HBVdb

Dataset for nucleotide sequence PreS1 of genotype D

[Download (right click)] [Alignment] [Repertoires]

1503 sequence(s)

>gnl|hbvcds|AB048701_PreS1_P-D Feature FT:CDS AB048701_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccatcagttggatccagccttcagagcaaacac
caacaatccagattgggacttcaatcccaacaaggacacttggccagacgccaacaaggtaggagctggagcattcggac
tagggttcaccccaccgcacggaggccttctggggtggagccctcaggctcagggcataatgcaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgacagtcaggacggcagcctaccccgctgtctccacctctgagaaccactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatctccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccacattgtcaacctcctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtgttggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtc
cctttttaccgctgttaccaattttcttttatctttgggtatacatttaa
>gnl|hbvcds|AB078031_PreS1_P-D Feature FT:CDS AB078031_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FH1-YS). Non-functional genomic sequence. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaaccctctgggattctttcccgaccaccagttggatccagccttcagagcaaactc
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagccgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatccaagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB078032_PreS1_P-D Feature FT:CDS AB078032_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AH1-SY). Non-functional genomic sequence. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaaccctctgggattctttcccgaccaccagttggatccagccttcagagcaaactc
agcaaatccagattgggacttcaatcccaacaaggacacctggccagccgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttcccagcaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatccaagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcgtcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB078033_PreS1_P-D Feature FT:CDS AB078033_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IS1-OY). Non-functional genomic sequence. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaaccctctgggattctttcccgaccaccagttggatccagccttcagagcaaactc
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagccgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatccaagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB090268_PreS1_P-D Feature FT:CDS AB090268_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacggcaacaaggtaggagctggagcattcgggc
cgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactaacaaccttgccagcaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagtctaccccgctgtctccacctttgagagacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggacccccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB090269_PreS1_P-D Feature FT:CDS AB090269_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1182 residues).
atggggcagaacatggagaagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagcctt
cagagcaaacaccgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctg
gagcattcgggctgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaacc
ttgccagcaaatccgcctcctgcatctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaa
cactcatcctcaggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatt
tccctgctggtggctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgagg
attggggaccctgcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttt
cttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccg
tgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgc
tggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggacta
tcaaggtatgttgcccgtttgtcctctaattccaggatctccaaccaccagcgtgggaccatgcagaacctgcacgacta
ctgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatccca
tcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgt
tcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtaca
gcatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB090270_PreS1_P-D Feature FT:CDS AB090270_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagggagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB104709_PreS1_P-D Feature FT:CDS AB104709_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EG64). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcttctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctctgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgttgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaacctttggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB104710_PreS1_P-D Feature FT:CDS AB104710_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EG105). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacttggccagacgccaacaaggtaggagcgggagcattcgggc
tgggattcaccccaccgcacggaggcctgttggggtggagccctcaggctcagggcacactacaaaccctgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB104711_PreS1_P-D Feature FT:CDS AB104711_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EG104). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcttctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctctgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgttgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctcaaacctgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcgtcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtcttgggggccaagtctgtgcagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB104712_PreS1_P-D Feature FT:CDS AB104712_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EG75). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacttggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggtcttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacacacatcctca
ggccatgcagtggaactccactaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB109475_PreS1_P-D Feature FT:CDS AB109475_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctatgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB109476_PreS1_P-D Feature FT:CDS AB109476_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB109477_PreS1_P-D Feature FT:CDS AB109477_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB109478_PreS1_P-D Feature FT:CDS AB109478_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacccctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatgacaaccttgccagcaaat
ccgcctcctgcgtctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB109479_PreS1_P-D Feature FT:CDS AB109479_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaacaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttccaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB110075_PreS1_P-D Feature FT:CDS AB110075_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB116266_PreS1_P-D Feature FT:CDS AB116266_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccatcaaggacacctggccagacgccaagaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggaccagccctcaggctcagggcataatagaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgaggagcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB119251_PreS1_P-D Feature FT:CDS AB119251_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
agcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagagacacgcatcctca
agccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB119252_PreS1_P-D Feature FT:CDS AB119252_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcacaccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagagacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaacaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB119253_PreS1_P-D Feature FT:CDS AB119253_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
agcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagagacacgcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB119254_PreS1_P-D Feature FT:CDS AB119254_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagccgaccccactgtcaccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB119255_PreS1_P-D Feature FT:CDS AB119255_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcacccctccgcacggaggccttttggggtggagccctcaggctcagggcatgatacaaaccttgccagcaaat
ccgcctcctgcttctaccaatcgccggtcaaccaggcagcctaccccgctgtctccacctttgagagacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtcaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaacaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatctgcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaa
cctctatgtatccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggcttttagttatatggatgatgtggtattgggggccaagactgtgcagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB119256_PreS1_P-D Feature FT:CDS AB119256_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Non-functional genomic sequence. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
tgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggtgtgaagccctcaggctcagggcataatacaaaccatgccagtatat
ccgcctcctgcatctaccaatcgaaggtcaaaaaggcagcctaccccgctgtctccacctttgagagacactcatcccca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtgtttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcgtggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccattgtttggcttttagctatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB120308_PreS1_P-D Feature FT:CDS AB120308_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcacaccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagagacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggacccccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB126581_PreS1_P-D Feature FT:CDS AB126581_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-RU301). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggtggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctggacgactcctggtcaaggaa
cctctatgtatccctcctggtgctggaccaaacctttggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB188241_PreS1_P-D Feature FT:CDS AB188241_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate KAMCHATKA25). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
agcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttgggttggagccctcaggctcagggcataatacaatccttgccagtaaat
ccgcctcctgcatccaccaatcgccagtcaggaaggcaacctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaattcaacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgatgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctatcctctaattccaggatcgtcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB188242_PreS1_P-D Feature FT:CDS AB188242_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate KAMCHATKA38). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacccctggccagacgccaacaaggtaggagctggagcgttcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatgacaaccttgccagcaaat
ccgcctcctgcatctaccaatcgcaagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaactttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaatctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcgaccaccagcgtgggaccatgcagaacctgcacgactactgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggcttttagttatatggatgatgtggtattgggggccaagactgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB188244_PreS1_P-D Feature FT:CDS AB188244_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate UZ24). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactctacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgaagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtggccctcatgttgctgtaccaaacctacggacggaaattgcacctgtattcccatcccatcgtcctgggct
ttcgcaaaatacctatgggagtgggcctcagcccgtttctcktggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtc
cctttataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB205126_PreS1_P-D Feature FT:CDS AB205126_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-IF714-1). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB205127_PreS1_P-D Feature FT:CDS AB205127_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-RU313-2). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccacctcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcatcgaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatccaca
ggccatgcagtggaactccacaactttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttctcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaa
cctctatgtatccctcttgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB205128_PreS1_P-D Feature FT:CDS AB205128_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-RU316-1). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattcttccccgaccaccagttggatccagccttcagagcaaacac
cgcacatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcatccaccaatcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gttccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcttcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaagtaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttccccttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtttccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcctccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB210820_PreS1_P-D Feature FT:CDS AB210820_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacacgcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaaaagtaaaccctgttccgactactgcctctccaatatcgtcaatcttctcgaggattggggaccct
gcactgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgcacaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB210821_PreS1_P-D Feature FT:CDS AB210821_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB210822_PreS1_P-D Feature FT:CDS AB210822_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB222709_PreS1_P-D Feature FT:CDS AB222709_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate UZBV34). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcattctacaaaccttgccagcaaat
ccgcctcctgcttctaccaatcgccagtcaagaaggcagcctacccctctgtctccacctttgcgaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gygctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccgggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB222710_PreS1_P-D Feature FT:CDS AB222710_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate UZNVC6M). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1167 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcattctacaaaccttgccagcaaat
ccgcctcctgcttctaccaatcgccagtcaagaaggcagcctacccctctgtctccacctttgcgaaacactcatcctca
ggcacagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggct
ccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgyg
ctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaat
cctcacaataccgcagagtctagactcgtggtggacttctctcaattttctcgggggaactaccgtgtgtcttggccaaa
attcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcgg
cgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcc
cgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactactgctcaaggaacct
ctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttc
ggaaaattcctatgggagtgggcctcagcccgtttctgctggctcagtttactagtgccatttgttcagtggttcgtagg
gctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccct
ttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB222711_PreS1_P-D Feature FT:CDS AB222711_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate UZNV24). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcgtcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB222712_PreS1_P-D Feature FT:CDS AB222712_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate UZBV61). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatctkgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AB222713_PreS1_P-D Feature FT:CDS AB222713_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate UZNVC6). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcactgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcatcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB246347_PreS1_P-D Feature FT:CDS AB246347_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cacaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcgaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB246348_PreS1_P-D Feature FT:CDS AB246348_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaatactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaagttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaa
cctctatatatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AB267090_PreS1_P-D Feature FT:CDS AB267090_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Ehime 22-HS). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaaccctctgggattctttcccgaccaccagttggatccagccttcagagcaaactc
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagccgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB270539_PreS1_P-D Feature FT:CDS AB270539_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL200F). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacacgcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctacaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccat
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtatcaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB270541_PreS1_P-D Feature FT:CDS AB270541_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL47F). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccaatcaggaaggcagccgacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaactttccaccaaactctgcaagatcccagagtgagaggcctgtatctccctgctggtg
gctccagttcaggaacagtaaaccctgttccgaccactgtctctcacatatcgtcaatcttctcgaggattggggacctt
gcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggcttttagttatatggatgatgtggtattgggggccaagaatgwrcagcatcttgagtc
cctttttaccgctgtkaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB270542_PreS1_P-D Feature FT:CDS AB270542_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL12F). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgaaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggactcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctcygactccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtattcccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccattgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB270543_PreS1_P-D Feature FT:CDS AB270543_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL209F). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagcgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB270546_PreS1_P-D Feature FT:CDS AB270546_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL88F). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacccctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaatactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgckgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggatcatgcagaacctgcacgactcctgctcaaggaa
cctctatgaatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggcttttagttatatggatgatgtggtattgggggcgaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB270547_PreS1_P-D Feature FT:CDS AB270547_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL295F). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaacatgcagaacctgcacgacccctgctcgcggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtaccgcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|AB270548_PreS1_P-D Feature FT:CDS AB270548_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL207F). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcctacgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgaccactgtctctcacatatcgtcaatcttctcgaggattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctcgactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB270550_PreS1_P-D Feature FT:CDS AB270550_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL247F). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagagacactcatcctca
ggccatgcagtggaactccacaaccttccaacaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtttccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacagcaccttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB330367_PreS1_P-D Feature FT:CDS AB330367_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TAJ14HBV). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctctccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcaaagcaaacac
tgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tggggttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcggggaggcagcctactcctctgtctccgcctttgagagtcactcatcctca
ggccatgcagtggaattccacgaccttccaccaaactctgcaagattccagagtaagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtatctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctactcgtgttacaggcggggtttttcttgttgacaag
aatcctaacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgcttgatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcgaggtatgtt
gcccgtttgccctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtaccgcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB330369_PreS1_P-D Feature FT:CDS AB330369_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TAJ5HBV). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagatgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaattccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactactgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|AB330370_PreS1_P-D Feature FT:CDS AB330370_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TAJ6HBV). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagatgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaattccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttgtgtctttgggtatacatttaa
>gnl|hbvcds|AB471856_PreS1_P-D Feature FT:CDS AB471856_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate F3O-C1). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB471857_PreS1_P-D Feature FT:CDS AB471857_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate F3O-C2). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB493846_PreS1_P-D Feature FT:CDS AB493846_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 17UC). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaatac
cgcaaacccagattgggacttcaatcccaacaaggacacctggccggacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctctgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgaccactgcctctcccttatcgtcaatctactcgaggattggggaccct
gcgctgaacatggagaacattacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB555496_PreS1_P-D Feature FT:CDS AB555496_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-TA31). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccacctcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagagaaactcatcctca
ggccatgcagtggaactccacaaacttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggggccctgctaatgatacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtgtacatttaa
>gnl|hbvcds|AB555497_PreS1_P-D Feature FT:CDS AB555497_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-TA37). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
tgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccacctcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagagaaactcatcctca
ggccatgcagtggaaatccacgaacttccagcaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcacatatcgtcaatcttctcgaagattgggggccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcctggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtgtacatttaa
>gnl|hbvcds|AB555500_PreS1_P-D Feature FT:CDS AB555500_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-TA64). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccggacgccaacaaggtaggagccggagcattcgggc
tgggattcaccccacctcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagaaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagagacactcatcctca
agccatgcagtggaactccacgaacttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacataacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacgaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctgctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctgattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgctcaacaccttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtgtacatttaa
>gnl|hbvcds|AB555501_PreS1_P-D Feature FT:CDS AB555501_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-TA65). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
cgggattcaccccacctcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccacctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaacttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggggaccct
gcgatgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgtt
gcccgtttgtcctctaattccaggatcttcaacaaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtttccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttatgtctttgggtattcatataa
>gnl|hbvcds|AB583680_PreS1_P-D Feature FT:CDS AB583680_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Pkst7912). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagagacactcatcctca
ggccatgaagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB674405_PreS1_P-D Feature FT:CDS AB674405_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AnkaraHCCA12). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattttttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtatgtcctctaattccaggatcttcaaccaccagcacgggaccatgcaaaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB674406_PreS1_P-D Feature FT:CDS AB674406_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IstambulB23). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacaactggccagatgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggcccagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagagacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtattcccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaagatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgaagagtctagactcgtggtggacttctctcaattttctagggggagccaccgtgtgtcgtggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctacttccaggatcttcaaccaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcrtcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB674407_PreS1_P-D Feature FT:CDS AB674407_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SamsunD35). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccacctcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaagccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactactgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|AB674408_PreS1_P-D Feature FT:CDS AB674408_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SamsunD83). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcaaagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggagtggagccctcaggctcaaggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaacagcacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtraaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgaagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB674411_PreS1_P-D Feature FT:CDS AB674411_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SamsunD84). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattttttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcggac
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaattccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatctcctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaacgaccagtacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggttttcagttatgtggatgatgtggtattgggggccaagtctgtacagcaccttgagtc
cctttttaccgctgttaccaattttcttttgtctgtgggtatacatttaa
>gnl|hbvcds|AB674416_PreS1_P-D Feature FT:CDS AB674416_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AnkaraE19). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgaaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcagggaggcagcctacccctctcactccacctttgagagacactcatcctca
ggctattcagtggaactccacgaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttacctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattgggggccct
gcgctgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctcgggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactatcagggtatgtt
gcccgtttgtcctctaattccaggatcttcaacaaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgttcagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB674417_PreS1_P-D Feature FT:CDS AB674417_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AnkaraLCE1). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=1158 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagctttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
cgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcacactaacaaccttgccaacaaat
ccgcctcctgcctctaccaatcgccagacaggaaggcagcctacccctctgactccacctttgagagacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccaggcctctccctgctggtggctccagttcag
gaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatg
gagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaat
accgcagagtctagactcgtggtggacttctctcaattttctaggggggactaccgtgtgtcttggccaaaattcgcagt
ccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatc
atattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcc
tctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatc
cctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattc
ctatgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccc
cactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgc
tgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB674418_PreS1_P-D Feature FT:CDS AB674418_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GaziantepLCC7). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=1158 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagctttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
cgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcacactaacaaccttgccaacaaat
ccgcctcctgcctctaccaatcgccagacaggaaggcagcctacccctctgactccacctttgagagacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccaggcctctccctgctggtggctccagttcag
gaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatg
gagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaat
accgaagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagt
ccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatc
atcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcc
tctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatc
cctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattc
ctatgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccc
cactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgc
tgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB674419_PreS1_P-D Feature FT:CDS AB674419_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GaziantepLCC16). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
tgcaaatccagattgggacttcaaccccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggcctcttggggtggagccctcaggctcaaggcacactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgacagtcaggaaggcagccgacccctctgtctccacctttgagaaacactcatcctca
ggccatacagtggaattccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcagggacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaatgccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgttgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatgtggatgatgtggtgttgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgtttccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB674420_PreS1_P-D Feature FT:CDS AB674420_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SamsunLCD2). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggactcctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggcctgttggggtggagccctcaggctcaaggcataatacaaaccttgccagcaaat
ccgcctccggcctctaccaatcgccagtcaggaaggcagcccacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagggacctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggca
cctctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggct
ttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtc
cctttataccgctgttaccaattttcttttgtctgtgggtatacatttaa
>gnl|hbvcds|AB674422_PreS1_P-D Feature FT:CDS AB674422_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AnkaraE15). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB674423_PreS1_P-D Feature FT:CDS AB674423_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SamsunD18). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
agcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
cgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacacaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggacggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatctccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttatcgaggattggggacctt
gtgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacaaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtatctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtaccgcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatataa
>gnl|hbvcds|AB674424_PreS1_P-D Feature FT:CDS AB674424_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AnkaraE24). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggactcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctccggcctctaccaatcgccagacaggaaggcagcctaccccgctgtctccacctttgagagacacccatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaaaatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggtccct
gcgttgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgaagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtccactaattccaggatcttcaacgaccagcacgggaccatgcagaacctgcacgagtcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcatggctcaatttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB674425_PreS1_P-D Feature FT:CDS AB674425_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AnkaraE44). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgaaaatccggattgggacttcaatcccaacaaggacacctggcccgacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgccgtctccacctctgagaaacacgcatcctca
ggccgtgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatctccctgctggtg
gctccagttcaggaacagcaaaccctgttccgactactgtctctcccatatcatcaatcttctcgaggattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggaaccaccgtgtgtcgtggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtttccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB674427_PreS1_P-D Feature FT:CDS AB674427_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SamsunD54). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctccggcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaaytccacaacctttcaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccgacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgcttcgcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB674428_PreS1_P-D Feature FT:CDS AB674428_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IstambulB26). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcacaccgccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccacctcctgcctccaccaatcgtcagtcgggaagacagcctactccgctgtctccacctttgagagacactcatcctca
ggccacacagtggaactccacaactttccaccaaactttgcaagatcccagagtgagaggcctgtatctccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgcggaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaacgaccagcacgggaccatgcagaacctgcacgagtcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtgtcgcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB674431_PreS1_P-D Feature FT:CDS AB674431_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GaziantepLCC27). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacccctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacacacatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccaaagtgaaaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaagattcctaggacccctgctcgggttactggcggggttttccttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacyaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgttgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtgttgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF043593_PreS1_P-D Feature FT:CDS AF043593_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 6/89). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=1158 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
agcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
taggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagacaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagacctgctggtggctccagttcag
gaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatg
gagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaat
accgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagt
ccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatc
atcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcc
tctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgaccactgttcaaggaacctctatgtatc
cctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattc
ctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccc
cactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtaccgcatcttgagtccctttttaccgc
tgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF043594_PreS1_P-D Feature FT:CDS AF043594_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 1/91). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
agcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
taggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagacaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaa
cctctatgtatccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF121239_PreS1_P-D Feature FT:CDS AF121239_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV/1303). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
agcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcttctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacacccatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtatctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF121240_PreS1_C-D Feature FT:CDS AF121240_PreS1_C-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV/11066). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcttctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF121241_PreS1_P-D Feature FT:CDS AF121241_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV/1758). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcttctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF121242_PreS1_P-D Feature FT:CDS AF121242_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV/1218). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcttctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcaaaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF151735_PreS1_P-D Feature FT:CDS AF151735_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacacaccgtgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagccgaccccgctgtctccacctttgagaaacacgcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgttaatcttctcgaagattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggaaggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccattgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF280817_PreS1_P-D Feature FT:CDS AF280817_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-D1). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcatacgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaatcttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaatatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgc
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AJ131956_PreS1_P-D Feature FT:CDS AJ131956_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 1). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgccagacaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaattccacaacctttcaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggagcagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatatt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaacctttggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AJ344116_PreS1_P-D Feature FT:CDS AJ344116_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBsAg negative patient GX27). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtccggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatctccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacaaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccgacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtccagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaggc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AJ627215_PreS1_P-D Feature FT:CDS AJ627215_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 06115). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaagctcagggcatgatacaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagagacactcatcctca
ggccatgcagtggaattccacgaccttccaccaaactctgcaagatcccagggtgaggggcctgtatttccctgctggtg
gctccagttcgggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcctggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgtt
gcccgtgtgtcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaa
cctctatgtatccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtc
gctttttaccgctgttaccaattttcttatgtctctgggtatacatttaa
>gnl|hbvcds|AJ627216_PreS1_P-D Feature FT:CDS AJ627216_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 17707). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaagctcagggcgtgatrcaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagagacactcatcctca
ggccatgcagtggaattccacgaccttccaccaaactctgcaagatcccagggtgaggggcctgtatttccctgctggtg
gctccagttcgggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacyaccgtgtgtcctggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgtt
gcccgtgtgtcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaa
cctctatgtatccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaartctgtacaacatcttgagtc
gctttttaccgctgttaccaattttcttwtgtctctgggtatacatttaa
>gnl|hbvcds|AJ627218_PreS1_P-D Feature FT:CDS AJ627218_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 21116). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaagctcagggcgtgatgcaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagagacactcatcctca
ggccatgcagtggaattccacgaccttccaccaaactctgcaagatcccagggtgaggggcctgtatttccctgctggtg
gctccagttcgggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcctggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgtt
gcccgtgtgtcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaa
cctctatgtatccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtc
gctttttaccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AJ627219_PreS1_P-D Feature FT:CDS AJ627219_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 24039). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctgtccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
caacaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tagggttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaatccgygccagcaaat
ccgcctcctgcctctaccaatcgcaagtcaggcaggcagcctaccccgctgtctccacctctgagagacactcatcctca
ggccatgcagtggaactccacaaccttccatcaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggggaccct
gcactgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcgtcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttyagttatatggatgatgtggtattgggggccaagactgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AJ627220_PreS1_P-D Feature FT:CDS AJ627220_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 29234). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatamtacaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgccagtcagcaaggcagcctaccccgctgtctccacctttgagaaacacgcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaa
actctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AJ627222_PreS1_P-D Feature FT:CDS AJ627222_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 31228). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
agcaaatccagattgggacttcaatcccaacaaggacacttggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccacctcacggaggcctcttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcatccaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcracctccgcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcarggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttacaaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AJ627223_PreS1_P-D Feature FT:CDS AJ627223_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 33720). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaacccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AJ627224_PreS1_P-D Feature FT:CDS AJ627224_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 33852). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcaaagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctactcctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM422939_PreS1_P-D Feature FT:CDS AM422939_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate X28). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaaccctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagagacactcatcctca
ggccatgcagtggaattccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcgctcaacatggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaacaaccagcacgggaccatgccggacctgcatgactactgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY090452_PreS1_P-D Feature FT:CDS AY090452_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cacaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataacacaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctaccccactgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaacaaactctgcaagatcccagggtgaaaggcctgtttctccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggcccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctgattccaggatcctcaaccaccagcacgggaccatgcaaaacctgcacgactactgttcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY090453_PreS1_P-D Feature FT:CDS AY090453_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggtcagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagcccacaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctaccccgttgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcattttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcaagacctgcacgactactgttcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcatgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttcttctggctcaatttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY161150_PreS1_P-D Feature FT:CDS AY161150_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccatcagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
actctattcatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY161151_PreS1_P-D Feature FT:CDS AY161151_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Non-functional genomic sequence. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgaatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgacctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
actctattcatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY161152_PreS1_P-D Feature FT:CDS AY161152_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Non-functional genomic sequence. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccatcagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacataaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
actctattcatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY161157_PreS1_P-D Feature FT:CDS AY161157_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccacctcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccagcctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagaatgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY161158_PreS1_P-D Feature FT:CDS AY161158_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccacctcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcaatccccagcctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagaatgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY233291_PreS1_P-D Feature FT:CDS AY233291_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 179). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaattccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtgtgtcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctggcct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY233292_PreS1_P-D Feature FT:CDS AY233292_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 184). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctatcccgctgtctccacctttgagagacactcatcctca
ggccatgcagtggaattccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggttgacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatatt
gcccgtgtgtcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY233294_PreS1_P-D Feature FT:CDS AY233294_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 305). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagagacactcatcctca
ggccatgcagtggaattccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggttgacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatatt
gcccgtgtgtcctctaattccaggatcctcaaccaccagcacgggaccctgccgaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtaccatttgttcagtggttcgt
aaggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY233296_PreS1_P-D Feature FT:CDS AY233296_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 185). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tggggttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagagacactcatcctca
ggccatgcagtggaattccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaacaaccagcacgggaccatgccggacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
ccttttcaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY236160_PreS1_P-D Feature FT:CDS AY236160_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 1A). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcacccaaccgcacggaggtcttttggggtggagccctcaggttcagggcatgctacaaactttgccagcaaat
ccgcctcctgcctccaccaatcggcagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcagaaacagtaaaccctgttccgactactgcctctcctttatcgtcaatcttctcgaggattggggaccct
gcactgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcttgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggcgtgggcctcagcccgttcctcctggctcagtttactagtgccatttgttcaggggttcgg
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttctttggtctttgggtatacatttaa
>gnl|hbvcds|AY236162_PreS1_P-D Feature FT:CDS AY236162_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 23A). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggactcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccgtgccagcaaat
ccgcctcctgcctctaccaatcgtcagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccacgaagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatcttcctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcactgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacgaccgtgtgtcgtggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggatcatgcagaacctgcacgactcctgctcaaggaa
cctctatgaatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY236164_PreS1_P-D Feature FT:CDS AY236164_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 30). Non-functional genomic sequence. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcacccaaccgcacggaggtcttttggggtggagccctcaggcttagggcatgctacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcagaaacagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcactgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcgcaataccgcagagtctagactcgtggaggacttctctcagttttctagggggaaacaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgccgaatctgcacgactcttgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtc
cctttttaccgctgttaccaattttctttggtctttgggtatacatttaa
>gnl|hbvcds|AY661792_PreS1_P-D Feature FT:CDS AY661792_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate ayw). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttagggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctacctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctacaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcttcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY661793_PreS1_P-D Feature FT:CDS AY661793_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 2). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
ggggattcaccccaccgcacggaggccttttagggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctacctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctacaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcttcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY721605_PreS1_P-D Feature FT:CDS AY721605_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AK1.1). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaattccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcgaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY721606_PreS1_P-D Feature FT:CDS AY721606_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AT1.2). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagtacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctgtgggtatacatttaa
>gnl|hbvcds|AY721607_PreS1_P-D Feature FT:CDS AY721607_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HIY1.3). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatacttcaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcgtcaaccaccagcacgggaccatgcagaacctgcacaactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY721608_PreS1_P-D Feature FT:CDS AY721608_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IB1.4). Non-functional genomic sequence. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactgcaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgccgaacatgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctgtgggtatacatttaa
>gnl|hbvcds|AY721609_PreS1_P-D Feature FT:CDS AY721609_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AA1.5). Non-functional genomic sequence. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgacctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggctcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY721611_PreS1_P-D Feature FT:CDS AY721611_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SK1.7). Non-functional genomic sequence. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggcctgttgggatggagccctcaggctcagggcatgctacacaccgtgccagcaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagagacactcatcctca
ggccatgcagtggaactccgcaaccttccacgaaactctgcaagatcccagagtgagaagcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgacctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtatcaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY721612_PreS1_P-D Feature FT:CDS AY721612_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BL1.8). Non-functional genomic sequence. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacacgcatcctca
ggccatgcagtggaactccacaacctaccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY741794_PreS1_P-D Feature FT:CDS AY741794_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-IPI-50). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacccctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctccgtctccacctttgagaaacacgcaccctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccgtcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccattgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtaccgcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY741795_PreS1_P-D Feature FT:CDS AY741795_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-IPI-Hi). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacccctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctccgtctccacctttgagaaacacgcaccctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccgtcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccattgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtaccgcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY741796_PreS1_P-D Feature FT:CDS AY741796_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-IPI-P3). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacccctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctccgtctccacctttgagaaacacgcaccctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttggcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccgtcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccattgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtaccgcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY741797_PreS1_P-D Feature FT:CDS AY741797_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-IPI-21). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatccgca
ggccatgcagtggaactccacaactttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtctttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttgccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY741798_PreS1_P-D Feature FT:CDS AY741798_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-IPI-P4). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactcaacaacattccaccaaactctgcaagatcccaaagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggacaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccagtcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgtt
gcccgtttgtcctgtaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtgcagcatcttgaggc
cctttataccgctgttgtcaattttctttggtctttgggtattcatttaa
>gnl|hbvcds|AY796030_PreS1_P-D Feature FT:CDS AY796030_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FC1.9). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctacccatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
cgggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY796031_PreS1_P-D Feature FT:CDS AY796031_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate RA1.10). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacccctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagagacactcatcctca
ggccatgcagtggaacaccacaactttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggaaaccaccgtgtgtcgtggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactactgctcaaggga
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgaggc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY796032_PreS1_P-D Feature FT:CDS AY796032_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NA1.11). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacttggccagacgcccacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY945307_PreS1_P-D Feature FT:CDS AY945307_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccacctcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaattccacaactttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcgtcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttgggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ111986_PreS1_P-D Feature FT:CDS DQ111986_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MBT181). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcggga
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactgcaaaccttgccagcaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctacccctccgtctccacctttaagaaacactcatcctca
ggccatgcagtggaactccacaaccttccatcaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggtccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgaagagtctagactcgtggtggacttctctcaattttctagggggaaataccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttctgtctttgggtatacatttaa
>gnl|hbvcds|DQ304547_PreS1_P-D Feature FT:CDS DQ304547_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT4). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcgaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggactcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccgtgccagcaaat
ccgcctcctgcctctaccaatcgtcagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccacgaagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatcttcctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcactgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacgaccgcgtgtcgtggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
agccgtttgtcctctaattccaggatcttcaaccaccagcacgggatcatgcagaacctgcacgactcctgctcaaggaa
cctctatgaatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ304548_PreS1_P-D Feature FT:CDS DQ304548_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT4). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggactcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccgtgccagcaaat
ccgcctcctgcctctaccaatcgtcagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccacgaagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatcttcctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgacaatcttctcgaggattggggaccct
gcactgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaac
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacgaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggatcatgcagaacctgcacgactcctgctcaaggaa
cctctatgaatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ304549_PreS1_P-D Feature FT:CDS DQ304549_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT4). Non-functional genomic sequence. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggactcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccgtgccagcaaat
ccgcctcctgcctctaccaatcgtcagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccacgaagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatcttcctgctggtg
gctccagttaaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcactgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaac
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacgaccgtgtgtcgtggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggatcatgcagaacctgcacgactcctgctcaaggaa
cctctatgaatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ304550_PreS1_P-D Feature FT:CDS DQ304550_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT4). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggactcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccgtgccagcaaat
ccgcctcctgcctctaccaatcgtcagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccacgaagtggaactccacaaccttccaccaaactctacaagatcccagagtgagaggcctgtatcttcctgctggtg
gctccagttcaagaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcactgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaac
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacgaccgtgtgtcgtggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggatcatgcagaacctgcacgactcctgctcaaggaa
cctctatgaatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ304551_PreS1_P-D Feature FT:CDS DQ304551_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT4). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggactcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccgtgccagcaaat
ccgcctcctgcctctaccaatcgtcagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccacgaagtggaactccacaaccttccaccaaactctacaagatcccagagtgagaggcctgtatcttcctgctggtg
gctccagttcaagaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcactgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacgaccgtgtgtcgtggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggatcatgcagaacctgcacgactcctgctcaaggaa
cctctatgaatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ315776_PreS1_P-D Feature FT:CDS DQ315776_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EI00615). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaattccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaacaaccagcacgggaccatgccggacctgcatgactactgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ329356_PreS1_P-D Feature FT:CDS DQ329356_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT1). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattcttgcccgaccaccagttggatccagccttcagagcaaacac
cggaaatccagattgggacttcaatccaaacaaggacacctggcaagacgccaacaaggaaggagctggagcattcgggc
tgggtttcacccaaccgcacggaggccttttggggtggagccctcaggttcagggcatgctacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgtcagtcaggaaggcagcctaccccgttgtctcaacctttgagaaacactcatcctca
ggccatgcagtggaattccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcactgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcgcaataccgcagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaacaaccagcacgggaccatgccggacttgcatgactactgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ329357_PreS1_P-D Feature FT:CDS DQ329357_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT1). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattcttgcccgaccaccagttggatccagccttcagagcaaacac
cggaaatccagattgggacttcaatcccaacaaggacacctggcaagacgccaacaaggtaggagctggagcattcgggc
tgggtttcacccaaccgcacggaggccttttggggtggagccctcaggttcagggcatgctacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgtcagtcaggaaggcagcctaccccgttgtctcaacctttgagaaacactcatcctca
ggccatgcagtggaactcctcaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcagaaacagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcactgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcgcaataccgcagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaacaaccagcacgggaccatgccggacttgcatgactactgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ336674_PreS1_P-D Feature FT:CDS DQ336674_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S1). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggtcttttggggtggagccctcaggctcagggcatgctacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcagaaacagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcactgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgcttctatgcctcatcttcttgttgggtcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcttgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ336675_PreS1_P-D Feature FT:CDS DQ336675_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S1). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggtcttttggggtggagccctcaggctcagggcatgctacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcagaaacagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcactgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcttgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ336676_PreS1_P-D Feature FT:CDS DQ336676_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S1). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggtcttttggggtggagccctcaggctcagggcatgctacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcagaaacagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcactgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctgggtatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcttgctcaaggaa
cctctatgtatccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ336677_PreS1_P-D Feature FT:CDS DQ336677_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S1). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggtcttttggggtggagccctcaggctcagggcatgctacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcagaaacagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcactgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctgggtatcgctggatgtgtctg
cggcgttttatcatattcctcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcttgctcaaggaa
cctctatgtatccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ336678_PreS1_P-D Feature FT:CDS DQ336678_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S1). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggtcttttggggtggagccctcaggctcagggcatgctacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcagaaacagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcactgaacatggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcttgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ336679_PreS1_P-D Feature FT:CDS DQ336679_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S1). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggtcttttggggtggagccctcaggctcagggcatgctacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcagaaacagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcactgaacatggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcttgctcaaggaa
cctctatgtatccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ336685_PreS1_P-D Feature FT:CDS DQ336685_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT5). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcagaaacagcaaaccctgttccgactactgcctctcctttatcgtcaatcttctcgaggattggggaccct
gcactgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcgaccaccagcacgggtccttgccgaacctgcacgactcttgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ336686_PreS1_P-D Feature FT:CDS DQ336686_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT5). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggtcttttggggtggagccctcaggctcagggcatgctacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcagaaacagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcactgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcgcaataccgcagagtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgctcg
cggcgttttatcatcttcctcttcatcctgcttctatgcctcatcttcttgttgggtcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcgaccaccagcacgggaccatgccggacctgcacgactcttgctcaaggaa
cctctatgtatccttcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|DQ336687_PreS1_P-D Feature FT:CDS DQ336687_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT5). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagtcggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggtcttttggggtggagccctcaggctcagggcatgctacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcagaaacagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcactgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcgcaataccgcagagtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgctcg
cggcgttttatcatcttcctcttcatcctgcttctatgcctcatcttcttgttgggtcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcgaccaccagcacgggaccatgccggacctgcacgactcttgctcaaggaa
cctctatgtatccttcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|DQ336688_PreS1_P-D Feature FT:CDS DQ336688_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT5). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgactaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagccttcgggc
tgggtttcaccccaccgcacggaggtcttttggggtggagccctcaggctcagggcatgctacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcagaaacagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcactgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcgcaataccgcagagtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgctcg
cggcgttttatcatcttcctcttcatcctgcttctatgcctcatcttcttgttgggtcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcgaccaccagcacgggaccatgccggacctgcacgactcttgctcaaggaa
cctctatgtatccttcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|DQ336689_PreS1_P-D Feature FT:CDS DQ336689_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT5). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggtcttttggggtggagccctcaggctcagggcatgctacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtattcccctgctggtg
gctccagttcagaaacagcaaaccctgttccgactactgcctctcctttatcgtcaatcttctcgaggattggggaccct
gcactgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcgacaaccagcacgggaccatgccggacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|DQ336690_PreS1_P-D Feature FT:CDS DQ336690_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT5). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
ttgggttcaccccaccgcacggaggtcttttggggtggagccctcaggctcagggcatgctacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcagaaacagcaaaccctgttccgactactgcctctcctttatcgtcaatcttctcgaggatggggaccctt
gcactgaacatggagaacatcacatcaagactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcttgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgggtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ336691_PreS1_P-D Feature FT:CDS DQ336691_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT5). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggtcttttggggtggagccctcaggctcaaggcatactacaaactttgccagcaaat
ccgcctcctgcctccaacaaatgtcagtcaggaaggcagcctaccccactgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcagaaacagcaaaccctgttccgactactgcctctcctttatcgtcaatcttctcgaggattggggaccct
gcactgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttccctcagttttctagggggaaacaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctgggtatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaacaaccagcacgggaccatgccggacttgcatgactactgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatattgatgatgtgggattgggggccaagtctgtacaacatcttgagtc
cctttttaccgctgttaccaattttctttggcctttgggtatacatttaa
