Dataset for nucleotide sequence C of genotype E

[Download (right click)] [Edit] [Sequences] [Repertoires]

655 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

HM363611_C_P-E      atggacatcgacccttataaagaatttggagcttccgtggagttactctcttttttgcct
AB219534_C_P-E      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KY498770_C_P-E      -tggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB915180_C_P-E      atggacattgatccttataaagaatttggagctactgtggagttaatctcgtttttgcct
OK318680_C_P-E      atggacattgacccttataaagaatttggagcttctgccgagttactctcgtttttgcct
AB219529_C_P-E      atggacatcgacccttataaagaatttggagctactttgcagttactctcgtttttgcct
MH580648_C_P-E      atggacattgacccttataaagaatttggagctactgtcgagttactctcgtttttgcct
FN594748_C_P-E      atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgcct
AM494692_C_P-E      atggacatcgacccttataaagaatttggagcttctgtggatttactctcgtttttgcct
AM494787_C_P-E      atggacatcgacccttataaagaatttggagcttctgtggatttactctcgtttttgcct
HM363607_C_P-E      atggacatcgacccttataaagaatttggagcttccgtggagttactctcgtttttgcct
FN594761_C_P-E      atggacatygacccttataaagaatttggagctwctgkggagttactctcgtttttgcct
GQ491112_C_P-E      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH580645_C_P-E      atggacatcgacccttataaagaatttggagcttctgtcgagttactctcgtttttgcct
AB274979_C_P-E      atggacatcgacccttataaagaatttggagcgactgtgcagttactctcgtttttgcct
FN594762_C_P-E      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU239220_C_P-E      atggacatcgacccttataaagaatttggagctactgtggagttactctcttttttgcct
MF772357_C_P-E      atggacattgacccttataaagaatttggagctactgttgagttactctcttttttgcct
AB915178_C_P-E      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
HM363610_C_P-E      atggacatcgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
FN594766_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcck
MF772355_C_P-E      atggacatcgacccttataaagaatttggagcttctgtggagttactctcttttttgcct
HM363565_C_P-E      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF772358_C_P-E      atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccg
FN545823_C_P-E      atggacatcgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
OK318681_C_P-E      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
FN594758_C_P-E      atggacattgacccttataaagaatttggagctacagtggagttactctcgtttttgcct
FN594760_C_P-E      atggacattgacccttataaagaatttggagctagtgtggagttactctcgtttttgcct
FN594759_C_P-E      atggacattgacccttataaagaatttggagcttctgtgsagytactctcgtttttgcct
AB274977_C_P-E      atggacattgacccttataaagaatttggagctactgtagagttactctcgtttttgcct
LT623851_C_P-E      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MF772361_C_P-E      atggacatcgacccttataaagaatttggagctactgtggagttactctcttttttgcct
FN594751_C_P-E      atggacatcgacccttataaagaatttggagctastgtggagttactctcgtttttgccg
FN594763_C_P-E      atggacatcgacccttataaagaatttggagctagtgtggagttactctcgtttttgcct
FN594765_C_P-E      atggacattgacccttataaagaatttggagcttcygtggagttactctcktttttgccg
KF849724_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcct
HM363606_C_P-E      atggtcattgacccctataaagaatttggagctactgtggagttactctcgtttttgcct
HM363605_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcct
AM494786_C_P-E      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
HM363609_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
FN594753_C_P-E      atggacatcgacccttataaagaatttggagcttccgtggagttactctcgtttttgcct
KF849728_C_P-E      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
FN545842_C_P-E      atggacattgacccttataaagaatttggagctactgtsgagttactctcatttttgcct
LT623843_C_P-E      atggacatcgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
FN594756_C_P-E      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
AB219533_C_P-E      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
FN594749_C_P-E      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
HM363608_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB194948_C_P-E      atggacatcgacccttataaagaatttggagcttctgtggacttactctcgtttttgcct
HM363601_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ161768_C_P-E      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
AM494691_C_P-E      atggacatcgacccttataaagagtttggagctactgtggagttactctcgtttttgcct
AB274975_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
HM363603_C_P-E      atggacattgacccttataaagaatttggagctagtgtggagttactctcgtttttgcct
AB205188_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB274976_C_P-E      atggatattgacccttataaagaatttggagctactgtggagttgctctcgtttttgcct
AM494791_C_P-E      atggacattgaccctcataaagaatttggagctactgtggagttactctcgtttttgcct
AM494793_C_P-E      atggacattgaccctcataaagaatttggagctactgtggagttactctcgtttttgcct
HM363598_C_P-E      atggacattgacccttataaagaatttggaggtactgtggagttactctcgtttttgcct
HM363566_C_P-E      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
GQ161811_C_P-E      atggacatygacccttataaagaatttggagcttctgtggagttactctcttttttgcct
LT623847_C_P-E      atggacattgacccttataaagaatttggagctactgtgcagttactctcgtttttgcct
HM363602_C_P-E      atggtcattgacccttataaagaatttggcgcttctgtggagttactctcgtttttgcct
GQ161807_C_P-E      atggacattgacccgtataaagaatttggagcttctgtggagttactctcgtttttgcct
HM363597_C_P-E      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
GQ161786_C_P-E      atggacatcgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MN507840_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
LT623849_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
HM363604_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
HM363578_C_P-E      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
GQ161823_C_P-E      atggacatcgacccttatgaagaatttggagctactgtggagttactctcgtttttgcct
HM363600_C_P-E      atggacatcgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
AM494695_C_P-E      atggacattgacccttataaagaatttggagcttctgttgagttactctcgtttttgcct
AB274984_C_P-E      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KU736913_C_P-E      atggacattgacccttataaagaatttggagctwstgtggagttgctctcgtttttgcct
AB274982_C_P-E      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
FJ349240_C_P-E      atggacattgatccttataaagaatttggagctactgtggagttactctcttttttgcct
KT749841_C_P-E      atggacattgacctttataaagaatttggagctactgtggagttactctcgtttttgcct
MH580626_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MW455164_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606739_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ161783_C_P-E      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
GQ161824_C_P-E      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
HM363599_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ161796_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AM494792_C_P-E      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF849726_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF849720_C_P-E      atggtcatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF849713_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH464855_C_P-E      nnnnnnattgacccttataanngatttggagctactgtggagttactctcgtttttgcct
AB201290_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT192626_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB274973_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF849725_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY935700_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
OM256457_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH464856_C_P-E      atggacattgacccttataaaggatttggagctactgtggagttactctcgtttttgcct
KF849727_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF849719_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttcctctcgtttttgcct
KF849717_C_P-E      atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgcct
KF849716_C_P-E      atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgcct
AY738144_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY738145_C_C-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY738147_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY738146_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF922439_C_P-E      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KF849722_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ000009_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MN507841_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
DQ060823_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
DQ060822_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF772354_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF922438_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF849721_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF849715_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF849723_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF849714_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttacyctcgtttttgcct
DQ060824_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
DQ060825_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU620071_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
LT623842_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT731872_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ161797_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
FN545822_C_P-E      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB274980_C_P-E      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MH725192_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU239222_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB274985_C_P-E      atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgcct
HM363575_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
HM363576_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
FN594752_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
FN545827_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
FN545821_C_P-E      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF849718_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB106564_C_C-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MN507842_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU239219_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU239223_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ161773_C_P-E      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
GQ161802_C_P-E      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MW455162_C_P-E      atggacattgacccttataaagaatttggagcgtctgtggagttactctcgtttttgcct
HM363587_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ161826_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ161757_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MW455165_C_P-E      atggacattgacccttataaagaatttggagcgtctgtggagttactctcgtttttgcct
KU736911_C_P-E      atggacatygacccttataaagaatttggagctactgtgsagttactctcgtttttgcct
KU736909_C_P-E      atggacatygacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ161834_C_P-E      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AM494714_C_P-E      atggacattgacccttataaagaatttggagctagtgtggagttactctcgtttttgcct
MT731911_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB274981_C_P-E      atggacattgacccttataaagaatttggagctactgtcgagttactctcgtttttgcct
LT623844_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AM494703_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AM494800_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
HM363594_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
HM363596_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MW455163_C_P-E      atggacattgacccttataaagaatttggagcgtctgtggagttactctcgtttttgcct
GQ161820_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ161775_C_P-E      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
EU239217_C_P-E      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB205191_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB091256_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MN967527_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AM494706_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH580650_C_P-E      atggacattgacccttataaagaatttggagctactgaggagttactctcgtttttgcct
AM494710_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AM494709_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AM494697_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AM494789_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MW082636_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ161815_C_P-E      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ161812_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB201287_C_P-E      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
FN594750_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
HM363590_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
HM363588_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
HM363589_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KU736892_C_P-E      atggacatagacccttataaagaatttggagctactgtggagttactctcgtttttgcct
HM363574_C_P-E      atggacattgacccttataaagaatttggagctactgtggaattactctcgtttttgcct
GQ161814_C_P-E      atggacatygacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB201288_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MW679683_C_P-E      atggacattgacccttataaagaatttggagcgtctgtggagttactctcgtttttgcct
MT427111_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
LT623848_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
LT623845_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606738_C_P-E      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
HM363595_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ161803_C_P-E      atggacattgacccttataaagaatttggagctactgaggagttactctcgtttttgcct
EU239224_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccg
AM494797_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccg
AM494711_C_P-E      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AM494698_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB274978_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MW679682_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700551_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
HM363593_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY739674_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY739675_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH580633_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH580631_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH580632_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH580652_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB274974_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH580624_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH580629_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH580646_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH580649_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
HM363573_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB194947_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH580647_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH580634_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH580635_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH580636_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KY271392_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH580621_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH580622_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH580625_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH580637_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
HM363583_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
HM363584_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ161782_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ161792_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF170741_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ161755_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MZ962196_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MZ962190_C_P-E      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ161760_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH580638_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB205129_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccg
AB205192_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccg
HM363582_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
HM363585_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MW401520_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KU736904_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KU736893_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
HM363577_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ161835_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ161794_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ161785_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttgctctcgtttttgcct
GQ161780_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ161762_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AM494796_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB205190_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MZ962191_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ161758_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcct
GQ161766_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcct
GQ161774_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcct
MZ962197_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcct
KU736902_C_P-E      atggacatagacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB201289_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB915175_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427118_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427113_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427123_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427140_C_P-E      atggacattgacccttatatagattttggagctactgtggagttactctcgtttttgcct
MT427112_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427197_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427196_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427186_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427187_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427171_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427170_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427163_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427156_C_P-E      atggacattgacccttataaagaattgggagctactgtggagttactctcgtttttgcct
MT427145_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427141_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427138_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427133_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427160_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427132_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427131_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcct
MT427121_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427126_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427120_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427114_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427115_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427147_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427193_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427110_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427144_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427150_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427116_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427117_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427119_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427122_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427124_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427125_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427127_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427128_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427129_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427130_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427134_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427135_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427136_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427137_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427139_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427142_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427143_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427146_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427148_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427149_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427151_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427152_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427155_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427157_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427158_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427159_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427161_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427162_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427164_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427165_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427166_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427167_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427168_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427169_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427172_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427173_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427174_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427175_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427176_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427177_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427178_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427179_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427180_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427181_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427182_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427183_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427184_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427185_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427188_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427189_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427190_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427191_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427192_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427194_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427195_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427198_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427199_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427200_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427201_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427153_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT427154_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KU736912_C_P-E      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB274972_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MZ962189_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU239218_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MW455161_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ161833_C_P-E      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ161756_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ161795_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MN507844_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725114_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
