HBVdb

Dataset for nucleotide sequence PreS1 of genotype D

[Download (right click)] [Edit] [Sequences] [Repertoires]

1503 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


MF925366_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
X65258_PreS1_P-D        ---atggg---gc------------aga---atctatccaccagcaatcc
JN604245_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF170749_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
FJ562309_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KT749823_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090637_PreS1_P-D      ---atggg---gc------------aga---atctttcctccagcaatcc
JN257153_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN257195_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF170768_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF170775_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB674420_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB330367_PreS1_P-D      ---atggg---gc------------aga---atctctccaccagcaatcc
JF754617_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF754588_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
DQ464181_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GU456678_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN257160_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN257176_PreS1_P-D      ---atggg---tc------------aga---atctttccaccagcaatcc
JN257177_PreS1_P-D      ---atggg---tc------------aga---atctttccaccagcaatcc
DQ464182_PreS1_P-D      ---atggg---gc------------gga---atctttccaccagcaatcc
JN040753_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
FJ349215_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB674419_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK355501_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
X80924_PreS1_P-D        ---atggg---gc------------aga---atctttccaccagcaatcc
X80926_PreS1_P-D        ---atggg---gc------------aga---atctttccaccagcaatcc
EF103280_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN642128_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GU456674_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090609_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB674416_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GU456684_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF754629_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN642135_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GU456682_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090640_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090641_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB674425_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN257165_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN257166_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GU456665_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KM524338_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF061169_PreS1_P-D      ---atggg---gc------------aga---atctttccaccakcmatcc
GU456679_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB674406_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GU456657_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB188244_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB674417_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB674418_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN664931_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
JN642126_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GQ477458_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040830_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040775_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GU456676_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF471644_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN257159_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EF103276_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040782_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB674431_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KM524348_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF754606_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040766_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KM108595_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN642138_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN642129_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN257188_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN257183_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF754600_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AY721611_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GQ183467_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GQ183460_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GQ183469_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GQ183461_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GQ183458_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GQ183456_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GQ183465_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GQ183459_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GQ183468_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GQ183455_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GQ183452_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GQ183449_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GQ183450_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GQ183451_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GQ183453_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GQ183454_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GQ183457_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GQ183462_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GQ183463_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GQ183464_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GQ183466_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GQ183448_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN642165_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
DQ304547_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
DQ304548_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
DQ304550_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
DQ304551_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AY236162_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
DQ304549_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN642164_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040779_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090665_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB270541_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KM108601_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN642158_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN642147_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN257172_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
FJ904427_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF754626_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF471642_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF754612_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
FJ904426_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KX276975_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
FJ904418_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KP995100_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN642155_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN604312_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GU456675_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GU456654_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
FJ904422_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090676_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF754609_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GU456668_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GU456659_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GU456653_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU787443_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF754599_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF754623_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MF925391_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KM108596_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040762_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KY629633_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF061167_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090721_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040790_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AJ344116_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK355500_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF170772_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN642131_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN257150_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GQ205380_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB270550_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090668_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN642157_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN642136_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GU456677_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GU456671_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GU456658_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF471654_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040793_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040773_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GU456669_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
FJ904431_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
DQ111986_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090647_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GU456656_PreS1_P-D      ---atggg---gc------------aga---atctctccaccagcaatcc
AB104710_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN642153_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040751_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040771_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040757_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040750_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF754614_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF754590_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GU456683_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GU456667_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GU357846_PreS1_P-D      ---atggg---gc------------aga---atccttccaccagcaatcc
KM108594_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF170756_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN257200_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN257149_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF471657_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090660_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN642166_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN257170_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF471645_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF471659_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GU456655_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
FJ349219_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK598645_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN257163_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040784_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040774_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GU456670_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AY741797_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF471650_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN642156_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040765_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF754592_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GU456673_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EF103279_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB270542_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF170771_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040826_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaaccc
GU456661_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
FJ904445_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK693108_PreS1_P-D      ---atggg---gc------------aga---atcttttcaccagcaatcc
JX090681_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KM108603_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KM108602_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF170755_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040824_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040815_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040778_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF754594_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF754593_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GU456681_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GU456664_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EF103281_PreS1_P-D      ---atggg---gc------------aga---atcttttcaccagcaatcc
EF103275_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AY945307_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB270546_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
FJ904420_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
FJ904421_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
FJ904415_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AY741794_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AY741795_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AY741796_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF170770_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GU456666_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF061170_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF061168_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
FJ904424_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB246348_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090621_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF754627_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
FJ904432_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040781_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB270548_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF471646_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040767_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040759_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB674407_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AY161151_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AY161150_PreS1_P-D      ---atggg---gc------------aga---atctttccatcagcaatcc
AY161152_PreS1_P-D      ---atggg---gc------------aga---atctttccatcagcaatcc
FJ349229_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB270539_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KM524342_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040758_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AY161157_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AY161158_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF471656_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB270547_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
LT992454_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF170773_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF170757_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090695_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF754615_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GU456680_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AF121239_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MN507838_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MN507853_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF471660_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875292_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040791_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GU456660_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK507913_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KY629634_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KX827300_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KM606753_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF471641_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090627_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN604263_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040761_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF754601_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GQ183480_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
FJ904412_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
FJ349228_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU414136_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU414135_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AJ627224_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AF280817_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF754604_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN257209_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN257193_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090684_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JQ687531_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF754618_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB222712_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090655_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090654_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090650_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090651_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090652_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090653_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090649_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB674405_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF754624_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN257182_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AF121240_PreS1_C-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AF121241_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AF121242_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KT366498_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KT366500_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KT366501_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KT366502_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB246347_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
HM750155_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
HM750156_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KT366508_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KT366499_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KM108600_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF170776_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN604278_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN604206_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN257171_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN257151_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040794_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GQ183470_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
FJ904443_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
FJ386590_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
FJ349230_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
FJ349216_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AY721607_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF170765_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040783_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF471658_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
FJ349220_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KM108591_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KM108606_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KM108607_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF170758_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF170759_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF754628_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF170747_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF170764_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
LC365689_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KP322600_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF170766_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN642167_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040792_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
HM750152_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU787446_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB583680_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU787436_PreS1_P-D      ---atggg---gc------------aga---atctttccacaagcaatcc
MK507914_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK507910_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GQ377589_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB270543_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU594397_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN257179_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN257185_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK507911_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB222711_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX310727_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK052949_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK052961_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaaccc
MK052954_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK052950_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK052959_PreS1_P-D      ---atggg---gc------------aga---atctctccaccagcaatcc
MK052951_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK052973_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK052975_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK052974_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK052948_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK052966_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK052963_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK052971_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK052955_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK052956_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK052958_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK052960_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK052972_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK052952_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK052947_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK052953_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF754598_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040818_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090697_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN642133_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN257162_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB674424_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090610_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GQ184322_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GQ167301_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GQ167302_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF754611_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GU456643_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040769_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN642154_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB674428_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF754630_PreS1_P-D      ---atggg---gc------------aga---atctttccatcagcaatcc
JX310734_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
L27106_PreS1_P-D        ---atggg---gc------------aga---gtctttccaccagcaatcc
JX090635_PreS1_P-D      ---atggg---gc------------aga---atctttcctccagcaatcc
GU456645_PreS1_P-D      ---atggg---gc------------aga---atctctccaccagcaatcc
AY741798_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040804_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF754631_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF754632_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB555500_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN604239_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU787438_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU939681_PreS1_P-D      ---atggg---gc------------aga---atctctccaccagcaatcc
FJ899792_PreS1_P-D      ---atggg---gc------------aga---atctctccaccagcaatcc
EU787445_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090720_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090719_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090723_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090722_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090707_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
HQ833467_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
HQ833469_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090724_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090705_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU787441_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
HQ833465_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU919197_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090687_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090644_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090706_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU787437_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090708_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU787447_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
