HBVdb

Dataset for nucleotide sequence C of genotype E

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
       * **     *       ** ** *         *       *  ***   *      * ** * *    *   
ATGGACATTGACCCTTATAAAGAATTTGGAGCTACTGTGGAGTTACTCTCGTTTTTGCCTTCTGACTTCTTTCCTTCAGT
        c  t                     t c              t        gg c  t  t a   g  ca 
                                                  a         a                   
                                                            c                   

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
    *   *  *     *                 *    *   *  *          *      *              
AAGAGATCTTCTAGATACCGCCTCAGCTCTGTATCGGGATGCCTTAGAATCTCCTGAgCATTGTTCACCtCACCAcACtG
tca       t     t   g t   t c tc  a  a  t   g   t    a     ca    g  t  t  g 
                        c     a                                               a 
                                                                              c 

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   * * *          * ** ** **  *  * *      *    **  **** **    **  *  * *  *     
CACTCAGGCAAGCCATTCTTTGCTGGGGGGAacTAATGACTCTAGCTACCTGGGTGGGTGtaAATTTGGAAGATCCAGCA
 ta a        tg  t g  t      ct t   ta a   gc           g ct   ac c  c att  
             a   a             tg        t                  g                a  
                                a                                               

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *    **     *  *    ****  **   *      *               *  *  *  ** * **    **   
TCCAGGGACCTAGTAGTCAGTTATGTCAATACTAATATGGGCCTAAAGTTCAGGCAATTATTGTGGTTTCACATTTCTTG
  t  a  ttag   tg       t  c a c cg    at    a  t  a   c gc          t c   c  
        a  t   a                                                              
                                                                                

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  * *   * ** *        *      * *     ** ** *  ** *  ** **   ******       ** ** *
TCTCACTTTTGGAAGAGAAACCGTCaTAGAGTATtTGGTGTCTTTTGGAGTGTGGATTCGCACTCCTCCAGCTTATAGaC
ca t     c      c tgtt  tg        c    a  c  c                     aacc    c  g 
                  c  a   c                                          tt          
                         t                                                      

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*    **********     **  *   * * **   *    ** ****               ***  *   *  * **
CACCAAATGCCCCTATCTTATCAACACTTCCGGAGAaTACTGTTGTTAGACGAAGAG------GCAGGTCCCCTAGAAGA
 g               c             t  a c       a        c                        
                                    t                                           
                                                                                

       490       500       510       520       530       540       550        
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:...
 *   * ****   *  *  **   *   *  *** *   **  *  *  *  * * *                    
AGAACTCCCTCGCCTCGCAGACGAAGATCTCAATCGCCGCGTCGCAGAAGATCTCAATCTCcaGctTCcCAATGTTAG
c          a           c  g        a                         ggtaa  tagc      
                                                                g             
                                                                              
© 1998-2021Legal notice