LT623850_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KU736901_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KU736900_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ161759_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
HM363569_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
HM363570_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
HM363567_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
HM363568_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ161778_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ161810_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH580640_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH580641_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH580617_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
MH580628_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
MH580644_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
GQ161763_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ161777_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
FJ349237_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
FJ349238_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AM494694_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AM494696_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AM494700_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB205189_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU239221_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
DQ060826_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
DQ060827_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
DQ060828_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
DQ060829_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MZ962195_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ161790_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ161808_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KU736895_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctygtttttgcct
KU736896_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
HM363592_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
HM363586_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
HM363591_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MN967526_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
HM363579_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
HM363580_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
HM363581_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT426115_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725020_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725021_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725042_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
X75657_C_P-E        atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MZ962194_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MZ962192_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MN507846_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MN507845_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KU736910_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KU736897_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KU736898_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KU736894_C_P-E      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KU736891_C_P-E      atggacatagacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF170742_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ000008_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ161832_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcct
GQ161771_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
FJ349226_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AM494806_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AM494803_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AM494794_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB274969_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ161801_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ161772_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ161764_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ161787_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ161770_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ161800_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ161819_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ161829_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ161791_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ161793_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ161827_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MN507843_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MN507848_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MZ962199_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AM494701_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AM494707_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH580630_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MN967529_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH918655_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KU736903_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
HM363571_C_P-E      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
EU239226_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AM494807_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AM494805_C_P-E      atggacattgacccttataaagaatttggagctgctgtggagttactctcgtttttgcct
AM494804_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AM494802_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AM494795_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AM494705_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AM494801_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AM494702_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AM494798_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AM494799_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AM494689_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AM494690_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AM494693_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AM494699_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AM494704_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AM494708_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AM494712_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AM494715_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AM494717_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AM494788_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AM494790_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ161816_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
HM363572_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KU736905_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KX186584_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH580614_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH580615_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH580616_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH580618_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH580619_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH580620_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH580623_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH580651_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK321264_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK720631_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK720632_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MN967528_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MN507847_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
FN545841_C_P-E      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AM494713_C_P-E      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KU736906_C_P-E      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KU736907_C_P-E      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KU736908_C_P-E      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KU736899_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ161836_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ161769_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ161779_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ161765_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ161761_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
FJ349239_C_P-E      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB091255_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB274971_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ161776_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ161781_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ161784_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ161789_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ161798_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ161804_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ161817_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ161828_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MZ962193_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MZ962198_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP857055_C_P-E      atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgcct
GQ161825_C_P-E      atggaccttgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF798275_C_P-E      atggacattgacccttataaagaatttggagcgactgtggagttactctcatttttgcct
X85274_C_P-E        atggacattgatccttataaagaatttggagcttctgtggagttactatcgtttttgcct
KP857010_C_P-E      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
AY269055_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP856973_C_P-E      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MF772356_C_P-E      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KF798305_C_P-E      atggacatcgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
EU726953_C_P-E      atggacattgacccttataaagaatttggagcttctgtgcagttactctcgtttttgcct
KP856998_C_P-E      atggacatcgacccttataaagaatttggagctactatagagttactctcgtttttgcct
KP856982_C_P-E      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
EU726883_C_P-E      atggacattgacgcttataaagaatttggagctactgtggagttactctcgtttttgcct
KP857001_C_P-E      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KP857011_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF798259_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF798270_C_P-E      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
KF798298_C_P-E      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
MF772359_C_P-E      atggacattgacccttataaagaattaggagctactgtggagttactctcgtttttacat
AF350211_C_P-E      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
AF350127_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350161_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350164_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350139_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350167_C_P-E      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350134_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350135_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350208_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
AF350184_C_P-E      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
AF350187_C_P-E      atggacattgacccttataaagaatttggagcttctgtggagttactctcctttttgcct
GQ161831_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350110_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AM494808_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AM494810_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AM494809_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AM494811_C_P-E      atggacgttgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AM494812_C_P-E      atggacattgacccttacaaagaatttggagctactgtggagttactctcgtttttgcct
AF350176_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350117_C_P-E      atggacattgacccttataaagaatttggagccactgtggagttactctcgtttttgcct
AF350153_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350132_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350133_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350169_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350131_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350122_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350190_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350155_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350125_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350130_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350144_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350168_C_P-E      atggacattgactcttataaagaatttggagcttctgtggagttactctcgtttttgcct
AF350154_C_P-E      atggacattgacccttataaagaatttggagctactgtggagtcactctcgtttctgcct
AF350145_C_P-E      atggacattgacccttataaagaatttggagctactgtgcagttactctcgtttttgcct
AF350105_C_P-E      atggacattgacccttataaagaatttggagctactgaggagttactctcgtttttgcct
AF350210_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350206_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350177_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350146_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350205_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350188_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350212_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350213_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725141_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350142_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350143_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350207_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
AF350209_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
LT623846_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350182_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350123_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350149_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF772360_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
DQ060830_C_P-E      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700550_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700552_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF772362_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350175_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350112_C_P-E      atggacattgacccttataaagaatttggagctactgtggagatactctcgtttttgcct
AF350137_C_P-E      atggacattgacccttataaagaatttggagctactgaggagttactctcgtttttgcct
AF350107_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350103_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350109_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350114_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350219_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350220_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350180_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350181_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725010_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725024_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350198_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350199_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350202_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350172_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350150_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350200_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350201_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350179_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350115_C_P-E      atggacattgacccttataaagaatttggagctactgaggagttactctcgtttttgcct
AF350116_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB274970_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350215_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgttttggcct
AF350151_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350126_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350214_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350218_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350203_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350197_C_P-E      atggacattgacccttataaagaatttggagccactgtggagttactctcgtttttgcct
AF350166_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350183_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350159_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350160_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350140_C_P-E      atggacatcgacccttataaagaatttggagctacagtggagttactctcgtttttgcct
AF350141_C_P-E      atggacatcgacccttataaagaatttggagctacagtggagttactctcgtttttgcct
AF350111_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350101_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350191_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350204_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350186_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350136_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350173_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350216_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350217_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350185_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350147_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350128_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350113_C_P-E      atggacattgactcttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350106_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350100_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350165_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350152_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350120_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350121_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350148_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350124_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350158_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350156_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350157_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350104_C_P-E      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350162_C_P-E      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350163_C_P-E      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350189_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350171_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350170_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350178_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350118_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350099_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350102_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350119_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350174_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350192_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350193_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350194_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350195_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350196_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350108_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350138_C_P-E      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
                           * **     *       ** ** *         *       *  ***   *  

HM363611_C_P-E      actgacttctatccttccgtaagagatcttctagataccgcctcagctctgtttagggat
AB219534_C_P-E      actgacttctttccttccgtaagagatcttctagataccgcctccgctctgtttcgggat
KY498770_C_P-E      wctgacttctttccttccgtccgagatctccttgacaccgcctcagcrctgtatcgggaa
AB915180_C_P-E      agtgacttctttccttckgtacgagatctactagataccgcctcagctctgtttcgggat
OK318680_C_P-E      gctgacttctttccttcartaagagatcttctagataccgccaaagcgctgtttcaggat
AB219529_C_P-E      ggtgatttctttccttcagtaagagatcttctagataccgcctcagctctgtttcgggat
MH580648_C_P-E      cctgacttctttccttcagtaaaagatcttctagataccatctcagctctgtttcgggat
FN594748_C_P-E      tctgacttctatccttcagtaagagatcttctagataccgcctcagctctctatcgggat
AM494692_C_P-E      tctgacttctttccttcggttcgagatctcctagacactgccttagctctgtatcgggat
AM494787_C_P-E      tctgacttctttccttcggttcgagatctcctagacactgccttagctctgtatcgggat
HM363607_C_P-E      tctgatttctttccttcagtaagagatattatagatactgcctcaggtttgtttcgggat
FN594761_C_P-E      tctgacttctttccttcagtaagagatctactagataccgcctcagctctctgtcggggt
GQ491112_C_P-E      tctgacttctttccttcggttcgagatctcctagacactgcctcagctctgtatcgggat
MH580645_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtttcgggat
AB274979_C_P-E      ggtgaattctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggaa
FN594762_C_P-E      tctgacttctttccttccgtaagagatcttctagataccgcctcagctctctttcgggat
EU239220_C_P-E      ggtgacttctttccttcagtaagagatcttctagataccgccacagctctgtatcgggat
MF772357_C_P-E      gctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtttcgggat
AB915178_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
HM363610_C_P-E      cctgatttctttccttcagtaagagatcttctggataccgccgcagctttgtttcgggat
FN594766_C_P-E      tctgacttctttccttcagtaaaagatcttctagataccgcctcagctctgtatagggat
MF772355_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctctgctctgtatcgggat
HM363565_C_P-E      cttgacttctttccttcagtaaaagatcttctagataccgcctcagctctatatcgggat
MF772358_C_P-E      gctgacttctatccttcagtaaaagatcttctagattccgccacagctctgtttcgggat
FN545823_C_P-E      tctgacttctttccttcrgtaaragatctcctagataccgcctcagctctgtttcgggat
OK318681_C_P-E      kstgacttctttccttcagtaagagatcttctagataccgccgcagctctgtatcgsgat
FN594758_C_P-E      tctgacttctttccttcagtaaaagatcttctagataccgcctcagctctgtatcgggat
FN594760_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
FN594759_C_P-E      tctgacttctttccttcagtaagagatctcctagataccgcctcagctctgtatcgggat
AB274977_C_P-E      actgacttctttccttcagtaagagatcttctagataccgcctcagctttgtatcgggat
LT623851_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgccacagctctgtatcgggat
MF772361_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcggctctgtttcggcat
FN594751_C_P-E      tctgatttctttccgtcagtaagagatcttctagataccgcctcagctctgtatcgggat