HM750154_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
HM750153_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090629_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
HQ833468_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090703_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
HQ833471_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090626_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090630_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090631_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090632_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090638_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090642_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090643_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090645_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090704_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090646_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KY629630_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
HQ833470_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU787442_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU787440_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KX276999_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MH724236_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX310733_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040810_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040822_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040768_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GU456651_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX310735_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GU456637_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090634_PreS1_P-D      ---atggg---gc------------aga---atctctccaccagcaatcc
DQ399006_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN642150_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN642140_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
M32138_PreS1_P-D        ---atggg---gc------------aga---atctttccaccagcaatcc
GU456639_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN642149_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN257186_PreS1_P-D      ggcatggg---gc------------aga---atctttccaccagcaatcc
JN040755_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GU456635_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GU456636_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN257201_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX036333_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX036334_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN642142_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
FJ904446_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB674423_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF754610_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GU456649_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040820_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF754634_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
HQ700472_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB674411_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB555501_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF754635_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040800_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040801_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF471640_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF754603_PreS1_P-D      ---atggg---gc------------aga---atctttccacaagcaatcc
JN642134_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF584160_PreS1_P-D      ---atggg---gc------------aga---acctttccaccagcaatcc
KF584163_PreS1_P-D      ---atggg---gc------------aga---acctttccaccagcaatcc
KF584164_PreS1_P-D      ---atggg---gc------------aga---acctttccaccagcaatcc
KY382412_PreS1_P-D      ---atggg---gc------------aga---acctttccaccagcaatcc
KF584165_PreS1_P-D      ---atggg---gc------------aga---acctttccaccagcaatcc
KF584166_PreS1_P-D      ---atggg---gc------------aga---acctttccaccagcaatcc
GQ477459_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KY382414_PreS1_P-D      ---atggg---gc------------aga---acctttccaccagcaatcc
KF584161_PreS1_P-D      ---atggg---gc------------aga---acctttccaccagcaatcc
KF584162_PreS1_P-D      ---atggg---gc------------aga---acctttccaccagcaatcc
MK618431_PreS1_P-D      ---atggg---gc------------aca---atctttccaccagcaatcc
MK618437_PreS1_P-D      ---atggg---gc------------aca---atctttccaccagcaatcc
JN040809_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK618429_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK618430_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EF103277_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB555497_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN604189_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF471655_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN642161_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040802_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF754619_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB222709_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB222710_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN257202_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN257148_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040819_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040814_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
HQ700449_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN688695_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN642132_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
FJ349235_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AF151735_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF754633_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GU456647_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
HQ700481_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
HQ700463_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
HQ700473_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
HQ700474_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
HQ700480_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
HQ700444_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
HQ700478_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
HQ700553_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
HQ700477_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
HQ700448_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
HQ700483_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
HQ700455_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
HQ700454_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
HQ700445_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
HQ700446_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
HQ700453_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
HQ700466_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
HQ700487_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
HQ700471_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
HQ700469_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
HQ700470_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
HQ700440_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
HQ700441_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
HQ700447_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
HQ700459_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
HQ700464_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
HQ700479_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
HQ700482_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
HQ700484_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
HQ700488_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
HQ700442_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
HQ700443_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
HQ700450_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
HQ700451_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GU456638_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB674408_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB126581_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040808_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040828_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090636_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN604259_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF754602_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB555496_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK598650_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK598647_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK598646_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK598648_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK598649_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF754605_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090633_PreS1_P-D      ---atggg---gc------------aga---atctctccaccagcaatcc
FJ904402_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040787_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040786_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040788_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
FJ349231_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN257205_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB104712_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN257199_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN642130_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN642151_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MH724252_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF471651_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF471652_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN257196_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KM524339_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF754591_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN257155_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN257169_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GU456650_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK618432_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK618433_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN642146_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN642145_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040823_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040821_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040812_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
FJ349234_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040795_PreS1_P-D      ---atggg---gc------------aga---atctctccaccagcaatcc
GU456663_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB674427_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GU456646_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK598637_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
MK598640_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
MK598641_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
MK598638_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
MK598636_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
MK598639_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
MK618436_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK618434_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK618435_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK598644_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK598642_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK598643_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU594396_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK618427_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KM108605_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK618428_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MN507851_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MN507836_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KX827291_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX096955_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB104711_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK693107_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KT963508_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF471647_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN257152_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040799_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GU456652_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040827_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040777_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF754607_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875276_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KX196214_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040805_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GU456640_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF471649_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN604265_PreS1_P-D      ---atggg---gc------------aga---atctctccaccagcaatcc
JN040813_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
HQ700511_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AY721612_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB104709_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN257203_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AY661792_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AY661793_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875289_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875279_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040811_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040806_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GU456641_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
FJ904399_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AY796032_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AY721605_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875282_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
X02496_PreS1_P-D        ---atggg---gc------------aga---atctttccaccagcaatcc
FJ349233_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KX196208_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KX196228_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875288_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875296_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KX196211_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875277_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KX196215_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
Y07587_PreS1_P-D        ---atggg---gc------------aga---atctttccaccagcaatcc
KC875304_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875303_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875302_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875287_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875285_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040829_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040797_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040770_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AY721609_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875299_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AY721608_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875275_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875295_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KX196227_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875309_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KX196209_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875305_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875293_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875294_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875306_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875308_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875290_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KX196212_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040785_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875301_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875297_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KX196236_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875283_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875280_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040796_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF754596_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AY721606_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB674422_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB222713_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN040807_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GU456648_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AY796030_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF754595_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KX196213_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875291_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KX196210_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875278_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875284_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875286_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875281_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KP322599_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KX196226_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875298_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875300_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN604152_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU414140_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JQ707689_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JQ707686_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JQ707683_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JQ707697_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JQ707699_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JQ707702_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JQ707706_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JQ707705_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JQ707703_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JQ707701_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JQ707696_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JQ707693_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JQ707682_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JQ707684_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JQ707685_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JQ707687_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JQ707688_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JQ707691_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JQ707692_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JQ707694_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JQ707695_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JQ707698_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JQ707700_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JQ707704_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JQ707690_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090690_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GQ922004_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB048701_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JQ927384_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KP168419_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
FJ904395_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF779382_PreS1_P-D      ---atggg---ag------------agacagatctttccaccagcaatcc
KF170774_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KX357622_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
FJ904419_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KJ470893_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KJ470885_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KJ470896_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KJ470895_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KJ470889_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MH724251_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF192834_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF192831_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF192832_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF192830_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF922432_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
HQ700458_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KJ470894_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN604207_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX310726_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GQ922003_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
LT992444_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AJ627219_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
FJ904438_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
LT992439_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GQ922005_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN604174_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KM606755_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KM606752_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
FJ692532_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
FJ692533_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KM606744_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KM606754_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
FJ904433_PreS1_C-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF170767_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KM108598_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KM108597_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KM108604_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KM108599_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
FJ904439_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF170763_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
FJ904410_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
FJ904435_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090648_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN604139_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN792912_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN792905_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN792911_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN792906_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN792908_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN792907_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN792903_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN792909_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN792910_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN792904_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN604175_PreS1_P-D      ---atggg---gc------------aga---atctttcmaccagcaatcc
JX090677_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090689_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GQ477453_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090712_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN642144_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK598664_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KJ647352_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KJ647350_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090614_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090716_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK598672_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK618423_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK618424_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK618425_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MH724216_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GQ477452_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GQ477456_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK598675_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MH724241_PreS1_P-D      ---atggg---gc------------aga---atctttccaacagcaatcc
AF043593_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AF043594_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK598676_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK618422_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MH724247_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MH724238_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK598679_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK598678_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MH724217_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MH724223_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF779220_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
Z35716_PreS1_P-D        ---atggg---gc------------aga---atctttccaccagcaatcc
