttccaaatgttagtattccttggactcacaaggtgggaaat
GQ161808_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MH580633_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MH580634_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MH580635_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MH580636_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
HM363573_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
HM363571_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
KU736900_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccgtggactcacaaggtgggaaat
GQ161763_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161777_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MH580621_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MH580625_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MH580622_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MH580637_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MN507848_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
DQ060830_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
MH580647_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161816_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
GQ161780_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
KX186584_P_P-E      gaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
                     *  **** ***  * *         *   *  ** ** *   * *  ********    

GQ161775_P_P-E      tttacggggctttactcttctaccatacctgtcttcaatcctaactggaaaactccatct
MW679682_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
HM363611_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggcaaactccatct
LT623851_P_P-E      tttacggggatttactcttctactatacctacctttaatcctaactggaaaactccatct
MF772356_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
AB106564_P_C-E      tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatct
MN507842_P_P-E      tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatct
MF772355_P_P-E      tttacggggctttattcttcttctatacctgtctttaatcctaactggaaaactccttct
MZ962198_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MW455162_P_P-E      tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161768_P_P-E      tttacagggctttattcttctactatacctgtctttaatcctaactggaaaactccttct
LT623842_P_P-E      tttacrgggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
AB194948_P_P-E      tttacggggctttactcttccactatacctgtctttaatcctaactggaaaactccctct
GQ161820_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161826_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
AB274985_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
EU239224_P_P-E      tttacggggctttactctactactatacctgtctttaatcctaactggaaaactccatct
MN507847_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MW455165_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161785_P_P-E      tttacggggctttactctactactatacctgtctttaatcctaactggaaaactccatct
AB274982_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MW455163_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MN507844_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161823_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MZ962192_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161776_P_P-E      tttacggggctttactcttctactattcctgtctttaatcctaactggaaaactccatct
GQ161789_P_P-E      tttacggggctttactcttctactattcctgtctttaatcctaactggaaaactccatct
GQ161828_P_P-E      tttacggggctttactcttctactattcctgtctttaatcctaactggaaaactccatct
GQ161784_P_P-E      tttacggggctttactcttctactattcctgtctttaatcctaactggaaaactccatct
GQ161786_P_P-E      catacggggctttactcttctactatacctgtctttaatcctaactggaaacctccatct
GQ161807_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161797_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MZ962190_P_P-E      tttacggggctttactcttctactatacctgtatttaatcctaactggaaaactccatct
GQ161836_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161756_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161795_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161761_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161830_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MZ962196_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161755_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161835_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MW455164_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161773_P_P-E      tttacggggctctactcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161802_P_P-E      tttacggggctctactcttctactatacctgtctttaatcctaactggaaaactccatct
AB091255_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MN507843_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161803_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161794_P_P-E      tttacggggctttactctactactatacctgtctttaatcctaactggaaaactccatct
MZ962194_P_P-E      tttacggggctttactctactactatacctgtctttaatcctaactggaaaactccatct
GQ161834_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaacctccatct
KU736894_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161771_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
KU736897_P_P-E      tttacggggctttactctactactatacctgtctttaatcctaactggaaaactccatct
KU736898_P_P-E      tttacggggctttactctactactatacctgtctttaatcctaactggaaaactccatct
MN507845_P_P-E      tttacggggctttactctactactatacctgtctttaatcctcactggaaaactccatct
AB274976_P_P-E      ttttcggggctttactctactactatacctgtctttaatcctaactggaaaactccatct
KU736895_P_P-E      tttacggggctttactctactactatacctgtctttaatcctcactggaaaactccatct
KU736896_P_P-E      tttacggggctttactctactactatacctgtctttaatcctcactggaaaactccatct
AB274971_P_P-E      tttacggggctttactctactactatacctgtctttaatcctaactggaaaactccatct
GQ161817_P_P-E      tttacggggctttactctactactatacctgtctttaatcctaactggaaaactccatct
MN507846_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MZ962193_P_P-E      tttacggggctgtactcttctactatacctgtctttaatcctaactggaaaactccatct
AM494696_P_P-E      tttacggggctttactcttccactatacctgtctttaatcctaactggaaaactccctat
AM494694_P_P-E      tttacggggctttactcttccactatacctgtctttaatcctaactggaaaactccctat
AM494700_P_P-E      tttacggggctttactcttccactatacctgtctttaatcctaactggaaaactccctat
GQ161812_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161782_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161792_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161814_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
FJ349237_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccctct
FJ349238_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccctct
MW082636_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161832_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
KU736899_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161798_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161759_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161772_P_P-E      tttacggggctttactcttctactatacctgtctttaaacctaactggaaaactccatct
GQ161787_P_P-E      tttacggggctttactcttctactatacctgtctttaaccctaactggaaaactccatct
GQ161764_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161801_P_P-E      tttacggggctttactcttctactatacatgtctttaatcctaactggaaaactccatct
MZ962199_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161829_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161770_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161791_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161800_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161819_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161781_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161804_P_P-E      tttacggggctgtactcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161793_P_P-E      tttacggggttgtactcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161827_P_P-E      tttacggggttgtactcttctactatacctgtctttaatcctaactggaaaactccatct