FN594763_C_P-E      tctgatttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
FN594765_C_P-E      tctgacttctttccttcagtaaaagatcttctagataccgcctcagctctgtatcgggat
KF849724_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctctgctctgtttcgggat
HM363606_C_P-E      tccgacttctttccttcagtaagagatcttctagataccgcctcagctttgtatcgggat
HM363605_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcatcagctctgtatcgggat
AM494786_C_P-E      tccgacttctttccttcagtaaaagatcttctagataccgcctcagctctgtatcgggat
HM363609_C_P-E      tctgacttctttccttcagtaagagatcttttggtaaccgctccggctcggaaccggaat
FN594753_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
KF849728_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctctgctttgtttcgggat
FN545842_C_P-E      ggtgacttctttccttcagtaagagatcttctagataccgcccaagctctgtttcgggat
LT623843_C_P-E      tctgatttctttccttcagtaagagatcttctagataccgccagagctctgtttcgggat
FN594756_C_P-E      tctgacttctttccttcagtaagagatcttctagatacagcctcagctctgtatcgtgat
AB219533_C_P-E      actgatttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
FN594749_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcaactctgtatcgggat
HM363608_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtttcgggat
AB194948_C_P-E      gccgacttctttccttcagtaagagatcttctagatactgcctcagctctgtatcgggat
HM363601_C_P-E      gccgacttctttccttcagtaagagatcttctagataccgcttcagctctgtttcgggat
GQ161768_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcatcagctctgtatcgagat
AM494691_C_P-E      aatgacttctttccttccgtaagagatcttctagataccgcctcagctctgtatcgggat
AB274975_C_P-E      gttgacttctatccttcagtaagagatcttctagataccgcctcagctctgtttcgggat
HM363603_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcccaagctctgtatcgggat
AB205188_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgagat
AB274976_C_P-E      actgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AM494791_C_P-E      tctgacttctttccgtccgtaagagatcttctagataccgcctcagctctgtatcgggat
AM494793_C_P-E      tctgacttctttccttccgtaagagatcttctagataccgcctcagctctgtatcgggat
HM363598_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctttgtatcgggat
HM363566_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
GQ161811_C_P-E      tctgacttctttccttcagcaagagatcttctagatacygcctcagctctgtatcgggat
LT623847_C_P-E      cctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
HM363602_C_P-E      tccgacttctttccttcagtaagagatcttatagataccgcctcagctttgtatcgggat
GQ161807_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
HM363597_C_P-E      tctgacttctttccttcaataagagatcttctagataccgcctcagctctgtatcgggat
GQ161786_C_P-E      tctgacttctttccttcagtaagagatcttctagataccggcccagctctgtatcgggat
MN507840_C_P-E      catgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
LT623849_C_P-E      wctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
HM363604_C_P-E      tctgacttctttccttcaataagagatcttctagataccgcctcagctctcttccgggat
HM363578_C_P-E      tctgacttctttccttcagtgagagatcttctagataccgcctcagctctgtttcgggat
GQ161823_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
HM363600_C_P-E      tccgacttctttccttcagtaagagatcttctagatactgcctcagctctgtttcgggat
AM494695_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctccgctctgtatcgggat
AB274984_C_P-E      gctgacttctatccttcagtaaaagatcttctagataccgcctcagctctgtatcgggat
KU736913_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AB274982_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
FJ349240_C_P-E      cctgacttctttccttcagtaagagatcttctagataccgccaaagctctgtttcgggat
KT749841_C_P-E      actgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MH580626_C_P-E      tctgacttttttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MW455164_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
KM606739_C_P-E      gctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtttcgggat
GQ161783_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctctatcgggat
GQ161824_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctctatcgggat
HM363599_C_P-E      actgacttctttccttcagtaagagatcttctagatactgcatcagctctgtttcgggat
GQ161796_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AM494792_C_P-E      tctgacttctttccttccgtaagagatcttctagataccgccgcagctctgtatcgggat
KF849726_C_P-E      tctgacttctttccgtcagtaagagaccttctagataccgcctctgctctgtatcgggat
KF849720_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctctgctctgtatcgggat
KF849713_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctctgctctgtatcgggat
MH464855_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctctgctctgtatcgggat
AB201290_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctctgctctgtatcgggat
KT192626_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctctgctctgtatcgggat
AB274973_C_P-E      tctgacttctttccttcagtaaaagatcttctagataccgcctcagctctgtatcgggat
KF849725_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctctgctctgtatcgggat
AY935700_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctctgctctgtatcgggat
OM256457_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctctgctctgtatcgggat
MH464856_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctctgctctgtatcgggat
KF849727_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctctgctctgtatcgggat
KF849719_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctctgctctgtatcgggat
KF849717_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctctgctctgtatcgggat
KF849716_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctctgctctgtatcgggat
AY738144_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctctgctctgtatcgggat
AY738145_C_C-E      tctgacttctttccttcagtaagagatcttctagataccgcctctgctctgtatcgggat
AY738147_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctctgctctgtatcgggat
AY738146_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctctgctctgtatcgggat
KF922439_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctctgctctgtatcgggat
KF849722_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctctgctctgtatcgggat
JQ000009_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MN507841_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
DQ060823_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctctgctctgtatcgggat
DQ060822_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctccgctctgtatcgggat
MF772354_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctctgctctgtatcgggat
KF922438_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctctgctctgtatcgggat
KF849721_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctctgctctgtatcgggat
KF849715_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctctgctctgtatcgggat
KF849723_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctctgctctgtatcgggat
KF849714_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctctgctctgtatcgggat
DQ060824_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctctgctctgtatcgggat
DQ060825_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctctgctctgtatcgggat
EU620071_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctctgctctgtatcgggat
LT623842_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT731872_C_P-E      cctgacttctttccttcagtaagagatcttctagataccgccaaagctctgtttcgggat
GQ161797_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
FN545822_C_P-E      tctgacttctttccttcagttagagatcttctagataccgcctcagctctgtttcgggat
AB274980_C_P-E      gctgacttctwtccgtcagtaaaagatcttctagataccgcctcagctctgtatcgggat
MH725192_C_P-E      tctgacttctttccttccgtaagagatcttctagataccgcctcagctctgtatcgggat
EU239222_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AB274985_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
HM363575_C_P-E      tctgacttctttccttcagtaagagatcttctagatactggctcatctctgtatggggat
HM363576_C_P-E      tctgacttctttccttcagtaagagatcttctagatactggctcatctctgtgtggggat
FN594752_C_P-E      tctgatttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
FN545827_C_P-E      tctgacttctttccttcagtaaragatcttctagataccgcctcagctctgtatagggat
FN545821_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
KF849718_C_P-E      tcygacttctttccttcagtaagagatcttytagataccgcctctgctctgtatcgggat
AB106564_C_C-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctctatcgggat
MN507842_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctctatcgggat
EU239219_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctctatcgggat
EU239223_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctttatcgggat
GQ161773_C_P-E      tctgacttctttccttcaataagagatcttctagataccgcctcagctctgtatcgggat
GQ161802_C_P-E      tctgacttctttccttcaataagagatcttctagataccgcctcagctctgtatcgggat
MW455162_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
HM363587_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
GQ161826_C_P-E      tctgacttctttccttcagtaaaagatcttctatataccgcctcagctctgtatcgggat
GQ161757_C_P-E      actgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MW455165_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
KU736911_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
KU736909_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
GQ161834_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AM494714_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT731911_C_P-E      tctgacttctttccttcagtaagagatcttctagatacagcctcagctctgtatcgggat
AB274981_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctttgtttcgggat
LT623844_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AM494703_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AM494800_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
HM363594_C_P-E      tctgacttctttccttcagtaagagctcttctagataccgcctcagctctgtttcgggat
HM363596_C_P-E      tctgacttctttccttcagtaagagctcttctagataccgcctcagctctgtttcgggat
MW455163_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
GQ161820_C_P-E      tctgacttctttcattcagtaagagatcttctagataccgcctcagctctgtatcgggat
GQ161775_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
EU239217_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AB205191_C_P-E      tccgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AB091256_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MN967527_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AM494706_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MH580650_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AM494710_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AM494709_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AM494697_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AM494789_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MW082636_C_P-E      tcggacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
GQ161815_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctctatcgggat
GQ161812_C_P-E      tctgacttctttccttcagtaagagatcttttagattccgcatcagctatgtttcgggat
AB201287_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
FN594750_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
HM363590_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
HM363588_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcttcagctctgtatcgggat
HM363589_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcttcagctctgtatcgggat
KU736892_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
HM363574_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
GQ161814_C_P-E      tctgacttctttcattcagtaagagatcttctagataccgcctcagctctgtatcgggat
AB201288_C_P-E      tctgacttctttccttcggttagagatcttctagataccgcctcagctctgtatcgggat
MW679683_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427111_C_P-E      tctgacttctttccttcagtaagagatgttctagataccgcctcagctctgtatcgggat
LT623848_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
LT623845_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
KM606738_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctccgctctgtatcgggat
HM363595_C_P-E      tccgacttctttccttcagtaagagatcttatagatactgcctcagctttgtatcgggat
GQ161803_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
EU239224_C_P-E      tctgacttctttccttcagtaagggatcttctagataccgcctcagcactgtatcgggat
AM494797_C_P-E      tctgacttctttcctgcagtaagagatcttctagataccgcctcagctctgtatcgggat
AM494711_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AM494698_C_P-E      tctgacttttttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AB274978_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtaccgggat
MW679682_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
HQ700551_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
HM363593_C_P-E      tcggacttctttccttcagtaagagatcttctagataccgcctcagctctgtttcgggat
AY739674_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AY739675_C_P-E      tctgacttctttccttcagtaaaagatcttctagataccgcctcagctctgtatcgggat
MH580633_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MH580631_C_P-E      tctgacttttttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MH580632_C_P-E      tctgacttttttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MH580652_C_P-E      tctgacttttttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AB274974_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MH580624_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MH580629_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MH580646_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MH580649_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
HM363573_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctttgtatcgggat
AB194947_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MH580647_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MH580634_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MH580635_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MH580636_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
KY271392_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MH580621_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MH580622_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MH580625_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MH580637_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
HM363583_C_P-E      tctgacttctttccgtcagtaagagatcttctagatactgcctccgcgctgtatcgggat
HM363584_C_P-E      tctgacttctttccgtcagtaagagatcttctagatactgcctccgcgctgtatcgggat
GQ161782_C_P-E      tctgatttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
GQ161792_C_P-E      tctgatttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
KF170741_C_P-E      tctgatttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
GQ161755_C_P-E      tctgacttctttccttcagtaagggatcttctagataccgcctcagctttgtatggggat
MZ962196_C_P-E      tctgacttctttccttcagtaagggatcttctagataccgcctcagctttgtatggggat
MZ962190_C_P-E      tctgacttctttccttcagtaagggatcttctagataccgcctcagctttgtatggggat
GQ161760_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MH580638_C_P-E      tctgacttctttccttcagtaagagatcttctagatactgcctcagctctgtatcgggat
AB205129_C_P-E      tctgacttctttccgtcagttagagatcttctagataccgcctcagctctgtatcgggat
AB205192_C_P-E      tctgacttctttccgtcagttagagatcttctagataccgcctcagctctgtatcgggat
HM363582_C_P-E      tctgacttctttccgtcagtaagagatcttctagatactgcctcagctctgtatcgggat
HM363585_C_P-E      tccgacttctttccttcagtaagagatcttctagatactgcctcagctctgtatcgggat
MW401520_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
KU736904_C_P-E      tctgacttytttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
KU736893_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctttatcgggat
HM363577_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
GQ161835_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctttgtatcgggat
GQ161794_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
GQ161785_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
GQ161780_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgrgat
GQ161762_C_P-E      tctgacttctttcattcagtaagagatcttctagataccgcctcagctctgtatcgggat
AM494796_C_P-E      gctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AB205190_C_P-E      tctgacttctttccttcagttagagatcttctagataccgcctcagctctgtatcgggat
MZ962191_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
GQ161758_C_P-E      tctgacttctttccttcagtaaaagatcttctagataccgcctcagctctgtatcgggat
GQ161766_C_P-E      tctgacttctttccttcagtaaaagatcttctagataccgcctcagctctgtatcgggat
GQ161774_C_P-E      tctgacttctttccttcagtaaaagatcttctagataccgcctcagctctgtatcgggat
MZ962197_C_P-E      tctgacttctttccttcagtaaaagatcttctagataccgcctcagctctgtatcgggat
KU736902_C_P-E      tctgacttttttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AB201289_C_P-E      tctgatttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AB915175_C_P-E      tctgatttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427118_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427113_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427123_C_P-E      tcttacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427140_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427112_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427197_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427196_C_P-E      tctgacttcttttcttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427186_C_P-E      tctgacttctttccttcagtaagagatctcctagataccgcctcagctctgtatcgggat
MT427187_C_P-E      tctgacttctttccttcagtaagagatctcctagataccgcctcagctctgtatcgggat
MT427171_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427170_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427163_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427156_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427145_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427141_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427138_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427133_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427160_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427132_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427131_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427121_C_P-E      cctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427126_C_P-E      cctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427120_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427114_C_P-E      tctgacttctttccttcagtaagagatcttctggataccgcctcagctctgtatcgggat
MT427115_C_P-E      tctgacttctttccttcagtaagagatcttctggataccgcctcagctctgtatcgggat
MT427147_C_P-E      tctgacttctttccttcagtaagagatcttctggataccgcctcagctctgtatcgggat
MT427193_C_P-E      tctgacttctttccttcagtaagagatcttctggataccgcctcagctctgtatcgggat
MT427110_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427144_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427150_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427116_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427117_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427119_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427122_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427124_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427125_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427127_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427128_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427129_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427130_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427134_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427135_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427136_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427137_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427139_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427142_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427143_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427146_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427148_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427149_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427151_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427152_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427155_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427157_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427158_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427159_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427161_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427162_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427164_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427165_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427166_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427167_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427168_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427169_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427172_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427173_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427174_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427175_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427176_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427177_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427178_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427179_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427180_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427181_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427182_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427183_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427184_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427185_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427188_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427189_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427190_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427191_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427192_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427194_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427195_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427198_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427199_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427200_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427201_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427153_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT427154_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
KU736912_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AB274972_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MZ962189_C_P-E      tctgacttctttcattcagtaagagatcttctagataccgcctcagctctgtatcgggat
EU239218_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MW455161_C_P-E      catgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
GQ161833_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
GQ161756_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
GQ161795_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MN507844_C_P-E      tctgacttctttcattcagtaagagatcttctagataccgcctcagctctgtatcgggat
MH725114_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
LT623850_C_P-E      tctgacttctttccttccgtaagagatcttctagataccgcctcagctctgtatcgggat
KU736901_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
KU736900_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