MK618418_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK618420_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK598677_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK598669_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU594429_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU594431_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU594432_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KP184495_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KP184496_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KP184498_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU594416_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU594417_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU594409_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU594402_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX096958_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KP184497_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KP202941_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KP202942_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KP202944_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KT962022_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU594401_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU594415_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU594421_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK618419_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK598666_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK598671_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK618421_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK618426_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MN507839_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU594424_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK598673_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MH724246_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MH724231_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MH724244_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MN507837_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KX827290_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU594410_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU594405_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU594407_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU594427_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU594403_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU594413_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU594414_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KP165605_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KX827301_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU594400_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090715_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090717_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090675_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090711_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK598667_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU594428_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KP143745_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KP165598_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KP165601_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KP165602_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KP202945_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU594419_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU594420_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU594423_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU594422_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KP230541_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KT962025_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU594408_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KP165599_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX096956_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KP143744_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KX276856_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KT151620_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN604120_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF053178_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK598665_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN642163_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB119256_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN664919_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MF618349_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KX276857_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB119255_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KT366465_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KT366494_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN664941_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB188242_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN664927_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JQ707491_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
JQ707487_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
JQ707505_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
JQ707481_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
JQ707490_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
JQ707499_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
JQ707479_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
JQ707485_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
JQ707507_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
JQ707494_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
JQ707480_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
JQ707488_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
JQ707503_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
JQ707478_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
JQ707482_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
JQ707489_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
JQ707496_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
JQ707500_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
JQ707502_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
JQ707508_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
JQ707476_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
AY090453_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MF925379_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KU668449_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GQ183473_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK598663_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
JN664928_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GQ924652_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN642143_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KM524341_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN664918_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF679998_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KT366511_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GQ183472_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB119254_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB090268_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KT366510_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MF925383_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB120308_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB119252_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MF925393_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MH932714_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB116266_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KT366493_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN664930_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GQ183477_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GQ183471_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB090270_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875310_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB109478_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KT366496_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KT366491_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JQ707493_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
GQ183479_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB078032_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaaccc
GQ183476_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KP165604_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KM524352_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KM524347_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JQ707529_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
JQ707515_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
JQ707519_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
JQ707516_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
JQ707524_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
JQ707525_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
JQ707512_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
JQ707514_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
JQ707518_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
JQ707520_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
JQ707521_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
JQ707522_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
JQ707523_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
JQ707526_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
JQ707528_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
JQ707530_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
JQ707513_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
JQ707517_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
GQ183481_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB078031_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaaccc
AB078033_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaaccc
AB267090_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaaccc
MF925364_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KM524355_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KM524354_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF679997_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JQ707483_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccaacaatcc
AB119251_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB119253_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MF925363_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JQ707486_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
JQ707527_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
GQ183474_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF679994_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GQ183475_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KP184499_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
KP202937_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
KP202938_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
KP202939_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
KP202940_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
KP202943_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
KT962021_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
KT962023_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
KT962024_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
GQ183482_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GQ183483_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MF925358_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KM524353_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF679996_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875311_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JQ707497_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
AB109479_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KR905424_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KT366495_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KT366506_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KT366509_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB090269_PreS1_P-D      ---atggg---gcagaacatggagaaga---atctttccaccagcaatcc
AB109476_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB109477_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB110075_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB205126_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB210821_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB210822_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB471856_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB471857_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875312_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB109475_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF170760_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF170761_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN604238_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KT749827_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AJ627215_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AJ627216_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AJ627218_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF170744_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN642162_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KM577671_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KM108592_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF754621_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN257190_PreS1_P-D      ---atggg---gc------------aga---atctttctaccagcaatcc
AY090452_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090701_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090700_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GQ477455_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN642148_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AY796031_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KM577670_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KM524358_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090688_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF754597_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB188241_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX310728_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
FJ349218_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK598659_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN604161_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KX357639_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KU736924_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KU736925_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090606_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN642159_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090619_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK598670_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK598661_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AJ627222_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KM577669_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JQ687530_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MF618348_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB205128_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX310729_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK598662_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KX357637_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KM524344_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KM524346_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KM524351_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
X97848_PreS1_P-D        ---atggg---gc------------aga---atctttccaccagcaatcc
MK598660_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090617_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU594398_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB210820_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB205127_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AJ627220_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
FJ349206_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KT749821_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB330369_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB330370_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090718_PreS1_P-D      ---atggg---gc------------aga---atctctccaccagcaatcc
JX090625_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN664939_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090683_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KM577668_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090693_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090686_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090685_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
HQ700510_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090713_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090663_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK598674_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GQ183484_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
X72702_PreS1_P-D        ---atggg---gc------------aga---atctttccaccagcaatcc
MK516278_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090699_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090692_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090679_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU594425_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU414139_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU414138_PreS1_P-D      ---atggg---gc------------nga---atctttccaccagcaatcc
AJ627223_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KT749828_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
X97849_PreS1_P-D        ---atggg---gc------------aga---atctttccaccagcaatcc
GQ477457_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
FJ349205_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN604295_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
FJ349208_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU594404_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF679995_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KR905423_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KX357638_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KM108593_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
HQ700513_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
HQ700514_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KP165600_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KP165603_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
HQ700512_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU594418_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090696_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KP322601_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU594399_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU594426_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX096954_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX096957_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090618_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK598668_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090702_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU594430_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU594433_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU155895_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU155893_PreS1_P-D      ---atggg---gc------------aga---atctatccaccagcaatcc
MF979166_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MF979155_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MF979165_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
DQ329356_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
DQ329357_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
DQ336691_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AY236160_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
DQ486021_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
DQ336689_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AY236164_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
DQ486022_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
DQ336688_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
DQ336692_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
DQ336686_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
DQ336687_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
DQ336690_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
DQ336685_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
DQ464173_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
DQ464176_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
DQ464177_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
DQ464175_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
DQ464178_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
DQ464174_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
DQ464172_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
DQ336678_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
DQ336674_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
DQ336675_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
DQ336679_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
DQ336676_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
DQ336677_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN604318_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090611_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN664947_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090623_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KU736926_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KU736927_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KJ647353_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090714_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK598651_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK598655_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK598657_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KM524340_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN664932_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN664926_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN664924_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GQ205384_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaaccc
GQ205382_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KM524345_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GQ205389_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875340_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KX196229_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875342_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GQ205388_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MF618342_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GQ205385_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KU668439_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090616_PreS1_P-D      ---atggg---gc------------aga---atctctccgtcagaaatcc
KF679990_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090678_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KU668441_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KU668444_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KM212957_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KP143742_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KP143743_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KP165597_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF439719_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF439717_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF439713_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF439694_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF439707_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF439712_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF439715_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF439702_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF439695_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF439716_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF439693_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF439696_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF439703_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF439692_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF439699_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF439718_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF439706_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF439711_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF439700_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF439701_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF439710_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF439709_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF439704_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF439705_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JF439708_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MH724245_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
FJ349214_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX470760_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC012652_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN604275_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF779289_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF779222_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF779219_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KJ843187_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN604313_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN604272_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF779302_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF779301_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF779303_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF779296_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF779288_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF779212_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF779285_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF779216_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF779318_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF779218_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF779223_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX898691_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX898692_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AJ131956_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF779209_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF779230_PreS1_P-D      ---atgggagtgc------------aga---atctttccaccagcaatcc