LT623843_P_P-E      tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatct
FN594751_P_P-E      tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatct
AB219533_P_P-E      tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatct
FN594750_P_P-E      tttacggggctttattcttctactataccggtctttaatcctaactggaaaactccatct
AB219529_P_P-E      tttactgggctttattcttctactatacctgtctttaatcctaactggaaaactccctct
MN507841_P_P-E      tttacgggtctttattcttctactatacctgtctttaatcctaactggaaaactccatct
JQ000008_P_P-E      tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatct
JQ000009_P_P-E      tttacgggtctttattcttctactatacctgtctttaatcctaactggaaaactccatct
KM606738_P_P-E      tttacggggctttattcttctactatacctgtctttaatcctaattggaaaactccatct
FN594749_P_P-E      tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatct
KF849720_P_P-E      tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatct
DQ060827_P_P-E      tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatct
DQ060826_P_P-E      tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactctctct
DQ060828_P_P-E      tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatct
DQ060829_P_P-E      tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatct
KF849715_P_P-E      tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatct
AY738147_P_P-E      tttacggggctttattcttctactattcctgtctttaatcctaactggaaaactccatct
AY738144_P_P-E      tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatct
AY738145_P_C-E      tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatct
AY738146_P_P-E      tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatct
FN594752_P_P-E      tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatct
KF849723_P_P-E      tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatct
KF849728_P_P-E      tttacggggctttattcttctactattcctgtctttaatcctaactggaaaactccatct
OM256457_P_P-E      tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatct
AB201290_P_P-E      tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatct
FN594763_P_P-E      tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatct
KF170741_P_P-E      tttacggggctttattcttctactattcctgtctttaatcctaactggaaaactccatct
AB201289_P_P-E      tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatct
AB915175_P_P-E      tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatct
KF849724_P_P-E      tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatct
KF849716_P_P-E      tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatct
MH464856_P_P-E      tttacggggctctattcttctactatacctgtctttaatcctaactggaaaactccatct
KF849726_P_P-E      tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatct
KF849717_P_P-E      tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatct
DQ060822_P_P-E      tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatct
DQ060823_P_P-E      tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatct
KF849718_P_P-E      tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatct
MH464855_P_P-E      tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatct
DQ060824_P_P-E      tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatct
KF849714_P_P-E      tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatct
DQ060825_P_P-E      tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatct
KF849725_P_P-E      tttacggggctttattcttcttctatacctgtctttaatcctaactggaaaactccatct
KF849719_P_P-E      tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatct
KF849721_P_P-E      tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatct
KF849713_P_P-E      tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatct
KF849722_P_P-E      tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatct
MF772354_P_P-E      tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatct
AY935700_P_P-E      tttacagggctttattcttctactatacctgtctttaatcctaactggaaaactccatct
KT192626_P_P-E      tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatct
KF922438_P_P-E      tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatct
KF922439_P_P-E      tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatct
HM363610_P_P-E      tttacagggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
HM363600_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
HM363592_P_P-E      tttacggggctttactcttctactttacctgtctttaaccctaactggaaaactccatct
HM363602_P_P-E      tttacgggactttactcttctactatacctgtctttaatcctaactggaaaactccatct
HM363585_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
HM363582_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
HM363583_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
HM363584_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaacctccatct
HM363601_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
HM363597_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
HM363591_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
HM363590_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
HM363588_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
HM363589_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
HM363604_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
HM363586_P_P-E      tttacgggactttactcttctactatacctgtctttaatcctaactggaaaactccgtct
HM363587_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
HM363567_P_P-E      ttcacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
HM363568_P_P-E      ttcacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
EU239220_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MZ962197_P_P-E      tttacggggctttactcttctactatacctatctttaatcctaactggaaaactccattt
AB915180_P_P-E      tttacgggactttactcttctactatacctgtctttaatcctaactggaaaactccatct
AB274984_P_P-E      tttacggggctttactcttctactatacctgtttttaatcctaactggaaaactccatct
FN594762_P_P-E      tttacggggctttactcttctgctatacctgtctttaatcctaactggaaaactccatct
MZ962195_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
LT623844_P_P-E      tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatct
HM363603_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctcactggaaaactccatct
FN594753_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
FN594765_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MF772358_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MF772357_P_P-E      tttacggggctttactcttccactatacctatctttaatcctaactggaaaactccatct
HM363599_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccttct
HM363565_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctcactggaaaactccatct
HM363566_P_P-E      tttacggggctttactcttctactatacctgtctttaatccccactggaaaactccatct
AB274973_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaacgccatct
FN545822_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161831_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
HM363605_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
HM363606_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
FN594766_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
AM494711_P_P-E      tttacggggctttactcttctactatacctatctttaatcctaactggaaaactccatct
HM363596_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MZ962189_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