GQ161759_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
HM363569_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
HM363570_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
HM363567_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
HM363568_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
GQ161778_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
GQ161810_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MH580640_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MH580641_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MH580617_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MH580628_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MH580644_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
GQ161763_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
GQ161777_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
FJ349237_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
FJ349238_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AM494694_C_P-E      tccgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AM494696_C_P-E      tccgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AM494700_C_P-E      tccgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AB205189_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
EU239221_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
DQ060826_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctccgctctgtatcgggat
DQ060827_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctccgctctgtatcgggat
DQ060828_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctccgctctgtatcgggat
DQ060829_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctccgctctgtatcgggat
MZ962195_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
GQ161790_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
GQ161808_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
KU736895_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
KU736896_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
HM363592_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
HM363586_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctttgtatcgggat
HM363591_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MN967526_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
HM363579_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
HM363580_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
HM363581_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MT426115_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MH725020_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MH725021_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MH725042_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
X75657_C_P-E        tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MZ962194_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MZ962192_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MN507846_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MN507845_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
KU736910_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
KU736897_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
KU736898_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
KU736894_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
KU736891_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
KF170742_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
JQ000008_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctctgctctgtatcgggat
GQ161832_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
GQ161771_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
FJ349226_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AM494806_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AM494803_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AM494794_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AB274969_C_P-E      tctgacttctttccttcagtaagagatctgctagataccgcctcagctctgtatcgggat
GQ161801_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
GQ161772_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
GQ161764_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
GQ161787_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
GQ161770_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
GQ161800_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
GQ161819_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
GQ161829_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
GQ161791_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
GQ161793_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctctatcgggat
GQ161827_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctctatcgggat
MN507843_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MN507848_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MZ962199_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AM494701_C_P-E      tctgacttctttccttcagtaagagatcttttagataccgcctcagctctgtatcgggat
AM494707_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MH580630_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MN967529_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MH918655_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
KU736903_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
HM363571_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
EU239226_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AM494807_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AM494805_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AM494804_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AM494802_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AM494795_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AM494705_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AM494801_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AM494702_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AM494798_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AM494799_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AM494689_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AM494690_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AM494693_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AM494699_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AM494704_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AM494708_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AM494712_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AM494715_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AM494717_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AM494788_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AM494790_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
GQ161816_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
HM363572_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
KU736905_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
KX186584_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MH580614_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MH580615_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MH580616_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MH580618_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MH580619_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MH580620_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MH580623_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MH580651_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MK321264_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MK720631_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MK720632_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MN967528_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MN507847_C_P-E      tctgacttctttcattcagtaagagatcttctagataccgcctcagctctgtatcgggat
FN545841_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AM494713_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
KU736906_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
KU736907_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
KU736908_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
KU736899_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
GQ161836_C_P-E      tctgacttctttcattcagtaagagatcttctagataccgcctcagctctgtatcgggat
GQ161769_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
GQ161779_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
GQ161765_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
GQ161761_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
FJ349239_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AB091255_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AB274971_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
GQ161776_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
GQ161781_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
GQ161784_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
GQ161789_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
GQ161798_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
GQ161804_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
GQ161817_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
GQ161828_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MZ962193_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MZ962198_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
KP857055_C_P-E      tctgacttctttccttcggtacgagatcttctagataccgcctcagccctgtatcgggat
GQ161825_C_P-E      ggtgacttctttccttcagtaagagatcttctatataccgcctcagctctgtatcgggat
KF798275_C_P-E      tctgatttctttccgtctgtacgagatcttctagataccgccgcagctctatatcgggat
X85274_C_P-E        aatgacttctatccttcagtaagagatcttctagataccgcctcagctctatatcgggaa
KP857010_C_P-E      tctgacttctttccttccgtacgagatcttctagataccgcctcagctctgtttcgggat
AY269055_C_P-E      tctgacttttttccttctgtacgagatcttctagacaccgccgcggctctgtatcgggat
KP856973_C_P-E      caggacttctttccttcagtacgcgatcttctagataccgcctcagctctgtatcggcaa
MF772356_C_P-E      cctgacttctttccttcagtaaaagatcttctagataccgcctcagctctatttcgggat
KF798305_C_P-E      tctgacttctttccttcagtacgagatctgctagataccgccgcagctctgtatcgggat
EU726953_C_P-E      tctgacttctttccttcaatacgagatcttctagataccgccgcagctctgtatcgggat
KP856998_C_P-E      tctgacttctatccgtcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KP856982_C_P-E      actgacttctttccttcagtacgagatcttctagatactgcctcagctctgtatcgggat
EU726883_C_P-E      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KP857001_C_P-E      tctgacttctttccttcagtacgagatcttctagataccgccgcagctctgtatcgggaa
KP857011_C_P-E      tctgacttctttccttccgcacgagatcttctagataccgcctcagctctgtatcgggaa
KF798259_C_P-E      tctgacttctttccttcagtacgagatctccttgataccgcctcagctctgtatcgggaa
KF798270_C_P-E      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KF798298_C_P-E      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggat
MF772359_C_P-E      aatgacttctttccttcactaagagatcttctagataccgcctcagctctgtatcgggat
AF350211_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350127_C_P-E      tctgacttctttccttcagttcgagatcttctagatactgcctcagctctgtaccgggat
AF350161_C_P-E      tctgacttctttccttcagttcgagatcttctagatactgcctcagctctgtatcgggat
AF350164_C_P-E      tctgacttctttccttccgttcgagatcttctagatactgcctcagctctgtatcgggat
AF350139_C_P-E      tctgacttctttccttccgttcgagatctcctagatactgcctcagctctgtaccgggat
AF350167_C_P-E      tctgacttctttccttccgttcgagatctcctagatactgcctcagctctgtaccgggat
AF350134_C_P-E      tctgacttctttccttccgttcgagatctcctagatactgcctcagctctgtaccgggat
AF350135_C_P-E      tctgacttctttccttccgttcgagatctcctagatactgcctcagctctgtaccgggat
AF350208_C_P-E      aatgacttctttccttcagtaagagatcttctagataccgcctcagctttgtatcgggat
AF350184_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgagat
AF350187_C_P-E      tctgacttctttccttccataagagatcttctagataccgcctcagctctgtatcgggat
GQ161831_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350110_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AM494808_C_P-E      tctgacttctttccttcagtacgagatctactagataccgcctcagctctgtatcgggat
AM494810_C_P-E      tctgacttctttccttcagtacgagatctactagataccgcctcagctctgtatcgggat
AM494809_C_P-E      tctgacttctttccttcagtacgagatctactagataccgcctcagctctgtatcgggat
AM494811_C_P-E      tctgacttctttccttcagtacgtggccttctagataccgcctcagctctgtatcgggat
AM494812_C_P-E      tctgacttctttccttcagtacgtggccttctagataccgcctcagctctgtatcgggat
AF350176_C_P-E      tctgacttctttccttcagtaagagatcttcttgataccgcctcagctctgtatcgggat
AF350117_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtttcgggat
AF350153_C_P-E      tctgacttctttccttcagtacgagatctcctagataccgcctcagctctgtatcgggat
AF350132_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctttgtatcgggat
AF350133_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctttgtatcgggat
AF350169_C_P-E      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggat
AF350131_C_P-E      tctgacttctttccttcagtgagagatcttctagataccgcctcagctctgtatcgggat
AF350122_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctttgtatcgggat
AF350190_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctttgtatcgggat
AF350155_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350125_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctttgtatcgggat
AF350130_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctttgtatcgggat
AF350144_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350168_C_P-E      tctgacttctttccttcagtaagggatcttctagataccgcctcagctctgtatcgggat
AF350154_C_P-E      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggat
AF350145_C_P-E      tctgacttctttccgtcagtaagagatcttctagataccgcctcagctctgtttcgggat
AF350105_C_P-E      tctgacttctttccttcagtaagagatcttcttgataccgcctccgctctgtatcgggat
AF350210_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgagat
AF350206_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgagat
AF350177_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgagat
AF350146_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgagat
AF350205_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgagat
AF350188_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgagat
AF350212_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgagat
AF350213_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgagat
MH725141_C_P-E      tctgacttctttccttcaataagagatcttctagataccgcctcagctctgtatcgggag
AF350142_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctttgtatcgggat
AF350143_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctttgtatcgggat
AF350207_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctttgtatcgggat
AF350209_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctttgtatcgggat
LT623846_C_P-E      tctgacttctttccttcagtaagagatcttctagatacagcctcagctctgtatcgggat
AF350182_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350123_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggaa
AF350149_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MF772360_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
DQ060830_C_P-E      tctgacttctttccttcagtaagagatcttctagatactgcctcagctctgtatcgggat
HQ700550_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
HQ700552_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MF772362_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350175_C_P-E      tctgacttctttccttcagtaagagatcttcttgataccgcctccgctctgtatcgggat
AF350112_C_P-E      tctgacttctttccttcagtaagagatcttcttgataccgcctccgctctgtatcgggat
AF350137_C_P-E      tctgacttctttccttcagtaagagatcttcttgataccgcctccgctctgtatcgggat
AF350107_C_P-E      tctgacttctttccttcagtaagagatcttcttgataccgcctccgctctgtatcgggat
AF350103_C_P-E      tctgacttctttccttcagtaagagatcttcttgataccgcctccgctctgtatcgggat
AF350109_C_P-E      tctgacttctttccttcagtaagagatcttcttgataccgcctccgctctgtatcgggat
AF350114_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctctgctctgtatcgggat
AF350219_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350220_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350180_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350181_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MH725010_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
MH725024_C_P-E      tctgacttctttccttcaataagagatcttctagataccgcctcagctctgtatcgggat
AF350198_C_P-E      tctgacttctttccttcagttcgagatcttctagataccgcctcagctctgtatcgggat
AF350199_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350202_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350172_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350150_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350200_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350201_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350179_C_P-E      tctgacttctttccttcagttagagatcttctagataccgcctcagctctgtatcgggat
AF350115_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350116_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AB274970_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350215_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350151_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350126_C_P-E      tctgacttttttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350214_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350218_C_P-E      tccgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350203_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350197_C_P-E      tctgacttctttccgtcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350166_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350183_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350159_C_P-E      tctgacttctttccttcagtaagagatcttctagatactgcctcagctctgtatcgggat
AF350160_C_P-E      tctgacttctttccttcagtaagagatcttctagatactgcctcagctctgtatcgggat
AF350140_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350141_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350111_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350101_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350191_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350204_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350186_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350136_C_P-E      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggat
AF350173_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350216_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350217_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350185_C_P-E      tctgacttctttccttcagtaagagatcttctagatactgcctcagctctgtatcgggat
AF350147_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350128_C_P-E      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggat
AF350113_C_P-E      tctgacttctttccgtcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350106_C_P-E      tctgacttctttccttctgtaagagatcttctagataccgcctcagctctgtatcgggat
AF350100_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350165_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350152_C_P-E      tccgacttctttccttcagtaagagatcttctagataccgcctcagctctatatcgggat
AF350120_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctatatcgggat
AF350121_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctatatcgggat
AF350148_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctatatcgggat
AF350124_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctatatcgggat
AF350158_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350156_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350157_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350104_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350162_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350163_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350189_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350171_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcttcagctctgtatcgggat
AF350170_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350178_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350118_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350099_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350102_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350119_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350174_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350192_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350193_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350194_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350195_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350196_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350108_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
AF350138_C_P-E      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
                        * ** * *    *       *   *  *     *                      

HM363611_C_P-E      gccttggaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
AB219534_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
KY498770_C_P-E      gccttagagtctcctgagcattgttcaccgcatcatacggccctcaggcaagccattctt
AB915180_C_P-E      gccttagaatcttctgagcattgctcacctcaccacactgcactcaggcaagccgttctt
OK318680_C_P-E      gctttggaatctcctgagcattgtacagctcaccatactgcaatcaggcaagccattatt
AB219529_C_P-E      gccttagaatctcctgagcattgtacccctcaccatactgcgctcaggcaagtcattctt
MH580648_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcaatcaggcaagccattctt
FN594748_C_P-E      gccttagaatcttctgagcattgttcaactcaccctgctgcactcaggcaagccattctt
AM494692_C_P-E      gccttagagtctcctgagcattgctcacctcatcatacagcactcaggcaagcgattctt
AM494787_C_P-E      gccttagagtctcctgagcattgctcacctcatcatacagcactcaggcaagcgattctt
HM363607_C_P-E      gccttcgaatctcttgagcattgttcaccttaccatactgcactcaggcaagccattctt
FN594761_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgctctcaggcaagccattctt
GQ491112_C_P-E      gccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagcgattctt
MH580645_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
AB274979_C_P-E      gccttagaatctcctgagcattgtacacctcatcacacggcactcaggcaagccattctt
FN594762_C_P-E      gccttagaatctcctgagcattgctcacctcaccatagtgcactcaggcaagccgttctt
EU239220_C_P-E      gccttagaatctcctgagcattgctcacctcaccatactgcactcaggcaggccattctt
MF772357_C_P-E      gccttagaatctcctgaacatttttcaccgcaccacactgcactcaggcaagccattctt
AB915178_C_P-E      gccatagaatctccggagcattgttcacctcaccacacggcactcaggcaagccattatt
HM363610_C_P-E      gccttcgaatctcctgagcattgtacacctcaccatactgcactcaggcaagccattctt
FN594766_C_P-E      gccttgaaatctcctgagcattgttcmcctcaccacactgcactcaggcaagcaattctt
MF772355_C_P-E      gccttagaatcttctgagcattgttcagctcaccatactgcactcaggcaagccattctt
HM363565_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
MF772358_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
FN545823_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
OK318681_C_P-E      gctttrgaatctcctgagcattgttcacctcaccatactgcactcaggcaagccgttctt
FN594758_C_P-E      gccttagaatctcctgagcattgttcccytcaccacactgcactcaggcaagccattctt
FN594760_C_P-E      gccttggaatctcctgagcattgttcccytcaccacactgcactcaggcaagccattctt
FN594759_C_P-E      gccttagaatctcctgagcattgttcacytcacaccactgcactcaggcaagcccttctt
AB274977_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