JN604170_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN604301_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF779225_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX898694_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX898689_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF779292_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KX827292_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF779228_PreS1_P-D      ---atgggagtgc------------aga---atctttccaccagcaatcc
KF779229_PreS1_P-D      ---atgggagtgc------------aga---atctttccaccagcaatcc
KF779217_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF779377_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF779376_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF779340_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX898697_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF779224_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF779341_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875333_PreS1_P-D      ---atggg---ga------------aga---atcattccaccagcaatcc
KC875329_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KX196235_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875322_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875323_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KX196225_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KX196224_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875328_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875330_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875326_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KM606745_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875331_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875325_PreS1_P-D      ---atggg---gg------------aga---atctttccaccagcaatcc
KC875318_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875314_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KP090177_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KP090178_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MH724218_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MH724219_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
FJ349209_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875315_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875320_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KX196217_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875324_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KX196231_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875336_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KX196219_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875337_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KX196232_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KX196220_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875321_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875316_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875313_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875334_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KX196221_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KX196233_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KX196222_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KX196218_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KX196216_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875332_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875335_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KX196230_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875317_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KX196234_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KC875319_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN664922_PreS1_P-D      ---atggg---ag------------gtt---gtctttccaccagcaatcc
JN664912_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090624_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK618441_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK618443_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MN507852_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090657_PreS1_P-D      ---atggg---gc------------aaa---atctctccaccagcaatcc
JX090691_PreS1_P-D      ---gtggg---gc------------aga---atctctccaccagcaatcc
MK541688_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090671_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090667_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090673_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN664920_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090659_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090669_PreS1_P-D      ---atggg---gc------------aca---atctttccaccagcaatcc
JX090672_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090666_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090661_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090662_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090674_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU414142_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090698_PreS1_P-D      ---atggg---gc------------aga---atctctccaccagcaatcc
JX090605_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090639_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090620_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU594382_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF779214_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU414141_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090709_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090710_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
DQ464170_PreS1_P-D      ---atggg---gc------------aga---atctttcaaccagcaatcc
KU668447_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KU668448_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
DQ464168_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MF488704_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KP202936_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KU668433_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KU668435_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
DQ464169_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MF618343_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN664913_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN664921_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KU668445_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN664936_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN664910_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KM524349_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN664909_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN257181_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AM422939_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaaccc
KU668442_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN664914_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN664917_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KU668436_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KM524350_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN664938_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KM524361_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
DQ315776_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN664911_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF170746_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KU668434_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KU668437_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KU668438_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KU668446_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MF618339_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MF618340_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MF618341_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
V01460_PreS1_P-D        ---atggg---gc------------aga---atctttccaccagcaatcc
JN664937_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN688711_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN604250_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090664_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090615_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090670_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN688685_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
DQ486025_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF476030_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090680_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
FJ349213_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090622_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MF979168_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MF979173_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
X85254_PreS1_P-D        ---atggg---gc------------aga---atctttccaccagcaatcc
JX090658_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU939680_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU594434_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KJ647355_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090656_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN688710_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU921418_PreS1_P-D      ---atggg---gc------------aga---atctctccaccagcaatcc
JN688712_PreS1_P-D      ---atggg---gc------------aga---atctgtccaccagcaatcc
JN688683_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MF979157_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MF979174_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MF979171_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KM524356_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN688679_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GQ922000_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN688713_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK693109_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU921419_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GQ183485_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090613_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
FJ562338_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090682_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090628_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MF979163_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KP090179_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MK598658_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
LT992438_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KX276998_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN370954_PreS1_P-D      -----------gc------------aga---atctttccaccagcaatcc
MH724235_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MH724232_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
EU414143_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AB493846_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
HM750151_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090607_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090608_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090612_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
HQ236016_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MF979167_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN688708_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MH724226_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MH724249_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MH724250_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
HQ236014_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
HQ236015_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KP090180_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AY233292_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AY233294_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JX090694_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MH724237_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF679989_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
FJ349232_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GQ183478_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF476028_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF476029_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KT347090_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN688678_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MH724242_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MH724233_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
JN370949_PreS1_P-D      -----------gc------------aga---atctttccaccagcaatcc
JN370950_PreS1_P-D      -----------gc------------aga---atctttccaccagcaatcc
JN370951_PreS1_P-D      -----------gc------------aga---atctttccaccagcaatcc
JN370952_PreS1_P-D      -----------gc------------aga---atctttccaccagcaatcc
JN370953_PreS1_P-D      -----------gc------------aga---atctttccaccagcaatcc
MK507912_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MH724234_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MF979170_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF679992_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KF679993_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KT366497_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KT366507_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AY233296_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MF979156_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MF979176_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MF979161_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MF979175_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KR139748_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MH724224_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MH724225_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MH724227_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MH724229_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MH724230_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MH724248_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MH724228_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MF979162_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MF979172_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
AY233291_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KM519455_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KR139747_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MF979158_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MF979160_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MF979164_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MF979154_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
FJ692506_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
FJ692507_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MH724214_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MH724221_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GQ922001_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MH724215_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
MH724220_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
GQ922002_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
KP090181_PreS1_P-D      ---atggg---gc------------aga---atctttccaccagcaatcc
X65257_PreS1_P-D        ---atggg---gc------------aga---atctttccaccagcaatcc
                                                         *  *     *   * **

MF925366_PreS1_P-D      cctgggattctttcccgaccatcagttggatccagccttcagagcaaaca
X65258_PreS1_P-D        tctgggattctttcccgaccaccagttggatccagcctccagagcaaaca
JN604245_PreS1_P-D      tctgggattcttccccgaccaccagttggatccagccttcagagtaaata
KF170749_PreS1_P-D      tctgggattctttcccgatcaccagttggatccagccttcagagcaaaca
FJ562309_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KT749823_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090637_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN257153_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN257195_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF170768_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF170775_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccattttttcaaaca
AB674420_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB330367_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcaaagcaaaca
JF754617_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JF754588_PreS1_P-D      tctgggattctttcccgatcaccagttggatccagccttcagagcaaaca
DQ464181_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GU456678_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN257160_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN257176_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN257177_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
DQ464182_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN040753_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
FJ349215_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcaaagcaaaca
AB674419_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK355501_PreS1_P-D      tctgggattctttcccgaccaccagttggatccggccttcagagcaaaca
X80924_PreS1_P-D        tctgggattctttcccgaccatcagttggatccagccttcagagcaaaca
X80926_PreS1_P-D        tctgggattctttcccgaccatcagttggatccagccttcagagcaaaca
EF103280_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN642128_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GU456674_PreS1_P-D      tctgggattctttcccgaccaccagttggacccagccttcagagcaaaca
JX090609_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB674416_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GU456684_PreS1_P-D      tctgggattccttcccgaccaccagttggatccagccttcagagcaaaca
JF754629_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN642135_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GU456682_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcaaagcaaaca
JX090640_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090641_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB674425_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN257165_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN257166_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GU456665_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KM524338_PreS1_P-D      tctgggattctttcccgatcaccagttggatccagccttcagagcaaaca
KF061169_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GU456679_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB674406_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GU456657_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttccgagcaaaca
AB188244_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB674417_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagctttcagagcaaaca
AB674418_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagctttcagagcaaaca
JN664931_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN642126_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GQ477458_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcaaagcaaaca
JN040830_PreS1_P-D      tctgggattctttcccgatcaccagttggatccagccttcagagcaaata
JN040775_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GU456676_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF471644_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN257159_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EF103276_PreS1_P-D      tctgggattctttcccgaacaccagttggatccagccttcagagcaaaca
JN040782_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB674431_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KM524348_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JF754606_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcaaagcaaaca
JN040766_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KM108595_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN642138_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN642129_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN257188_PreS1_P-D      tctgggattctttcccgaacaccagttggatccagccttcagagcaaaca
JN257183_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JF754600_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AY721611_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GQ183467_PreS1_P-D      tctgggattctttccggaccaccagttggatccagccttcagagcaaaca
GQ183460_PreS1_P-D      tctgggattctttccggaccaccagttggatccagccttcagagcaaaca
GQ183469_PreS1_P-D      tctgggattctttccggaccaccagttggatccagccttcagagcaaaca
GQ183461_PreS1_P-D      tctgggattctttccggaccaccagttggatccagccttcagagcaaaca
GQ183458_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GQ183456_PreS1_P-D      tctgggattctttccggaccaccagttggatccagccttcagagcaaaca
GQ183465_PreS1_P-D      tctgggattctttccggaccaccagttggatccagccttcagagcaaaca
GQ183459_PreS1_P-D      tctgggattctttccggaccaccagttggatccagccttcagagcaaaca
GQ183468_PreS1_P-D      tctgggattctttccggaccaccagttggatccagccttcagagcaaaca
GQ183455_PreS1_P-D      tctgggattctttccggaccaccagttggatccagccttcagagcaaaca
GQ183452_PreS1_P-D      tctgggattctttccggaccaccagttggatccagccttcagagcaaaca
GQ183449_PreS1_P-D      tctgggattctttccggaccaccagttggatccagccttcagagcaaaca
GQ183450_PreS1_P-D      tctgggattctttccggaccaccagttggatccagccttcagagcaaaca
GQ183451_PreS1_P-D      tctgggattctttccggaccaccagttggatccagccttcagagcaaaca
GQ183453_PreS1_P-D      tctgggattctttccggaccaccagttggatccagccttcagagcaaaca
GQ183454_PreS1_P-D      tctgggattctttccggaccaccagttggatccagccttcagagcaaaca
GQ183457_PreS1_P-D      tctgggattctttccggaccaccagttggatccagccttcagagcaaaca
GQ183462_PreS1_P-D      tctgggattctttccggaccaccagttggatccagccttcagagcaaaca
GQ183463_PreS1_P-D      tctgggattctttccggaccaccagttggatccagccttcagagcaaaca
GQ183464_PreS1_P-D      tctgggattctttccggaccaccagttggatccagccttcagagcaaaca
GQ183466_PreS1_P-D      tctgggattctttccggaccaccagttggatccagccttcagagcaaaca
GQ183448_PreS1_P-D      tctgggattctttccggaccaccagttggatccagccttcagagcaaaca
JN642165_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
DQ304547_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
DQ304548_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
DQ304550_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
DQ304551_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AY236162_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
DQ304549_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN642164_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN040779_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090665_PreS1_P-D      tctgggattctttcccgaccaccaattggatccagccttcagagcaaaca
AB270541_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KM108601_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN642158_PreS1_P-D      tctgggattctttccggaccaccagttggatccagccttcagagcaaaca
JN642147_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN257172_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaata
FJ904427_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagcgttcagagcaaaca
JF754626_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcaaagcaaaca
KF471642_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JF754612_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
FJ904426_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KX276975_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
FJ904418_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KP995100_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN642155_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN604312_PreS1_P-D      tctgggattctttcccgaccatcagttggatccagccttcaaagcaaata
GU456675_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GU456654_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
FJ904422_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090676_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagcattcaaagcaaaca
JF754609_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GU456668_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttccgagcaaaca
GU456659_PreS1_P-D      tctgggattctttcccgatcaccagttggatccagccttcagagcaaaca
GU456653_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU787443_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JF754599_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JF754623_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MF925391_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KM108596_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN040762_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KY629633_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF061167_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090721_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN040790_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AJ344116_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK355500_PreS1_P-D      tctgggattctttcccgaccaccagttgggtccggccttcaaagcaaaca