FN594760_P_P-E      tttacggggctttactcttccactatacctgtctttaatcctaactggaaaactccatct
AB274981_P_P-E      tttgcggggctttactcttctactatacctgtctttaatcctaattggaaaactccatct
AB205190_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161796_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
HM363598_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161825_P_P-E      tttacggggctttactcttcttctatacctgtctttaatcctaactggaaaactccatct
LT623847_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
EU239222_P_P-E      tttacggggctttactcttctactttacctgtctttaatcctaattggaaaactccatct
HM363608_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
FN545821_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
AB915178_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
AM494689_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161762_P_P-E      tttacgggactttactcttctactatacctgtctttaatcctagctggaaaactccatct
AM494712_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
AM494714_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
AM494692_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
AM494710_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
AM494709_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
AM494697_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MH580650_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
HM363607_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
AB274979_P_P-E      tttgcggggctttactcttctactatacctgtctttaatcctcactggaaaactccatct
AB205188_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
FN594758_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
FN594759_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MH580648_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
AB274977_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaacctccatct
AB274975_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
LT623849_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
FN594748_P_P-E      tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatct
MH580645_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
HM363572_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161757_P_P-E      tttacggggctttactcttctactttacctgtctttaatcctaactggaaaactccatct
FN594761_P_P-E      tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatct
AM494691_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
KM606739_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MF772360_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
LT623845_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
LT623846_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctagctggaaaactccatct
AB201287_P_P-E      tttacggggctttactcttctactatacctgtatttaatcctaactggaaaactccatct
HM363594_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccttct
AB274980_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
KU736913_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161760_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MN507840_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
HM363595_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaattggaaaactccttct
AM494695_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
FJ349240_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161758_P_P-E      tttacggggctttactcttctactatacctatctttaatcctaactggaaaactccattt
GQ161766_P_P-E      tttacggggctttactcttctactatacctatctttaatcctaactggaaaactccattt
GQ161774_P_P-E      tttacggggctttactcttctactatacctatctttaatcctaactggaaaactccattt
MT426115_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
HM363579_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
HM363580_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
HM363581_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
KT749841_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccttct
AB091256_P_P-E      ttttcggggctttactcttctactatacctgtctttaatcctcactggaaaactccatct
MH580626_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
FJ349226_P_P-E      tttacggggctttactcttctactgttcctgtctttaatcctaactggaaaactccatct
MN967526_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
AM494703_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
KU736902_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
KF170742_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MK720631_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccattt
MK720632_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccattt
MK321264_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccattt
KU736904_P_P-E      tttacggggctttactcttctactatacctgtctttaattctaactggaaaactccatct
AM494699_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
AM494698_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
AM494715_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
AM494693_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
AM494704_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
KU736910_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
KU736911_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
KU736905_P_P-E      tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatct
KU736912_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
KU736906_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
KU736907_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
KU736908_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
KU736903_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
KU736909_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
AM494713_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
AM494701_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
AM494707_P_P-E      tttacggggctttactcttctactatacctgtctttaatcccaactggaaaactccatct
AM494690_P_P-E      tttacggggctttactcttctaatatacctgtctttaatcctaactggaaaactccatct
AM494708_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
AM494717_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MN967529_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
AM494702_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MN967528_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MW679683_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
FN594756_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctagctggaaaactccatct
EU239221_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccttcg
HM363609_P_P-E      tttacggggctttactcttctactatacctgtctttaatcttaacttgaaaactccatct
HM363593_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
FN545823_P_P-E      tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatct
AB274970_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
X75657_P_P-E        tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MH580631_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MH580632_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MH580652_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
AB205189_P_P-E      tttacggggctttactcttctactctacctgtctttaatcctaactggaaaactccctct
AB205129_P_P-E      tttacgggcctttactcttctactatacctgtctttaatcctaactggaaaactccatct
AB205192_P_P-E      tttacgggcctttactcttctactatacctgtctttaatcctaactggaaaactccatct
AB274978_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
EU239217_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
EU239219_P_P-E      tttacggggctttattcttctactatacctgtctttaattctaactggaaaactccatct
EU239223_P_P-E      tttacggggctttattcttctactatacctgtctttaattctaactggaaaactccatct
KU736901_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161783_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161824_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