LT623851_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccatamta
MF772361_C_P-E      gacttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
FN594751_C_P-E      gccttagaatctcctgagcattgttcacytcaccctgctgcwctcaggcaagccattctc
FN594763_C_P-E      gccttagaatctcctgagcattgttcacctcacaatactgcactcaggcaagccattctt
FN594765_C_P-E      gccttggaatcttctgagcattgttcacctcaccacactgcactcaggcaagccattctt
KF849724_C_P-E      gccttagaatctcctgagcattgtacacctcaccatactgcactcaggcaagccgttctt
HM363606_C_P-E      gccttggaatctcctgagcattggtcacctcaccatactgcactcaggcacgtcattctt
HM363605_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
AM494786_C_P-E      gccttagaatcacctgagcattgttcacctcatcacactgcactcaggcaagccattctt
HM363609_C_P-E      gccttagaatttcctgagcattgttcaactcaacctaccgcaatcaggccaagccttttt
FN594753_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgccctcaggcaagccattctt
KF849728_C_P-E      gccttagaatcacctgagcattgttcacctcaccatactgcactcaggcaagccattctt
FN545842_C_P-E      gctttagaatctcctgagcattgttcacctcatcacactgcactcaggcaagccattctt
LT623843_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
FN594756_C_P-E      gccttggaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
AB219533_C_P-E      gccttagaatcttctcagcattgttcacctcaccatactgcactcaggcaagccattctt
FN594749_C_P-E      gccttagaatctcctccgcattgttcaccctcacatactgcwctcaggcaagccgttctt
HM363608_C_P-E      gccttagaatctcctgagcattgttcaccccaccacactgcactcaggcaagccattctt
AB194948_C_P-E      gccttagaatctcatgagcattgttcaccgcaccacactgcactcaggcaagccatactt
HM363601_C_P-E      gccttagaatctcctgagcattgtacacctcaccatactgcactcaggcaagccattctt
GQ161768_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
AM494691_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgctctcaggcaagctattctt
AB274975_C_P-E      gccttacaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
HM363603_C_P-E      gccttagaatcttctgagcattgttcacctcaccatactgcactcaggcaagccattctt
AB205188_C_P-E      gccttggaatctcctgagcattgttcacctcaccatactgcactcaggcaggccattctt
AB274976_C_P-E      gccttagaatctcctcagcattgttcaccgcaccacactgcactcaggcaagccattctt
AM494791_C_P-E      gccttagaatctcctgagcattggtcacctcaccactctgcaatcaggcaagccattctt
AM494793_C_P-E      gccgtagaatctcctgagcattggtcacctcaccactctgcaatcaggcaagccattctt
HM363598_C_P-E      gccttagaatctcctgagcattgcacacctcaccatactgcactcaggcaagccattctt
HM363566_C_P-E      gccttagaatctcctgagcatgtttcacatcaccatactgcactcaggcaagccattctt
GQ161811_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
LT623847_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
HM363602_C_P-E      gccttcgaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
GQ161807_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacaccgcactcaggcaagccattctt
HM363597_C_P-E      gccttagaatctcctgagcattgtacacatcaccatactgcaatcaggcaagccattatt
GQ161786_C_P-E      gccttagaatctcctgagcattgtacaccgcaccacactgcactcaggcaagccattctt
MN507840_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
LT623849_C_P-E      gccttagaatctcctgagcattgttcacctcaycacactgcactcaggcaagccattctt
HM363604_C_P-E      gccttggaatctcctgatcattgctcacctcaccatactgcactcaggcaagccattctt
HM363578_C_P-E      gccttagaatctcctgagcattgttcagctcaccatactgctctcaggcaagccgttctt
GQ161823_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacacggcactcaggcaagccattctt
HM363600_C_P-E      gccttagaaggtcctgagcattgtacacctcaccatactgcactcaggcaagccattatt
AM494695_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
AB274984_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
KU736913_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
AB274982_C_P-E      gccttagaatctcctgagcatagttcaccgcatcacactgcactcaggcaagccattctt
FJ349240_C_P-E      gccttggaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
KT749841_C_P-E      gccttagaatcgcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
MH580626_C_P-E      gccttagaatcttctgagcattgctcacctcaccacactgcactcaggcaagccattctt
MW455164_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgctctcaggcaagccattctt
KM606739_C_P-E      gccttagaatctcctgtacatgtttcaccgcaccacactgcactcaggcaagccattctt
GQ161783_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
GQ161824_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
HM363599_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
GQ161796_C_P-E      gccttagaatctcctgagcattgctcaccgcaccacactgcactcaggcaagccattctt
AM494792_C_P-E      gccttaaaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
KF849726_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattatt
KF849720_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
KF849713_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
MH464855_C_P-E      gccttagaatctcctgagcattgttcacctcaccatacagcactcaggcaagccattctt
AB201290_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgccctcaggcaagtcattctt
KT192626_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
AB274973_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
KF849725_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagcctgtctt
AY935700_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
OM256457_C_P-E      gccttagaatctcctgagcattgttcacctcaccatacagcactcaggcaagccattctt
MH464856_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
KF849727_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
KF849719_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
KF849717_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
KF849716_C_P-E      gccttaaaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
AY738144_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattttg
AY738145_C_C-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattttg
AY738147_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattttg
AY738146_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattttg
KF922439_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
KF849722_C_P-E      gccttagaatctcctgagcattgttcacctcaccatacggcactcaggcaagccattctt
JQ000009_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
MN507841_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
DQ060823_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
DQ060822_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
MF772354_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
KF922438_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
KF849721_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
KF849715_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagctattctt
KF849723_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagctattctt
KF849714_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
DQ060824_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
DQ060825_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
EU620071_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
LT623842_C_P-E      gccttagaatctcctgagcatytttcaccgcaccacactgcactcaggcaagccattctt
MT731872_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
GQ161797_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcaatcaggcaagccattatt
FN545822_C_P-E      gccttagaatctcctgagcaytgttcacctcaccacacggcactcaggcaagccattctt
AB274980_C_P-E      gccttagaatctcctgagcattgttcacctcatcatactgcactcaggcaagccattctt
MH725192_C_P-E      gcgttggaatctcccgagcattgttcatctcaccacactgcactcaggcaagccattctt
EU239222_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
AB274985_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
HM363575_C_P-E      gccttacaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
HM363576_C_P-E      gccctagaatctcctgagcattgttcacctcaccatactgaactcaggcaagccattctt
FN594752_C_P-E      gccttagaatctcctgagcattgttcatctycacatctgccactcaggcaagccattctt
FN545827_C_P-E      gccttggaatctcctgagcattgttcacctcaccacactgcactcaggcaagccmttctt
FN545821_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
KF849718_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagycattctt
AB106564_C_C-E      gccttagaatctcctgagcattgctcacctcaccatactgcactcaggcaagccattctt
MN507842_C_P-E      gccttagaatctcctgagcattgttcacctcatcacactgcactcaggcaagccattctt
EU239219_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
EU239223_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
GQ161773_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
GQ161802_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
MW455162_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgctctcaggcaagccattctt
HM363587_C_P-E      gccttagaatctcctgagcattgtacccctcaccatactgcactcaggcaagtcattctt
GQ161826_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
GQ161757_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
MW455165_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
KU736911_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
KU736909_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
GQ161834_C_P-E      gccttagaatctcctgagcatggttcaccgcaccacactgcactcaggcaagccattctt
AM494714_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
MT731911_C_P-E      gccttagaatctcctgagcattgttcgcctcaccatactgcactcaggcaagccattctt
AB274981_C_P-E      gccttagaatctccagagcattgttcacctcaccacactgcactcaggcaagccattctt
LT623844_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctg
AM494703_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
AM494800_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
HM363594_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattatt
HM363596_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattatt
MW455163_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgctctcaggcaagccattctt
GQ161820_C_P-E      gccttagaatctcctgagcattgttcaycgcaccacactgcactcaggcaagccattctt
GQ161775_C_P-E      gccttagaatctcctgagcatgtttcaccgcaccacactgcactcaggcaagccattctt
EU239217_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgctctcaggcaagccattctt
AB205191_C_P-E      gccttagaatctcctgagcattgttcaccccaccacacggcactcaggcaagccattctt
AB091256_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacagcactcaggcaagccattctt
MN967527_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
AM494706_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
MH580650_C_P-E      gccttagaatctcctgagcattgttcacctcatcacactgcactcaggcaagccattctt
AM494710_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
AM494709_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
AM494697_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
AM494789_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
MW082636_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
GQ161815_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
GQ161812_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
AB201287_C_P-E      gccttagaatctcctgaacattgttctcctcaccatacagcactcaggcaagccattctt
FN594750_C_P-E      gccttagaatctcctgagcattgttcacctycacatactgcactcaggcaagccattctt
HM363590_C_P-E      gccttagaatctcctgagcattgtacacctcatcatactgcactcaggcaagccattctt
HM363588_C_P-E      gccttagaatctcctgagcattgtacacctcaccatactgcactcaggcaagccattctt
HM363589_C_P-E      gccttagaatctcctgagcattgcacacctcaccatactgcactcaggcaagccattctt
KU736892_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
HM363574_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
GQ161814_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
AB201288_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MW679683_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
MT427111_C_P-E      gccttagaatgtcctgagcattgttcacctccccacacggcagtcaggcgagccattctt
LT623848_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
LT623845_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
KM606738_C_P-E      gccttagaatctcctgagcattgttcacctcaccataccgcactcaggcaagccattctt
HM363595_C_P-E      gccttcgaatctcctgagcattgttcaccttaccatactgcactcaggcaagccattctt
GQ161803_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
EU239224_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
AM494797_C_P-E      gccttagaatctcctgagccttgttcacctcaccacactgcactcaggcaagccattctt
AM494711_C_P-E      gccttagaatctcctgagcattgttcacctcatcacactgcactcaggcaagccattctt
AM494698_C_P-E      gccttagaatctcctgagcattgctcacctcaccacactgcactcaggcaagccattctt
AB274978_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
MW679682_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
HQ700551_C_P-E      gccttggaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
HM363593_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
AY739674_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
AY739675_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
MH580633_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
MH580631_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
MH580632_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
MH580652_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
AB274974_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
MH580624_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
MH580629_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
MH580646_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
MH580649_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
HM363573_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
AB194947_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
MH580647_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
MH580634_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
MH580635_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
MH580636_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
KY271392_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
MH580621_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
MH580622_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
MH580625_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
MH580637_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
HM363583_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
HM363584_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
GQ161782_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
GQ161792_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
KF170741_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
GQ161755_C_P-E      gccttagaatctcctgagcattgttcgccgcaccacactgcactcaggcaagccattctt
MZ962196_C_P-E      gccttagaatctcctgagcattgttcgccgcaccacactgcactcaggcaagccattctt
MZ962190_C_P-E      gccttagaatctcctgagcattgttcgccgcaccacactgcactcaggcaagccattctt
GQ161760_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
MH580638_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
AB205129_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
AB205192_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
HM363582_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
HM363585_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
MW401520_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
KU736904_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
KU736893_C_P-E      gccttagaatctcctgagcattgttcacctcatcacactgcactcaggcaagccattctt
HM363577_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
GQ161835_C_P-E      gccttagaatctcttgagcattgttcaccgcaccacactgcactcaggcaagccattctt
GQ161794_C_P-E      gccttagaatctcatgagcattgttcaccgcaccacactgcactcaggcaagctattctt
GQ161785_C_P-E      gccttagaatctcctgagcattgttcagcgcaccacactgcactcaggcaagccattctt
GQ161780_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
GQ161762_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
AM494796_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
AB205190_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MZ962191_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
GQ161758_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
GQ161766_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
GQ161774_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MZ962197_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
KU736902_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgctctcaggcaagccattctt
AB201289_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
AB915175_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
MT427118_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427113_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427123_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427140_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427112_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427197_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427196_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427186_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427187_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427171_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427170_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427163_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427156_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427145_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427141_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427138_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427133_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427160_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427132_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427131_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427121_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427126_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427120_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427114_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427115_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427147_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427193_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427110_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427144_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427150_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427116_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427117_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427119_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427122_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427124_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427125_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427127_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427128_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427129_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427130_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427134_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427135_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427136_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427137_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427139_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427142_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427143_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427146_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427148_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427149_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427151_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427152_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427155_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427157_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427158_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427159_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427161_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427162_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427164_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427165_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427166_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427167_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427168_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427169_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427172_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427173_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427174_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427175_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427176_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427177_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427178_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427179_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427180_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427181_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427182_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427183_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427184_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427185_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427188_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427189_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427190_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427191_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427192_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427194_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427195_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427198_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427199_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427200_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427201_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MT427153_C_P-E      gccttagaatctcctgagcattgttcacttcaccacacggcactcaggcaagccattctt
MT427154_C_P-E      gccttagaatctcctgagcattgttcacttcaccacacggcactcaggcaagccattctt
KU736912_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
AB274972_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcagggaagcgattctt
MZ962189_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
EU239218_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
MW455161_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
GQ161833_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
GQ161756_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcattcaggcaagccattctt
GQ161795_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
MN507844_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
MH725114_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
LT623850_C_P-E      gccttagaatctcctgagcactgttcacctcaccacacggcactcaggcaagccattctt
KU736901_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
KU736900_C_P-E      gccttagaatctcctgagcattgctcacctcaccacactgcactcaggcaagccattctg
GQ161759_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
HM363569_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
HM363570_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
HM363567_C_P-E      gccttagaatctcctgagcattgtacacctcaccatactgcactcaggcaagccattctt
HM363568_C_P-E      gccttagaatctcctgagcattgtacacctcaccatactgcactcaggcaagccattctt
GQ161778_C_P-E      gccttagaatctcctgaacattgctcaccgcaccacactgcactcaggcaagccattctt
GQ161810_C_P-E      gccttagaatctcctgaacattgctcaccgcaccacactgcactcaggcaagccattctt
MH580640_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgctctcaggcaagccattctt
MH580641_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgctctcaggcaagccattctt
MH580617_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
