HBVdb

Dataset for nucleotide sequence C of genotype E

[Download (right click)] [Alignment] [Repertoires]

533 sequence(s)

>gnl|hbvcds|AB091255_C_P-E Feature FT:CDS AB091255_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate ABI-129). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggatctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB091256_C_P-E Feature FT:CDS AB091256_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate ABI-212). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacacag
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgttaatactaatatgggcctaaaattcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB106564_C_C-E Feature FT:CDS AB106564_C_C-E of [Viruses] Hepatitis B Virus genotype E (isolate HBV-GA325). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctctatcgggatgccttagaatctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagacccagca
tccagagacctagtagtcagttatgtcaatactaatatgggactaaagttcaggcaattattgtggtttcacatttcttg
tctcactttgggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcccactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB194947_C_P-E Feature FT:CDS AB194947_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CMR954). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagttagttatgtcaatactaatatgggactaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaactgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttacagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatctccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB194948_C_P-E Feature FT:CDS AB194948_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CMR936). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagcttctgtggacttactctcgtttttgcctgccgacttctttccttcagt
aagagatcttctagatactgcctcagctctgtatcgggatgccttagaatctcatgagcattgttcaccgcaccacactg
cactcaggcaagccatactttgctggggggacctaatgtctctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtggtcagttatgtcaatactaatatgggcctaaaattcaggcaattattgtggtttcacatttcttg
tctcactttcggaagagacaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
cacaaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB201287_C_P-E Feature FT:CDS AB201287_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Benin11). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttctcctcaccatacag
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggactaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaactgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB201288_C_P-E Feature FT:CDS AB201288_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Benin89). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcggt
tagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacacgg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggatctggtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcctagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB201289_C_P-E Feature FT:CDS AB201289_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Benin269). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggactaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB201290_C_P-E Feature FT:CDS AB201290_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Benin293). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
ccctcaggcaagtcattctttgctggggagacctaatgactctagctacctgggtgggtgtaaatttggacgatccagca
tcaagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB205129_C_P-E Feature FT:CDS AB205129_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HBV-G758-2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccgtctgacttctttccgtcagt
tagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB205188_C_P-E Feature FT:CDS AB205188_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HBV-GA283). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgagatgccttggaatctcctgagcattgttcacctcaccatactg
cactcaggcaggccattctttgctggggggacctaatgaatctaggtacctgggtgggtggaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagataccgtcgtagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
cacccaatgcccctatcgtatcaacacttcccgagaatactgttgttagacgaagaagcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB205189_C_P-E Feature FT:CDS AB205189_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HBV-G138). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccccaccacacgg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaactgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaaggact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB205190_C_P-E Feature FT:CDS AB205190_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HBV-G123). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
tagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacacgg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatcaagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaactgttatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB205191_C_P-E Feature FT:CDS AB205191_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HBV-G166). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttccgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccccaccacacgg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgttaatactaatatgggcctaaaattcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB205192_C_P-E Feature FT:CDS AB205192_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate HBV-G758). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccgtctgacttctttccgtcagt
tagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB219529_C_P-E Feature FT:CDS AB219529_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate UK1). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactttgcagttactctcgtttttgcctggtgatttctttccttcagt
aagagatcttctagataccgcctcagctctgtttcgggatgccttagaatctcctgagcattgtacccctcaccatactg
cgctcaggcaagtcattctttgctggggagacctaatgaatctagctacctgggtgggtggaaatttgcaagatccagca
tccagggatctagtagtcaattatgtcaatattaatatgggactaaagttcaggcaattattgtggttccacatttcttg
tctcacttttggaagagaaaccgttacagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB219533_C_P-E Feature FT:CDS AB219533_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate UK5). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcctactgatttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatcttctcagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggatataatgactatagctacntgggtgggtgtgaatttgcaagatcaagaa
tccagggacctagtagtcagttatgtcaatactaatatgggactaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaatcgttattgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB219534_C_P-E Feature FT:CDS AB219534_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate UK6). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcctactgacttctttccttccgt
aagagatcttctagataccgcctccgctctgtttcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggagaattaatgtctctagctacctgggtgggtgcaaatttgcaagatccagca
tccagggaccaagtagtcacttatgtgaatactaatatgggcacaaagttcaggcaattattgtggtttcacatttcgtg
tatcacttttggaagggaaattgtcgtagagtatttggtgtcttttggagtgtggattcgcactcctccaccttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagatgcggaggcaggacctctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccgatgctag
>gnl|hbvcds|AB274969_C_P-E Feature FT:CDS AB274969_C_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatctgctagataccgcctcagctctgtatcgggatgcattagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcatatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB274970_C_P-E Feature FT:CDS AB274970_C_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatcctgca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB274971_C_P-E Feature FT:CDS AB274971_C_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB274972_C_P-E Feature FT:CDS AB274972_C_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcagggaagcgattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggactaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB274973_C_P-E Feature FT:CDS AB274973_C_P-E of [Viruses] Hepatitis B Virus genotype E. Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aaaagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggacctaatgaatctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB274974_C_P-E Feature FT:CDS AB274974_C_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaactgtcatagagtatttggtatcttttggagtctggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB274975_C_P-E Feature FT:CDS AB274975_C_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcctgttgacttctatccttcagt
aagagatcttctagataccgcctcagctctgtttcgggatgccttacaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggacgtaatgaatctagctacctgggtgggtgcaaatttggaagatccagca
tccagggacctagtagtcggttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcatatttcttg
tctcacttttggaagagaaaccgtcgtagagtatttggtctcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctaaatcgccgagtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB274976_C_P-E Feature FT:CDS AB274976_C_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=552 residues).
atggatattgacccttataaagaatttggagctactgtggagttgctctcgtttttgcctactgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctcagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccatca
tccagggacctagtagtcggttatgtcaatagtaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaatcgtcctagagtttttggtgtcttttggagtgtggattcgcactcctccaccttatagac
caccaaatgcccctatcttatcaacacttccggagattactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB274977_C_P-E Feature FT:CDS AB274977_C_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtagagttactctcgtttttgcctactgacttctttccttcagt
aagagatcttctagataccgcctcagctttgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactttagctacctgggtgggtgcaaatttggaagatccagca
tcccgggacctagtagtcagttatgtcaataataatatgggcctaaagttcaggcaattattgtggtttcacacttcttg
tatcacttttggaagagatatcgtcttagagtatttggtgtcttttggagtgtggatacgcactcctccaccttatagac
cagcaaatgcccctatcttatcaacacttccggagactactgttcttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB274978_C_P-E Feature FT:CDS AB274978_C_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtaccgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactcatatgggcctaaagttcaggcaattattgtggtttcatatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB274979_C_P-E Feature FT:CDS AB274979_C_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagcgactgtgcagttactctcgtttttgcctggtgaattctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggaagccttagaatctcctgagcattgtacacctcatcacacgg
cactcaggcaagccattctttgctggggggaactaatgacactagctacttgggtgggtgtaaatttggaagatccatca
tccagggacctagtagtcagttatgtcaatgataatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagacgtcgttctagagtttttggtgtcttttggagtgtggattcgcactcctccaccttatagac
caccaaatgcccctatcttatcaacacttccggagattactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB274980_C_P-E Feature FT:CDS AB274980_C_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcctgctgacttctwtccgtcagt
aaaagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcatcatactg
cactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggtgaaaatttggaagatccagca
tccagggacctcgtagtcagttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgccgaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB274981_C_P-E Feature FT:CDS AB274981_C_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtcgagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctttgtttcgggatgccttagaatctccagagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggactaaagttcaggcaattattgtggtttcatatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
cactaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcacaatgttag
>gnl|hbvcds|AB274982_C_P-E Feature FT:CDS AB274982_C_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcatagttcaccgcatcacactg
cactcaggcaagccattctttgctggggggacttaatgtctctagctacctgggtgggtgcaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctaacttttggaagagaaacagtcatagagtatttggtgtcttttggagtgtggattcgcactcctacagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcacaatgttag
>gnl|hbvcds|AB274984_C_P-E Feature FT:CDS AB274984_C_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcctgctgacttctatccttcagt
aaaagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggacctaatgaatctagctacctgggtgggtgttaatttggaagatcaagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctgaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcgtagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccgatgttag
>gnl|hbvcds|AB274985_C_P-E Feature FT:CDS AB274985_C_P-E of [Viruses] Hepatitis B Virus genotype E. Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggagttaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacacttcttg
tatcacttttggaagagaaaccgtcgtagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccactgttag
>gnl|hbvcds|AB915175_C_P-E Feature FT:CDS AB915175_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SA1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggactaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB915178_C_P-E Feature FT:CDS AB915178_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SA4). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccatagaatctccggagcattgttcacctcaccacacgg
cactcaggcaagccattatttgctggggagacctaatgtctctagctacctgggtgggtgaaaatttgcaagatcaagca
tccagggacctggtagtaagttatgtcaacactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcttagagtatttggtgtcctttggagtgtggattcgcactcctcaagcttatagac
cactaaatgcccctatcttatcaacacttcctgagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AB915180_C_P-E Feature FT:CDS AB915180_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SA6). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttaatctcgtttttgcctagtgacttctttccttckgt
acgagatctactagataccgcctcagctctgtttcgggatgccttagaatcttctgagcattgctcacctcaccacactg
cactcaggcaagccgttctttgctggggggatataatgaatatagctacctgggtgggtgcaaatttggaagatccagca
tccagggaactagtagtaagttatgtcaatactaacatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcgtacagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgccgacgaagatctcaatcgccgcgtcgcaaaagatctcaatctcgaggtgcccaatgttag
>gnl|hbvcds|AF350099_C_P-E Feature FT:CDS AF350099_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam4102). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350100_C_P-E Feature FT:CDS AF350100_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam4125). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
ctctcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350101_C_P-E Feature FT:CDS AF350101_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam4527). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagggacctagttgtcagttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgccatagagtatttggtgtcttttggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350102_C_P-E Feature FT:CDS AF350102_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam4537). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350103_C_P-E Feature FT:CDS AF350103_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam4531). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttcttgataccgcctccgctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggggtaaatttggaagatccagca
tccagggatctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350104_C_P-E Feature FT:CDS AF350104_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam4579). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350105_C_P-E Feature FT:CDS AF350105_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam4550). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgaggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttcttgataccgcctccgctctgtatcgggatgccttagaatctcctgagcatcgttcaccgcaccacactg
cactcaggcaagccatactttgctggggggaactaatgactctagctacctgggtgggggtaaatttggaagatccagca
tccaaggatctagtagtcagttatgctaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350106_C_P-E Feature FT:CDS AF350106_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam4607). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttctgt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagctattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350107_C_P-E Feature FT:CDS AF350107_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam4625). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttcttgataccgcctccgctctgtatcgggatgccttagaatctcctgagcattgttcaccgaaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggggtaaatttggaagatccagca
tccagggatttagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350108_C_P-E Feature FT:CDS AF350108_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam4628). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350109_C_P-E Feature FT:CDS AF350109_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam4640). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttcttgataccgcctccgctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggggtaaatttggaagatccagca
tccagggatctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaacccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350110_C_P-E Feature FT:CDS AF350110_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam4644). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgtacaccgcaccacactg
cactcaggcaagccattctgtgctggggggacctaatgagtctagctacctgggtgggtgttaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcatatttcttg
tctcacttttggaagacaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350111_C_P-E Feature FT:CDS AF350111_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam4539). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagggacctagttgtcagttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggccccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350112_C_P-E Feature FT:CDS AF350112_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam4618). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagatactctcgtttttgccttctgacttctttccttcagt
aagagatcttcttgataccgcctccgctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggggtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350113_C_P-E Feature FT:CDS AF350113_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam4690). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgactcttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccgtcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350114_C_P-E Feature FT:CDS AF350114_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam4697). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctctgctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtctttcggagtgtgtattcgcactcctccagcttatagac
cgcccaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350115_C_P-E Feature FT:CDS AF350115_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1001F1). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgaggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350116_C_P-E Feature FT:CDS AF350116_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1002F1). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350117_C_P-E Feature FT:CDS AF350117_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1003F1). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagccactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtttcgggatgccttagaatctcctgagcatggttcaccgcaccacactg
cactcaggcaagccatactttgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagataccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350118_C_P-E Feature FT:CDS AF350118_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1011F5). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacatgggtgggtgttaatttggaagatccagca
tccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350119_C_P-E Feature FT:CDS AF350119_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1013F5). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350120_C_P-E Feature FT:CDS AF350120_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1073F18). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctatatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagggacctagtagtcagttatgttaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350121_C_P-E Feature FT:CDS AF350121_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1074F18). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctatatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagggacctagtagtcagttatgttaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350122_C_P-E Feature FT:CDS AF350122_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1076F18). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctttgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
ctctcaggcaagccattctttgctggggggaattaatgactctagccacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcccccagcttatagac
caccaaatgcccctatcctatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350123_C_P-E Feature FT:CDS AF350123_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1081F20). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggaagccttagaatctcctgagcattgttcacggcaccacattg
cactcaggcaagctattctttgctggggggaactgatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagtttaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350124_C_P-E Feature FT:CDS AF350124_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1099F18). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctatatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350125_C_P-E Feature FT:CDS AF350125_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1100F20). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctttgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacacgg
ctctcaggcaagccattctttgctggggggaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350126_C_P-E Feature FT:CDS AF350126_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1115). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttttttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatcctgca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350127_C_P-E Feature FT:CDS AF350127_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1119F29). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