FN545842_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
FN545827_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
FN545841_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MH580614_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MH580615_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MH580616_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MH580618_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MH580619_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MH580620_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MH580623_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MH580651_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MH918655_P_P-E      tttacggggctttactcttctactatacctgtctttaaccctaactggaaaactccatct
MH580630_P_P-E      tttacggggctttactcttctactattcctgtctttaatcctaactggaaaactccatct
AY739674_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctagctggaaaactccatct
AY739675_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctagctggaaaactccatct
MW455161_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccattt
FJ349239_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
KU736891_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
KU736892_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
AB915177_P_P-E      tttacggggctttactcttctactattcctgtctttaatcctaactggaaaactccatct
LT623850_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctcactggaaacctccatct
AB201288_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
HQ700551_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccaact
MZ962191_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MN967527_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
AB205191_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccttct
MT427116_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427114_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427115_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427113_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427124_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427112_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427120_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427117_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427122_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427119_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427110_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427136_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427135_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427137_P_P-E      tttacggggctttattcttctactatacctgtctttaatcctaactggaaaactccatct
MT427132_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427130_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427128_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427111_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427148_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427146_P_P-E      tttacggggctttactcttctactattcctgtctttaatcctaactggaaaactccatct
MT427144_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427131_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427129_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427127_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427133_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427134_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427142_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427118_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427125_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427139_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427138_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427172_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427170_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427169_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427168_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427167_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427165_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427164_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427162_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427161_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427159_P_P-E      tttacggggctttactcttctactatacctgtatttaatcctaactggaaaactccatct
MT427158_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427157_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427155_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427150_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427149_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427147_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427145_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427152_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427173_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427154_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427174_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427175_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427176_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427151_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427143_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427141_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427126_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427123_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427177_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427178_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427179_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427121_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427156_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427198_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427199_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427195_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427194_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427192_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427191_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427190_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427189_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427188_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427186_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427184_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427183_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427182_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427181_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427185_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427180_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427171_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427166_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427163_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427160_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427140_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427187_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427193_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427196_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427197_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427200_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427201_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MT427153_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MH580638_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161822_P_P-E      tttacggggctttactcttctactatacctgtatttaatcctaactggaaaactccatct