MH580628_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
MH580644_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
GQ161763_C_P-E      gccttagaatctcctgagcattgctcaccgcaccacactgcactcaggcaagccattctt
GQ161777_C_P-E      gccttagaatctcctgagcattgctcaccgcaccacactgcactcaggcaagccattctt
FJ349237_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
FJ349238_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
AM494694_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
AM494696_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
AM494700_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
AB205189_C_P-E      gccttagaatctcctgaacattgttcaccccaccacacggcactcaggcaagccattctt
EU239221_C_P-E      gccttagaatctcctgagcattgttcaccccaccacacggcactcaggcaagccattctt
DQ060826_C_P-E      gccttagaatctcctgagcattgttcacctcaccataccgcactcaggcaagccattctt
DQ060827_C_P-E      gccttagaatctcctgagcattgttcacctcaccataccgcactcaggcaagccattctt
DQ060828_C_P-E      gccttagaatctcctgagcattgttcacctcaccataccgcactcaggcaagccattctt
DQ060829_C_P-E      gccttagaatctcctgagcattgttcaccgcaccataccgcactcaggcaagccattctt
MZ962195_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
GQ161790_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
GQ161808_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
KU736895_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattcta
KU736896_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattcta
HM363592_C_P-E      gccttagaatctcctgagcattgtacacctcaccatactgcactcaggcaagccattctt
HM363586_C_P-E      gccttagaatcgcctgagcattgtacacctcaccatactgcactcaggcaagccattctt
HM363591_C_P-E      gccttagaatctcctgagcattgtacacctcaccatactgcactcaggcaagccattctt
MN967526_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
HM363579_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
HM363580_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
HM363581_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
MT426115_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
MH725020_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
MH725021_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
MH725042_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
X75657_C_P-E        gccttagagtctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
MZ962194_C_P-E      gccttagaatctcatgagcattgttcaccgcaccacactgcactcaggcaagctattctt
MZ962192_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
MN507846_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MN507845_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
KU736910_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
KU736897_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
KU736898_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
KU736894_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactaaggcaagccattctt
KU736891_C_P-E      gccttagaatctcctgagcattgttcacckcaccacactgcactcaggcaagccattctt
KF170742_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
JQ000008_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
GQ161832_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
GQ161771_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
FJ349226_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
AM494806_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
AM494803_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
AM494794_C_P-E      gccttagaatctcctgagcattgttcacctcactacactgcactcaggcaagccattctt
AB274969_C_P-E      gcattagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
GQ161801_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
GQ161772_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
GQ161764_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
GQ161787_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
GQ161770_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
GQ161800_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
GQ161819_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
GQ161829_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
GQ161791_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
GQ161793_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
GQ161827_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
MN507843_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
MN507848_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
MZ962199_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
AM494701_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
AM494707_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
MH580630_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
MN967529_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
MH918655_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
KU736903_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
HM363571_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
EU239226_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
AM494807_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
AM494805_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
AM494804_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
AM494802_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
AM494795_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
AM494705_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagctattctt
AM494801_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagctattctt
AM494702_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
AM494798_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
AM494799_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
AM494689_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
AM494690_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
AM494693_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
AM494699_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
AM494704_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
AM494708_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
AM494712_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
AM494715_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
AM494717_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
AM494788_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
AM494790_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
GQ161816_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
HM363572_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
KU736905_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
KX186584_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
MH580614_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
MH580615_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
MH580616_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
MH580618_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
MH580619_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
MH580620_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
MH580623_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
MH580651_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
MK321264_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
MK720631_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
MK720632_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
MN967528_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
MN507847_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
FN545841_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
AM494713_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
KU736906_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
KU736907_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
KU736908_C_P-E      gccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaagccattctt
KU736899_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
GQ161836_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
GQ161769_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacaccgcactcaggcaagccattctt
GQ161779_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacaccgcactcaggcaagccattctt
GQ161765_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacacggcactcaggcaagccattctt
GQ161761_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
FJ349239_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
AB091255_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
AB274971_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
GQ161776_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
GQ161781_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
GQ161784_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
GQ161789_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
GQ161798_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
GQ161804_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
GQ161817_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
GQ161828_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
MZ962193_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
MZ962198_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
KP857055_C_P-E      gccttagaatctcctgagcattgttcacctcatcatactgcaatcaggcaagcagttctt
GQ161825_C_P-E      gccttagaatctcctgagcattgctcacctcatcatactgcactcaggcaagccattctt
KF798275_C_P-E      gcgttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
X85274_C_P-E        gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
KP857010_C_P-E      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaatatta
AY269055_C_P-E      gccttagaatctcctgagcattgttcatctcaccatactgcactcaggcaagcaattctt
KP856973_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcaatcaggcaagcaattttg
MF772356_C_P-E      gccttggaatcaggtgaacattgctcaccgcaccacactgcactcaggcatgcctttctt
KF798305_C_P-E      gccttagaatctcctgagcattgtacacctcaccatactgcactcaggcaagcatttctt
EU726953_C_P-E      gccttagaatctcctgagcattgttcagctcaccatactgcactcaggcaagcaattctg
KP856998_C_P-E      gccttagaatctcaggatcattgctcacctcaccatactgcactcaggcaagcaattctc
KP856982_C_P-E      gccttagaatctcctgagcattgtacacctcaccatactgcactcaggcaagcaattctg
EU726883_C_P-E      gctttagaatctcctgagcattgctcacctcaccacactgcactcaggcaagcaattctc
KP857001_C_P-E      gctttagaatctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctg
KP857011_C_P-E      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattttg
KF798259_C_P-E      gccttagaatctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
KF798270_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
KF798298_C_P-E      gccttagaatcgcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MF772359_C_P-E      gccttagaatctcctgaacactgctcaccgcaccacactgcactcaggcaagccattctt
AF350211_C_P-E      gccttggaatctcctcaacatcattcaccacaccacactgcactcaggcaagccattctt
AF350127_C_P-E      gccttagaatctcctgagcattgctcacctcaccatacagcactaaggcaagccattctt
AF350161_C_P-E      gccttagaatctcctgagcattgctcacctcaccatacagcactaaagcaagctattctt
AF350164_C_P-E      gccttagaatctcctgagcattgctcacctcaccatacagcactcaggcaagctattctc
AF350139_C_P-E      gccttagaatctcctgagcattgctcacctcaccatacagcacttaggcaagctattctt
AF350167_C_P-E      gccttagaatctcctgagcattgctcacctcaccatacagcactaaggcaagctattctc
AF350134_C_P-E      gccttagaatctcctgagcattgctcacctcaccatacagcactaaggcaagctattctc
AF350135_C_P-E      gccttagaatctcctgagcattgctcacctcaccatacagcactaaggcaagctattctt
AF350208_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
AF350184_C_P-E      gccttggaatctcctgagcattgttcacctcatcatactgcactcaggcatgccgttctt
AF350187_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcaatcaggcaagccattctt
GQ161831_C_P-E      gccttagaatctcctgagcattgctcacctcaccatactgcactcaggcaagccattctt
AF350110_C_P-E      gccttagaatctcctgaacattgtacaccgcaccacactgcactcaggcaagccattctg
AM494808_C_P-E      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
AM494810_C_P-E      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
AM494809_C_P-E      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
AM494811_C_P-E      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
AM494812_C_P-E      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
AF350176_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccgttctt
AF350117_C_P-E      gccttagaatctcctgagcatggttcaccgcaccacactgcactcaggcaagccatactt
AF350153_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcacttaggcaagccattctt
AF350132_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacacggctctcaggcaagccattctt
AF350133_C_P-E      gccttagaatctcctgagcattgttcaccgcaccatacggctctcaggcaagccattctt
AF350169_C_P-E      gccttagaatctcctgagcattgttcacctcaccatacagctctcaggcaagccattctt
AF350131_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacacggctctcaggcaagccattctt
AF350122_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgctctcaggcaagccattctt
AF350190_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacacggctctcaggcaagccattctt
AF350155_C_P-E      gccttagaatctcctgagcattgttcaccgcaccatacggctctcaggcaagccattctt
AF350125_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacacggctctcaggcaagccattctt
AF350130_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacacggctctcaggcaagccattctt
AF350144_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
AF350168_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgctctcaggcaagccattctt
AF350154_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
AF350145_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
AF350105_C_P-E      gccttagaatctcctgagcatcgttcaccgcaccacactgcactcaggcaagccatactt
AF350210_C_P-E      gccttagaatctcctgaacattgttcacctcaccacacggcactcaggcaagccattctt
AF350206_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
AF350177_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
AF350146_C_P-E      gccttagaatctcctgagcattgttcaccttaccacacggcactcaggcaagccattctt
AF350205_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
AF350188_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
AF350212_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
AF350213_C_P-E      gccttagaatctcctgagcattgttcacctcaccacacggcactcaggcaagccattctt
MH725141_C_P-E      gccttagaatctccggaccattgttcacctcaccatacagcactcaggcaagccattctt
AF350142_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
AF350143_C_P-E      gctttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
AF350207_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
AF350209_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
LT623846_C_P-E      gccttagaatctccggaacattgttcaccgcaccacactgcactcaggcaagccattctt
AF350182_C_P-E      gctttagaatctcctgagcattgttctccgcaccacactgcactcaggcaagccattctt
AF350123_C_P-E      gccttagaatctcctgagcattgttcacggcaccacattgcactcaggcaagctattctt
AF350149_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagctattctt
MF772360_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccgttctt
DQ060830_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
HQ700550_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
HQ700552_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
MF772362_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
AF350175_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattgtt
AF350112_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
AF350137_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
AF350107_C_P-E      gccttagaatctcctgagcattgttcaccgaaccacactgcactcaggcaagccattctt
AF350103_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
AF350109_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
AF350114_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
AF350219_C_P-E      gccttagaatcgcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
AF350220_C_P-E      gccttagaatcgcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
AF350180_C_P-E      gctttagaatctcctgagcattgttctccgcaccacactgcactcaggcaagccattctt
AF350181_C_P-E      gctttagaatctcctgagcattgttctccgcaccacactgcactcaggcaagccattctt
MH725010_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
MH725024_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
AF350198_C_P-E      gccttagaatctcctgaacattgttcacctcaccatactgcactaaggcaagctattctt
AF350199_C_P-E      gccttagaatctcctgaacattgttcacctcaccatactgcactaaggcaagctattctt
AF350202_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
AF350172_C_P-E      gccttagaatctcctgagcattgttcaccgcatcacactgcactcaggcaagccattctt
AF350150_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
AF350200_C_P-E      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
AF350201_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
AF350179_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
AF350115_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
AF350116_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
AB274970_C_P-E      gccttagaatctcctgagcattgctcacctcaccatactgcactcaggcaagccattctt
AF350215_C_P-E      gccttagaatctcctgagcattgctcacctcaccatactgcaatcaggcaagccattctt
AF350151_C_P-E      gccttagaatctcctgagcattgctcacctcaccatactgcactcaggcaagccattctt
AF350126_C_P-E      gccttagaatctcctgagcattgctcacctcaccatactgcactcaggcaagccattctt
AF350214_C_P-E      gccttagaatctcctgagcattgctcacctcaccatactgcactcaggcaagccattctt
AF350218_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
AF350203_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgctctcaggcaagccattctg
AF350197_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
AF350166_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
AF350183_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
AF350159_C_P-E      gccttagaatctcctgaacattgttcaccgcatcacactgcactcaggcaagccattctt
AF350160_C_P-E      gccttagaatctcctgaacattgttcaccgcatcacactgcactcaggcaagccattctt
AF350140_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
AF350141_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
AF350111_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
AF350101_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
AF350191_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
AF350204_C_P-E      gccttagaatctcctgaacattgttcaccgcatcacactgcactcaggcaagccattctt
AF350186_C_P-E      gccttagaatctcctgaacattgttcacctcaccacacggcactcaggcaagccattctt
AF350136_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
AF350173_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
AF350216_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
AF350217_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
AF350185_C_P-E      gccttagaatctcctgaacattgttcaccgcatcacactgcactcaggcaagccattctt
AF350147_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
AF350128_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
AF350113_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
AF350106_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagctattctt
AF350100_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgctctcaggcaagccattctt
AF350165_C_P-E      gccttagaatctcctgaacattgttcacctcaccacactgcactcaggcaagccattctt
AF350152_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
AF350120_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
AF350121_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
AF350148_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
AF350124_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
AF350158_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
AF350156_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
AF350157_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
AF350104_C_P-E      gccttagaatctcctgagcattgttcaccgcaccacactgcactcaggcaagccattctt
AF350162_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
AF350163_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
AF350189_C_P-E      gccttagaatctcctgaacattgttcaccgcaccatactgcactcaggcaagccattctt
AF350171_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
AF350170_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
AF350178_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
AF350118_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
AF350099_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
AF350102_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
AF350119_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
AF350174_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
AF350192_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
AF350193_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
AF350194_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
AF350195_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
AF350196_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
AF350108_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
AF350138_C_P-E      gccttagaatctcctgaacattgttcaccgcaccacactgcactcaggcaagccattctt
                    *   *  *          *      *                 * * *          * 

HM363611_C_P-E      tgctggggggacctaatgactctagctacctgggtgggtgcaaatttggaaggtccagca
AB219534_C_P-E      tgctggggagaattaatgtctctagctacctgggtgggtgcaaatttgcaagatccagca
KY498770_C_P-E      tgctggggggaattaatgactctagctacctgggtgggtgtaaatttggaagatcmakca
AB915180_C_P-E      tgctggggggatataatgaatatagctacctgggtgggtgcaaatttggaagatccagca
OK318680_C_P-E      tgctggggggaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AB219529_C_P-E      tgctggggagacctaatgaatctagctacctgggtgggtggaaatttgcaagatccagca
MH580648_C_P-E      tgctgggggaaccttatgaatctagctacctgggtgggtgtaaatttggaagatcaagca
FN594748_C_P-E      tgctggggggacctaatgaatctaggtacctgggtgggcggcaatttggaagaccaagca
AM494692_C_P-E      tgctggggggaattaatgactctagctacctgggtgggtgcaaacttggaagatccagca
AM494787_C_P-E      tgctggggggaattaatgactctagctacctgggtgggtgcaaacttggaagatccagca
HM363607_C_P-E      tgctggggggaattaatgactctagctacctgggtgggtgcaaatttggaagatccagca
FN594761_C_P-E      tgctggggggatcttatgaacctagctacctgggtgggtgcaaatttggaagacccagca
GQ491112_C_P-E      tgctggggggaattaatgactctagctacctgggtgggggcaaacctggacgatcaagca
MH580645_C_P-E      tgctggggggaattaatgactctagctacctgggtgggtgcaaatttggaagatccagga
AB274979_C_P-E      tgctggggggaactaatgacactagctacttgggtgggtgtaaatttggaagatccatca
FN594762_C_P-E      tgctggggggacctaatgaatctagctacctgggtgggtgtaaatttggaagatccagcc
EU239220_C_P-E      tgctggggggaactaatgactctagctacatgggtgggtgcaaatttagaagatccagca
MF772357_C_P-E      tgctggggggacttaatgtctctagctacctgggtgggtgttaatttggaagatccagca
AB915178_C_P-E      tgctggggagacctaatgtctctagctacctgggtgggtgaaaatttgcaagatcaagca
HM363610_C_P-E      tgctggggggaacttatgactctagctacctgggtgggtgcaaatttggaagatccagca
FN594766_C_P-E      tgctggggggacctaatgaatctagctacctgggtgggtgcaaatttggaagatcaagca
MF772355_C_P-E      tgctggggagatttaatgtccctagctacctgggtgggtgtaaatttggaagatccagca
HM363565_C_P-E      tgctggggggacctaatgaatttagccacctgggtgggtgcaaatttggacgacccagga
MF772358_C_P-E      tgctggggggacttaatgaatctagctacctgggtgggtgttaatttggaagatcaagca
FN545823_C_P-E      tgctggggggamytaaygamtctagctacctgggtgggkgtaaatttggaagatccagca
OK318681_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgcaaatttggaagatccagcg
FN594758_C_P-E      tgctggggggacctaatgaatctagctacctgggtgggtgcaaatttggaagatccatca
FN594760_C_P-E      tgctggggggacctaatgaatctagctacctgggtgggtgcaaatttggaagatccatca
FN594759_C_P-E      tgctggggggacctaatgaatctagctacctgggtgggtgcaaatttggaagatccatca
AB274977_C_P-E      tgctggggggaactaatgactttagctacctgggtgggtgcaaatttggaagatccagca
LT623851_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgcaaatttggamgatccagca
MF772361_C_P-E      tgctggggggacctaatgactctagctacctgggtgggtggtaatttggaagatcaagca
FN594751_C_P-E      tgctggggggacctaatgaatctagctacctgggtgggtgcaaatttggatgatccagca
FN594763_C_P-E      tgctggggggacctaatgaatctagctacctgggtgggtgcaaatttggatgatccagca
FN594765_C_P-E      tgctggggggacctaatgtctctagctacctgggtgggtgtaaatttggaagatccagca
KF849724_C_P-E      tgctggggagaattaatgaatctagctacctgggtgggtgcaaatttgcaagatccgaca
HM363606_C_P-E      tgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaagatccagca
HM363605_C_P-E      tgctggggggaattaatgactctagctacctgggtgggtgcaaatttggacgatccagca
AM494786_C_P-E      tgctggggggacctaatgaatctagctacctgggtgggtgcaaatttgcaagatccagca
HM363609_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccatca
FN594753_C_P-E      tgctggggggatgtaatgaatatggctacatgggtgggtgtgaatttgcaagatcaagca
KF849728_C_P-E      tgctggggtgatgtaatgaatctagcgacatgggtgggtgtaaatttggaagatccggca
FN545842_C_P-E      tgctggggggacctaatgtctctagctacctgggtgggtacaaatttggatgatccagca
LT623843_C_P-E      tgctggggggacctaatgtycctagctacctgggtgggtgtaaatttggaagatccagca
FN594756_C_P-E      tgctggggggacataatgaatatagctacctgggtaggtgcaaatttggaagatcaagca
AB219533_C_P-E      tgctggggggatataatgactatagctacntgggtgggtgtgaatttgcaagatcaagaa
FN594749_C_P-E      tgctggggggatgtaatgaatctagctaccggggtgggtacaaatttggaagatccagca
HM363608_C_P-E      tgctggggggatgtaatgaatctagctacctgggtgggtgcaaatttggaagatcccaca
AB194948_C_P-E      tgctggggggacctaatgtctctagctacctgggtgggtgtaaatttggaagatccagca
HM363601_C_P-E      tgttggggggaactaatgactctagctacctgggtgggtgcaaatttggaagatcaagca
GQ161768_C_P-E      tgctggggggatgtaatgaatttagctacctgggtgggtgtaaatttgcaagatccagca
AM494691_C_P-E      tgctggggggacctaatgactctagctacctgggtgggtgcaaatttggaagatccagca
AB274975_C_P-E      tgctggggggacgtaatgaatctagctacctgggtgggtgcaaatttggaagatccagca
HM363603_C_P-E      tgctggggggacctaatgtccctaggtacctgggtggggggaaatttggaagatcaagcg
AB205188_C_P-E      tgctggggggacctaatgaatctaggtacctgggtgggtggaaatttggaagatccagca
AB274976_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccatca
AM494791_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaaattggaagatccagca
AM494793_C_P-E      tgctggggggacttaatgactctagctacctgggtgggtgtaaatttggaagatccagca
HM363598_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatcaagga
HM363566_C_P-E      tgctggggggatataatgaatatagctacctgggtgggtgcaaatttggaagaccaagca
GQ161811_C_P-E      tgctggggggaattaatgactctagctacctgggtgggtggaaatttggaagatccagca
LT623847_C_P-E      tgytggggggatataatgaatatagctacctgggtgggtgctaatttggaagatcaaaca
HM363602_C_P-E      tgctggggggatttaatgaatctagctacctgggtgggtgtaaatttggaagatccagca
GQ161807_C_P-E      tgctggggggatctaatgactctagctacctgggtgggtgcaaatttagaagatccagca
HM363597_C_P-E      tgctggggggaactaatgaatctagctacctgggtgggtgtaaatttggaagatccagca
GQ161786_C_P-E      tgctggggggaactaatgactctagctacctgggtgggggtaaatttgcaagatcaagca
MN507840_C_P-E      tgctggggggatgtaatgaatctagctacctgggtgggtgtaaatttggaagatccagca
LT623849_C_P-E      tgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaagatccagca
HM363604_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgcaaatttggaagatccagca
HM363578_C_P-E      tgctggggggagctaatgactctagctacctgggtgggtgtaaatttggaagatcaagca
GQ161823_C_P-E      tgctggggggacctaatgaatctaggcacctgggtgggtgtaaatttagaagatcaagca
HM363600_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttagacgatccagca
AM494695_C_P-E      tgctggggggaactaatgactctagctacctgggtgggagtaaatttggaagatccagca
AB274984_C_P-E      tgctggggggacctaatgaatctagctacctgggtgggtgttaatttggaagatcaagca
KU736913_C_P-E      tgctggggggacytaatgaatctagctacctgggtgggtgtaaatttggaagatccagca
AB274982_C_P-E      tgctggggggacttaatgtctctagctacctgggtgggtgcaaatttggaagatccagca
FJ349240_C_P-E      tgctggggggacctaatgactctagctacctgggtgggtgcaaatttggaagatccagca
KT749841_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtggtaatttggaggatccagca
MH580626_C_P-E      tgctggggagatctaatgaatctaggaacctgggtgggtggaaatttggaagatccagca
MW455164_C_P-E      tgctggggggaactaatgactttagctacctgggtgggtgtcaatttggaagatcaagca
KM606739_C_P-E      tgctggggggatgtaatgtctctagctacctgggtgggtgttaatttggaagatccagca
GQ161783_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccatca
GQ161824_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccatca
HM363599_C_P-E      tgctggggggacctaatgactctagctacctgggtgggtgcaaatttggaagatccagca
GQ161796_C_P-E      tgctggggggacctaatgaatctaggtacctgggtgggtgcaaatttggatgatcaagca
AM494792_C_P-E      tgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaagatccagca
KF849726_C_P-E      tgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaggatccatca
KF849720_C_P-E      tgctggggagaattaatgactctagctacctgggtgggtggaaatttgcaagatccaaca
KF849713_C_P-E      tgctggggrgaaytaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MH464855_C_P-E      tgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AB201290_C_P-E      tgctggggagacctaatgactctagctacctgggtgggtgtaaatttggacgatccagca
KT192626_C_P-E      tgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AB274973_C_P-E      tgctggggggacctaatgaatctagctacctgggtgggtgtaaatttggaagatccagca
KF849725_C_P-E      tgctggggagatgtaatgaatctagctacctgggtgggtgtaaatttggaagatccagca
AY935700_C_P-E      tgctggggagatgtaatgtctctagctacctgggtgggtgtaaatttggaagatccagca
OM256457_C_P-E      tgctggggagatttaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MH464856_C_P-E      tgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
KF849727_C_P-E      tgctggggagaattaatgacgctagctacctgggtgggggtaaatttggaagatccagca
KF849719_C_P-E      tgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
KF849717_C_P-E      tgctggggagaattgatgactctagctacctgggtgggtgtaaatttggaggatccagca
KF849716_C_P-E      tgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AY738144_C_P-E      tgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AY738145_C_C-E      tgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AY738147_C_P-E      tgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AY738146_C_P-E      tgctggggagaattaatgactctagctacctgggtgggcgtaaatttggaagatccagca
KF922439_C_P-E      tgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
KF849722_C_P-E      tgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
JQ000009_C_P-E      tgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MN507841_C_P-E      tgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
DQ060823_C_P-E      tgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
DQ060822_C_P-E      tgctggggagaattaatgactctagctacctgggtgggggtaaatttggaagatccagca
MF772354_C_P-E      tgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
KF922438_C_P-E      tgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
KF849721_C_P-E      tgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
KF849715_C_P-E      tgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
KF849723_C_P-E      tgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
KF849714_C_P-E      tgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
DQ060824_C_P-E      tgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
DQ060825_C_P-E      tgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
EU620071_C_P-E      tgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagct
LT623842_C_P-E      tgttggggggatctaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT731872_C_P-E      tgctggggggatctaatgactctagctacctgggtgggtgaaaatttggaagatccagca
GQ161797_C_P-E      tgctggggggaactaatgactctagctacctgggtgggggtaaatttggaagatccagca
FN545822_C_P-E      tgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AB274980_C_P-E      tgctggggggacctaatgactctagctacctgggtgggtgaaaatttggaagatccagca
MH725192_C_P-E      tgctggggagacctaatgtctctagctacctgggtgggtgtaaatttggaagatccagca
EU239222_C_P-E      tgttggggggaccttatgactctagctacctgggtgggtgtaaatttggaagatccagca
AB274985_C_P-E      tgctggggggagttaatgactctagctacctgggtgggtgtaaatttggaagatccagca
HM363575_C_P-E      tgctggggggaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
HM363576_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
FN594752_C_P-E      tgctggggggatgtaatgaacctagcaacctgggtgggtgtaaatttggaagatccagca
FN545827_C_P-E      tgctggggggacctaatgaatctagctacctgggtgggtgtaaatttggaagatccagca
FN545821_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgaaaatttacaagatcaagca
KF849718_C_P-E      tgctggggagaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AB106564_C_C-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagacccagca
MN507842_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagacccagca
EU239219_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttagaagacccagca
EU239223_C_P-E      tgctggggggatataatgactatagctacctgggtgggtgtaaatttagaagacccagca
GQ161773_C_P-E      tgctggggggaacttatgactctagctacctgggtgggggtaaatttggaagatccatca
GQ161802_C_P-E      tgctggggggaacttatgactctagctacctgggtgggggtaaatttggaagatccatca
MW455162_C_P-E      tgctggggggaactaatgactttagctacctgggtgggtgtcaatttggaagatcaagca
HM363587_C_P-E      tgctggggggacctaatgactctagctacctgggtgggtggaaatttggaagatcaaaca
GQ161826_C_P-E      tgctggggggacttaatgaatctagcgacctgggtgggtgtaaatttggaagatccagca
GQ161757_C_P-E      tgctggggggacctaataactctaagtacctgggtgggtgctaatttggaagatccagca
MW455165_C_P-E      tgctggggggacctaataactctaagtacctgggtgggtgctaatttggaagatccagca
KU736911_C_P-E      tgctggggggacctaatgtctctagctacctgggtgggtgtaaatttggaagatccagca
KU736909_C_P-E      tgctggggggacctaatgamtctagctacctgggtgggtgtaaatttggaagatccagca
GQ161834_C_P-E      tgctggggggacttaatgactctagctacctgggtgggggaaaatttggaagatccagca
AM494714_C_P-E      tgctggggggacttaatgaatctagctacctgggtgggtgtaaacttggaagatccagca
MT731911_C_P-E      tgctggggggacctaatgtctctggctacctgggtgggtgtaaatttggaagatccagca
AB274981_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
LT623844_C_P-E      tgctggggggatgtaatgaatttagctacctgggtgggtgtaaatttggaagatccagca
AM494703_C_P-E      tgctggggggatgtaatgactctagccacctgggtgggtgtaaatttggaagatccagca
AM494800_C_P-E      tgctggggggatgtaatgactctagccacctgggtgggtgtaaatttggaaggtccagca
HM363594_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
HM363596_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MW455163_C_P-E      tgctggggggaactaatgactctagccacctgggtgggggtaaatttggaagatccagca
GQ161820_C_P-E      tgctggggggaastaatgactytagctacctgggtgggtgtaaatttggaagatccagca
GQ161775_C_P-E      tgctggggggacctaatgactctagctacctgggtgggggtaaatttggaagatccagca
EU239217_C_P-E      tgctggggggacttaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AB205191_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AB091256_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MN967527_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AM494706_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MH580650_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaacttggaagatccagca
AM494710_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaacttggaagatccagca
AM494709_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaacttggaagatccagca
AM494697_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaacttggaagatccagca
AM494789_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaacttggaagatccagca
MW082636_C_P-E      tgctggggggacctaatgaatctaggtacctgggtggggggaaatttggaagatccagca
GQ161815_C_P-E      tgctggggggamctaatgactctagctacctgggtgggagttaatttggaagatccagca
GQ161812_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AB201287_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
FN594750_C_P-E      tgctggggggaccttatgtctctagctacctgggtgggtgtaaatttggaagatccagca
HM363590_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
HM363588_C_P-E      tgttggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
HM363589_C_P-E      tgttggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
KU736892_C_P-E      tgctggggggatgtaatgaatctagctacctgggtgggtgtaaatttggaagatccagta
HM363574_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcc
GQ161814_C_P-E      tgctggggggatctaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AB201288_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MW679683_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427111_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
LT623848_C_P-E      tgctggggggacctaatgactctagctacctgggtgggtgttaatttggaagatccagca
LT623845_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgcaaatttggaagatccagca
KM606738_C_P-E      tgctggggagacctaatgactctagctacctgggtgggtgtaaatttggaagatccagca
HM363595_C_P-E      tgctggggggaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
GQ161803_C_P-E      tgctggggggaactaatgactctagctacctgggtgggggtaaatttggaagatccagca
EU239224_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AM494797_C_P-E      tgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AM494711_C_P-E      tgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AM494698_C_P-E      tgctggggggaactaatgactctagctacctgggtgggagtaaacttggaagatccagca
AB274978_C_P-E      tgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MW679682_C_P-E      tgctggggggacctaatgactctagctacctgggtgggggtaaatttggaagatccagca
HQ700551_C_P-E      tgctggggggacctaatgactctagctacctgggtgggtgttaatttggaagatccagca
HM363593_C_P-E      tgctggggggaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AY739674_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AY739675_C_P-E      tgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MH580633_C_P-E      tgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MH580631_C_P-E      tgctggggggaactaatgactctagccacctgggtgggggtaaatttggaagatccagca
MH580632_C_P-E      tgctggggggaactaatgactctagccacctgggtgggggtaaatttggaagatccagca
MH580652_C_P-E      tgctggggggaactaatgactctagccacctgggtgggggtaaatttggaagatccagca
AB274974_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MH580624_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MH580629_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MH580646_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MH580649_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
HM363573_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AB194947_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MH580647_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MH580634_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MH580635_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MH580636_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
KY271392_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MH580621_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MH580622_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MH580625_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MH580637_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
HM363583_C_P-E      tgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaagatcccgca
HM363584_C_P-E      tgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaagatcccgca
GQ161782_C_P-E      tgctggggggatctaatgactctagctacctgggtgggtgtaaatttggaagatccagca
GQ161792_C_P-E      tgctggggggatctaatgactctagctacctgggtgggtgtaaatttggaagatccagca
KF170741_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
GQ161755_C_P-E      tgctggggggaactaatgtctctagctacctgggtgggtgtaaatttggaagatccagcc
MZ962196_C_P-E      tgctggggggaactaatgtctctagctacctgggtgggggtaaatttggaagatccagca
MZ962190_C_P-E      tgctggggggaactaatgtctctagctacctgggtgggtgtaaatttggaagatccagca
GQ161760_C_P-E      tgctggggggacttaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MH580638_C_P-E      tgctggggggaactaatgactctggctacctgggtgggtgtaaatttggaagatccagca
AB205129_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AB205192_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
HM363582_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
HM363585_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MW401520_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
KU736904_C_P-E      tgctggggggaacttatgactctagctacytgggtgggtgtaaatttggaagatccagca
KU736893_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
HM363577_C_P-E      tgctggggggagctaatgactctagctacctgggtgggtgtaaatttggaagatccagca
GQ161835_C_P-E      tgctggggggaactaatgtctctagctacctgggtgggtgtaaatttggaagatccagcc
GQ161794_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
GQ161785_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgcaaatttggaagatccagca
GQ161780_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
GQ161762_C_P-E      tgctggggggacctaatgtctctagctacctgggtgggtgtaaatttggaagatccagca
AM494796_C_P-E      tgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AB205190_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatcaagca
MZ962191_C_P-E      tgctggggggacctgatgactctagctacctgggtgggtgtaaatttggaagatccagca
GQ161758_C_P-E      tgctggggggacctgatgactctagctacctgggtgggtgtaaatttggaagatccagca
GQ161766_C_P-E      tgctggggggacctgatgactctagctacctgggtgggtgtaaatttggaagatccagca
GQ161774_C_P-E      tgctggggggacctgatgactctagctacctgggtgggtgtaaatttggaagatccagca
MZ962197_C_P-E      tgctggggggacctgatgactctagctacctgggtgggtgtaaatttggaagatccagca
KU736902_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AB201289_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AB915175_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427118_C_P-E      tgctggggggaactaatgactctagctacctgggtgggttgaaatttggaagatccagca
MT427113_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427123_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427140_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427112_C_P-E      tgctggggggaactaatgactctagctacctgggtggggtgaaatttggaagatccagca
MT427197_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427196_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427186_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427187_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427171_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427170_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427163_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427156_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427145_C_P-E      tgctgaggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427141_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427138_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427133_C_P-E      tgctgaggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427160_C_P-E      tgctgaggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427132_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427131_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427121_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427126_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427120_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427114_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427115_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427147_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427193_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427110_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427144_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427150_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427116_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427117_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427119_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427122_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427124_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427125_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427127_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427128_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427129_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427130_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427134_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427135_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427136_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427137_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427139_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427142_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427143_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427146_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427148_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427149_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427151_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427152_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427155_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427157_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427158_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427159_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427161_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427162_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427164_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427165_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427166_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427167_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427168_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427169_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427172_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427173_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427174_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427175_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427176_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427177_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427178_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427179_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427180_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427181_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427182_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427183_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427184_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427185_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427188_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427189_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427190_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427191_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427192_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427194_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427195_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427198_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427199_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427200_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427201_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427153_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT427154_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
KU736912_C_P-E      tgctggggggatataatgactatakctacctgggtkggtgtaaatttggaagatccagca
AB274972_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MZ962189_C_P-E      ttctcgggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
EU239218_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcg
MW455161_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