tcgagatcttctagatactgcctcagctctgtaccgggatgccttagaatctcctgagcattgctcacctcaccatacag
cactaaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaacatgggcctaaagttcaggcaattattgtggtttcacatttcctg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttacagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350128_C_P-E Feature FT:CDS AF350128_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1121F29). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350130_C_P-E Feature FT:CDS AF350130_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1127F28). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctttgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacacgg
ctctcaggcaagccattctttgctggggggaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcccccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350131_C_P-E Feature FT:CDS AF350131_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1129). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
gagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacacgg
ctctcaggcaagccattctttgctggggggaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattagcactcccccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350132_C_P-E Feature FT:CDS AF350132_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1131F31). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctttgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacacgg
ctctcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tcaagagacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggggtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350133_C_P-E Feature FT:CDS AF350133_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1132F31). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctttgtatcgggatgccttagaatctcctgagcattgttcaccgcaccatacgg
ctctcaggcaagccattctttgctggggggaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaacatgggcctaaagttcaggcaattattgtggtttcacatttcctg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350134_C_P-E Feature FT:CDS AF350134_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1135F31). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
tcgagatctcctagatactgcctcagctctgtaccgggatgccttagaatctcctgagcattgctcacctcaccatacag
cactaaggcaagctattctctgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaacatgggcctaaagttcaggcaattattgtggtttcatatttcctg
ccttacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttacagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350135_C_P-E Feature FT:CDS AF350135_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1136F31). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
tcgagatctcctagatactgcctcagctctgtaccgggatgccttagaatctcctgagcattgctcacctcaccatacag
cactaaggcaagctattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaacatgggcctaaagttcaggcaattattgtggtttcatatttcctg
ccttacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttacagac
caccaaatgcccctatcttatcaacacttccggagaatattgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350136_C_P-E Feature FT:CDS AF350136_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1139). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagagacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctacagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350137_C_P-E Feature FT:CDS AF350137_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1142F33). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgaggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttcttgataccgcctccgctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggggtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350138_C_P-E Feature FT:CDS AF350138_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1143F33). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350139_C_P-E Feature FT:CDS AF350139_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1145F33). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
tcgagatctcctagatactgcctcagctctgtaccgggatgccttagaatctcctgagcattgctcacctcaccatacag
cacttaggcaagctattctttgctggggggaactaatgactctagctacctgggtgggtgtgaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaacatgggcctaaagttcaggcaattattgtggtttcatatttcctg
cctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttacagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350140_C_P-E Feature FT:CDS AF350140_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1149F34). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctacagtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttagaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350141_C_P-E Feature FT:CDS AF350141_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1152F34). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctacagtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttagaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350142_C_P-E Feature FT:CDS AF350142_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1157F35). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctttgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagccacctgggtgggtgtaaatttggaagatccagca
tccagagacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350143_C_P-E Feature FT:CDS AF350143_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1158F35). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctttgtatcgggatgctttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagccacctgggtgggtgtaaatttggaagatccagca
tccagagacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350144_C_P-E Feature FT:CDS AF350144_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1159F36). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggacttaatgtctctaggtacctgggtgggtggtaatttggaagatcaagca
tccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350145_C_P-E Feature FT:CDS AF350145_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1162F36). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtgcagttactctcgtttttgccttctgacttctttccgtcagt
aagagatcttctagataccgcctcagctctgtttcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaattaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagagacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcgtagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350146_C_P-E Feature FT:CDS AF350146_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1167). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgagatgccttagaatctcctgagcattgttcaccttaccacacgg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacttagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattgttgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350147_C_P-E Feature FT:CDS AF350147_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1175F40). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagagacctagtagtcagttatgttaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350148_C_P-E Feature FT:CDS AF350148_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1179F42). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctatatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagggacctagtagtcagttatgttaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350149_C_P-E Feature FT:CDS AF350149_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1181F41). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagctattctttgctggggggaactgatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagtttaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaaggggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350150_C_P-E Feature FT:CDS AF350150_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1182F41). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350151_C_P-E Feature FT:CDS AF350151_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1184F41). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggatctagtagtcagttatgtcaatactaatatgggcctaaaattcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350152_C_P-E Feature FT:CDS AF350152_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1187F42). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttccgacttctttccttcagt
aagagatcttctagataccgcctcagctctatatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagggacctagtagtcagttatgttaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350153_C_P-E Feature FT:CDS AF350153_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1194). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatctcctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cacttaggcaagccattctttgctggggggaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcactattggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatctcatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350154_C_P-E Feature FT:CDS AF350154_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1208). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagtcactctcgtttctgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatcctgca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350155_C_P-E Feature FT:CDS AF350155_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1211). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccatacgg
ctctcaggcaagccattctttgctggggggaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350156_C_P-E Feature FT:CDS AF350156_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1246F53). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgttaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350157_C_P-E Feature FT:CDS AF350157_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1247F53). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagggacctagtagtcagttatgttaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350158_C_P-E Feature FT:CDS AF350158_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1249F53). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagggacctagtagtcagttatgttaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagtact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350159_C_P-E Feature FT:CDS AF350159_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1285). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagatactgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcatcacactg
cactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagggacttagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagataccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350160_C_P-E Feature FT:CDS AF350160_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1288F61). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagatactgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcatcacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagggacttagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagataccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350161_C_P-E Feature FT:CDS AF350161_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1307). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
tcgagatcttctagatactgcctcagctctgtatcgggatgccttagaatctcctgagcattgctcacctcaccatacag
cactaaagcaagctattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaacatgggcctaaagttcaggcaattattgtggtttcacatttcttg
cctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350162_C_P-E Feature FT:CDS AF350162_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1325F81). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350163_C_P-E Feature FT:CDS AF350163_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1326F81). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350164_C_P-E Feature FT:CDS AF350164_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1327F81). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
tcgagatcttctagatactgcctcagctctgtatcgggatgccttagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagctattctctgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaacatgggcctaaagttcaggcaattattgtggtttcacatttcctg
cctcacttttggaagagaaaccgtcatagagtattcggtgtcttttggagtgtggattcgcactcctccagcttacagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350165_C_P-E Feature FT:CDS AF350165_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1328F82). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggatccgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350166_C_P-E Feature FT:CDS AF350166_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1331). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggggttaatttggaagatccagca
tccagagacctagttgtcagttatgtcaatactaatatgggcctgaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagataccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350167_C_P-E Feature FT:CDS AF350167_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1348F82). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
tcgagatctcctagatactgcctcagctctgtaccgggatgccttagaatctcctgagcattgctcacctcaccatacag
cactaaggcaagctattctctgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaacatgggcctaaagttcaggcaattattgtggtttcatatttcctg
ccttacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttacagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtggcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350168_C_P-E Feature FT:CDS AF350168_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1349F90). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgactcttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
aagggatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
ctctcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccatca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagtttaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaagtcgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350169_C_P-E Feature FT:CDS AF350169_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1352F90). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatacag
ctctcaggcaagccattctttgctggggggaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350170_C_P-E Feature FT:CDS AF350170_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1353F89). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagtttaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350171_C_P-E Feature FT:CDS AF350171_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1374). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcttcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350172_C_P-E Feature FT:CDS AF350172_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1376). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcatcacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350173_C_P-E Feature FT:CDS AF350173_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1442). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagggacctagtagtcagttatgttaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatactatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgcggcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350174_C_P-E Feature FT:CDS AF350174_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1444). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350175_C_P-E Feature FT:CDS AF350175_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1453). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttcttgataccgcctccgctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattgtttgctggggggatataatgactctagctacctgggtgggggtaaatttggaagatccagca
tccagggacctggtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350176_C_P-E Feature FT:CDS AF350176_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1456). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttcttgataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccgttctttgctggggggacttaatgtctctagctacctgggtgggtgtaaatttggaagatccagca
tccagggatctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagacaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350177_C_P-E Feature FT:CDS AF350177_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1461). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgagatgccttagaatctcctgagcattgttcacctcaccacacgg
cactcaggcaagccattctttgctggggggatctaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattgttgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350178_C_P-E Feature FT:CDS AF350178_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1482F89). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagtttaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350179_C_P-E Feature FT:CDS AF350179_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1520). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
tagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350180_C_P-E Feature FT:CDS AF350180_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1522F137). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgctttagaatctcctgagcattgttctccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggggtaaatttggaagatccagca
cccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350181_C_P-E Feature FT:CDS AF350181_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1524F137). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgctttagaatctcctgagcattgttctccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggggtaaatttggaagatccagca
tcaagagacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggggtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350182_C_P-E Feature FT:CDS AF350182_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1525F137). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgctttagaatctcctgagcattgttctccgcaccacactg
cactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagtttaggcaattattgtggtttcacatttcttg
tctcactttcggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350183_C_P-E Feature FT:CDS AF350183_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1535). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagggacttagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagataccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350184_C_P-E Feature FT:CDS AF350184_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1540). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgagatgccttggaatctcctgagcattgttcacctcatcatactg
cactcaggcatgccgttctttgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350185_C_P-E Feature FT:CDS AF350185_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1557F61). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagatactgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcatcacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350186_C_P-E Feature FT:CDS AF350186_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1560). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcacctcaccacacgg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350187_C_P-E Feature FT:CDS AF350187_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1577). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcctttttgccttctgacttctttccttccat
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
caatcaggcaagccattctttgctggggggaattaatgaatctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaatttctgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcctagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350188_C_P-E Feature FT:CDS AF350188_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1590). Partial genome (Contains: HBe, HBc, HBx). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgagatgccttagaatctcctgagcattgttcacctcaccacacgg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattgttgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcataagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350189_C_P-E Feature FT:CDS AF350189_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1594). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagtttaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350190_C_P-E Feature FT:CDS AF350190_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1615). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctttgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacacgg
ctctcaggcaagccattctttgctggggggaattaatgactctagccacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcccccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350191_C_P-E Feature FT:CDS AF350191_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1654F172). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagggacctagttgtcagttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350192_C_P-E Feature FT:CDS AF350192_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1660F173). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350193_C_P-E Feature FT:CDS AF350193_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1664F174). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350194_C_P-E Feature FT:CDS AF350194_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1665F174). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350195_C_P-E Feature FT:CDS AF350195_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1670F172). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350196_C_P-E Feature FT:CDS AF350196_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1676F174). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350197_C_P-E Feature FT:CDS AF350197_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1678). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagccactgtggagttactctcgtttttgccttctgacttctttccgtcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaattaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350198_C_P-E Feature FT:CDS AF350198_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1682). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
tcgagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcacctcaccatactg
cactaaggcaagctattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350199_C_P-E Feature FT:CDS AF350199_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1691). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcacctcaccatactg
cactaaggcaagctattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350200_C_P-E Feature FT:CDS AF350200_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1713). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350201_C_P-E Feature FT:CDS AF350201_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1720). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350202_C_P-E Feature FT:CDS AF350202_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1722). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctacagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350203_C_P-E Feature FT:CDS AF350203_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1729F202). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
ctctcaggcaagccattctgtgctggggggacctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350204_C_P-E Feature FT:CDS AF350204_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1741F173). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcatcacactg
cactcaggcaagccattctttgctggggggacctaatgagtctagctacctgggtgggtgttaatttggaagatccagca
tccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350205_C_P-E Feature FT:CDS AF350205_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1821F217). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgagatgccttagaatctcctgagcattgttcacctcaccacacgg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattgttgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350206_C_P-E Feature FT:CDS AF350206_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1822F217). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgagatgccttagaatctcctgagcattgttcacctcaccacacgg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattgttgtggtttcacatttcttg
tgtcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccaggttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350207_C_P-E Feature FT:CDS AF350207_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1824F218). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctttgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggacttaataactctatctacctgggtgggtgctaatttggaagatccagca
tccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350208_C_P-E Feature FT:CDS AF350208_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1825F218). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcctaatgacttctttccttcagt
aagagatcttctagataccgcctcagctttgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgctaatttggaagatccagca
tccagggacctagttgtcagttatgtcaatactcatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaatcgtcttagagtatttggtgtcttttggagtgtggattcgcactcctccaccttatagac
caccaaatgcccctatcttatcatcacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350209_C_P-E Feature FT:CDS AF350209_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1827F218). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctttgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggacctaatgtctctagctacctgggtgggtgttaatttggaagatccagca
tccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350210_C_P-E Feature FT:CDS AF350210_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1828F219). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgagatgccttagaatctcctgaacattgttcacctcaccacacgg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggatctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattgttgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttacagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350211_C_P-E Feature FT:CDS AF350211_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1831F219). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttggaatctcctcaacatcattcaccacaccacactg
cactcaggcaagccattctttgctggggggacctaatgtctctagctacctgggtgggtgttaatttggaagatccagca
tccagggacctagtagtcagttatgttaatactaatatgggcctaaagtttaggcaattattgtggtttcacatttcttg
cctcacttttggaagagataccgtcttagagtatttggtgtcttttggagtgtggattcgcactcctccaccttatagac
caccaaatgcccctatcttatcaacacttccggaaattactgttgttagacgaagaggcaggtcccctagaagaagaaat
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350212_C_P-E Feature FT:CDS AF350212_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1833F217). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgagatgccttagaatctcctgagcattgttcacctcaccacacgg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattgttgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350213_C_P-E Feature FT:CDS AF350213_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1834F217). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgagatgccttagaatctcctgagcattgttcacctcaccacacgg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattgttgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350214_C_P-E Feature FT:CDS AF350214_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1842). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatcctgca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350215_C_P-E Feature FT:CDS AF350215_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1847). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgttttggccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgctcacctcaccatactg
caatcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatcctgca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350216_C_P-E Feature FT:CDS AF350216_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1862F231). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctcgctacctgggtgggtgttaatttggaagatccagct
tccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350217_C_P-E Feature FT:CDS AF350217_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1863F231). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctcgctacctgggtgggtgttaatttggaagatccagct
tccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350218_C_P-E Feature FT:CDS AF350218_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1872). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttccgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggggttaatttggaagatccagca
tccagagacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaataccgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350219_C_P-E Feature FT:CDS AF350219_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1874F238). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatcgcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggatctaatgactatagctacctgggtgggtgttaatttggaagatccagca
tccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcagttattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggaaaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350220_C_P-E Feature FT:CDS AF350220_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Gam1876F238). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatcgcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggatctaatgactatagctacctgggtgggtgttaatttggaagatccagca
tccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcagttattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AM494689_C_P-E Feature FT:CDS AM494689_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR006). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatctacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494690_C_P-E Feature FT:CDS AM494690_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR008). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494691_C_P-E Feature FT:CDS AM494691_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR024). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagagtttggagctactgtggagttactctcgtttttgcctaatgacttctttccttccgt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
ctctcaggcaagctattctttgctggggggacctaatgactctagctacctgggtgggtgcaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcacatttcttg
tcttacttttggaagagaaaccgttatagagtatttggtgtcttttggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttccaaatgttag
>gnl|hbvcds|AM494692_C_P-E Feature FT:CDS AM494692_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR026). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagcttctgtggatttactctcgtttttgccttctgacttctttccttcggt
tcgagatctcctagacactgccttagctctgtatcgggatgccttagagtctcctgagcattgctcacctcatcatacag
cactcaggcaagcgattctttgctggggggaattaatgactctagctacctgggtgggtgcaaacttggaagatccagca
tccagggacctagttgtcagttatgtcaatactaatatgggcttaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtatcttttggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagattactgttgttagacgaagaggcaggtcccctcgaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494693_C_P-E Feature FT:CDS AM494693_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR039). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494694_C_P-E Feature FT:CDS AM494694_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR047). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttccgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtggtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcactttcggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494695_C_P-E Feature FT:CDS AM494695_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR053). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgttgagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctccgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggagtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacacttcttg
tatcacttttggaagagaaaccgtcgtagagtatttggtgtcttttggagtgtggattcgcactcctccagcgtatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacacagaggcaggtccactagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494696_C_P-E Feature FT:CDS AM494696_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR060). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttccgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtggtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcactttcggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494697_C_P-E Feature FT:CDS AM494697_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR063). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaacttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctcgaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494698_C_P-E Feature FT:CDS AM494698_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR066). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttttttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgctcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggagtaaacttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494699_C_P-E Feature FT:CDS AM494699_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR082). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494700_C_P-E Feature FT:CDS AM494700_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR083). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttccgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtggtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcactttcggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494701_C_P-E Feature FT:CDS AM494701_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR097). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttttagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
cgccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494702_C_P-E Feature FT:CDS AM494702_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR106). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatcgagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494703_C_P-E Feature FT:CDS AM494703_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR107). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggatgtaatgactctagccacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcggttatgtcaatactaatatgggactaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctaaaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccatcttcccaatgttag
>gnl|hbvcds|AM494704_C_P-E Feature FT:CDS AM494704_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR112). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494705_C_P-E Feature FT:CDS AM494705_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR115). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagctattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494706_C_P-E Feature FT:CDS AM494706_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR131). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttccggcaattgttgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctcgaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494707_C_P-E Feature FT:CDS AM494707_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR137). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
cgccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494708_C_P-E Feature FT:CDS AM494708_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR138). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494709_C_P-E Feature FT:CDS AM494709_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR143). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaacttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcttaaaattcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctcgaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494710_C_P-E Feature FT:CDS AM494710_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR144). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaacttggaagatccagca
tccagggacctagtagtcagttatgttaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcctg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctcgaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494711_C_P-E Feature FT:CDS AM494711_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR146). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcatcacactg
cactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggtctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494712_C_P-E Feature FT:CDS AM494712_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR150). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494713_C_P-E Feature FT:CDS AM494713_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR154). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tctagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494714_C_P-E Feature FT:CDS AM494714_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR165). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctagtgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggacttaatgaatctagctacctgggtgggtgtaaacttggaagatccagca
tccagagacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctaccgcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctcgaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccatcttcccaatgttag
>gnl|hbvcds|AM494715_C_P-E Feature FT:CDS AM494715_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR171). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494717_C_P-E Feature FT:CDS AM494717_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR187). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494786_C_P-E Feature FT:CDS AM494786_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR081). Partial genome (Contains: HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttccgacttctttccttcagt
aaaagatcttctagataccgcctcagctctgtatcgggatgccttagaatcacctgagcattgttcacctcatcacactg
cactcaggcaagccattctttgctggggggacctaatgaatctagctacctgggtgggtgcaaatttgcaagatccagca
tctagggaccaagtagtcagttatgtcaatactactgcgggcctaaagttcaggcaattattgtggtttcacatttcttg
ccttacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
ccccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctcgaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494787_C_P-E Feature FT:CDS AM494787_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR087). Partial genome (Contains: HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagcttctgtggatttactctcgtttttgccttctgacttctttccttcggt
tcgagatctcctagacactgccttagctctgtatcgggatgccttagagtctcctgagcattgctcacctcatcatacag
cactcaggcaagcgattctttgctggggggaattaatgactctagctacctgggtgggtgcaaacttggaagatccagca
tccagggacctagttgtcagttatgtcaatactaatatgggcttaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtatcttttggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagattactgttgttagacgaagaggcaggtcccctcgaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494788_C_P-E Feature FT:CDS AM494788_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR145). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494789_C_P-E Feature FT:CDS AM494789_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR198). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaacttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctcgaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494790_C_P-E Feature FT:CDS AM494790_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR234). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494791_C_P-E Feature FT:CDS AM494791_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR001-1). Partial genome (Contains: HBe, HBc, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgaccctcataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccgtccgt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattggtcacctcaccactctg
caatcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaaattggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatttgggcctaaagttccagcaattgttgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttatagac
caccaaatgcccctatcttatcaacaattccggagaatactgttgttagacgaagaggcaggtcccctcgaagaagaact
tcctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccaggttcccaatgttag
>gnl|hbvcds|AM494792_C_P-E Feature FT:CDS AM494792_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR001-2). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
aagagatcttctagataccgccgcagctctgtatcgggatgccttaaaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatgtgggcctaaagttccggcaattgttgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtcttttggagtgtggattcgcactcctaccgcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggccccctcgaggaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494793_C_P-E Feature FT:CDS AM494793_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR001-3). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgaccctcataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
aagagatcttctagataccgcctcagctctgtatcgggatgccgtagaatctcctgagcattggtcacctcaccactctg
caatcaggcaagccattctttgctggggggacttaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatttgggcctacagttccagcaattgttggggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttatagac
caccaaatgcccctatcttatcaacaattccggagaatactgttgttagacgaagaggcaggtcccctcgaagaagaact
tcctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccaggttcccaatgttag
>gnl|hbvcds|AM494794_C_P-E Feature FT:CDS AM494794_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR039-1). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcactacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatttcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494795_C_P-E Feature FT:CDS AM494795_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR039-2). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494796_C_P-E Feature FT:CDS AM494796_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR067-1). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcctgctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctacagcttatagac
cgccaaatgcccctatcttatcaacactttcggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494797_C_P-E Feature FT:CDS AM494797_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR067-2). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccgtctgacttctttcctgcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagccttgttcacctcaccacactg
cactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcgggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
cgccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494798_C_P-E Feature FT:CDS AM494798_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR106-1). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatcgagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494799_C_P-E Feature FT:CDS AM494799_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR106-2). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatcgagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494800_C_P-E Feature FT:CDS AM494800_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR107). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggatgtaatgactctagccacctgggtgggtgtaaatttggaaggtccagca
tccagggacctagtagtcggttatgtcaatactaatatgggactaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccatcttcccaatgttag
>gnl|hbvcds|AM494801_C_P-E Feature FT:CDS AM494801_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR115). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagctattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494802_C_P-E Feature FT:CDS AM494802_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR138-1). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtgaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494803_C_P-E Feature FT:CDS AM494803_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR138-2). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagtacaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttataggc
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494804_C_P-E Feature FT:CDS AM494804_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR138-3). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttaggcgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494805_C_P-E Feature FT:CDS AM494805_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR138-4). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctgctgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494806_C_P-E Feature FT:CDS AM494806_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR138-5). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttgggagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatatcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494807_C_P-E Feature FT:CDS AM494807_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR138-6). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctctcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AM494808_C_P-E Feature FT:CDS AM494808_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR175-1). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatctactagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgttggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tctagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcctagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AM494809_C_P-E Feature FT:CDS AM494809_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR175-2). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatctactagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgttggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tctagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacctttggaagagaaaccgtcctagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AM494810_C_P-E Feature FT:CDS AM494810_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR175-3). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatctactagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgttggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tctagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcctagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AM494811_C_P-E Feature FT:CDS AM494811_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR177-1). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacgttgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgtggccttctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgttggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tctagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcctagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcagtctcgggaatctcaatgttag
>gnl|hbvcds|AM494812_C_P-E Feature FT:CDS AM494812_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate CAR177-2). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttacaaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgtggccttctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgttggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tctagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcctagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY269055_C_P-E Feature FT:CDS AY269055_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 2483). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttttttccttctgt
acgagatcttctagacaccgccgcggctctgtatcgggatgccttagaatctcctgagcattgttcatctcaccatactg
cactcaggcaagcaattctttgctggggagaactaatgactctagctacctgggtgggtactaatttagaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagaaacggttctagagtatttggtgtcttttggagtgtggattcgcactcccccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY738144_C_P-E Feature FT:CDS AY738144_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate patient B, 7/98). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattttgtgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctctcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AY738145_C_C-E Feature FT:CDS AY738145_C_C-E of [Viruses] Hepatitis B Virus genotype E (isolate patient B, 7/98). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattttgtgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctctcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AY738146_C_P-E Feature FT:CDS AY738146_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate patient B, 7/98). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattttgtgctggggagaattaatgactctagctacctgggtgggcgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctctcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AY738147_C_P-E Feature FT:CDS AY738147_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate patient B, 10/98). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattttgtgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctctcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AY739674_C_P-E Feature FT:CDS AY739674_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate patient P2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctcgtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcgtatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AY739675_C_P-E Feature FT:CDS AY739675_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate patient P2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aaaagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctcgtagtcagttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcgtatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|AY935700_C_P-E Feature FT:CDS AY935700_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate TH-HBV-012). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggagatgtaatgtctctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcggttatgtcaatactaatatgggcctaaagtttaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|DQ060822_C_P-E Feature FT:CDS DQ060822_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 8510-91). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctccgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggagaattaatgactctagctacctgggtgggggtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|DQ060823_C_P-E Feature FT:CDS DQ060823_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 8504-91). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacttagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|DQ060824_C_P-E Feature FT:CDS DQ060824_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 0121-20). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|DQ060825_C_P-E Feature FT:CDS DQ060825_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 0262-09). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|DQ060826_C_P-E Feature FT:CDS DQ060826_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 0433-20). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctccgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccataccg
cactcaggcaagccattctttgctggggagaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|DQ060827_C_P-E Feature FT:CDS DQ060827_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 0317-04). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctccgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccataccg
cactcaggcaagccattctttgctggggagaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|DQ060828_C_P-E Feature FT:CDS DQ060828_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 0443-03). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctccgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccataccg
cactcaggcaagccattctttgctggggagaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcttaaagttcaggcaattactgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|DQ060829_C_P-E Feature FT:CDS DQ060829_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 0350-03). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctccgctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccataccg
cactcaggcaagccattctttgctggggagaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcttaaagttcaggcaattactgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|DQ060830_C_P-E Feature FT:CDS DQ060830_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 235-01). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagatactgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagagacttagtagttagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgacgatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|EU239217_C_P-E Feature FT:CDS EU239217_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate G2451). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
ctctcaggcaagccattctttgctggggggacttaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatgtgggcctaaagttcaggcaattattggggtttcatatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactccttcagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|EU239218_C_P-E Feature FT:CDS EU239218_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate BD2). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcg
tccagggacctggtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattactgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|EU239219_C_P-E Feature FT:CDS EU239219_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PW3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctctatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttagaagacccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|EU239220_C_P-E Feature FT:CDS EU239220_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PW5). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcttttttgcctggtgacttctttccttcagt
aagagatcttctagataccgccacagctctgtatcgggatgccttagaatctcctgagcattgctcacctcaccatactg
cactcaggcaggccattctttgctggggggaactaatgactctagctacatgggtgggtgcaaatttagaagatccagca
tccagggaccttgtagtcagttatgtcaatgataatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaagtcgtcctagagtatttggtgtcttttggagtgtggattcgcactcctccaccttatagac
caccaaatgcccctatcttatcaacacttccggagattactgttattagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|EU239221_C_P-E Feature FT:CDS EU239221_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PW1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccccaccacacgg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaactgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|EU239222_C_P-E Feature FT:CDS EU239222_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PW2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgttggggggaccttatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattactgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcgtagagtatttggtgtcttttggagtgtggattcgcactcctacagcatatagac
caccaaatgcccctatcttatcaacacttcctgagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|EU239223_C_P-E Feature FT:CDS EU239223_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PW4). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctttatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggatataatgactatagctacctgggtgggtgtaaatttagaagacccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|EU239224_C_P-E Feature FT:CDS EU239224_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate BD1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccgtctgacttctttccttcagt
aagggatcttctagataccgcctcagcactgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacggagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagaactcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|EU239226_C_P-E Feature FT:CDS EU239226_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PW6). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcatatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|EU620071_C_P-E Feature FT:CDS EU620071_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Irish-16). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagct
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|EU726883_C_P-E Feature FT:CDS EU726883_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IR-RCGLD-7064). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacgcttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagctttagaatctcctgagcattgctcacctcaccacactg
cactcaggcaagcaattctctgctggggggaactaatgactctagctacttgggtgggtggtaatttggaagatccaata
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726953_C_P-E Feature FT:CDS EU726953_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IR-RCGLD-3551). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtgcagttactctcgtttttgccttctgacttctttccttcaat
acgagatcttctagataccgccgcagctctgtatcgggatgccttagaatctcctgagcattgttcagctcaccatactg
cactcaggcaagcaattctgtgctggggggacttaatgtccctggctacctgggtgggtggtaatttggaagatccagta
tccagggaactagtaatcggttatgtcaacactactgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttatgtttggaagagaaacagttgtagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ349226_C_P-E Feature FT:CDS FJ349226_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate H6). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccatca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctcgaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|FJ349237_C_P-E Feature FT:CDS FJ349237_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C27). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggccttaagttcaggcaattattgtggtttcacatttcttg
tctaactttcggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|FJ349238_C_P-E Feature FT:CDS FJ349238_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C65). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggccttaagttcaggcaattattgtggtttcacatttcttg
tctaactttcggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|FJ349239_C_P-E Feature FT:CDS FJ349239_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C74). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|FJ349240_C_P-E Feature FT:CDS FJ349240_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C89). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcttttttgcctcctgacttctttccttcagt
aagagatcttctagataccgccaaagctctgtttcgggatgccttggaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggtgcaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatattaatgtgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcgtagagtatttggtgtcttttggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|FN545821_C_P-E Feature FT:CDS FN545821_C_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgaaaatttacaagatcaagca
tccagggacctagtagtcagttatgtcaatactcatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcytagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
ctccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|FN545822_C_P-E Feature FT:CDS FN545822_C_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
tagagatcttctagataccgcctcagctctgtttcgggatgccttagaatctcctgagcaytgttcacctcaccacacgg
cactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggatctggtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctacagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|FN545823_C_P-E Feature FT:CDS FN545823_C_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcrgt
aaragatctcctagataccgcctcagctctgtttcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggamytaaygamtctagctacctgggtgggkgtaaatttggaagatccagca
tccagggacckagtagttagttatgtcaatactaatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagataccgttgtagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
cacaaaatgcccctatcttatcaacacttccggagamtgctgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagctgcccaatgttag
>gnl|hbvcds|FN545827_C_P-E Feature FT:CDS FN545827_C_P-E of [Viruses] Hepatitis B Virus genotype E. Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aaragatcttctagataccgcctcagctctgtatagggatgccttggaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccmttctttgctggggggacctaatgaatctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactcmtgtgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcyagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|FN545841_C_P-E Feature FT:CDS FN545841_C_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacacgg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|FN545842_C_P-E Feature FT:CDS FN545842_C_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtsgagttactctcatttttgcctggtgacttctttccttcagt
aagagatcttctagataccgcccaagctctgtttcgggatgctttagaatctcctgagcattgttcacctcatcacactg
cactcaggcaagccattctttgctggggggacctaatgtctctagctacctgggtgggtacaaatttggatgatccagca
tccagggaccwagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tcttacttttggaagagaaatcgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|FN594748_C_P-E Feature FT:CDS FN594748_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne6). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgccttctgacttctatccttcagt
aagagatcttctagataccgcctcagctctctatcgggatgccttagaatcttctgagcattgttcaactcaccctgctg
cactcaggcaagccattctttgctggggggacctaatgaatctaggtacctgggtgggcggcaatttggaagaccaagca
tccagggacgcagtagtcagttatgtcaatactaatatgggactaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttgggagagatacagtcgtagagtatttggtgtcttttggagtgtggattcgcactcctacagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|FN594749_C_P-E Feature FT:CDS FN594749_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne8). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcaactctgtatcgggatgccttagaatctcctccgcattgttcaccctcacatactg
cwctcaggcaagccgttctttgctggggggatgtaatgaatctagctaccggggtgggtacaaatttggaagatccagca
tccagggacctagtagtcggttatgtcaatactaatatgggactaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtctcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|FN594750_C_P-E Feature FT:CDS FN594750_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne12). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctycacatactg
cactcaggcaagccattctttgctggggggaccttatgtctctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggactaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctctagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|FN594751_C_P-E Feature FT:CDS FN594751_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne52H). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctastgtggagttactctcgtttttgccgtctgatttctttccgtcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacytcaccctgctg
cwctcaggcaagccattctctgctggggggacctaatgaatctagctacctgggtgggtgcaaatttggatgatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggactaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaacaccaaccgtcgtagagtatttggtatcttttggagtgtggattcgcactcctattgcttatagac
caccaaatgcccctatcttatcaacacttccggagcatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|FN594752_C_P-E Feature FT:CDS FN594752_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne134). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcatctycacatctgc
cactcaggcaagccattctttgctggggggatgtaatgaacctagcaacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcggttatgtcaatactaatatgggactaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|FN594753_C_P-E Feature FT:CDS FN594753_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne137). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagcttccgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
ccctcaggcaagccattctttgctggggggatgtaatgaatatggctacatgggtgggtgtgaatttgcaagatcaagca
tccagggaccaagtagtcagttatgtcaatactaatatgggactaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagacaaaccgtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccaggttcccaatgttag
>gnl|hbvcds|FN594756_C_P-E Feature FT:CDS FN594756_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne250). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagatacagcctcagctctgtatcgtgatgccttggaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggacataatgaatatagctacctgggtaggtgcaaatttggaagatcaagca
tccagggacctagtagtcagttatgtcaattctaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcctagagtatttggtgtcttttggagtgtggattcgcactcctccaccttatagac
caccaaatgcccctatcttatcaacacttccggagattactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|FN594758_C_P-E Feature FT:CDS FN594758_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne341). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctacagtggagttactctcgtttttgccttctgacttctttccttcagt
aaaagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcccytcaccacactg
cactcaggcaagccattctttgctggggggacctaatgaatctagctacctgggtgggtgcaaatttggaagatccatca
tccagggaactagtagtcggttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcctagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttgtcaacgcttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcacctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttaa
>gnl|hbvcds|FN594759_C_P-E Feature FT:CDS FN594759_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne342). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtgsagytactctcgtttttgccttctgacttctttccttcagt
aagagatctcctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacytcacaccactg
cactcaggcaagcccttctttgctggggggacctaatgaatctagctacctgggtgggtgcaaatttggaagatccatca
tccagggaactagtagtcggttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcctagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttgtcaacgcttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcacctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttaa
>gnl|hbvcds|FN594760_C_P-E Feature FT:CDS FN594760_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne362). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctagtgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttggaatctcctgagcattgttcccytcaccacactg
cactcaggcaagccattctttgctggggggacctaatgaatctagctacctgggtgggtgcaaatttggaagatccatca
tccagggaactagtagtcggttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcctagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttgtcaacgcttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcacctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttaa
>gnl|hbvcds|FN594761_C_P-E Feature FT:CDS FN594761_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne385). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatygacccttataaagaatttggagctwctgkggagttactctcgtttttgccttctgacttctttccttcagt
aagagatctactagataccgcctcagctctctgtcggggtgccttagaatctcctgagcattgttcacctcaccatactg