GQ161833_P_P-E      tttacggggctttactcttctactatacctgtatttaatcctaactggaaaactccatct
HM363574_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
AB274974_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
HM363575_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
HM363576_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
AB194947_P_P-E      tttacggggctttactcttctactatacctacctttaatcctaactggaaaactccatct
MH580624_P_P-E      tttacggggctttactcttctactacacctatctttaatcctaactggaaaactccatct
MH580629_P_P-E      tttacggggctttactcttctactatacctatctttaatcctaactggaaaactccatct
MH580646_P_P-E      tttacggggctttactcttctactatacctatctttaatcctaactggaaaactccatct
MH580649_P_P-E      tttacggggctttactcttctactatacctatctttaatcctaactggaaaactccatct
HM363578_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
HM363577_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161815_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161765_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161769_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccattt
GQ161779_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccattt
MH580617_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaacaccatct
MH580628_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaacaccatct
MH580644_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaacaccatct
AM494706_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
AB274969_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
LT623848_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccwtcc
MF772362_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
EU239218_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
AM494705_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
HQ700550_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
HQ700552_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161821_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161818_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161790_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161805_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161799_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
EU239226_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
KU736893_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161811_P_P-E      tttacggggctttactcttctactatacctatctttaatcctaactggaaaactccttct
MH580640_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MH580641_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
HM363569_P_P-E      tttacggggctttactcttctactatacctgtctttaattctaactggaaaactccatct
HM363570_P_P-E      tttacggggctttactcttctactatacctgtctttaattctaactggaaaactccatct
GQ161778_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161810_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161808_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MH580633_P_P-E      tttacggggctttactcttctactttacctgtctttaatcctaactggaaaactccatct
MH580634_P_P-E      tttacggggctttactcttctactttacctgtctttaatcctaactggaaaactccatct
MH580635_P_P-E      tttacggggctttactcttctactttacctgtctttaatcctaactggaaaactccatct
MH580636_P_P-E      tttacggggctttactcttctactttacctgtctttaatcctaactggaaaactccatct
HM363573_P_P-E      tttacggggctctactcttctactatacctgtctttaatcctaactggaaaactccatct
HM363571_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
KU736900_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161763_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161777_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MH580621_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MH580625_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MH580622_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MH580637_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MN507848_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
DQ060830_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
MH580647_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161816_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
GQ161780_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
KX186584_P_P-E      tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatct
                        * **  * ** *** *       *     ** **       * * ** * *     

GQ161775_P_P-E      tttcctgatattcatttacaccaggacattattaacaaatgtgaacaatttgtaggtcct
MW679682_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
HM363611_P_P-E      tttcctgatattcatttgcaccaggacattgttaacaaatgtgaacaatttgtaggtcct
LT623851_P_P-E      tttcctgatattcatttgcaccaggacatcattaacaaatgtgaacaatttgtaggtcct
MF772356_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
AB106564_P_C-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
MN507842_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
MF772355_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
MZ962198_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
MW455162_P_P-E      tttcctaatattcatctgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
GQ161768_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
LT623842_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
AB194948_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
GQ161820_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggycct
GQ161826_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
AB274985_P_P-E      tttcctgatattcatttgcaccaggacattattgacaaatgtgaacaatttgtaggtcct
EU239224_P_P-E      tttcctgatattcatttgcaccaggatattattaacaaatgtgaacaatttgtaggtcct
MN507847_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggacct
MW455165_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
GQ161785_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
AB274982_P_P-E      tttcctgatattcacttgcaccaggacattattaacaaatgtgaagaatttgtaggtcct
MW455163_P_P-E      tttcctaatattcatctgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
MN507844_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggccct
GQ161823_P_P-E      tttcctgatattcatttgcaccaggacattattaacagatgtgaacaatttgtaggtcct
MZ962192_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgagcaatttgtaggtcct
GQ161776_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
GQ161789_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
GQ161828_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
GQ161784_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
GQ161786_P_P-E      tttcctgatattcatttgcaccaggacattatttacaaatgtgaacaatttgtaggtcct
GQ161807_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
GQ161797_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
MZ962190_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
GQ161836_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggccct
GQ161756_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
GQ161795_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
GQ161761_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
GQ161830_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
MZ962196_P_P-E      tttccagatattcatttgcaccaagacattattaacaaatgtgaacaatttgtaggtcct
GQ161755_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
GQ161835_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
MW455164_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
GQ161773_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
GQ161802_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
