HBVdb

Dataset for nucleotide sequence PreS1 of genotype D

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                    *     *   * **    **  *  * **  *  * *    ** 
---ATGGG---GC------------AGA---ATCTTTCCACCAGCAATCCTCTGGGATTCTTTCCCGACCACCAGTTGGA
                                   g                               t  a     
                                   c                                            
                                                                                

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *  *                       *  *  *****   * *  *        *    * *            *   
TCCAGCCTTCAGAGCAAACACcGCAAATCCAGATTGGGACTTCAATCCCAACAAGGACACCTGGCCAGACGCCAACAAGG
c          a   g  tt aaac  c           t                  c t      a t          
                     ttg                                    a                   
                                                                                

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  **    **  *                                                                   
TAGGAGCTGGAGCATTCGGGCTGGGaTTCACCCCACCgCACGGAGGCCTTTTGGGGTGGAGCCCTCAGGCTCAGGGCATA
    g  g     c a   a ca  tc       g  a        t  g  a  a        g  a     a    cg
       c     t           g           t                                          
                                                                                

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
cTACAAACcTTGCCAgCAAATCCGCCTCCTGCcTCtACCAATCGCCAGTCAGGAAGGCAGCCTACCCCgCTGTCTCCACC
a g  c  tg     aa g    a       tag c    g   t gaa ga gc a  a  c  t  t   a    g  
t        c      t               t           a                 g  a  a           
                                                                                

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
TTTGAGAaACACTCATCCTCAGGCCATGCAGTGGAAcTCCACAACCTTCCACCAAACTCTGCAAGATCCCAGaGTGAGAG
gc  c  g t  g  c     a  a  a        t aa a  at  t  t   g gt a          ag    ag 
            c                                a                                t 
            a                                                                   

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
             *  **                          * ** *   *     *                   *
GCCTGTATTTCCCTGCTGGTGGCTCCAGTTCAGGAACAGTAAACCCTGTTCCGACTACTGcCTCTCcCaTATCGTCAATC
    a   c t                c   c agg   cg g        t   c    ta    a tc  ta      
                                                                                
                                                                                

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
      *  *        * **        ***           *                   *            ***
TTCTCGAGGATTGGGGACCcTGCGCTGAACATGGAGAACATCACATCAGGATTCCTAGGACCCCTgCTCGTGTTACAGGC
                 t  tatc   t     a               c             t              
                        aa                                                      
                                                                                

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *    *     *   * *     * *                 *   **  * *  **   *  *      *     **
GGGGTTTTTCTTGTTGACAAGAATCCTCACAATACCGCAGAGTCTAGACTCGTGGTGGACTTCTCTCAATTTTCTAGGGG
        c           a               aa                              g           
                                                                                
                                                                                

       650       660       670       680       690       700       710       720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                **    *   *  *  *  *            * **   * * *   *  ***           
GaACtACCGTGTGTCTTGGCCAAAATTCGCAGTCCCCAACCTCCAATCACTCACCAACCTCCTGTCCTCCAACTTGTCCT
ag ac          g                                             t        g         
 c  g                                                                           
                                                                                

       730       740       750       760       770       780       790       800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*  * **       *      * *        **     *  * *  *  *      *  *  * *   *  * *  *  
GGTTATCGCTGGATGTGTCTGCGGCGTTTTATCATCTTCCTCTTCATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCT
  a     t       a                  a          c      t          c               
                                                                                
                                                                                

       810       820       830       840       850       860       870       880
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
    *         *         ***    **                       *             *         
TCTGGACTATCAAGGTATGTTGCCCGTtTGTCCTCTAATTCCA------GGATCtTCAACc---------ACCAGCacGG
           gg              c     aa gc                c  g  t               gt  
            c              g                          a     a                   
                                                      g                         

       890       900       910       920       930       940       950       960
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
     *         * *  *                 *                 **  *    **            *
GACCATGCaGAACCTGCAcGACTcCTGcTCAAGGAACCTCTATGTATCCCTCCTGTTGCTGTACCAAACCTTCGGACGGA
  a c   cag  t     taat  t      cg         t      a  c     ta     c t   ta  
  t                                                 t                           
                                                                                

       970       980       990      1000      1010      1020      1030      1040
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*    ***   ** ** * **** ** ** **    *  * **  *  * * **   ***        **  *     * 
AATTGCACCTGTATTCCCATCCCATCATCcTGGGCTTTCGGAAAATTCCTATGGGAGTGGGCCTCAGCCCGTTTCTCCTG
  c     a                    t          c              c        t            a  
                             a                                               t  
                                                                                

      1050      1060      1070      1080      1090      1100      1110      1120
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
    *           *  *  *  *       *        *  *         **    *     *    ** *    
GCTCAGTTTACTAGTGCCATTTGTTCAGTGGTTCGTAGGGCTTTCCCCCACTGTTTGGCTTTCAGTTATATGGATGATGT
                  c                c              t   c       t      g t        
                                                                       c        
                                                                                

      1130      1140      1150      1160      1170      1180      1190      1200
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
      ***  * *              *         *           *    *  *   *                 
GGTATTGGGGGCCAAGTCTGTACAgCATCTTGAGTCCCTTTTTACCGCTGTTACCAATTTTCTTTTGTCTTTGGGTATAC
   g           aa   cgtca  c     ag      a   t                  a c   c    cg   
                     t  c                                       c     g         
                                                                                

      
....:.
      
ATTTAA
  c g 
      
      
© 1998-2022Legal notice