ctctcaggcaagccattctttgctggggggatcttatgaacctagctacctgggtgggtgcaaatttggaagacccagca
tccagggacctagtagtcggttatgtcaatactactgtgggactaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagacgtcgtcatagagtatttggtgtcttttggagtgtggattcgcactcctatagcttataggc
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagacgaact
ccctcgcctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|FN594762_C_P-E Feature FT:CDS FN594762_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne439). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
aagagatcttctagataccgcctcagctctctttcgggatgccttagaatctcctgagcattgctcacctcaccatagtg
cactcaggcaagccgttctttgctggggggacctaatgaatctagctacctgggtgggtgtaaatttggaagatccagcc
tccagggacctggtagtcagttatgtcaatactgatatgggcctgaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagataccgtcgtagagtatttggtgtcttttggagtgtggattcgcactcctataccttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|FN594763_C_P-E Feature FT:CDS FN594763_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne446). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctagtgtggagttactctcgtttttgccttctgatttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcacaatactg
cactcaggcaagccattctttgctggggggacctaatgaatctagctacctgggtgggtgcaaatttggatgatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggactaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaacaccaaccgtcgtagagtatttggtatcttttggagtgtggattcgcactcctattgcttatagac
caccaaatgcccctatcttatcaacacttccggagcatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|FN594765_C_P-E Feature FT:CDS FN594765_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne9447). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttcygtggagttactctcktttttgccgtctgacttctttccttcagt
aaaagatcttctagataccgcctcagctctgtatcgggatgccttggaatcttctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggacctaatgtctctagctacctgggtgggtgtaaatttggaagatccagca
tccagggaccaagtagtcagttatgtcaacactaatatgggagtaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcgtagagtatttggtgtctttcggagtgtggattcgcactcctccaccttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccgatgttag
>gnl|hbvcds|FN594766_C_P-E Feature FT:CDS FN594766_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate bne9449). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccktctgacttctttccttcagt
aaaagatcttctagataccgcctcagctctgtatagggatgccttgaaatctcctgagcattgttcmcctcaccacactg
cactcaggcaagcaattctttgctggggggacctaatgaatctagctacctgggtgggtgcaaatttggaagatcaagca
tccagggacttagtagtcggttatgtcaatactactgtgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagatatcgtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagacttctgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161755_C_P-E Feature FT:CDS GQ161755_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1694). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagggatcttctagataccgcctcagctttgtatggggatgccttagaatctcctgagcattgttcgccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgtctctagctacctgggtgggtgtaaatttggaagatccagcc
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161756_C_P-E Feature FT:CDS GQ161756_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1684). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cattcaggcaagccattctttgctggggggacctaatgtctctagctacctgggtgggtgtaaatttagaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161757_C_P-E Feature FT:CDS GQ161757_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1156). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcctactgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggacctaataactctaagtacctgggtgggtgctaatttggaagatccagca
tccagggacctagtagtcagttatgttaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaagtcgttttagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161758_C_P-E Feature FT:CDS GQ161758_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1506). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccttcagt
aaaagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacacgg
cactcaggcaagccattctttgctggggggacctgatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggaccttgtagtcagttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161759_C_P-E Feature FT:CDS GQ161759_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU934). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagccacctgggtgggggtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttcctgagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161760_C_P-E Feature FT:CDS GQ161760_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1374). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggacttaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacgtttggaagagaaaccgtagtagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161761_C_P-E Feature FT:CDS GQ161761_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1033). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttagaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161762_C_P-E Feature FT:CDS GQ161762_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU716). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttcattcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggacctaatgtctctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161763_C_P-E Feature FT:CDS GQ161763_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1013). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgctcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagacccagca
tccagggacctagtagttagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161764_C_P-E Feature FT:CDS GQ161764_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1056). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactttagctacctgggtgggggtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161765_C_P-E Feature FT:CDS GQ161765_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU952). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacacgg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161766_C_P-E Feature FT:CDS GQ161766_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1671). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccttcagt
aaaagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacacgg
cactcaggcaagccattctttgctggggggacctgatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggaccttgtagtcagttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161768_C_P-E Feature FT:CDS GQ161768_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU960). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcatcagctctgtatcgagatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggatgtaatgaatttagctacctgggtgggtgtaaatttgcaagatccagca
tccagggaccaagtagtcggttatgtcaatactaatatgggactaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttacagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttccaaatgttag
>gnl|hbvcds|GQ161769_C_P-E Feature FT:CDS GQ161769_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU865). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacaccg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161770_C_P-E Feature FT:CDS GQ161770_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU927). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggggtaaatttggaagatccagca
tccagggacctagtggtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtacttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161771_C_P-E Feature FT:CDS GQ161771_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU896). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaacatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161772_C_P-E Feature FT:CDS GQ161772_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU873). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggggtaaacttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161773_C_P-E Feature FT:CDS GQ161773_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1406). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcaat
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaacttatgactctagctacctgggtgggggtaaatttggaagatccatca
tccagggaactagtagtcagttatgtcaatactaatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagacaagtcgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161774_C_P-E Feature FT:CDS GQ161774_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1501). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccttcagt
aaaagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacacgg
cactcaggcaagccattctttgctggggggacctgatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggaccttgtagtcagttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161775_C_P-E Feature FT:CDS GQ161775_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU754). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcatgtttcaccgcaccacactg
cactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggggtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccgatgttag
>gnl|hbvcds|GQ161776_C_P-E Feature FT:CDS GQ161776_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1178). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161777_C_P-E Feature FT:CDS GQ161777_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU807). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgctcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagacccagca
tccagggacctagtagttagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161778_C_P-E Feature FT:CDS GQ161778_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1035). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgctcaccgcaccacactg
cactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctacagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttccaaatgttag
>gnl|hbvcds|GQ161779_C_P-E Feature FT:CDS GQ161779_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU557). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacaccg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161780_C_P-E Feature FT:CDS GQ161780_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU50). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgrgatgccttagaatctcctgagcattgttcacctcaccacacgg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagggtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagatct
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161781_C_P-E Feature FT:CDS GQ161781_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU200). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161782_C_P-E Feature FT:CDS GQ161782_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1489). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggatctaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatattgccctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161783_C_P-E Feature FT:CDS GQ161783_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU981). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctctatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccatca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacacttcttg
tatcacttttggaagacaaaccgtcgtagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaaaatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161784_C_P-E Feature FT:CDS GQ161784_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU766). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161785_C_P-E Feature FT:CDS GQ161785_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU758). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttgctctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcagcgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgcaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaactgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161786_C_P-E Feature FT:CDS GQ161786_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1688). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccggcccagctctgtatcgggatgccttagaatctcctgagcattgtacaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggggtaaatttgcaagatcaagca
tccagggacctagtagtcaattatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaatcgtcttagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
cactaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161787_C_P-E Feature FT:CDS GQ161787_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU841). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggggtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161789_C_P-E Feature FT:CDS GQ161789_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1169). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161790_C_P-E Feature FT:CDS GQ161790_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1408). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161791_C_P-E Feature FT:CDS GQ161791_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU459). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggggtaaatttggaagatccagca
tccagggacctagtggtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtacttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgccttgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161792_C_P-E Feature FT:CDS GQ161792_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU605). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggatctaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatattgccctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaacccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161793_C_P-E Feature FT:CDS GQ161793_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU932). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctctatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggggtaaatttggaagatccagca
tccagggacctagtggtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161794_C_P-E Feature FT:CDS GQ161794_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU846). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcatgagcattgttcaccgcaccacactg
cactcaggcaagctattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaactgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
ccccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161795_C_P-E Feature FT:CDS GQ161795_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1558). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggacctaatgtctctagctacctgggtgggtgtaaatttagaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161796_C_P-E Feature FT:CDS GQ161796_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1146). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgctcaccgcaccacactg
cactcaggcaagccattctttgctggggggacctaatgaatctaggtacctgggtgggtgcaaatttggatgatcaagca
tccagggaccttgtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcgtg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttacagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttccaaatgttag
>gnl|hbvcds|GQ161797_C_P-E Feature FT:CDS GQ161797_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1660). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
caatcaggcaagccattatttgctggggggaactaatgactctagctacctgggtgggggtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcagacaattattgtggtttcacacatcttg
tatcacttttggaagagaaaccgtcttagagtatttggtgtcttttggagtgtggattcgcactcctccaccttatagac
caccaaatgcccctatcttatcaacacttccggaaattactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161798_C_P-E Feature FT:CDS GQ161798_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1222). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161800_C_P-E Feature FT:CDS GQ161800_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1039). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggggtaaatttggaagatccagca
tccagggacctagtggtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtacttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161801_C_P-E Feature FT:CDS GQ161801_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU438). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaagtaatgactctagctacctgggtgggggtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161802_C_P-E Feature FT:CDS GQ161802_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU921). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcaat
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaacttatgactctagctacctgggtgggggtaaatttggaagatccatca
tccagggaactagtagtcagttatgtcaatactaatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagacaagtcgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161803_C_P-E Feature FT:CDS GQ161803_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1700). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgaggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggggtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttgggagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
cgccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccacgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161804_C_P-E Feature FT:CDS GQ161804_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1428). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161807_C_P-E Feature FT:CDS GQ161807_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1168). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacaccg
cactcaggcaagccattctttgctggggggatctaatgactctagctacctgggtgggtgcaaatttagaagatccagca
tccagggaccaagtagtcagttatgtcaatgataatatagccctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcgtagagtatttggtgtcttttggagtgtggattcgcactcctccaccttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161808_C_P-E Feature FT:CDS GQ161808_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1398). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161810_C_P-E Feature FT:CDS GQ161810_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU852). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgctcaccgcaccacactg
cactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctacagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttccaaatgttag
>gnl|hbvcds|GQ161811_C_P-E Feature FT:CDS GQ161811_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1361). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatygacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttcagc
aagagatcttctagatacygcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacacgg
cactcaggcaagccattctttgctggggggaattaatgactctagctacctgggtgggtggaaatttggaagatccagca
tccagggaccttgtagtcggttatgtcaacactaatatgggcataaggttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagacaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161812_C_P-E Feature FT:CDS GQ161812_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1577). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttttagattccgcatcagctatgtttcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaagccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161814_C_P-E Feature FT:CDS GQ161814_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU625). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatygacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttcattcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggatctaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggaactattagtcagttatgtcaatactaatattgccctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgccaacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161815_C_P-E Feature FT:CDS GQ161815_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1241). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctctatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggamctaatgactctagctacctgggtgggagttaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttgtggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161816_C_P-E Feature FT:CDS GQ161816_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1214). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161817_C_P-E Feature FT:CDS GQ161817_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU630). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161819_C_P-E Feature FT:CDS GQ161819_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1062). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggggtaaatttggaagatccagca
tccagggacctagtggtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtacttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161820_C_P-E Feature FT:CDS GQ161820_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1089). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttcattcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaycgcaccacactg
cactcaggcaagccattctttgctggggggaastaatgactytagctacctgggtgggtgtaaatttggaagatccagca
tccagggayctagtagtcagttatgtcaatamtaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccascttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161823_C_P-E Feature FT:CDS GQ161823_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU3397). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttatgaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacacgg
cactcaggcaagccattctttgctggggggacctaatgaatctaggcacctgggtgggtgtaaatttagaagatcaagca
tccagggaccgagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcttagagtatttggtgtcttttggagtgtggattcgcactcctccaccttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161824_C_P-E Feature FT:CDS GQ161824_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU893). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctctatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccatca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacacttcttg
tatcacttttggaagacaaaccgtcgtagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaaaatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161825_C_P-E Feature FT:CDS GQ161825_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1769). Complete genome. [Hepadnaviridae] (length=549 residues).
atggaccttgacccttataaagaatttggagctactgtggagttactctcgtttttgcctggtgacttctttccttcagt
aagagatcttctatataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgctcacctcatcatactg
cactcaggcaagccattctttgctggggagatgtaatgaatttagctacctgggtgggtgcaaatttggaggatcctgta
tccagggacctagtcgtcagctatgtcaataataatatgggcctaaagttcaggcaattattgtgggttcacatttcttg
tctcacttttggaagagaaacagtcctacagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagaccaagcaggtcctatagaagaagaactccc
tcacctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161826_C_P-E Feature FT:CDS GQ161826_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU607). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aaaagatcttctatataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggacttaatgaatctagcgacctgggtgggtgtaaatttggaagatccagca
tccagggacctggtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttacagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161827_C_P-E Feature FT:CDS GQ161827_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU180). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctctatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggggtaaatttggaagatccagca
tccagggacctagtggtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161828_C_P-E Feature FT:CDS GQ161828_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1399). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161829_C_P-E Feature FT:CDS GQ161829_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU719). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggggtaaatttggaagatccagca
tccagggacctagtggtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtacttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161831_C_P-E Feature FT:CDS GQ161831_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU779). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctttgctggggggacctaatgaatctagctacctgggtggggggaaatttggaagatcctgca
tccagggacgtagtagtcaattatgtcaatactaatatagccctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagacaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161832_C_P-E Feature FT:CDS GQ161832_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1091). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcactttcggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161833_C_P-E Feature FT:CDS GQ161833_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU489). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgttaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacaactccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161834_C_P-E Feature FT:CDS GQ161834_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1128). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcatggttcaccgcaccacactg
cactcaggcaagccattctttgctggggggacttaatgactctagctacctgggtgggggaaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatgcgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctacagcttatagac
caccaaatgcccctatcttatcaactcttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161835_C_P-E Feature FT:CDS GQ161835_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU925). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctttgtatcgggatgccttagaatctcttgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgtctctagctacctgggtgggtgtaaatttggaagatccagcc
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ161836_C_P-E Feature FT:CDS GQ161836_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate GU1051). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttcattcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggatctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|GQ491112_C_P-E Feature FT:CDS GQ491112_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 8804335). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcggt
tcgagatctcctagacactgcctcagctctgtatcgggatgccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagcgattctttgctggggggaattaatgactctagctacctgggtgggggcaaacctggacgatcaagca
tccagggacctagtagtcagttatgtcaatactcatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaacagtccacgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctcgaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctccagcttcccaatgttag
>gnl|hbvcds|HM363565_C_P-E Feature FT:CDS HM363565_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A186). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcctcttgacttctttccttcagt
aaaagatcttctagataccgcctcagctctatatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggacctaatgaatttagccacctgggtgggtgcaaatttggacgacccagga
tctagggaccaagtagtcagttatgtcaatactaatatgggcttaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagatactgtcttagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccattgttag
>gnl|hbvcds|HM363566_C_P-E Feature FT:CDS HM363566_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IBL1082). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcatgtttcacatcaccatactg
cactcaggcaagccattctttgctggggggatataatgaatatagctacctgggtgggtgcaaatttggaagaccaagca
tctagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaactgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatccacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363567_C_P-E Feature FT:CDS HM363567_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C16). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgtacacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggggtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcgtagagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363568_C_P-E Feature FT:CDS HM363568_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C98). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgtacacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggggtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363569_C_P-E Feature FT:CDS HM363569_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A51). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtggtcagctatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcatatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctaaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363570_C_P-E Feature FT:CDS HM363570_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A85). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtggtcagctatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcatatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctaaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363571_C_P-E Feature FT:CDS HM363571_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V16). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363572_C_P-E Feature FT:CDS HM363572_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V5). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363573_C_P-E Feature FT:CDS HM363573_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctttgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagttagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaactgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttacagac
ctccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363574_C_P-E Feature FT:CDS HM363574_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V70). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggaattactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcc
tctagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcattgagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatccacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363575_C_P-E Feature FT:CDS HM363575_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V30). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagatactggctcatctctgtatggggatgccttacaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagttagttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccaggttcccaatgttag
>gnl|hbvcds|HM363576_C_P-E Feature FT:CDS HM363576_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V43). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagatactggctcatctctgtgtggggatgccctagaatctcctgagcattgttcacctcaccatactg
aactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagttagttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccaggttcccaatgttag
>gnl|hbvcds|HM363577_C_P-E Feature FT:CDS HM363577_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C19). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggagctaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagttagttatgtcaatactaatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363578_C_P-E Feature FT:CDS HM363578_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IBL802). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
gagagatcttctagataccgcctcagctctgtttcgggatgccttagaatctcctgagcattgttcagctcaccatactg
ctctcaggcaagccgttctttgctggggggagctaatgactctagctacctgggtgggtgtaaatttggaagatcaagca
tccagggacctagtagttagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcgtagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccactgttag
>gnl|hbvcds|HM363579_C_P-E Feature FT:CDS HM363579_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A32). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363580_C_P-E Feature FT:CDS HM363580_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A79). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363581_C_P-E Feature FT:CDS HM363581_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A84). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363582_C_P-E Feature FT:CDS HM363582_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IBL314). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccgtcagt
aagagatcttctagatactgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363583_C_P-E Feature FT:CDS HM363583_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V137). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccgtcagt
aagagatcttctagatactgcctccgcgctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaagatcccgca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaactgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363584_C_P-E Feature FT:CDS HM363584_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V129). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccgtcagt
aagagatcttctagatactgcctccgcgctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaagatcccgca
tccagggacctagtagtcagttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaactgtcatagagtatttggtgtcttttggagtgtggattcgcactcctacagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363585_C_P-E Feature FT:CDS HM363585_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IBL1455). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttccgacttctttccttcagt
aagagatcttctagatactgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363586_C_P-E Feature FT:CDS HM363586_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A227). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctttgtatcgggatgccttagaatcgcctgagcattgtacacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcttagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363587_C_P-E Feature FT:CDS HM363587_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V195). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgtacccctcaccatactg
cactcaggcaagtcattctttgctggggggacctaatgactctagctacctgggtgggtggaaatttggaagatcaaaca
tccagggacctaatagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363588_C_P-E Feature FT:CDS HM363588_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A100). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcttcagctctgtatcgggatgccttagaatctcctgagcattgtacacctcaccatactg
cactcaggcaagccattctttgttggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttcctgagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363589_C_P-E Feature FT:CDS HM363589_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A178). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcttcagctctgtatcgggatgccttagaatctcctgagcattgcacacctcaccatactg
cactcaggcaagccattctttgttggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttcctgagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363590_C_P-E Feature FT:CDS HM363590_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V119). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgtacacctcatcatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttcctgagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363591_C_P-E Feature FT:CDS HM363591_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A114). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgtacacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcttagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363592_C_P-E Feature FT:CDS HM363592_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A153). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgtacacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacctttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363593_C_P-E Feature FT:CDS HM363593_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IBL1577). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttcggacttctttccttcagt
aagagatcttctagataccgcctcagctctgtttcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
cacaaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363594_C_P-E Feature FT:CDS HM363594_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V157). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagctcttctagataccgcctcagctctgtttcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattatttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgccgacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363595_C_P-E Feature FT:CDS HM363595_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IBL1219). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttccgacttctttccttcagt
aagagatcttatagatactgcctcagctttgtatcgggatgccttcgaatctcctgagcattgttcaccttaccatactg
cactcaggcaagccattctttgctggggggaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363596_C_P-E Feature FT:CDS HM363596_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V87). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagctcttctagataccgcctcagctctgtttcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattatttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagttagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcttagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363597_C_P-E Feature FT:CDS HM363597_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A112). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcaat
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgtacacatcaccatactg
caatcaggcaagccattatttgctggggggaactaatgaatctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctggtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacgtttcttg
tctcacttttggaagagataccgtcttagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363598_C_P-E Feature FT:CDS HM363598_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V15). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggaggtactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctttgtatcgggatgccttagaatctcctgagcattgcacacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatcaagga
tccagggacctagtagtcagttatgtcaataatcatatgggcctaaagttcaggcaattgatgtggtttcacatttcttg
tctcacttttggaagagaaatcgtcctagagtttttggtgtcttttggagtgtggattcgcactcctccaccttatagac
caccaaatgcccctatcttatcaacacttccggagattactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363599_C_P-E Feature FT:CDS HM363599_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V144). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcctactgacttctttccttcagt
aagagatcttctagatactgcatcagctctgtttcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggtgcaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcacatttcttg
tcttatttttggaagagacgtcgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363600_C_P-E Feature FT:CDS HM363600_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C8). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttccgacttctttccttcagt
aagagatcttctagatactgcctcagctctgtttcgggatgccttagaaggtcctgagcattgtacacctcaccatactg
cactcaggcaagccattatttgctggggggaactaatgactctagctacctgggtgggtgtaaatttagacgatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagataccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccacgtcgcagaagatctcaatctccagcttcccgatgttag
>gnl|hbvcds|HM363601_C_P-E Feature FT:CDS HM363601_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IBL911). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcctgccgacttctttccttcagt
aagagatcttctagataccgcttcagctctgtttcgggatgccttagaatctcctgagcattgtacacctcaccatactg
cactcaggcaagccattctttgttggggggaactaatgactctagctacctgggtgggtgcaaatttggaagatcaagca
tccagggacctaatagtcagttatgtcaatagtagtatgggcctaaagttcaggcaaatattctggtttcacatttcttg
tctcacttttggaagagaagtcgttctagagtatttggtgtcttttggagtgtggattcgcactcctccaccttatagac
caccaaatgcccctatcttatcaacacttcctgagattactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363602_C_P-E Feature FT:CDS HM363602_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A231). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggtcattgacccttataaagaatttggcgcttctgtggagttactctcgtttttgccttccgacttctttccttcagt
aagagatcttatagataccgcctcagctttgtatcgggatgccttcgaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggatttaatgaatctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaatcgtcgtagagtatttggtgtcttttggagtgtggattcgcactcctatagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagacgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363603_C_P-E Feature FT:CDS HM363603_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate IBL1274). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctagtgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcccaagctctgtatcgggatgccttagaatcttctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggacctaatgtccctaggtacctgggtggggggaaatttggaagatcaagcg
tccagggacctagtagttagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttagtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccactgttag
>gnl|hbvcds|HM363604_C_P-E Feature FT:CDS HM363604_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A28). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcaat
aagagatcttctagataccgcctcagctctcttccgggatgccttggaatctcctgatcattgctcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgcaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaaattcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatccacacttccggagaatgctgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363605_C_P-E Feature FT:CDS HM363605_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C58). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccttcagt
aagagatcttctagataccgcatcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaattaatgactctagctacctgggtgggtgcaaatttggacgatccagca
tccagggacctagtagtcagttatgttaatactcatatgggcctaaagttcaggcaattattgtggtttcacctttcttg
tctcatgtttggaagagacactgtcgtagagtatttggtgtcttttggagtgtggattcgcactcctatagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccaggttcccaatgttag
>gnl|hbvcds|HM363606_C_P-E Feature FT:CDS HM363606_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate V64). Complete genome. [Hepadnaviridae] (length=552 residues).
atggtcattgacccctataaagaatttggagctactgtggagttactctcgtttttgccttccgacttctttccttcagt
aagagatcttctagataccgcctcagctttgtatcgggatgccttggaatctcctgagcattggtcacctcaccatactg
cactcaggcacgtcattctttgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgttaatactaatatgggcctaaagttcaggcaattattgtggtttcacgtttcttg
tctcatgtttggaagagaaaccgtcctagagtatttggtgtcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatctccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363607_C_P-E Feature FT:CDS HM363607_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C78). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagcttccgtggagttactctcgtttttgccttctgatttctttccttcagt
aagagatattatagatactgcctcaggtttgtttcgggatgccttcgaatctcttgagcattgttcaccttaccatactg
cactcaggcaagccattctttgctggggggaattaatgactctagctacctgggtgggtgcaaatttggaagatccagca
tccagggacctagtagttagttatgtcaatactcatatgggcctaaagttcaggcaattattgtggtttcacttctcttg
tatcacttttggaagagacaccgtcttagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgccgatctcaatcgccgcgtcgcagaagatctcaatctccatcttcccactgttag
>gnl|hbvcds|HM363608_C_P-E Feature FT:CDS HM363608_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A212). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtttcgggatgccttagaatctcctgagcattgttcaccccaccacactg
cactcaggcaagccattctttgctggggggatgtaatgaatctagctacctgggtgggtgcaaatttggaagatcccaca
tccagggaccttgtagtcagttatgtcaatactcatatgggcttaaagaccaggcaattattgtggtttcacatttcttg
tctcacttttggaagagatatcgtcttagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363609_C_P-E Feature FT:CDS HM363609_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A58). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttttggtaaccgctccggctcggaaccggaatgccttagaatttcctgagcattgttcaactcaacctaccg
caatcaggccaagccttttttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccatca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363610_C_P-E Feature FT:CDS HM363610_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C113). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagcttctgtggagttactctcgtttttgcctcctgatttctttccttcagt
aagagatcttctggataccgccgcagctttgtttcgggatgccttcgaatctcctgagcattgtacacctcaccatactg
cactcaggcaagccattctttgctggggggaacttatgactctagctacctgggtgggtgcaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctgaagttcaggcaattattctggtttcacatttcttg
tctcacttttggaagagaagtcgtattagagtatttggtgtcttttggagtgtggattcgcactcctccaccctatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HM363611_C_P-E Feature FT:CDS HM363611_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate A67). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagcttccgtggagttactctcttttttgcctactgacttctatccttccgt
aagagatcttctagataccgcctcagctctgtttagggatgccttggaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggtgcaaatttggaaggtccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacgtttcttg
cctcacttttgggagagaagtcgtagtagagtttttggtgtcttttggggtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctggaagaagaact
ccctcgcctcgcagacgaagacctcaatcgccgcgtcgcagaagatctcaatctccatcttcccaatgttag
>gnl|hbvcds|HQ700550_C_P-E Feature FT:CDS HQ700550_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate E_Mad_A032a). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagagacctagtagttagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgacgatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HQ700551_C_P-E Feature FT:CDS HQ700551_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate E_Mad_F017A). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttggaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagagacctagtagttagttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagaatatttggtgtcttttggagtgtggattcgcactcctacagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|HQ700552_C_P-E Feature FT:CDS HQ700552_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate E_Mad_030). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagagacctagtagttagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgacgatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|JQ000008_C_P-E Feature FT:CDS JQ000008_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate S1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggagaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|JQ000009_C_P-E Feature FT:CDS JQ000009_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate S2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggcttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KF170741_C_P-E Feature FT:CDS KF170741_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SDAC_047). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggatctagtagtcagttatgtcaatactaatatgggactaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatcccaacccccccccttggag
>gnl|hbvcds|KF170742_C_P-E Feature FT:CDS KF170742_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SDAC_125). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagtttaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcacaatgttag
>gnl|hbvcds|KF798259_C_P-E Feature FT:CDS KF798259_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate EICIB-01). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatctccttgataccgcctcagctctgtatcgggaagccttagaatctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgtgaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaaattcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF798270_C_P-E Feature FT:CDS KF798270_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate EICIB-12). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaattaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF798275_C_P-E Feature FT:CDS KF798275_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate EICIB-17). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcgactgtggagttactctcatttttgccttctgatttctttccgtctgt
acgagatcttctagataccgccgcagctctatatcgggatgcgttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggagaactaatgactctagctacctgggtgggtactaatttggaagatccagca
tctagggatctagtggtcagttatgtcaacactaacatgggcctaaagttcaggcaactattgtggtttcatatttcttg
tctcacttttgggagagaaacggttttggagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF798298_C_P-E Feature FT:CDS KF798298_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate EICIB-40). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagaatcgcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagtaatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF798305_C_P-E Feature FT:CDS KF798305_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate EICIB-47). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatctgctagataccgccgcagctctgtatcgggatgccttagaatctcctgagcattgtacacctcaccatactg
cactcaggcaagcatttctttgctggggtgaattaatgactctagctacctgggtgggtgctaatttggaagatcaagga
tctagggacctagtagtcagttatgtcaacgttaacatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagacaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctcaaccttataggc
caccaaatgcccctatcttatcaacacttccggagtgtactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF849713_C_P-E Feature FT:CDS KF849713_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA277). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggrgaaytaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggmctaaagttcagggaattattgtggtttcacatttcttg
tctcactttgggaagagaaaccgtcwtagactatttggtgtcttttggagtgtggattcccactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KF849714_C_P-E Feature FT:CDS KF849714_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA439). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttacyctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KF849715_C_P-E Feature FT:CDS KF849715_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA445). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagctattctttgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KF849716_C_P-E Feature FT:CDS KF849716_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA278). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctctgctctgtatcgggatgccttaaaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcasgcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KF849717_C_P-E Feature FT:CDS KF849717_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA504). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggagaattgatgactctagctacctgggtgggtgtaaatttggaggatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KF849718_C_P-E Feature FT:CDS KF849718_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA72). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttcygacttctttccttcagt
aagagatcttytagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagycattctttgctggggagaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcttaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcttagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagtgtactgttattagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KF849719_C_P-E Feature FT:CDS KF849719_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA154). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttcctctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggatctagtagtcagttatgtcaatactaacatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KF849720_C_P-E Feature FT:CDS KF849720_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA265). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggtcatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggagaattaatgactctagctacctgggtgggtggaaatttgcaagatccaaca
tccagggacctagtggtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
cctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KF849721_C_P-E Feature FT:CDS KF849721_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA379). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcactttgggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KF849722_C_P-E Feature FT:CDS KF849722_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA386). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatacgg
cactcaggcaagccattctttgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcttaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KF849723_C_P-E Feature FT:CDS KF849723_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA173). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagctattctttgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KF849724_C_P-E Feature FT:CDS KF849724_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA274). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctctgctctgtttcgggatgccttagaatctcctgagcattgtacacctcaccatactg
cactcaggcaagccgttctttgctggggagaattaatgaatctagctacctgggtgggtgcaaatttgcaagatccgaca
tccagggatctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcctagagtatttggtgtcttttggagtgtggattcgcactcctccaccttatagac
cacaaaatgcccctatcttatcaacacttccggagactactgttgttagacgaaggggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KF849725_C_P-E Feature FT:CDS KF849725_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA399). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagcctgtctttgctggggagatgtaatgaatctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcggttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcctagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KF849726_C_P-E Feature FT:CDS KF849726_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA417). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccgtcagt
aagagaccttctagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattatttgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaggatccatca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcatcacttccggagtgtactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KF849727_C_P-E Feature FT:CDS KF849727_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA405). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggagaattaatgacgctagctacctgggtgggggtaaatttggaagatccagca
tctagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KF849728_C_P-E Feature FT:CDS KF849728_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate LDA423). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctctgctttgtttcgggatgccttagaatcacctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggtgatgtaatgaatctagcgacatgggtgggtgtaaatttggaagatccggca
tccagggacctagtagtgggttatgtcaatactaatatgggcctaaagttccggcaattattgtggtttcacctttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccactgttag
>gnl|hbvcds|KF922438_C_P-E Feature FT:CDS KF922438_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PO04v1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KF922439_C_P-E Feature FT:CDS KF922439_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate PO04v2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttccccatgttag
>gnl|hbvcds|KM606738_C_P-E Feature FT:CDS KM606738_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Cuba27a). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctccgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccataccg
cactcaggcaagccattctttgctggggagacctaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgttaatactaatgtgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KM606739_C_P-E Feature FT:CDS KM606739_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Cuba32a). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcctgctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtttcgggatgccttagaatctcctgtacatgtttcaccgcaccacactg
cactcaggcaagccattctttgctggggggatgtaatgtctctagctacctgggtgggtgttaatttggaagatccagca
tccagggacctagtagtcggttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcttagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccatagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KP856973_C_P-E Feature FT:CDS KP856973_C_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcctcaggacttctttccttcagt
acgcgatcttctagataccgcctcagctctgtatcggcaagccttagaatctcctgagcattgttcacctcaccatactg
caatcaggcaagcaattttgtgctggggggaattaatgactctagctacctgggtgggtggtaatttggacgatccaaca
tccagggatctagtagtcagttatgtcaacactaatatgggcctaaaattcaggcaactattgtggtttcacatttcttg
cctcacttttggaagagatacagtcctagagtatttggtgtctttcggagtgtggattcgcactccccaagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KP856982_C_P-E Feature FT:CDS KP856982_C_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcctactgacttctttccttcagt
acgagatcttctagatactgcctcagctctgtatcgggatgccttagaatctcctgagcattgtacacctcaccatactg
cactcaggcaagcaattctgtgctggggggaattaatgactctagctacctgggtgggtggtaatttggaagatcccaca
tccagggacctagtagtcagttatgtcaacactaatatgggcctgaagtttaggcaattattgtggtttcacatttcttg
tctcacttttggaagacaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaaggttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagaggacgacgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|KP856998_C_P-E Feature FT:CDS KP856998_C_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactatagagttactctcgtttttgccttctgacttctatccgtcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagaatctcaggatcattgctcacctcaccatactg
cactcaggcaagcaattctctgctggggggaactaatgaatctagctacctgggtgggtggtaatttggaagacccaaca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagacacagttgcagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagatgtcgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttag
>gnl|hbvcds|KP857001_C_P-E Feature FT:CDS KP857001_C_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgccgcagctctgtatcgggaagctttagaatctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctagggaatctcaatgttag
>gnl|hbvcds|KP857010_C_P-E Feature FT:CDS KP857010_C_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgcctcagctctgtttcgggatgccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaatattatgctggggggaattaatgactttagctacctgggtgggtggaaatttggacgatccaaca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacctttcttg
tctcatgtttggaagagaagtagtcgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttrttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagamgatctcaatctcgggaaccycaatgttag
>gnl|hbvcds|KP857011_C_P-E Feature FT:CDS KP857011_C_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgc
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattttgtgctggggggacctaatgactctagctacctgggtgggtggaaatttggaagatccagga
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttaa
>gnl|hbvcds|KP857055_C_P-E Feature FT:CDS KP857055_C_P-E of [Viruses] Hepatitis B Virus genotype E. Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgccttctgacttctttccttcggt
acgagatcttctagataccgcctcagccctgtatcgggatgccttagaatctcctgagcattgttcacctcatcatactg
caatcaggcaagcagttctttgctggggggacttaatgtctctagctacctgggtgggtgttaatttggaagatcaagca
tctagagacctaatagtcagttatgtcaacaataatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaatagtcatagagtatttggtgtccttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcatcacttccggaaactactgttcttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|KT192626_C_P-E Feature FT:CDS KT192626_C_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggatctagtagtcagttatgtcaatactaatatgggactaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaactgtcattgagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttccccatgttag
>gnl|hbvcds|KT749841_C_P-E Feature FT:CDS KT749841_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate FL11). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacctttataaagaatttggagctactgtggagttactctcgtttttgcctactgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatcgcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtggtaatttggaggatccagca
tccagggatctagtagtcagttatgtcaatactactattggccttaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagatatcgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KU736891_C_P-E Feature FT:CDS KU736891_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Egypt_1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatagacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacckcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tcaagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KU736892_C_P-E Feature FT:CDS KU736892_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Egypt_2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatagacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggatgtaatgaatctagctacctgggtgggtgtaaatttggaagatccagta
tcaagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctacagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KU736893_C_P-E Feature FT:CDS KU736893_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Ethiopia_3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctttatcgggatgccttagaatctcctgagcattgttcacctcatcacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacraagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KU736894_C_P-E Feature FT:CDS KU736894_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Liberia_1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactaaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcttaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KU736895_C_P-E Feature FT:CDS KU736895_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Liberia_2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctygtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctatgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacttagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KU736896_C_P-E Feature FT:CDS KU736896_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Liberia_3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctatgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacttagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KU736897_C_P-E Feature FT:CDS KU736897_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Liberia_4). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
ccccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KU736898_C_P-E Feature FT:CDS KU736898_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Liberia_5). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
ccccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KU736899_C_P-E Feature FT:CDS KU736899_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Liberia_6). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctgaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KU736900_C_P-E Feature FT:CDS KU736900_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Somalia_2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgctcacctcaccacactg
cactcaggcaagccattctgtgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagttgtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KU736901_C_P-E Feature FT:CDS KU736901_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgttggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KU736902_C_P-E Feature FT:CDS KU736902_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_12). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatagacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttttttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
ctctcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KU736903_C_P-E Feature FT:CDS KU736903_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_13). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtaaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KU736904_C_P-E Feature FT:CDS KU736904_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_16). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttytttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaacttatgactctagctacytgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtaaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagaactcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KU736905_C_P-E Feature FT:CDS KU736905_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_17). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KU736906_C_P-E Feature FT:CDS KU736906_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KU736907_C_P-E Feature FT:CDS KU736907_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KU736908_C_P-E Feature FT:CDS KU736908_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_5). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KU736909_C_P-E Feature FT:CDS KU736909_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_6). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatygacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggacctaatgamtctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtaaatactmatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaacygtcatagagtatttggtgtcttttggagtgtggattcgcactcctmcagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KU736910_C_P-E Feature FT:CDS KU736910_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_8). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacttagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttctkg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KU736911_C_P-E Feature FT:CDS KU736911_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_9). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatygacccttataaagaatttggagctactgtgsagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggacctaatgtctctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacttagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcttagagtatttggtgtcttttggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KU736912_C_P-E Feature FT:CDS KU736912_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_4). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggatataatgactatakctacctgggtkggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KU736913_C_P-E Feature FT:CDS KU736913_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Sudan_7). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctwstgtggagttgctctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggacytaatgaatctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatrtgggcctaaagttcagrcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtmgtagagtatttggtgtcttttggagtgtggattcgcactcctryagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccamtgttag
>gnl|hbvcds|KX186584_C_P-E Feature FT:CDS KX186584_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Eafr). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KY271392_C_P-E Feature FT:CDS KY271392_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate C34082). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagttagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaactgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttacagac
caccaaatgcccctatcttatcaacacttccggagaatactattgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|KY498770_C_P-E Feature FT:CDS KY498770_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate P94). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=551 residues).
tggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcctwctgacttctttccttccgtc
cgagatctccttgacaccgcctcagcrctgtatcgggaagccttagagtctcctgagcattgttcaccgcatcatacggc
cctcaggcaagccattctttgctggggggaattaatgactctagctacctgggtgggtgtaaatttggaagatcmakcat
ctagggamcwagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgt
ctcacttttggaagagaaaccgtcayagagtatttggtgtcttttggagtgtggattcgcactcctcmascttatagacc
accaaatgcccctatcttatcawcacttccggagamtactgttrttagacgaagaggcaggtcccctagaagaagaactc
cctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctmaatctccagcttcccaatgttag
>gnl|hbvcds|LT623842_C_P-E Feature FT:CDS LT623842_C_P-E of [Viruses] Hepatitis B Virus genotype E. Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcatytttcaccgcaccacactg
cactcaggcaagccattctttgttggggggatctaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatgtgggcctmaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctacagcttatagac
casyaaatgcccctatcttatcaacwcttccggagamtactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttccaaatgttag
>gnl|hbvcds|LT623843_C_P-E Feature FT:CDS LT623843_C_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgatttctttccttcagt
aagagatcttctagataccgccagagctctgtttcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggacctaatgtycctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgttaatactaatatgggactaaagttcaggcaattattgtggtttcacatttcttg
cctcacttttggaagagaaaccgtcgtagagtatttggtatcttttggagtgtggattcgcactcctccagcttataggc
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|LT623844_C_P-E Feature FT:CDS LT623844_C_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctgtgctggggggatgtaatgaatttagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcggttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcratcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|LT623845_C_P-E Feature FT:CDS LT623845_C_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgcaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagacaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgargaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|LT623846_C_P-E Feature FT:CDS LT623846_C_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagatacagcctcagctctgtatcgggatgccttagaatctccggaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccascttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcacctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|LT623847_C_P-E Feature FT:CDS LT623847_C_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtgcagttactctcgtttttgcctcctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgytggggggatataatgaatatagctacctgggtgggtgctaatttggaagatcaaaca
tccagggacctagtagtcagttatgtcaatactaatatgggcataaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaagtagtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|LT623848_C_P-E Feature FT:CDS LT623848_C_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagagacctagtagtcagttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcmtagagtatttggtgtcttttggagtgtggattcgcactcctcmagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagacgatctcaatctccagcttcccaatgttag
>gnl|hbvcds|LT623849_C_P-E Feature FT:CDS LT623849_C_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcctwctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaycacactg
cactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatrtgggcctaaagttcaggcaattattgtggtttcatatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcscactcctcmagcttatagac
caccaaatgcccctatcttatcaacacttccggagamtactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcscctcscagacgaagatctcaatcgccgcgtcscagaagatctcaatctccascttcccaatgttag
>gnl|hbvcds|LT623850_C_P-E Feature FT:CDS LT623850_C_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcactgttcacctcaccacacgg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|LT623851_C_P-E Feature FT:CDS LT623851_C_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgccacagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccatamtatgctggggggaactaatgactctagctacctgggtgggtgcaaatttggamgatccagca
tccagggacctrgtagtcagttatgttaayactaatatgggcctaaagttcagacaattactrtggtttcacatttcttg
tctcacttttggaagagaagtcgtcctagagtatttggtgtcttttggagtgtggattcgcactcctccaccttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgamgaggcaggwcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MF772354_C_P-E Feature FT:CDS MF772354_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 1067). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatgtgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MF772355_C_P-E Feature FT:CDS MF772355_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 488). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctctgctctgtatcgggatgccttagaatcttctgagcattgttcagctcaccatactg
cactcaggcaagccattctttgctggggagatttaatgtccctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagctatgtcaacactaatatgggcctaaagkttaggcaattattgtggtttcacatttcttg
cctcacttttggaagagacgtcgtcctagagtatttggtgtcttttggagtgtggattcgcactcctccagcttataggc
caccaaatgcccctatcttatcaacacttcctgaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MF772356_C_P-E Feature FT:CDS MF772356_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 1834). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcctcctgacttctttccttcagt
aaaagatcttctagataccgcctcagctctatttcgggatgccttggaatcaggtgaacattgctcaccgcaccacactg
cactcaggcatgcctttctttgctggggggacttaatgtctctagctacttgggtgggtgttaatttggaagatcaagca
tccagagaccaagtagtcagttatgtcaacactaatatgggactaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagacaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccatcttcccaatgttag
>gnl|hbvcds|MF772357_C_P-E Feature FT:CDS MF772357_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 222). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgttgagttactctcttttttgcctgctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtttcgggatgccttagaatctcctgaacatttttcaccgcaccacactg
cactcaggcaagccattctttgctggggggacttaatgtctctagctacctgggtgggtgttaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggccttaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctatagcttatagac
cacaaaatgcccctatcttatccacacttccggaaactactgttattagacgaagagtcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccgatgttag
>gnl|hbvcds|MF772358_C_P-E Feature FT:CDS MF772358_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 2255). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccggctgacttctatccttcagt
aaaagatcttctagattccgccacagctctgtttcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggacttaatgaatctagctacctgggtgggtgttaatttggaagatcaagca
tccagagacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggttccacacttcttg
tatcacgtttggaagagaaaccgtagtagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggccccctagaggaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MF772359_C_P-E Feature FT:CDS MF772359_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 335). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaattaggagctactgtggagttactctcgtttttacataatgacttctttccttcact
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacactgctcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggcgccaatttggaagatccagca
tccagggacctagtagtcaattatgttaattctcatatgggcataaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaactgtcctagagtatttggtgtcttttggagtgtggattcgcactcctccaccttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacaacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccactgttag
>gnl|hbvcds|MF772360_C_P-E Feature FT:CDS MF772360_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 666). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccgttctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcctagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MF772361_C_P-E Feature FT:CDS MF772361_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 801). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcggctctgtttcggcatgacttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggtggtaatttggaagatcaagca
tccagagacctagtagtcaattatgtcaatattaatgtgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagataccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcaaaagatctcaatctccagcttccaaatgttag
>gnl|hbvcds|MF772362_C_P-E Feature FT:CDS MF772362_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 960). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagagacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH464855_C_P-E Feature FT:CDS MH464855_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate MA133). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
nnnnnnattgacccttataanngatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatacag
cactcaggcaagccattctttgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcttagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagagnnnnnngcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH464856_C_P-E Feature FT:CDS MH464856_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate MA134). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaaggatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctctgctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcttaaagttcaggcaattattgtggtttcacatttcttc
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagagnnnnnngcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580614_C_P-E Feature FT:CDS MH580614_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 177). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580615_C_P-E Feature FT:CDS MH580615_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 188). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580616_C_P-E Feature FT:CDS MH580616_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 190). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580617_C_P-E Feature FT:CDS MH580617_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 193). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580618_C_P-E Feature FT:CDS MH580618_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 199). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580619_C_P-E Feature FT:CDS MH580619_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 200). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580620_C_P-E Feature FT:CDS MH580620_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 201). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580621_C_P-E Feature FT:CDS MH580621_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 209). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagttagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaactgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttacagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580622_C_P-E Feature FT:CDS MH580622_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 210). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagttagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaactgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttacagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580623_C_P-E Feature FT:CDS MH580623_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 232). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580624_C_P-E Feature FT:CDS MH580624_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 226). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagttagttatgttaatactaatatgggactaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaactgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttacagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580625_C_P-E Feature FT:CDS MH580625_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 239). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagttagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaactgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttacagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580626_C_P-E Feature FT:CDS MH580626_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 240). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttttttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatcttctgagcattgctcacctcaccacactg
cactcaggcaagccattctttgctggggagatctaatgaatctaggaacctgggtgggtggaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaacatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagacttctgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580628_C_P-E Feature FT:CDS MH580628_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 304). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580629_C_P-E Feature FT:CDS MH580629_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 306). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagttagttatgttaatactaatatgggactaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaactgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttacagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580630_C_P-E Feature FT:CDS MH580630_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 310). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
cgccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580631_C_P-E Feature FT:CDS MH580631_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 333). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttttttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagccacctgggtgggggtaaatttggaagatccagca
tccagggacctagtagttagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttacagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580632_C_P-E Feature FT:CDS MH580632_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 334). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttttttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagccacctgggtgggggtaaatttggaagatccagca
tccagggacctagtagttagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttacagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580633_C_P-E Feature FT:CDS MH580633_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 398). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagttagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tcttacttttgggagagaaactgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcaagcttacagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580634_C_P-E Feature FT:CDS MH580634_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 400). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagttagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tcttacttttggaagagaaactgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttacagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580635_C_P-E Feature FT:CDS MH580635_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 401). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagttagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tcttacttttggaagagaaactgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttacagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580636_C_P-E Feature FT:CDS MH580636_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 402). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagttagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tcttacttttggaagagaaactgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttacagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580637_C_P-E Feature FT:CDS MH580637_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 408). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagttagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaactgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttacagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580638_C_P-E Feature FT:CDS MH580638_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 416). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagatactgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctggctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagttagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580640_C_P-E Feature FT:CDS MH580640_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 438). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
ctctcaggcaagccattctttgctggggggaactaatgactctagccacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagctgcccaatgttag
>gnl|hbvcds|MH580641_C_P-E Feature FT:CDS MH580641_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 439). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
ctctcaggcaagccattctttgctggggggaactaatgactctagccacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagctgcccaatgttag
>gnl|hbvcds|MH580644_C_P-E Feature FT:CDS MH580644_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 458). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580645_C_P-E Feature FT:CDS MH580645_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 472). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagcttctgtcgagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtttcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaattaatgactctagctacctgggtgggtgcaaatttggaagatccagga
tccagggaactagtagttagttatgtcaatactcatatgggcctaaagttcaggcaattaatgtggtttcacatttcttg
tctcacttttggaagagaacttgtcgtagagtatttggtgtcttttggagtgtggattcgcactcctccagcttacagac
cacaaaatgcccctatcttatcaacacttccggagactgctgttgttagatcaagaggcaggtcctctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagctccccgatgttag
>gnl|hbvcds|MH580646_C_P-E Feature FT:CDS MH580646_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 476). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagttagttatgttaatactaatatgggactaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaactgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttacagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580647_C_P-E Feature FT:CDS MH580647_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 490). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagttagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaactgtcatagagtatttggtatcttttggagtgtggattcgcactcctccagcttacagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580648_C_P-E Feature FT:CDS MH580648_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 522). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtcgagttactctcgtttttgcctcctgacttctttccttcagt
aaaagatcttctagataccatctcagctctgtttcgggatgccttagaatctcctgagcattgttcacctcaccatactg
caatcaggcaagccattctttgctgggggaaccttatgaatctagctacctgggtgggtgtaaatttggaagatcaagca
tccagggacctagtagttagttatgtcaatactaatatgggcctacagttcaggcaattattgtggtttcacatgtcttg
tatcatttttggaagggaaactgtcttagagtatttggtgtcttttggagtgtggattcgcactcctccagcttacagac
caccaaatgcccctatcttatcaacacttcctgagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagacgatctcaatctccatcttcccaatgttag
>gnl|hbvcds|MH580649_C_P-E Feature FT:CDS MH580649_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 523). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagttagttatgttaatactaatatgggactaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaactgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttacagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580650_C_P-E Feature FT:CDS MH580650_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 619). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgaggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcatcacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaacttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580651_C_P-E Feature FT:CDS MH580651_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 623). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH580652_C_P-E Feature FT:CDS MH580652_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 668). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttttttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagccacctgggtgggggtaaatttggaagatccagca
tccagggacctagtagttagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttacagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH725010_C_P-E Feature FT:CDS MH725010_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SA-263). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagccacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttga
>gnl|hbvcds|MH725020_C_P-E Feature FT:CDS MH725020_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SA-298). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggagaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtaagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgctag
>gnl|hbvcds|MH725021_C_P-E Feature FT:CDS MH725021_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SA-311). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggagaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtaagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH725024_C_P-E Feature FT:CDS MH725024_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SA-321). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcaat
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagccacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|MH725042_C_P-E Feature FT:CDS MH725042_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SA-387). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggagaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtaagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH725114_C_P-E Feature FT:CDS MH725114_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SA-870). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggagaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtaagttatgtcaatactaacatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tcttacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgccgaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MH725141_C_P-E Feature FT:CDS MH725141_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SA-1227). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcaat
aagagatcttctagataccgcctcagctctgtatcgggaggccttagaatctccggaccattgttcacctcaccatacag
cactcaggcaagccattctttgctggggggaattaatgactctagccacctgggtgggtggaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|MH725192_C_P-E Feature FT:CDS MH725192_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate SA-1435). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
aagagatcttctagataccgcctcagctctgtatcgggatgcgttggaatctcccgagcattgttcatctcaccacactg
cactcaggcaagccattctttgctggggagacctaatgtctctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtaagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcttagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagctccccaatgttag
>gnl|hbvcds|MH918655_C_P-E Feature FT:CDS MH918655_C_P-E of [Viruses] Hepatitis B Virus genotype E. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tcaagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MK321264_C_P-E Feature FT:CDS MK321264_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 1332). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MK720631_C_P-E Feature FT:CDS MK720631_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate p1332_RCA). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MK720632_C_P-E Feature FT:CDS MK720632_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate p1332_CL). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MN507840_C_P-E Feature FT:CDS MN507840_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 3816_HBVe_GC). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcctcatgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacacgg
cactcaggcaagccattctttgctggggggatgtaatgaatctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctggtagtcggttatgtcaatactaatatgggcctaaagttcagacaattattgtggtttcacacttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccaccttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgtagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccgatgttag
>gnl|hbvcds|MN507841_C_P-E Feature FT:CDS MN507841_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 7032_HBVe_GC). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggagaattaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggcttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MN507842_C_P-E Feature FT:CDS MN507842_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 1048_ocHBVe_GC). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctctatcgggatgccttagaatctcctgagcattgttcacctcatcacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagacccagca
tccagagacctagtagtcagttatgtcaatactaatatgggactaaagttcaggcaattattgtggtttcacatttcttg
tctcactttgggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcccactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MN507843_C_P-E Feature FT:CDS MN507843_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 1969_ocHBVe_GC). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggggtaaatttggaagatccagca
tccagggacctagtggtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MN507844_C_P-E Feature FT:CDS MN507844_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 2504_ocHBVe_GC). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttcattcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaataataatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccaccttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MN507845_C_P-E Feature FT:CDS MN507845_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 2547_ocHBVe_GC). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacttagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MN507846_C_P-E Feature FT:CDS MN507846_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 2506_ocHBVe_GC). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacacgg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggggtaaatttggaagatccagca
tccagggacctagtggtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtacttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MN507847_C_P-E Feature FT:CDS MN507847_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 2664_HBVe_GC). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttcattcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagagacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|MN507848_C_P-E Feature FT:CDS MN507848_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate 6778_HBVe_GC). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccacactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggggtaaatttggaagatccagca
tccagggacctagtggtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|X75657_C_P-E Feature FT:CDS X75657_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate Bas). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccacactg
cactcaggcaagccattctttgctggggagaactaatgactctagctacctgggtgggtgtaaatttggaagatccagca
tccagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttag
>gnl|hbvcds|X85274_C_P-E Feature FT:CDS X85274_C_P-E of [Viruses] Hepatitis B Virus genotype E (isolate patient Tedde'89). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactatcgtttttgcctaatgacttctatccttcagt
aagagatcttctagataccgcctcagctctatatcgggaagccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacttaatgactctagctacctgggtgggtggtaatttggaagatccaaca
tccagggacgtagtagtcagttatgttaacactaatgtgggccttaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaactgtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
© 1998-2020Legal notice