AB091255_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggccct
MN507843_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggccct
GQ161803_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
GQ161794_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
MZ962194_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
GQ161834_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
KU736894_P_P-E      tttcctgatattcatttgcaccaagacattattaacaaatgtgaacaatttgtaggtcct
GQ161771_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
KU736897_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
KU736898_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
MN507845_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
AB274976_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
KU736895_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
KU736896_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
AB274971_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
GQ161817_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
MN507846_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
MZ962193_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
AM494696_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
AM494694_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
AM494700_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
GQ161812_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
GQ161782_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
GQ161792_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
GQ161814_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
FJ349237_P_P-E      tttcctgatattcatttgcaccaggacattattaacagatgtgagcaatttgtaggtcct
FJ349238_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgagcaatttgtaggtcct
MW082636_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
GQ161832_P_P-E      tttcctgatattcatttgcaccaggacattattatcaaatgtgaacaatttgtaggtcct
KU736899_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
GQ161798_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
GQ161759_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
GQ161772_P_P-E      tttccagatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
GQ161787_P_P-E      tttccagatattcatttgcaccaagacattattaacaaatgtgaacaatttgtaggtcct
GQ161764_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
GQ161801_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
MZ962199_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
GQ161829_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
GQ161770_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
GQ161791_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
GQ161800_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
GQ161819_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
GQ161781_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
GQ161804_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
GQ161793_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
GQ161827_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
LT623843_P_P-E      tttcctgatattcatttgcaccakgacattattaacaaatgtgaacaatttgtaggtcct
FN594751_P_P-E      ttccctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
AB219533_P_P-E      ttccctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
FN594750_P_P-E      ttccctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
AB219529_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
MN507841_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
JQ000008_P_P-E      tttcctgatattcatttacaccaggacattattaacaaatgtgaacaatttgtaggtcct
JQ000009_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
KM606738_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
FN594749_P_P-E      ttccctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
KF849720_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
DQ060827_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
DQ060826_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
DQ060828_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
DQ060829_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
KF849715_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
AY738147_P_P-E      tttcctgatattcatttacaccaggacattattaacaaatgtgaacaatttgtaggtcct
AY738144_P_P-E      tttcctgatattcatttacaccaggacattattaacaaatgtgaacaatttgtaggtcct
AY738145_P_C-E      tttcctgatattcatttacaccaggacattattaacaaatgtgaacaatttgtaggtcct
AY738146_P_P-E      tttcctgatattcatttacaccaggacattattaacaaatgtgaacaatttgtaggtcct
FN594752_P_P-E      ttccctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
KF849723_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
KF849728_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
OM256457_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
AB201290_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
FN594763_P_P-E      ttccctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
KF170741_P_P-E      ttccctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
AB201289_P_P-E      ttccctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
AB915175_P_P-E      ttccctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
KF849724_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
KF849716_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
MH464856_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
KF849726_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
KF849717_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
DQ060822_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
DQ060823_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
KF849718_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
MH464855_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
DQ060824_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcca
KF849714_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
DQ060825_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
KF849725_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
KF849719_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
KF849721_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
KF849713_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
KF849722_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
MF772354_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
AY935700_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
KT192626_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
KF922438_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
KF922439_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
HM363610_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
HM363600_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
HM363592_P_P-E      tttcctgatattcatttgcaccaagacattattaacaaatgtgaacaatttgtgggtcct
HM363602_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
HM363585_P_P-E      tttcctgatattcatttgcatcaggacattattaacaaatgtgaacaatttgtaggtcct
HM363582_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
HM363583_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
HM363584_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
HM363601_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
HM363597_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
HM363591_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
HM363590_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
HM363588_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
HM363589_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