KF170772_PreS1_P-D      tctaggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN642131_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN257150_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GQ205380_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB270550_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090668_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN642157_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN642136_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GU456677_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GU456671_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GU456658_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF471654_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN040793_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN040773_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagcctgcagagcaaaca
GU456669_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
FJ904431_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
DQ111986_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090647_PreS1_P-D      tctgggattctttcccgatcaccagttggatccagccttcaaagcaaata
GU456656_PreS1_P-D      tctgggattctttcccgaccatcagttggatccagccttcagagcaaaca
AB104710_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN642153_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN040751_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN040771_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN040757_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN040750_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JF754614_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JF754590_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GU456683_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcaaagcaaaca
GU456667_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GU357846_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KM108594_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF170756_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN257200_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN257149_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF471657_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaata
JX090660_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN642166_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN257170_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF471645_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF471659_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcaaagcaaaca
GU456655_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
FJ349219_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcaaagcaaaca
MK598645_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN257163_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN040784_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN040774_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcaaagcaaaca
GU456670_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AY741797_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF471650_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN642156_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN040765_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JF754592_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GU456673_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EF103279_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB270542_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF170771_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN040826_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GU456661_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
FJ904445_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK693108_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090681_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KM108603_PreS1_P-D      tctgggattcttccccgaccaccagttggatccagccttcagagcaaaca
KM108602_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF170755_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN040824_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN040815_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaaa
JN040778_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JF754594_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JF754593_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GU456681_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GU456664_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EF103281_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EF103275_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AY945307_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB270546_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
FJ904420_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
FJ904421_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
FJ904415_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AY741794_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AY741795_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AY741796_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF170770_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GU456666_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF061170_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagcctkcagagcaaaca
KF061168_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
FJ904424_PreS1_P-D      tctgggattctttcccgatcaccagttggatccagccttcagagcaaaca
AB246348_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090621_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JF754627_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcaaagcaaaca
FJ904432_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN040781_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB270548_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF471646_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN040767_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN040759_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB674407_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AY161151_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AY161150_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AY161152_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
FJ349229_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaata
AB270539_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KM524342_PreS1_P-D      tctgggattctttcccgaacaccagttggatccagccttcagagcaaaca
JN040758_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AY161157_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AY161158_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF471656_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB270547_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
LT992454_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF170773_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF170757_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090695_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JF754615_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcaaagcaaaca
GU456680_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AF121239_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MN507838_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MN507853_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF471660_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KC875292_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN040791_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GU456660_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK507913_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KY629634_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KX827300_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KM606753_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF471641_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090627_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN604263_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN040761_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JF754601_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GQ183480_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
FJ904412_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
FJ349228_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcaaagcaaaca
EU414136_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcaaagcaaaca
EU414135_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AJ627224_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcaaagcaaaca
AF280817_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JF754604_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN257209_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN257193_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090684_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcaaagcaaaca
JQ687531_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcaaagcaaaca
JF754618_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcaaagcaaaca
AB222712_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090655_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090654_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090650_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090651_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090652_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090653_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090649_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB674405_PreS1_P-D      tctgggattttttcccgaccaccagttggatccagccttcagagcaaaca
JF754624_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN257182_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AF121240_PreS1_C-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AF121241_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AF121242_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KT366498_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KT366500_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KT366501_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KT366502_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB246347_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
HM750155_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
HM750156_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KT366508_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KT366499_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KM108600_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF170776_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN604278_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN604206_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN257171_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN257151_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN040794_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GQ183470_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
FJ904443_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
FJ386590_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
FJ349230_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaata
FJ349216_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcaaagcaaaca
AY721607_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF170765_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN040783_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF471658_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
FJ349220_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcaaagcaaaca
KM108591_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KM108606_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KM108607_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF170758_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF170759_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JF754628_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcaaagcaaaca
KF170747_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF170764_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
LC365689_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KP322600_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF170766_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN642167_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN040792_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
HM750152_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU787446_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB583680_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU787436_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK507914_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK507910_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GQ377589_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB270543_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU594397_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN257179_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN257185_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK507911_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB222711_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX310727_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK052949_PreS1_P-D      tctgggattctttcccgaccaccagttggacccagccttcagagcgaaca
MK052961_PreS1_P-D      tctgggattctttcccgaccaccagttggacccagccttcagagcgaaca
MK052954_PreS1_P-D      tctgggattccttcccgaccaccagttggacccagccttcagagcgaaca
MK052950_PreS1_P-D      tctgggattctttcccgaccaccagttggacccagccttcagagcgaaca
MK052959_PreS1_P-D      tctgggattctttcccgaccaccagttggacccagccttcagagcgaaca
MK052951_PreS1_P-D      tctgggattctttcccgaccaccagttggacccagccttcagagcgaaca
MK052973_PreS1_P-D      tctgggattctttcccgaccaccagttggacccagccttcagagcgaaca
MK052975_PreS1_P-D      tctgggattctttcccgaccaccagttggacccagccttcagagcgaaca
MK052974_PreS1_P-D      tctgggattctttcccgaccaccagttggacccagccttcagagcgaaca
MK052948_PreS1_P-D      tctgggattctttcccgaccaccagttggacccagccttcagagcgaaca
MK052966_PreS1_P-D      tctgggattctttcccgaccaccagttggacccagccttcagagcgaaca
MK052963_PreS1_P-D      tctgggattctttcccgaccaccagttggacccagccttcagagcgaaca
MK052971_PreS1_P-D      tctgggattctttcccgaccaccagttggacccagccttcagagcgaaca
MK052955_PreS1_P-D      tctgggattctttcccgaccaccagttggacccagccttcagagcgaaca
MK052956_PreS1_P-D      tctgggattctttcccgaccaccagttggacccagccttcagagcgaaca
MK052958_PreS1_P-D      tctgggattctttcccgaccaccagttggacccagccttcagagcgaaca
MK052960_PreS1_P-D      tctgggattctttcccgaccaccagttggacccagccttcagagcgaaca
MK052972_PreS1_P-D      tctgggattccttcccgaccaccagttggacccagccttcagagcaaaca
MK052952_PreS1_P-D      tctgggattctttcccgaccaccagttggacccagccttcagagcaaaca
MK052947_PreS1_P-D      tctgggattctttcccgaccaccagttggacccagccttcagagcaaaca
MK052953_PreS1_P-D      tctgggattctttcccgaccaccagttggacccagccttcagagcaaaca
JF754598_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN040818_PreS1_P-D      tctgggattctttcccgaccaccagtgggatccagccttcagagcaaaca
JX090697_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN642133_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN257162_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB674424_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090610_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GQ184322_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GQ167301_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GQ167302_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JF754611_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GU456643_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagcattcagagcaaaca
JN040769_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN642154_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB674428_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JF754630_PreS1_P-D      tctgggattcttccccgaccaccagttggatccagccttcagagcaaaca
JX310734_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
L27106_PreS1_P-D        tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090635_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GU456645_PreS1_P-D      gctgggattctttcccgaccatcagttggatccagccttcagagcaaaca
AY741798_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN040804_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JF754631_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagcattcagagcaaaca
JF754632_PreS1_P-D      tctgggattctttcccgaccaccagttggacccagccttcagagcaaaca
AB555500_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN604239_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU787438_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU939681_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
FJ899792_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU787445_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090720_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090719_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090723_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090722_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090707_PreS1_P-D      tctgggattcttccccgaccaccagttggatccagccttcagagcaaaca
HQ833467_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
HQ833469_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090724_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090705_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU787441_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagctttcagagcaaaca
HQ833465_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU919197_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090687_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090644_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090706_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU787437_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090708_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU787447_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
HM750154_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
HM750153_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090629_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
HQ833468_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090703_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
HQ833471_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090626_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090630_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090631_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090632_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090638_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090642_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090643_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090645_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090704_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090646_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KY629630_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
HQ833470_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU787442_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU787440_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KX276999_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MH724236_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX310733_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN040810_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN040822_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN040768_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GU456651_PreS1_P-D      tctgggattctttcccgatcaccagttggatccagccttcagagcaaaca
JX310735_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GU456637_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090634_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
DQ399006_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN642150_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN642140_PreS1_P-D      tctgggattctttcccgatcaccagttggatccagccttcagagcaaaca
M32138_PreS1_P-D        tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GU456639_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN642149_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN257186_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN040755_PreS1_P-D      tctgggattccttcccgaccaccagttggatccagccttcagagcaaaca
GU456635_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GU456636_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN257201_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX036333_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX036334_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN642142_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagccaaca
FJ904446_PreS1_P-D      tctgggattctttcccgatcaccagttggatccagccttcagagcaaaca
AB674423_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JF754610_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GU456649_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN040820_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcaaagcaaaca
JF754634_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
HQ700472_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB674411_PreS1_P-D      tctgggattttttcccgaccaccagttggatccagccttcagagcaaaca
AB555501_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JF754635_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN040800_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN040801_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF471640_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JF754603_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN642134_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF584160_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF584163_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF584164_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KY382412_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF584165_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF584166_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GQ477459_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KY382414_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF584161_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF584162_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK618431_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK618437_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN040809_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK618429_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK618430_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EF103277_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB555497_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN604189_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF471655_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN642161_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN040802_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JF754619_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB222709_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB222710_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN257202_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN257148_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN040819_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN040814_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
HQ700449_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN688695_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN642132_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
FJ349235_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AF151735_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JF754633_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GU456647_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
HQ700481_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
HQ700463_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
HQ700473_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
HQ700474_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
HQ700480_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
HQ700444_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
HQ700478_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
HQ700553_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
HQ700477_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
HQ700448_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
HQ700483_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
HQ700455_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
HQ700454_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
HQ700445_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
HQ700446_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
HQ700453_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
HQ700466_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
HQ700487_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
HQ700471_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
HQ700469_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
HQ700470_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
HQ700440_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
HQ700441_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
HQ700447_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
HQ700459_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
HQ700464_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
HQ700479_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
HQ700482_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
HQ700484_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
HQ700488_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
HQ700442_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
HQ700443_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
HQ700450_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
HQ700451_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GU456638_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB674408_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcaaagcaaaca
AB126581_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN040808_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN040828_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090636_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN604259_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JF754602_PreS1_P-D      tctgggattctttcccgatcaccagttggatccagccttcagagcaaaca
AB555496_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK598650_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK598647_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK598646_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK598648_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK598649_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JF754605_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagcattcagagcaaaca
JX090633_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
FJ904402_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN040787_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN040786_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN040788_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
FJ349231_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN257205_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB104712_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN257199_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN642130_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN642151_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MH724252_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF471651_PreS1_P-D      tctgggattctttcccgatcaccagttggacccagccttcagagcaaaca
KF471652_PreS1_P-D      tctgggattctttcccgatcaccagttggacccagccttcagagcaaaca
JN257196_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KM524339_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JF754591_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN257155_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN257169_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GU456650_PreS1_P-D      tctgggattctttcccgatcaccagttggatccagccttcagagcaaaca
MK618432_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK618433_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN642146_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN642145_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN040823_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN040821_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN040812_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
FJ349234_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagcattcagagcaaaca
JN040795_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GU456663_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB674427_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GU456646_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK598637_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK598640_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK598641_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK598638_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK598636_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK598639_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK618436_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK618434_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK618435_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK598644_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK598642_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK598643_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU594396_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK618427_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KM108605_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK618428_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MN507851_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MN507836_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KX827291_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX096955_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB104711_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK693107_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KT963508_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagcattcagagcaaaca
KF471647_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN257152_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN040799_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GU456652_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN040827_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN040777_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JF754607_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KC875276_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KX196214_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN040805_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagacttcagagcaaaca
GU456640_PreS1_P-D      tctgggattctttcccgaccaccaattggatccagccttcagagcaaaca
KF471649_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcaaagcaaaca
JN604265_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN040813_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
HQ700511_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AY721612_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB104709_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN257203_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AY661792_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AY661793_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KC875289_PreS1_P-D      tctgggattctttcccaaccaccagttggatccagccttcagagcaaaca
KC875279_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN040811_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN040806_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GU456641_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
FJ904399_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AY796032_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AY721605_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KC875282_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
X02496_PreS1_P-D        tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
FJ349233_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KX196208_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KX196228_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KC875288_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KC875296_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KX196211_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KC875277_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KX196215_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
Y07587_PreS1_P-D        tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KC875304_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KC875303_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KC875302_PreS1_P-D      tctgggattctttcccaaccaccagttggatccagccttcagagcaaaca
KC875287_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KC875285_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN040829_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN040797_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN040770_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AY721609_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KC875299_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AY721608_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KC875275_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KC875295_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KX196227_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KC875309_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KX196209_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KC875305_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KC875293_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KC875294_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KC875306_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KC875308_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KC875290_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KX196212_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN040785_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KC875301_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KC875297_PreS1_P-D      tctgggattctttcccaaccaccagttggatccagccttcagagcaaaca
KX196236_PreS1_P-D      tctgggattctttcccaaccaccagttggatccagccttcagagcaaaca
KC875283_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KC875280_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN040796_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JF754596_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AY721606_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB674422_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB222713_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN040807_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GU456648_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AY796030_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JF754595_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KX196213_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KC875291_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KX196210_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KC875278_PreS1_P-D      tctgggattctttcccgaccaccagttggttccagccttcagagcaaaca
KC875284_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KC875286_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KC875281_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KP322599_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KX196226_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KC875298_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KC875300_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN604152_PreS1_P-D      tctgggattctttcccgaccaccaattggatccagccttcagagcaaaca
EU414140_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707689_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707686_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707683_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707697_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707699_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707702_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707706_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707705_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707703_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707701_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707696_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707693_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707682_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707684_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707685_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707687_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707688_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707691_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707692_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707694_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707695_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707698_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707700_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707704_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707690_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090690_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GQ922004_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB048701_PreS1_P-D      tctgggattctttcccgaccatcagttggatccagccttcagagcaaaca
JQ927384_PreS1_P-D      tctgggattccttcccgatcaccagttggatccagccttcagagcaaaca
KP168419_PreS1_P-D      tctgggattccttcccgaycaccagttggatccagccttcagagcaaaca
FJ904395_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF779382_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF170774_PreS1_P-D      tctgggattctttcccgatcaccagttggatccagccttcagagcaaaca
KX357622_PreS1_P-D      tctgggattctttcccgaccaccagttggacccagccttcagagcaaaca
FJ904419_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KJ470893_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttccgagcaaatt
KJ470885_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaatt
KJ470896_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaatt
KJ470895_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaatt
KJ470889_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaatt
MH724251_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaatt
KF192834_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaatt
KF192831_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaatt
KF192832_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaatt
KF192830_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaatt
KF922432_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
HQ700458_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KJ470894_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagctttcagagcaaatt
JN604207_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX310726_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GQ922003_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
LT992444_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AJ627219_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
FJ904438_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
LT992439_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GQ922005_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN604174_PreS1_P-D      tctgggattctttcccgaccaccaattggatccagccttcagagcaaaca
KM606755_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KM606752_PreS1_P-D      tctgggattttttcccgaccaccagttggatccagccttcagagcaaaca
FJ692532_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
FJ692533_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KM606744_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KM606754_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
FJ904433_PreS1_C-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF170767_PreS1_P-D      cctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KM108598_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KM108597_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KM108604_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KM108599_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
FJ904439_PreS1_P-D      tctgggattctttcccgaccatcagttggatccagccttcagagcaaaca
KF170763_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
FJ904410_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
FJ904435_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090648_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN604139_PreS1_P-D      tctggggttctttcccgaccaccagttggatccagccttcagagcaaaca
JN792912_PreS1_P-D      tctgggattctttcccgaccaccagttggacccagccttcagagcaaaca
JN792905_PreS1_P-D      tctgggattctttcccgaccaccagttggacccagccttcagagcaaaca
JN792911_PreS1_P-D      tctaggattctttcccgaccaccagttggacccagccttcagagcaaaca
JN792906_PreS1_P-D      tctgggattctttcccgaccaccagttggacccagccttcagagcaaaca
JN792908_PreS1_P-D      tctgggattctttcccgaccaccagttggacccagccttcagagcaaaca
JN792907_PreS1_P-D      tctgggattctttcccgaccaccagttggacccagccttcagagcaaaca
JN792903_PreS1_P-D      tctgggattctttcccgaccaccagttggacccagccttcagagcaaaca
JN792909_PreS1_P-D      tctgggattctttcccgaccaccagttggacccagccttcagagcaaaca
JN792910_PreS1_P-D      tctgggattctttcccgaccaccagttggacccagccttcagagcaaaca
JN792904_PreS1_P-D      tctgggattctttcccgaccaccagttggacccagccttcagagcaaaca
JN604175_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090677_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090689_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GQ477453_PreS1_P-D      tctgggattctttcccgatcaccagttggatccagccttcagagcaaaca
JX090712_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN642144_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagcattcagagcaaaca
MK598664_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KJ647352_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KJ647350_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090614_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090716_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK598672_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK618423_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK618424_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK618425_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MH724216_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GQ477452_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GQ477456_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK598675_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MH724241_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AF043593_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AF043594_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK598676_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK618422_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MH724247_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MH724238_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK598679_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK598678_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MH724217_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MH724223_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF779220_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
Z35716_PreS1_P-D        tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK618418_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK618420_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK598677_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK598669_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU594429_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU594431_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU594432_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KP184495_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KP184496_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KP184498_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU594416_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU594417_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU594409_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU594402_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX096958_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KP184497_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KP202941_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KP202942_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KP202944_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KT962022_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU594401_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU594415_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU594421_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK618419_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK598666_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK598671_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK618421_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK618426_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MN507839_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU594424_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcaaagcaaaca
MK598673_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MH724246_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MH724231_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MH724244_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MN507837_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KX827290_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU594410_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU594405_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU594407_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU594427_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU594403_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU594413_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU594414_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KP165605_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KX827301_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU594400_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090715_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090717_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090675_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090711_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK598667_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU594428_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KP143745_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KP165598_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KP165601_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KP165602_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KP202945_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU594419_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU594420_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU594423_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU594422_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KP230541_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KT962025_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU594408_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KP165599_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX096956_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KP143744_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KX276856_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagcattcagagcaaaca
KT151620_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN604120_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF053178_PreS1_P-D      tctggggttctttcccgaccaccaattggatccagccttcagagcaaaca
MK598665_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN642163_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB119256_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN664919_PreS1_P-D      tctgggattctttcccgaacaccagttggatccagccttcagagcaaaca
MF618349_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KX276857_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB119255_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KT366465_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KT366494_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN664941_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB188242_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN664927_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707491_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707487_PreS1_P-D      tctgggattctttcccgaccatcagttggatccagccttcagagcaaaca
JQ707505_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707481_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707490_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707499_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707479_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707485_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707507_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707494_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707480_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707488_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707503_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707478_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707482_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707489_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707496_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707500_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707502_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707508_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707476_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AY090453_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MF925379_PreS1_P-D      tctgggattcttccccgaccaccagttggatccagccttcagagcaaaca
KU668449_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GQ183473_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK598663_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN664928_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GQ924652_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaata
JN642143_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KM524341_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN664918_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF679998_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KT366511_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GQ183472_PreS1_P-D      tctgggattctttcccgaccaccagttggacccagccttcagagcaaaca
AB119254_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB090268_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KT366510_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MF925383_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB120308_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB119252_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MF925393_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MH932714_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB116266_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KT366493_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN664930_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GQ183477_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GQ183471_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB090270_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KC875310_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB109478_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KT366496_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KT366491_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707493_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GQ183479_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB078032_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaact
GQ183476_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KP165604_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KM524352_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KM524347_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707529_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707515_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707519_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707516_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707524_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707525_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707512_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707514_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707518_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707520_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707521_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707522_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707523_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707526_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707528_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707530_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707513_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707517_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GQ183481_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB078031_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaact
AB078033_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaact
AB267090_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaact
MF925364_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KM524355_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KM524354_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF679997_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707483_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB119251_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB119253_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MF925363_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707486_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707527_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GQ183474_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF679994_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GQ183475_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KP184499_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KP202937_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KP202938_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KP202939_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KP202940_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KP202943_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KT962021_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KT962023_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KT962024_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GQ183482_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GQ183483_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MF925358_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KM524353_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF679996_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KC875311_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ707497_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB109479_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KR905424_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KT366495_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KT366506_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KT366509_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB090269_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB109476_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB109477_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB110075_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB205126_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB210821_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB210822_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB471856_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB471857_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KC875312_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB109475_PreS1_P-D      tatgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF170760_PreS1_P-D      tctgggattctttcccgaacaccagttggatccagccttcagagcaaaca
KF170761_PreS1_P-D      tctgggattctttcccgatcaccagttggatccagccttcagagcaaaca
JN604238_PreS1_P-D      tctaggattctttcccgaccaccagttggatccagccttcagagcaaaca
KT749827_PreS1_P-D      tctgggattctttcccgaccatcagctggatccagccttcagagcaaaca
AJ627215_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AJ627216_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AJ627218_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF170744_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN642162_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KM577671_PreS1_P-D      tctgggattcttccccgaccaccagttggatccagccttcagagcaaaca
KM108592_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JF754621_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN257190_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AY090452_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090701_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090700_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GQ477455_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN642148_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AY796031_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KM577670_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KM524358_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090688_PreS1_P-D      tctgggattctttcccgaccaccagctggatccagccttcagagcaaaca
JF754597_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB188241_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX310728_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
FJ349218_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK598659_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN604161_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KX357639_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KU736924_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KU736925_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090606_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN642159_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090619_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK598670_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK598661_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AJ627222_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KM577669_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JQ687530_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MF618348_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB205128_PreS1_P-D      tctgggattcttccccgaccaccagttggatccagccttcagagcaaaca
JX310729_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK598662_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KX357637_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KM524344_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KM524346_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KM524351_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
X97848_PreS1_P-D        tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK598660_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090617_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU594398_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB210820_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB205127_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AJ627220_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
FJ349206_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KT749821_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB330369_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AB330370_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090718_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090625_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN664939_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090683_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KM577668_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090693_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090686_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090685_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
HQ700510_PreS1_P-D      tctgggattctttcccgaycaccagttggatccagccttcagagcaaaca
JX090713_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090663_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK598674_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GQ183484_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
X72702_PreS1_P-D        tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK516278_PreS1_P-D      tctgggattttttcccgaccaccagttggatccagccttcagagcaaaca
JX090699_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090692_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090679_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU594425_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU414139_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU414138_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AJ627223_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KT749828_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
X97849_PreS1_P-D        tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GQ477457_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
FJ349205_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN604295_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
FJ349208_PreS1_P-D      cctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU594404_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF679995_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KR905423_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KX357638_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KM108593_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
HQ700513_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
HQ700514_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KP165600_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KP165603_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
HQ700512_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU594418_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090696_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KP322601_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU594399_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU594426_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX096954_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX096957_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090618_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK598668_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090702_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU594430_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU594433_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU155895_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU155893_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MF979166_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MF979155_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MF979165_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
DQ329356_PreS1_P-D      tctgggattcttgcccgaccaccagttggatccagccttcagagcaaaca
DQ329357_PreS1_P-D      tctgggattcttgcccgaccaccagttggatccagccttcagagcaaaca
DQ336691_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AY236160_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
DQ486021_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
DQ336689_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AY236164_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
DQ486022_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
DQ336688_PreS1_P-D      tctgggattctttcccgactaccagttggatccagccttcagagcaaaca
DQ336692_PreS1_P-D      tctgggattctttcccaaccaccagttggatccagccttcagagcaaaca
DQ336686_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
DQ336687_PreS1_P-D      tctgggattctttcccgaccaccagtcggatccagccttcagagcaaaca
DQ336690_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
DQ336685_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
DQ464173_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
DQ464176_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
DQ464177_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
DQ464175_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
DQ464178_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
DQ464174_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
DQ464172_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
DQ336678_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
DQ336674_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
DQ336675_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
DQ336679_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
DQ336676_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
DQ336677_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN604318_PreS1_P-D      tctgggattttttcccgaccaccagttggatccagccttcagagcaaata
JX090611_PreS1_P-D      catgggattctttcccgaccaccagttggatccagctttcagagcaaaca
JN664947_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090623_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KU736926_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KU736927_PreS1_P-D      tctgggattctttcccgaccaccaattggatccagccttcagagcaaaca
KJ647353_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090714_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK598651_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK598655_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK598657_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KM524340_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN664932_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN664926_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN664924_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GQ205384_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GQ205382_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KM524345_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GQ205389_PreS1_P-D      tctgggattctttcccgaccaccgcttggatccagccttcagagcaaaca
KC875340_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KX196229_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KC875342_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GQ205388_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MF618342_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GQ205385_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KU668439_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaata
JX090616_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF679990_PreS1_P-D      tctgggattctttcccgatcaccagctggatccagccttcagagcaaaca
JX090678_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KU668441_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaact
KU668444_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KM212957_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KP143742_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KP143743_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KP165597_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JF439719_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JF439717_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JF439713_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JF439694_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JF439707_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JF439712_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JF439715_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JF439702_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JF439695_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JF439716_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JF439693_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JF439696_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JF439703_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JF439692_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JF439699_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JF439718_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JF439706_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JF439711_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JF439700_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JF439701_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JF439710_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JF439709_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JF439704_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JF439705_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JF439708_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MH724245_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
FJ349214_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX470760_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KC012652_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN604275_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF779289_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagtaaaca
KF779222_PreS1_P-D      tctgggattctttcccgaacaccagttggatccagccttcagagcaaaca
KF779219_PreS1_P-D      tctgggattctttcccgaccaccaggtggatccagccttcagagcaaaca
KJ843187_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN604313_PreS1_P-D      tctgggattctttcccgaccaccaattggatccagccttcagagcaaaca
JN604272_PreS1_P-D      tctaggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF779302_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF779301_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF779303_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF779296_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF779288_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF779212_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF779285_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF779216_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF779318_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF779218_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF779223_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX898691_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX898692_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AJ131956_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF779209_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF779230_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN604170_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN604301_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF779225_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX898694_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX898689_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF779292_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KX827292_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF779228_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF779229_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF779217_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF779377_PreS1_P-D      tctgggattctttcccgaccaccaattggatccagccttcagagcaaaca
KF779376_PreS1_P-D      tctgggattctttcccgaccaccaattggatccagccttcagagcaaaca
KF779340_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX898697_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF779224_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF779341_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KC875333_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KC875329_PreS1_P-D      tctgggattctttcccaaccaccagttggatccagccttcagagcaaaca
KX196235_PreS1_P-D      tctgggattctttcccaaccaccagttggatccagccttcagagcaaaca
KC875322_PreS1_P-D      tctgggattctttcccaaccaccagttggatccagccttcagagcaaaca
KC875323_PreS1_P-D      tctgggattctttcccaaccaccagttggatccagccttcagagcaaaca
KX196225_PreS1_P-D      tctgggattctttcccaaccaccagttggatccagccttcagagcaaaca
KX196224_PreS1_P-D      tctgggattctttcccaaccaccagttggatccagccttcagagcaaaca
KC875328_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KC875330_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KC875326_PreS1_P-D      tctgggattctttcccgaccaccagttgggtccagccttcagagcaaaca
KM606745_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KC875331_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KC875325_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KC875318_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KC875314_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KP090177_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KP090178_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MH724218_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MH724219_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
FJ349209_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KC875315_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KC875320_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KX196217_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KC875324_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KX196231_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KC875336_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KX196219_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KC875337_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KX196232_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KX196220_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KC875321_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KC875316_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KC875313_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KC875334_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KX196221_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KX196233_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KX196222_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KX196218_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KX196216_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KC875332_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KC875335_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KX196230_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KC875317_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KX196234_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KC875319_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN664922_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN664912_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090624_PreS1_P-D      tctgggattctttcccgaccatcagttggatccagccttcagagcaaaca
MK618441_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK618443_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MN507852_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090657_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090691_PreS1_P-D      tctgggaatctttcccgaccaccaggtggatccagccttcagagcaaaca
MK541688_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090671_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090667_PreS1_P-D      tctgggattctttcccgaccaccagttggatctagccttcagagcaaaca
JX090673_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcaaagcaaaca
JN664920_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090659_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090669_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090672_PreS1_P-D      tctgggattctttcccgaccaccagttggacccagccttcagagcaaaca
JX090666_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcaaagcaaaca
JX090661_PreS1_P-D      tctgggattctttcccgaccaccagttggacccagccttcagagcaaaca
JX090662_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090674_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU414142_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090698_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090605_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090639_PreS1_P-D      tctgggattctttcccgaccatcagttggatccagccttcagagcaaaca
JX090620_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU594382_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagccaaca
KF779214_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU414141_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090709_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090710_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
DQ464170_PreS1_P-D      tttgggattctttccgcaccaccagttggatccagccttcagatcaaaca
KU668447_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KU668448_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
DQ464168_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcagcca
MF488704_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KP202936_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KU668433_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KU668435_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
DQ464169_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MF618343_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN664913_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN664921_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KU668445_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN664936_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN664910_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaact
KM524349_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN664909_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN257181_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AM422939_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KU668442_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN664914_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN664917_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KU668436_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KM524350_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN664938_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KM524361_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
DQ315776_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN664911_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF170746_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KU668434_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KU668437_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KU668438_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KU668446_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MF618339_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MF618340_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MF618341_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
V01460_PreS1_P-D        tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN664937_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN688711_PreS1_P-D      tctgggattctttcccgaccatcagttggatccagccttcagagcaaaca
JN604250_PreS1_P-D      tctgggattcttccccgaccaccagttggatccagccttcagagcaaaca
JX090664_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090615_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090670_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaata
JN688685_PreS1_P-D      tctgggattctttcccgaacaccagttggatccagccttcagagcaaaca
DQ486025_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagctttcagagcaaaca
KF476030_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090680_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaata
FJ349213_PreS1_P-D      tctgggattctttcccgatcaccagttggatccagccttcagagcaaaca
JX090622_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MF979168_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MF979173_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcaaagcaaaca
X85254_PreS1_P-D        tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090658_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU939680_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU594434_PreS1_P-D      tctgggattctttcccgaccatcagttggatccagccttcagagcaaata
KJ647355_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090656_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN688710_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU921418_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaata
JN688712_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN688683_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MF979157_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MF979174_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MF979171_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KM524356_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN688679_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GQ922000_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN688713_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaata
MK693109_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU921419_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaata
GQ183485_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090613_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
FJ562338_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090682_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090628_PreS1_P-D      tctgggattctttcccgatcaccagttggatccagccttcagagcaaata
MF979163_PreS1_P-D      tctgggattctttcccgaccaccagttggayccagccttcagagcaaaca
KP090179_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MK598658_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
LT992438_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaata
KX276998_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN370954_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcaaagcaaaca
MH724235_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MH724232_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
EU414143_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaata
AB493846_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaata
HM750151_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090607_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090608_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090612_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
HQ236016_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MF979167_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN688708_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagcattcagagcaaaca
MH724226_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MH724249_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MH724250_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
HQ236014_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
HQ236015_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KP090180_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AY233292_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AY233294_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JX090694_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MH724237_PreS1_P-D      tctgggattctttcccgatcaccagttggatccagccttcagagcaaaca
KF679989_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
FJ349232_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GQ183478_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF476028_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF476029_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KT347090_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN688678_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MH724242_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MH724233_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
JN370949_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcaaagcaaaca
JN370950_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcaaagcaaaca
JN370951_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcaaagcaaaca
JN370952_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcaaagcaaaca
JN370953_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcaaagcaaaca
MK507912_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MH724234_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MF979170_PreS1_P-D      tctgggattctttcccgatcaccagttggatccagccttcaaagcaaaca
KF679992_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KF679993_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KT366497_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KT366507_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AY233296_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MF979156_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MF979176_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MF979161_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MF979175_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KR139748_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MH724224_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MH724225_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MH724227_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MH724229_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MH724230_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MH724248_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MH724228_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MF979162_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MF979172_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
AY233291_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KM519455_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KR139747_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MF979158_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MF979160_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MF979164_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MF979154_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
FJ692506_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaata
FJ692507_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaata
MH724214_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MH724221_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GQ922001_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MH724215_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
MH724220_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
GQ922002_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
KP090181_PreS1_P-D      tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
X65257_PreS1_P-D        tctgggattctttcccgaccaccagttggatccagccttcagagcaaaca
                          * **  *  * **  *  * *    **  *  *               

MF925366_PreS1_P-D      ccagaaatccagattgggacttcaatcccaacaaggattgctggccagcg
X65258_PreS1_P-D        ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JN604245_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
KF170749_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
FJ562309_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
KT749823_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacttggacagac
JX090637_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JN257153_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JN257195_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
KF170768_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaaaaaggacacctggccagac
KF170775_PreS1_P-D      ccccaaatccagattgggacttcaatcccaacaaggacacttggccagac
AB674420_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggactcctggccagac
AB330367_PreS1_P-D      ctgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JF754617_PreS1_P-D      ctgcaaatccagattgggacttcaatcccaacaaagacacttggccagac
JF754588_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
DQ464181_PreS1_P-D      cagcaaatccagattgggacttcaatcccaacaaggacacctggccagac
GU456678_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacttggccagac
JN257160_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JN257176_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacamctggccagac
JN257177_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacamctggccagac
DQ464182_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacaactggccagac
JN040753_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
FJ349215_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
AB674419_PreS1_P-D      ctgcaaatccagattgggacttcaaccccaacaaggacacctggccagac
MK355501_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagag
X80924_PreS1_P-D        cagcaaatccagattgggacttcaatcccaacaaggacacctggccagac
X80926_PreS1_P-D        cagcaaatccagattgggacttcaatcccaacaaggacacctggccagac
EF103280_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JN642128_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
GU456674_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagat
JX090609_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
AB674416_PreS1_P-D      ccgaaaatccagattgggacttcaatcccaacaaggacacctggccagac
GU456684_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagat
JF754629_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JN642135_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
GU456682_PreS1_P-D      ctgcaaatccagattgggacttcaaccccaacaaggacacctggccagac
JX090640_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JX090641_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
AB674425_PreS1_P-D      ccgaaaatccggattgggacttcaatcccaacaaggacacctggcccgac
JN257165_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JN257166_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
GU456665_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
KM524338_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
KF061169_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
GU456679_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacatggccagac
AB674406_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacaactggccagat
GU456657_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
AB188244_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
AB674417_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
AB674418_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JN664931_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaagacacctggccagac
JN642126_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacatggccagac
GQ477458_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JN040830_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggactcctggccagac
JN040775_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
GU456676_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
KF471644_PreS1_P-D      cagcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JN257159_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacaactggccagac
EF103276_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JN040782_PreS1_P-D      ctgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
AB674431_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacccctggccagac
KM524348_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JF754606_PreS1_P-D      ccgcaaacccagattgggatttcaatcccaacaaggacacctggccagac
JN040766_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacttggccagac
KM108595_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JN642138_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JN642129_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JN257188_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacccctggccagac
JN257183_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JF754600_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagat
AY721611_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
GQ183467_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
GQ183460_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
GQ183469_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
GQ183461_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
GQ183458_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
GQ183456_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
GQ183465_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
GQ183459_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
GQ183468_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
GQ183455_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
GQ183452_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
GQ183449_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
GQ183450_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
GQ183451_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
GQ183453_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
GQ183454_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
GQ183457_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
GQ183462_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
GQ183463_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
GQ183464_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
GQ183466_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
GQ183448_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JN642165_PreS1_P-D      ccgcaaacccagattgggacttcaatcccaacaaggactcctggccagac
DQ304547_PreS1_P-D      ccgcgaatccagattgggacttcaatcccaacaaggacacctggccagac
DQ304548_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
DQ304550_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
DQ304551_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
AY236162_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
DQ304549_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JN642164_PreS1_P-D      ctgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JN040779_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JX090665_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
AB270541_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
KM108601_PreS1_P-D      ccgtaaatccagattgggacttccatcccaacaaggacacctggccggac
JN642158_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JN642147_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JN257172_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggactcctggccagac
FJ904427_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JF754626_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
KF471642_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JF754612_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacccctggccagac
FJ904426_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
KX276975_PreS1_P-D      ctgcaaatccagattgggacttcaatcccaacaaggactcctggccagac
FJ904418_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
KP995100_PreS1_P-D      cagcaaatccagattgggacttcaatcccaacaaggacacttggccagac
JN642155_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JN604312_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
GU456675_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
GU456654_PreS1_P-D      cagcaaatccagattgggacttcaatcccaacaaggacacctggccagac
FJ904422_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JX090676_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JF754609_PreS1_P-D      ccgcaaatccagattgggatttcaatcccaacaaggacacctggccagac
GU456668_PreS1_P-D      ctgcaaatccagattgggacttcaatcccaacaaggacacatggccagac
GU456659_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacttggccagac
GU456653_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacccctggccagac
EU787443_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JF754599_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JF754623_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
MF925391_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
KM108596_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagcc
JN040762_PreS1_P-D      cagcaaatccagattgggacttcaatcccaacaaggacacctggccagac
KY629633_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
KF061167_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JX090721_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JN040790_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
AJ344116_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
MK355500_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
KF170772_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JN642131_PreS1_P-D      cagcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JN257150_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacccctggccagac
GQ205380_PreS1_P-D      ccagaaatccagattgggacttcaatcccaacaaggacacctggccagac
AB270550_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JX090668_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JN642157_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacaactggccagac
JN642136_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
GU456677_PreS1_P-D      ctgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
GU456671_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
GU456658_PreS1_P-D      ctgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
KF471654_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JN040793_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacttggccagac
JN040773_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
GU456669_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
FJ904431_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
DQ111986_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JX090647_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
GU456656_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagat
AB104710_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacttggccagac
JN642153_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggtcagac
JN040751_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JN040771_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JN040757_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JN040750_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JF754614_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JF754590_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
GU456683_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
GU456667_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
GU357846_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
KM108594_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacccctggccagac
KF170756_PreS1_P-D      cagcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JN257200_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JN257149_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
KF471657_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JX090660_PreS1_P-D      cagcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JN642166_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JN257170_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
KF471645_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
KF471659_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
GU456655_PreS1_P-D      ctgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
FJ349219_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
MK598645_PreS1_P-D      ccccaaatccagattgggacttcaatcccaacaaggacccctggccagac
JN257163_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JN040784_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JN040774_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagat
GU456670_PreS1_P-D      cagcaaatccagattgggacttcaatcccaacaaggacacctggccagac
AY741797_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
KF471650_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JN642156_PreS1_P-D      ccgcaaatccagattgggatttcaatcccaacaaggacacctggccagac
JN040765_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JF754592_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
GU456673_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccaaac
EF103279_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
AB270542_PreS1_P-D      ccgaaaatccagattgggacttcaatcccaacaaggacacctggccagac
KF170771_PreS1_P-D      ccgcaaatccagattgggatttcaatcccaacaaggacacctggccagac
JN040826_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
GU456661_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
FJ904445_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
MK693108_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JX090681_PreS1_P-D      ccgcaaatccagattgggacttcaatcccatcaaggacacctggccagac
KM108603_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
KM108602_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
KF170755_PreS1_P-D      ccgcaaatcccgattgggacttcaatcccaacaaggacacctggccagac
JN040824_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacttggccagac
JN040815_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JN040778_PreS1_P-D      ctgcaaatccagattgggacttcaatcccaacaaggacacctggccagat
JF754594_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacttggccagac
JF754593_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
GU456681_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
GU456664_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacttggccagac
EF103281_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
EF103275_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
AY945307_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
AB270546_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacccctggccagac
FJ904420_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
FJ904421_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
FJ904415_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
AY741794_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacccctggccagac
AY741795_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacccctggccagac
AY741796_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacccctggccagac
KF170770_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
GU456666_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
KF061170_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagat
KF061168_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
FJ904424_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
AB246348_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JX090621_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JF754627_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
FJ904432_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JN040781_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagat
AB270548_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
KF471646_PreS1_P-D      ccgtaaatccagattgggacttcaatcccaacaaggacccctggccagac
JN040767_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JN040759_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
AB674407_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
AY161151_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
AY161150_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
AY161152_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
FJ349229_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
AB270539_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
KM524342_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JN040758_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
AY161157_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
AY161158_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
KF471656_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
AB270547_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
LT992454_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
KF170773_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
KF170757_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacaactggccagac
JX090695_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
JF754615_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
GU456680_PreS1_P-D      ccgcaaatccagattgggacttcaatcccaacaaggacacctggccagac
AF121239_PreS1_P-D      cagcaaatccagattgggacttcaatcccaacaaggacacctggccagac
MN507838_PreS1_P-D      ccgcaaatccagattgggactt