GQ161833_C_P-E      tgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaagatccagca
GQ161756_C_P-E      tgctggggggacctaatgtctctagctacctgggtgggtgtaaatttagaagatccagca
GQ161795_C_P-E      tgctggggggacctaatgtctctagctacctgggtgggtgtaaatttagaagatccagca
MN507844_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MH725114_C_P-E      tgctggggagaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
LT623850_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
KU736901_C_P-E      tgttggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
KU736900_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
GQ161759_C_P-E      tgctggggggaactaatgactctagccacctgggtgggggtaaatttggaagatccagca
HM363569_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
HM363570_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
HM363567_C_P-E      tgctggggggaactaatgactctagctacctgggtgggggtaaatttggaagatccagca
HM363568_C_P-E      tgctggggggaactaatgactctagctacctgggtgggggtaaatttggaagatccagca
GQ161778_C_P-E      tgctggggggacctaatgactctagctacctgggtgggtgttaatttggaagatccagca
GQ161810_C_P-E      tgctggggggacctaatgactctagctacctgggtgggtgttaatttggaagatccagca
MH580640_C_P-E      tgctggggggaactaatgactctagccacctgggtgggtgtaaatttggaagatccagca
MH580641_C_P-E      tgctggggggaactaatgactctagccacctgggtgggtgtaaatttggaagatccagca
MH580617_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MH580628_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MH580644_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
GQ161763_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagacccagca
GQ161777_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagacccagca
FJ349237_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
FJ349238_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AM494694_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AM494696_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AM494700_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AB205189_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
EU239221_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
DQ060826_C_P-E      tgctggggagaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
DQ060827_C_P-E      tgctggggagaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
DQ060828_C_P-E      tgctggggagaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
DQ060829_C_P-E      tgctggggagaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MZ962195_C_P-E      tgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaagatccagca
GQ161790_C_P-E      tgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaagatccagca
GQ161808_C_P-E      tgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaagatccagca
KU736895_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
KU736896_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
HM363592_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
HM363586_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
HM363591_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MN967526_C_P-E      tgctggggggacttaatgagtctagctacctgggtgggtgtaaatttggaagatccagca
HM363579_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
HM363580_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
HM363581_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MT426115_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MH725020_C_P-E      tgctggggagaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MH725021_C_P-E      tgctggggagaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MH725042_C_P-E      tgctggggagaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
X75657_C_P-E        tgctggggagaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MZ962194_C_P-E      tgctggggggaactaatgactctagctacctgggtgggggtaaatttggaagatccagca
MZ962192_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
MN507846_C_P-E      tgctggggggaactaatgactctagctacctgggtgggggtaaatttggaagatccagca
MN507845_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
KU736910_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
KU736897_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
KU736898_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
KU736894_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
KU736891_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
KF170742_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
JQ000008_C_P-E      tgctggggagaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
GQ161832_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
GQ161771_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
FJ349226_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccatca
AM494806_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AM494803_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AM494794_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AB274969_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
GQ161801_C_P-E      tgctggggggaagtaatgactctagctacctgggtgggggtaaatttggaagatccagca
GQ161772_C_P-E      tgctggggggaactaatgactctagctacctgggtgggggtaaacttggaagatccagca
GQ161764_C_P-E      tgctggggggaactaatgactttagctacctgggtgggggtaaatttggaagatccagca
GQ161787_C_P-E      tgctggggggaactaatgactctagctacctgggtgggggtaaatttggaagatccagca
GQ161770_C_P-E      tgctggggggaactaatgactctagctacctgggtgggggtaaatttggaagatccagca
GQ161800_C_P-E      tgctggggggaactaatgactctagctacctgggtgggggtaaatttggaagatccagca
GQ161819_C_P-E      tgctggggggaactaatgactctagctacctgggtgggggtaaatttggaagatccagca
GQ161829_C_P-E      tgctggggggaactaatgactctagctacctgggtgggggtaaatttggaagatccagca
GQ161791_C_P-E      tgctggggggaactaatgactctagctacctgggtgggggtaaatttggaagatccagca
GQ161793_C_P-E      tgctggggggaactaatgactctagctacctgggtgggggtaaatttggaagatccagca
GQ161827_C_P-E      tgctggggggaactaatgactctagctacctgggtgggggtaaatttggaagatccagca
MN507843_C_P-E      tgctggggggaactaatgactctagctacctgggtgggggtaaatttggaagatccagca
MN507848_C_P-E      tgctggggggaactaatgactctagctacctgggtgggggtaaatttggaagatccagca
MZ962199_C_P-E      tgctggggggaactaatgactctagctacctgggtgggggtaaatttggaagatccagca
AM494701_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AM494707_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MH580630_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MN967529_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MH918655_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
KU736903_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
HM363571_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
EU239226_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AM494807_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AM494805_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AM494804_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AM494802_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtgaatttggaagatccagca
AM494795_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AM494705_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AM494801_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AM494702_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AM494798_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AM494799_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AM494689_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AM494690_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AM494693_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AM494699_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AM494704_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AM494708_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AM494712_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AM494715_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AM494717_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AM494788_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AM494790_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
GQ161816_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
HM363572_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
KU736905_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
KX186584_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MH580614_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MH580615_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MH580616_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MH580618_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MH580619_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MH580620_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MH580623_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MH580651_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MK321264_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MK720631_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MK720632_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MN967528_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MN507847_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
FN545841_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AM494713_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
KU736906_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
KU736907_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
KU736908_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
KU736899_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
GQ161836_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
GQ161769_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
GQ161779_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
GQ161765_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
GQ161761_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttagaagatccagca
FJ349239_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AB091255_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AB274971_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
GQ161776_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
GQ161781_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
GQ161784_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
GQ161789_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
GQ161798_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
GQ161804_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
GQ161817_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
GQ161828_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MZ962193_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MZ962198_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
KP857055_C_P-E      tgctggggggacttaatgtctctagctacctgggtgggtgttaatttggaagatcaagca
GQ161825_C_P-E      tgctggggagatgtaatgaatttagctacctgggtgggtgcaaatttggaggatcctgta
KF798275_C_P-E      tgctggggagaactaatgactctagctacctgggtgggtactaatttggaagatccagca
X85274_C_P-E        tgctggggggacttaatgactctagctacctgggtgggtggtaatttggaagatccaaca
KP857010_C_P-E      tgctggggggaattaatgactttagctacctgggtgggtggaaatttggacgatccaaca
AY269055_C_P-E      tgctggggagaactaatgactctagctacctgggtgggtactaatttagaagatccagca
KP856973_C_P-E      tgctggggggaattaatgactctagctacctgggtgggtggtaatttggacgatccaaca
MF772356_C_P-E      tgctggggggacttaatgtctctagctacttgggtgggtgttaatttggaagatcaagca
KF798305_C_P-E      tgctggggtgaattaatgactctagctacctgggtgggtgctaatttggaagatcaagga
EU726953_C_P-E      tgctggggggacttaatgtccctggctacctgggtgggtggtaatttggaagatccagta
KP856998_C_P-E      tgctggggggaactaatgaatctagctacctgggtgggtggtaatttggaagacccaaca
KP856982_C_P-E      tgctggggggaattaatgactctagctacctgggtgggtggtaatttggaagatcccaca
EU726883_C_P-E      tgctggggggaactaatgactctagctacttgggtgggtggtaatttggaagatccaata
KP857001_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaaca
KP857011_C_P-E      tgctggggggacctaatgactctagctacctgggtgggtggaaatttggaagatccagga
KF798259_C_P-E      tgctggggggagctaatgactctagctacctgggtgggtgtgaatttggaagatccagca
KF798270_C_P-E      tgctggggggaattaatgactctagctacctgggtgggtgttaatttggaagatccagca
KF798298_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
MF772359_C_P-E      tgctggggggaactaatgactctagctacctgggtgggcgccaatttggaagatccagca
AF350211_C_P-E      tgctggggggacctaatgtctctagctacctgggtgggtgttaatttggaagatccagca
AF350127_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AF350161_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AF350164_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AF350139_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtgaatttggaagatccagca
AF350167_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AF350134_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AF350135_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AF350208_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgctaatttggaagatccagca
AF350184_C_P-E      tgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AF350187_C_P-E      tgctggggggaattaatgaatctagctacctgggtgggtgtaaatttggaagatccagca
GQ161831_C_P-E      tgctggggggacctaatgaatctagctacctgggtggggggaaatttggaagatcctgca
AF350110_C_P-E      tgctggggggacctaatgagtctagctacctgggtgggtgttaatttggaagatccagca
AM494808_C_P-E      tgttggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AM494810_C_P-E      tgttggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AM494809_C_P-E      tgttggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AM494811_C_P-E      tgttggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AM494812_C_P-E      tgttggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AF350176_C_P-E      tgctggggggacttaatgtctctagctacctgggtgggtgtaaatttggaagatccagca
AF350117_C_P-E      tgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AF350153_C_P-E      tgctggggggaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AF350132_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AF350133_C_P-E      tgctggggggaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AF350169_C_P-E      tgctggggggaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AF350131_C_P-E      tgctggggggaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AF350122_C_P-E      tgctggggggaattaatgactctagccacctgggtgggtgtaaatttggaagatccagca
AF350190_C_P-E      tgctggggggaattaatgactctagccacctgggtgggtgtaaatttggaagatccagca
AF350155_C_P-E      tgctggggggaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AF350125_C_P-E      tgctggggggaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AF350130_C_P-E      tgctggggggaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AF350144_C_P-E      tgctggggggacttaatgtctctaggtacctgggtgggtggtaatttggaagatcaagca
AF350168_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccatca
AF350154_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatcctgca
AF350145_C_P-E      tgctggggggaattaatgactctagctacctgggtgggtgttaatttggaagatccagca
AF350105_C_P-E      tgctggggggaactaatgactctagctacctgggtgggggtaaatttggaagatccagca
AF350210_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AF350206_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AF350177_C_P-E      tgctggggggatctaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AF350146_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AF350205_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AF350188_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AF350212_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AF350213_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
MH725141_C_P-E      tgctggggggaattaatgactctagccacctgggtgggtggaaatttggaagatccagca
AF350142_C_P-E      tgctggggggaactaatgactctagccacctgggtgggtgtaaatttggaagatccagca
AF350143_C_P-E      tgctggggggaactaatgactctagccacctgggtgggtgtaaatttggaagatccagca
AF350207_C_P-E      tgctggggggacttaataactctatctacctgggtgggtgctaatttggaagatccagca
AF350209_C_P-E      tgctggggggacctaatgtctctagctacctgggtgggtgttaatttggaagatccagca
LT623846_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
AF350182_C_P-E      tgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AF350123_C_P-E      tgctggggggaactgatgactctagctacctgggtgggtgtaaatttggaagatccagca
AF350149_C_P-E      tgctggggggaactgatgactctagctacctgggtgggtgtaaatttggaagatccagca
MF772360_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
DQ060830_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
HQ700550_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
HQ700552_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
MF772362_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
AF350175_C_P-E      tgctggggggatataatgactctagctacctgggtgggggtaaatttggaagatccagca
AF350112_C_P-E      tgctggggggaactaatgactctagctacctgggtgggggtaaatttggaagatccagca
AF350137_C_P-E      tgctggggggaactaatgactctagctacctgggtgggggtaaatttggaagatccagca
AF350107_C_P-E      tgctggggggaactaatgactctagctacctgggtgggggtaaatttggaagatccagca
AF350103_C_P-E      tgctggggggaactaatgactctagctacctgggtgggggtaaatttggaagatccagca
AF350109_C_P-E      tgctggggggaactaatgactctagctacctgggtgggggtaaatttggaagatccagca
AF350114_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
AF350219_C_P-E      tgctggggggatctaatgactatagctacctgggtgggtgttaatttggaagatccagca
AF350220_C_P-E      tgctggggggatctaatgactatagctacctgggtgggtgttaatttggaagatccagca
AF350180_C_P-E      tgctggggggaactaatgactctagctacctgggtgggggtaaatttggaagatccagca
AF350181_C_P-E      tgctggggggaactaatgactctagctacctgggtgggggtaaatttggaagatccagca
MH725010_C_P-E      tgctggggggaactaatgactctagccacctgggtgggtgtaaatttggaagatccagca
MH725024_C_P-E      tgctggggggaactaatgactctagccacctgggtgggtgtaaatttggaagatccagca
AF350198_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
AF350199_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
AF350202_C_P-E      tgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AF350172_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AF350150_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AF350200_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AF350201_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AF350179_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AF350115_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AF350116_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AB274970_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatcctgca
AF350215_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatcctgca
AF350151_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AF350126_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatcctgca
AF350214_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatcctgca
AF350218_C_P-E      tgctggggggaactaatgactctagctacctgggtgggggttaatttggaagatccagca
AF350203_C_P-E      tgctggggggacctaatgactctagctacctgggtgggtgttaatttggaagatccagca
AF350197_C_P-E      tgctggggggaattaatgactctagctacctgggtgggtgttaatttggaagatccagca
AF350166_C_P-E      tgctggggggaactaatgactctagctacctgggtgggggttaatttggaagatccagca
AF350183_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
AF350159_C_P-E      tgctggggggacctaatgactctagctacctgggtgggtgttaatttggaagatccagca
AF350160_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
AF350140_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgttaatttagaagatccagca
AF350141_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgttaatttagaagatccagca
AF350111_C_P-E      tgctggggggacctaatgactctagctacctgggtgggtgttaatttggaagatccagca
AF350101_C_P-E      tgctggggggacctaatgactctagctacctgggtgggtgttaatttggaagatccagca
AF350191_C_P-E      tgctggggggacctaatgactctagctacctgggtgggtgttaatttggaagatccagca
AF350204_C_P-E      tgctggggggacctaatgagtctagctacctgggtgggtgttaatttggaagatccagca
AF350186_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
AF350136_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
AF350173_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
AF350216_C_P-E      tgctggggggaactaatgactctcgctacctgggtgggtgttaatttggaagatccagct
AF350217_C_P-E      tgctggggggaactaatgactctcgctacctgggtgggtgttaatttggaagatccagct
AF350185_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
AF350147_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
AF350128_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
AF350113_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
AF350106_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
AF350100_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
AF350165_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
AF350152_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
AF350120_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
AF350121_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
AF350148_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
AF350124_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
AF350158_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
AF350156_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
AF350157_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
AF350104_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
AF350162_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
AF350163_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
AF350189_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
AF350171_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
AF350170_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
AF350178_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
AF350118_C_P-E      tgctggggggaactaatgactctagctacatgggtgggtgttaatttggaagatccagca
AF350099_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
AF350102_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
AF350119_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
AF350174_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
AF350192_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
AF350193_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
AF350194_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
AF350195_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
AF350196_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
AF350108_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
AF350138_C_P-E      tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
                    *  *  **  *  * *      *    **  **** **    **  *  * *  *     

HM363611_C_P-E      tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaatta
AB219534_C_P-E      tccagggaccaagtagtcacttatgtgaatactaatatgggcacaaagttcaggcaatta
KY498770_C_P-E      tctagggamcwagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaatta
AB915180_C_P-E      tccagggaactagtagtaagttatgtcaatactaacatgggcctaaagttcaggcaatta
OK318680_C_P-E      tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaatta
AB219529_C_P-E      tccagggatctagtagtcaattatgtcaatattaatatgggactaaagttcaggcaatta
MH580648_C_P-E      tccagggacctagtagttagttatgtcaatactaatatgggcctacagttcaggcaatta
FN594748_C_P-E      tccagggacgcagtagtcagttatgtcaatactaatatgggactaaagttcaggcaatta
AM494692_C_P-E      tccagggacctagttgtcagttatgtcaatactaatatgggcttaaagttcaggcaatta
AM494787_C_P-E      tccagggacctagttgtcagttatgtcaatactaatatgggcttaaagttcaggcaatta
HM363607_C_P-E      tccagggacctagtagttagttatgtcaatactcatatgggcctaaagttcaggcaatta
FN594761_C_P-E      tccagggacctagtagtcggttatgtcaatactactgtgggactaaagttcaggcaatta
GQ491112_C_P-E      tccagggacctagtagtcagttatgtcaatactcatatgggcctaaagttcaggcaatta
MH580645_C_P-E      tccagggaactagtag