HM363604_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
HM363586_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
HM363587_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
HM363567_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
HM363568_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
EU239220_P_P-E      tttcctgatattcatttgcaccaagacattattaacaaatgtgaacaatttgtaggtcct
MZ962197_P_P-E      tttcctgacattcatttgcaccaggacattattaacagatgtgaacaatttgtaggtcct
AB915180_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
AB274984_P_P-E      tttcctgatattcatttgcaccaggacattatcaacaaatgtgagcaatttgtaggtcct
FN594762_P_P-E      tttcctgatattcatttgcaccaggacattattaataaatgtgaacaatttgtaggtcct
MZ962195_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgagcaatttgtaggtcct
LT623844_P_P-E      tttcctaatattcatctgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
HM363603_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtccc
FN594753_P_P-E      tttcctgatattcatttacaccaagacattattaacaaatgtgagcaatttgtaggtcct
FN594765_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
MF772358_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
MF772357_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgagcaatttgtaggtcct
HM363599_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
HM363565_P_P-E      tttcctgatattcatttgcaccaggatattattaacaaatgtgaacaatttgtaggtcct
HM363566_P_P-E      tttcctgatattcatttgcaccaggacattattgacaaatgtgaacaatttgtaggtcct
AB274973_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
FN545822_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
GQ161831_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
HM363605_P_P-E      tttcctgatatccatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
HM363606_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
FN594766_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
AM494711_P_P-E      tttcctgatattcatttgcaacaggacattatcaacaaatgtgaacaatttgtaggtcct
HM363596_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
MZ962189_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggccct
FN594760_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
AB274981_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
AB205190_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
GQ161796_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
HM363598_P_P-E      tttcctgatattcatttgcaccaggacattattaataaatgtgaacaatttgtaggtcct
GQ161825_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
LT623847_P_P-E      tttcctgaaattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
EU239222_P_P-E      tttcctgacattcatttgcaccaggacatcattaacaaatgtgtacaatttgtaggtcct
HM363608_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
FN545821_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
AB915178_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
AM494689_P_P-E      tttcctgatattcatttacaccaggacattattgacaaatgtgaacaatttgtaggtccc
GQ161762_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtccc
AM494712_P_P-E      tttcctgatattcatttgcaccaggatattattaacaaatgtgaacaatttgtaggtcct
AM494714_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
AM494692_P_P-E      tttcctgatattcatttacaccaggacattattaacaaatgtgagcaatttgtaggtcct
AM494710_P_P-E      tttcctgatattcatttacaccaggacattattaacaaatgtgaacaatttgtaggtcct
AM494709_P_P-E      tttcctgatattcatttacaccaggacattattaacaaatgtgaacaatttgtaggtcct
AM494697_P_P-E      tttcctgatattcatttacaccaggacattattaacaaatgtgaacaatttgtaggtcct
MH580650_P_P-E      tttcctgatattcatttacaccaggacattattaacaaatgtgaacaatttgtaggtcct
HM363607_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
AB274979_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
AB205188_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
FN594758_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
FN594759_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
MH580648_P_P-E      tttcccgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
AB274977_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
AB274975_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
LT623849_P_P-E      tttcctgmtattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
FN594748_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgagcaatttgttggtcct
MH580645_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
HM363572_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgcgaacaatttgtaggtcct
GQ161757_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgagcaatttgtaggtcct
FN594761_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
AM494691_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
KM606739_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgagcaatttgtaggtcct
MF772360_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
LT623845_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
LT623846_P_P-E      tttcctaatattcatttacaccaggacattattaacaaatgtgaacaattcgtaggtccg
AB201287_P_P-E      tttcctgatattcatttacaccaggacattattaacaaatgtgaacaatttgtaggtccc
HM363594_P_P-E      tttcctgatattcatttgcaccaggacattattaaaaaatgtgaacaatttgtaggtcct
AB274980_P_P-E      tttcctaatattcatttgcaccaggacattgttaacaaatgtgaacaatttgtaggtcct
KU736913_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
GQ161760_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtccc
MN507840_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
HM363595_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
AM494695_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
FJ349240_P_P-E      tttcctgagattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
GQ161758_P_P-E      tttcctgacattcatttgcaccaggacattattaacagatgtgaacaatttgtaggtcct
GQ161766_P_P-E      tttcctgacattcatttgcaccaggacattattaacagatgtgaacaatttgtaggtcct
GQ161774_P_P-E      tttcctgacattcatttgcaccaggacattattaacagatgtgaacaatttgtaggtcct
MT426115_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtccc
HM363579_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtccc
HM363580_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtccc
HM363581_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtccc
KT749841_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
AB091256_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
MH580626_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
FJ349226_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaacttgtaggtcct
MN967526_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
AM494703_P_P-E      tttcctgatattcatttacaccaggacattattaacaaatgtgaacaatttgtaggtcct
KU736902_P_P-E      tttcctgatattcatttgcaccaggatattattaacaaatgtgaacaatttgtaggtcct
KF170742_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
MK720631_P_P-E      tttcctgacattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
MK720632_P_P-E      tttcctgacattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
MK321264_P_P-E      tttcctgacattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
KU736904_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
AM494699_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtcggtcct
AM494698_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
AM494715_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtgggtcct
AM494693_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtgggtcct
AM494704_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtgggtcct
KU736910_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
KU736911_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaatgtgaacaatttgtaggtcct
KU736905_P_P-E      tttcctgatattcatttgcaccaggacattattaacaaa