>gnl|hbvcds|DQ336692_PreS1_P-D Feature FT:CDS DQ336692_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT5). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccaaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggtcttttggggtggagccctcaggctcagggcatgctacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcagaaacagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcactgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcgcaataccgcagagtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgctcg
cggcgttttatcatcttcctcttcatcctgcttctatgcctcatcttcttgttgggtcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcgaccaccagcacgggaccatgccggacctgcacgactcttgctcaaggaa
cctctatgtatccttcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|DQ399006_PreS1_P-D Feature FT:CDS DQ399006_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate G1). Complete genome. [Hepadnaviridae] (length=1179 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacatggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccacctcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgactccacctttgagagacactcatcctca
ggccatgcagtggaattccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatctccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcgtggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtatctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcgaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagtacgaccagtacgggaccatgcagaacctgcacgactattg
ctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatca
tcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttca
gtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagca
tcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtgtacatttaa
>gnl|hbvcds|DQ464168_PreS1_P-D Feature FT:CDS DQ464168_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT8). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcagccac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggccttttgggttggagccctcaggctcaaggcatactacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaattccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcagaacaagtaaaccctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccagcttgtcctggttgtcgctgggtgtgtctg
cggcgttttgtcagcttcctcttcagcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaacaaccagcacgggaccatgccggacctgcatgactactgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ464169_PreS1_P-D Feature FT:CDS DQ464169_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT8). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccgggttgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggccttttggggtggagccctcaggctcaaggcatactacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctacccggctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaattccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggaatcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaatacggcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcg
aaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctcgatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaacaaccagcacgggaccatgccggacctgcatgactactgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ464170_PreS1_P-D Feature FT:CDS DQ464170_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT8). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttcaaccagcaatcctttgggattctttccgcaccaccagttggatccagccttcagatcaaacac
cgcaaatccagattgggacttcaatcccaacaagaacacctggccagacgccaacaaggtaggagctggagcattcgggc
ttgggttcaccccaccgcacggaggccttttggggtgggaccctcaggctcaaggcatactacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaattccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaagaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcatggtggacttctctcaattttctagggggaactaccgtgtgtcttggcg
aaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaacaaccagcacgggaccatgccggacctgcatgactactgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ464172_PreS1_P-D Feature FT:CDS DQ464172_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT2). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggtcttttggggtggagccctcaggctcagggcatgctacaaactctgccagcaaat
ccgcctcctgcctccaccaatcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcagaaacagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcactgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctgggtatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcttgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtc
cctttttaccgctgttaccaattttctttggtctttgggtatacatttaa
>gnl|hbvcds|DQ464173_PreS1_P-D Feature FT:CDS DQ464173_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT2). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggtcttttggggtggagccctcaggctcagggcatgctacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaattccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcctttatcgtcaatcttctcgaggattggggaccct
gcactgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcttgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtc
cctttttaccgctgttaccaattttctttggtctttgggtatacatttaa
>gnl|hbvcds|DQ464174_PreS1_P-D Feature FT:CDS DQ464174_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT6). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggtcttttggggtggagccctcaggctcagggcatgctacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcagaaacagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcactgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcgcaataccgcagagtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggtccatgccgaacctgcacgactcttgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttctgtctttgggtatacatttaa
>gnl|hbvcds|DQ464175_PreS1_P-D Feature FT:CDS DQ464175_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT6). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggtcttttggggtggagccctcaggctcagggcatgctacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcagaaacagcaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcactgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcttgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgtgtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ464176_PreS1_P-D Feature FT:CDS DQ464176_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT6). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggtcttttggggtggagccctcaggctcagggcatgctacaaactttgccagcaaat
ccgcctcctgcctcctccaatcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcagaaacagcaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcactgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgtcgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcttgctcaaggaa
cctctatgtatccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtc
cctttttaccgttgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ464177_PreS1_P-D Feature FT:CDS DQ464177_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT6). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggtcttttggggtggagccctcaggctcagggcatgctacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgtcagtcaggaaggcagcctaccccgctgtctccacctctgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcagaaacagcaaaccctgttccgactactgcctctcctttatcgtcaatcttctcgaggattggggaccct
gcactgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcttgctcaaggaa
cctctatgtatccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtc
cctttttaccgttgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ464178_PreS1_P-D Feature FT:CDS DQ464178_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT6). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaattccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggtcttttggggtggagccctcaggctcagggcatgctacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcagaaacagcaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcactgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcgcaataccgcagagtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgttggtcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcttgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgtgtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ464181_PreS1_P-D Feature FT:CDS DQ464181_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S3). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1164 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
agcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcggac
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgtcggtcaggaaggcagcctacccctctgactccacctttgagaaacacccatcctca
ggccatgcagtggaactcaacaaccttccaccaaactctgcaagatcccggagtgaggcagttacctgctggtggctcca
gttcaggaacagtaaaccctgttccgactactgtctctccaatatcgtcaatcttctcgaggattggggaccgtgcgctg
aacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcct
cacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcgaaaatt
cgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgt
tttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgt
ttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctcta
tgtttccctcctgttgctgtaccaaaccttcggacggaaattgcacatgtattcccatcccatcatcttgggctttcgga
aaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggct
ttcccccattgcctggctttcagttacatggatgatgtggtattgggggccaagtctgtacagcatcttgagtctctttt
taccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ464182_PreS1_P-D Feature FT:CDS DQ464182_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S4). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcggaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacaactggccagacgccaacaaggtaggagctggagcattcgggc
tgggactcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcttctaccaatcgccagtcaggaaggcagcctactcctctgtctccacctttgagagacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatctccctgctggtg
gcttcagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggacctt
gcactgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaagggatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgacttttgctcaaggaa
cctctatgaatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccattgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtgtacatttaa
>gnl|hbvcds|DQ486021_PreS1_P-D Feature FT:CDS DQ486021_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT13). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatgctacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcagaaacagcaaaccctgttccgactactgcctctcctttatcgtcaatcttctcgaggattggggaccct
gcactgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcgcaataccgcagtgtctagactcgtggaggacttctctcagttttctagggggaaacaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcttgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtc
cctttttaccgctgttaccaattttcttttggctttgggtatacatttaa
>gnl|hbvcds|DQ486022_PreS1_P-D Feature FT:CDS DQ486022_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT11). Non-functional genomic sequence. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcacccaaccgcacggaggtcttttggggtggagccctcaggcttagggcatgctacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcagaaacagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcactgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcgcaataccgcagagtctagactcgtggaggacttctctcagttttctagggggaaacaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgccgaatctgcacgactcttgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtc
cctttttaccgctgttaccaattttctttggtctttgggtatacatttaa
>gnl|hbvcds|DQ486025_PreS1_P-D Feature FT:CDS DQ486025_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT12). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagctttcagagcaaacac
tgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacacactgtgccagcaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctaccccgctctctccaccgctgagaaacactcatcctca
ggccgtgcagtggaactccacaaccttccaccaaactctgcaagatcccaaagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggaggacttctctcaattttctagggggaaccaccgtgtgtcgtggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaacaaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggatggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtc
actttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF103275_PreS1_P-D Feature FT:CDS EF103275_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Ran11). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccacctcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctacaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtgtgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF103276_PreS1_P-D Feature FT:CDS EF103276_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Ran22). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaacaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagccaccccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaaccccacaaccttccaccaaactctgcaagatcccagagtgagaggcctatatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcactgaatatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aacaattgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctccaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgttgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF103277_PreS1_P-D Feature FT:CDS EF103277_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Ran33). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacacgcatcctca
ggccatgcagtggaactctccaaacttccaccaaactttgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtgtg
cggcgtttaatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF103279_PreS1_P-D Feature FT:CDS EF103279_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Ran99). Non-functional genomic sequence. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctctaccagtcgccagtcaggaaggcagccgacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtgaaattccacaactttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggacctt
gcgctgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgttgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF103280_PreS1_P-D Feature FT:CDS EF103280_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Ran100). Non-functional genomic sequence. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggaccattccagg
tgggattcaccccaccgcacggaggccttttgggggggagccctcaggctcagggcatactacaaaccttgccaacgaat
catcctcctgcctctaccagtcgtcactcaggaagggagccgacccctctgtctccacctttgagagacactcctgctct
ggccatgcagtgaaactccacaactttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtggccctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EF103281_PreS1_P-D Feature FT:CDS EF103281_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Ran102). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1170 residues).
atggggcagaatcttttcaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaattccacaactttccaccaaactctgcaagatcccagaggggaaggcctgtatttccctgctgggg
gctccagttccggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtggccctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU155893_PreS1_P-D Feature FT:CDS EU155893_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 4). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctatccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatcaagattgggacttcaatcccaacaaggacacatggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgtctccaccaatcgccagtcacgaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcaatggaattccaaaaccttccaccaaactctacaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggggaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcaaagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactgtcaaggtatgtt
gcccgtttgtcctctaatttcaggatcctcaaccaccagcacgggaccctgccgaccctgcataacaactgctcaagaaa
cctctatgtttgcctcatgttgctgtaccaaacctttggacggaaattacacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagttcactagtgccatttgttcagtggttcgc
agggctttcccccactgtttggctttcagttatatggacgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU155895_PreS1_P-D Feature FT:CDS EU155895_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 5b). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaagtcttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcttccaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaattccacaaccttccaccacactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttccggaacagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcgctgagcatggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcagaataccgcagagtctagactcgtggtggacttctctcaattttcaagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaaccttcaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttctcgttggctcttctggactatcggggtatgtt
gcccgtttgtcctccaatgctagcatcctcaaacaccagcaggggcacatgccgaagctgcatgatacatgctccaggaa
cctctatgtctcccttctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggggtgggcctcagcccgtttctcctggctcagttcactagtgcaatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatatggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaatttccttttatctttgggtatacatttaa
>gnl|hbvcds|EU414135_PreS1_P-D Feature FT:CDS EU414135_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
cgggattcaccccaccgcacggaggccttttgggrtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaaratcccaragtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU414136_PreS1_P-D Feature FT:CDS EU414136_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcaaagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctctaccaatcgccattcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacgcaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU414138_PreS1_P-D Feature FT:CDS EU414138_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcngaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccggacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctaccccgctgtctccaccgttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaa
cctctatgtatccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatatgttcagtggttcgt
agggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU414139_PreS1_P-D Feature FT:CDS EU414139_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgccagtcagggaggcaacctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaaytccacaactttccatcaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU414140_PreS1_P-D Feature FT:CDS EU414140_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
agcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcycatatcgtcaatcttctcgaggattggggaccct
gtgccgaacatggagagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaar
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactmccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcytgtcctccaayttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactmtcaaggtatgtt
gcccgtytgtcctctaattccaggatcwtcaaccaccagyrygggaccmtgcmraacctgcacgactmytgytcaaggaa
cctctatgtwtccctcmtgttgctgtwcmaaaccttcggacggaaattgcacytgtattcccatcccatcatcmtgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgy
mgggctttcccccactgtytggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU414141_PreS1_P-D Feature FT:CDS EU414141_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
ygggtttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaactktgccagcaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgcgaaacactcatcctca
ggccatgcagtggaactccacaaccttccatcaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU414142_PreS1_P-D Feature FT:CDS EU414142_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccrccacacggaggccttttggggtggagccctcaggctcagggcataatacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctaccccgctgactccacctttgcgaaacactcatcctca
ggccatgcagtggaactccacaaccttccatcaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggaytcctaggaccccttctcgggttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccaytgtttggctttcagytatatggatgatgtggtattgggggccaagtctgtaycgcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU414143_PreS1_P-D Feature FT:CDS EU414143_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaatac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccccacggaggccttttggggtggagccctcaggctcagggcatgctacaaactttgccagcaaat
ccacctcctgcctccaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctcgcacttatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctactatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgccgcacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594382_PreS1_P-D Feature FT:CDS EU594382_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagccaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctaccccgttgtctccacctttgcgaaacactcatcctca
ggccatgcagtggaactccacaaccttccatcaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggactggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594396_PreS1_P-D Feature FT:CDS EU594396_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagacaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctacaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacytgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594397_PreS1_P-D Feature FT:CDS EU594397_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594398_PreS1_P-D Feature FT:CDS EU594398_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
tgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcggac
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatgcaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtattcccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactgctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594399_PreS1_P-D Feature FT:CDS EU594399_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctacaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594400_PreS1_P-D Feature FT:CDS EU594400_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
agcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccactcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594401_PreS1_P-D Feature FT:CDS EU594401_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
agcaaatccagattgggacttcaatcccaacaaggacacctggccaaacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaa
cctctatgtatccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594402_PreS1_P-D Feature FT:CDS EU594402_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
agcaaatccagattgggacttcaatcccaacaaggacacctggccaaacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaagaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaa
cctctatgtatccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594403_PreS1_P-D Feature FT:CDS EU594403_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
agcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594404_PreS1_P-D Feature FT:CDS EU594404_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccacctcctgcatccaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacacccaccctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgaagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594405_PreS1_P-D Feature FT:CDS EU594405_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
agcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aaccctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594407_PreS1_P-D Feature FT:CDS EU594407_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
agcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcgcaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594408_PreS1_P-D Feature FT:CDS EU594408_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
agcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtattaccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gtgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttatctttgggtatacatttaa
>gnl|hbvcds|EU594409_PreS1_P-D Feature FT:CDS EU594409_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
agcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatattgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaa
cctctatgtatccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594410_PreS1_P-D Feature FT:CDS EU594410_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
agcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaagattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594413_PreS1_P-D Feature FT:CDS EU594413_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
agcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594414_PreS1_P-D Feature FT:CDS EU594414_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
agcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594415_PreS1_P-D Feature FT:CDS EU594415_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
agcaaatccagattgggacttcaatcccaacaaggacacttggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacgaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594416_PreS1_P-D Feature FT:CDS EU594416_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
agcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgttgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcgaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaa
cctctatgtatccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594417_PreS1_P-D Feature FT:CDS EU594417_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
agcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaattccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaa
cctctatgtatccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594418_PreS1_P-D Feature FT:CDS EU594418_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccggacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594419_PreS1_P-D Feature FT:CDS EU594419_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
agcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcactccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gtgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcaggacctgcacgactactgttcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594420_PreS1_P-D Feature FT:CDS EU594420_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
agcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcactccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gtgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcaggacctgcacgactactgttcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594421_PreS1_P-D Feature FT:CDS EU594421_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
agcaaatccagattgggacttcaatcccaacaaggacacttggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacgaccttccaccaaactctacaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594422_PreS1_P-D Feature FT:CDS EU594422_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
agcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcactccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagagacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gtgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcaggacctgcacgactactgttcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccattgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594423_PreS1_P-D Feature FT:CDS EU594423_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
agcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcactccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gtgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcaggacctgcacgactactgttcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594424_PreS1_P-D Feature FT:CDS EU594424_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcaaagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccactgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594425_PreS1_P-D Feature FT:CDS EU594425_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacatggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctatatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctgkttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtytgtcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agagctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594426_PreS1_P-D Feature FT:CDS EU594426_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctacaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgttcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594427_PreS1_P-D Feature FT:CDS EU594427_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
agcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcgcaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594428_PreS1_P-D Feature FT:CDS EU594428_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
agcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccgtgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gtgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcaggacctgcacgactactgttcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594429_PreS1_P-D Feature FT:CDS EU594429_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
agcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccactaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgttgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaa
cctctatgtatccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594430_PreS1_P-D Feature FT:CDS EU594430_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcatccaccaatcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594431_PreS1_P-D Feature FT:CDS EU594431_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
agcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccactaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgttgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaa
cctctatgtatccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594432_PreS1_P-D Feature FT:CDS EU594432_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
agcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccactaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaa
cctctatgtatccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594433_PreS1_P-D Feature FT:CDS EU594433_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcatccaccaatcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcgcgggaacatgcagaacctgcacgactactgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU594434_PreS1_P-D Feature FT:CDS EU594434_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccatcagttggatccagccttcagagcaaatac
agcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcggtc
tgggtttcaccccaccccacggaggccttttggggtggagccctcaggctcagggcatgctacacactttgccggcgaat
ccacctcctgcctccaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtattaccctgctggtg
gctccagttcaggaacagtaaaccctgttccgaccactgcctctcacttatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggac
cctctatgtatccctcctgttgttgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|EU787436_PreS1_P-D Feature FT:CDS EU787436_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 165). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccacaagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU787437_PreS1_P-D Feature FT:CDS EU787437_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 17). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtcagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggatcctgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU787438_PreS1_P-D Feature FT:CDS EU787438_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 7). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1167 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacaactggccagacgccaacaaggtaggagctggagcattcgggc
taggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggaatactacaaaccatcccaacacat
ccgcctcctgcctccaccaatcgtcagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggcccagtggaattccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgactttccctgctggtggct
ccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcg
ctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaat
cctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaa
attcgcagtccccaacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcgg
cgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcc
cgtttgtcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacct
ctatgtatccctcctgttgctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggctttc
ggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagg
gctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccct
ttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU787440_PreS1_P-D Feature FT:CDS EU787440_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate W17). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcatgcctccaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtcagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU787441_PreS1_P-D Feature FT:CDS EU787441_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate W32). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagctttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggcgctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcttgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcttgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcaatttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU787442_PreS1_P-D Feature FT:CDS EU787442_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate W37). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctccaccaatcgcaagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtcagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU787443_PreS1_P-D Feature FT:CDS EU787443_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate w40). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagttggagcattcgggc
cgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttcaaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcactgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggcaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtc
cctttataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU787445_PreS1_P-D Feature FT:CDS EU787445_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate W51). Non-functional genomic sequence. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtattggcc
aaaattagcagtccccaacctacaatcactcaccagcatcaagtcctccaacttgtcgtggttatcgctggacgtgtatg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttatggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacatgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU787446_PreS1_P-D Feature FT:CDS EU787446_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate W75). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctccgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU787447_PreS1_P-D Feature FT:CDS EU787447_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate W46). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgagtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcttgttgctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU919197_PreS1_P-D Feature FT:CDS EU919197_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate XJU). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggccttttgggatggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttaccatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctactgttgctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU921418_PreS1_P-D Feature FT:CDS EU921418_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 22.165.07). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctctccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaatac
cgcaaacccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctaccccgctgactccacctttgagagacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctatatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgaccactgcctctcccttatcgtcaatcttctcgaggattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgataag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcgcaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgc
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU921419_PreS1_P-D Feature FT:CDS EU921419_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 22.252.07). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaatac
cgcaaacccagattgggacttcaatcccaacaaggacacctggccggacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctaccccgctgtctccgcctttgagaaacacacatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgaccactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaataccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgtcgaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgc
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939680_PreS1_P-D Feature FT:CDS EU939680_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C186). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccgccacacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaaa
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacctgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcgaggtatgtt
gcccgtgtgtcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgattcctgctcaaggaa
cctctatgtatccctcttgttgctgtaccaaagcttcggacagaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccatttctccttgctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939681_PreS1_P-D Feature FT:CDS EU939681_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D146). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctctccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggcgctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagagacacgcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagagacctgtatctccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcgtcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcttgttgctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ349205_PreS1_P-D Feature FT:CDS FJ349205_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H5). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggatttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaactttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ349206_PreS1_P-D Feature FT:CDS FJ349206_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H1). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
cgggattcaccccaccgcacggaggcctgttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctaccccgctgtctccgcctttgagaaacactcatcctca
ggccatgcagtggaactccacaactttccaccaaactctgcaagatcccagggtgagaggcctgtatctccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttcgcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FJ349208_PreS1_P-D Feature FT:CDS FJ349208_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H25). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcccctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaactttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaa
cctctatgtatccctcctgttgttgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ349209_PreS1_P-D Feature FT:CDS FJ349209_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H29). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacttggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaattccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaacaaccagcacgggaccatgccgaacctgcatgactactgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ349213_PreS1_P-D Feature FT:CDS FJ349213_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H59). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgatcaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacccctggccagacgccaacaaggtaggagctggagcattcgggc
cgggtttcaccccaccgcacggaggactcttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagagacacgcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtacttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgaagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtatctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcgtcgaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ349214_PreS1_P-D Feature FT:CDS FJ349214_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H61). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacaactggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcactccaccgcacggaggtcttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagccgaccccgctgtctccacctttgagaaacactcatcctca
tgccatgcagtggaattccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatctccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcgcggagcatggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacgaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgacaactgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ349215_PreS1_P-D Feature FT:CDS FJ349215_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H82). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcaaagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggtggccttttggggtggaggcctcaggctcagggcatactacaaaccttgcctacaaat
ccgcctcctgcctctaccaatcgtcagccaggaaggcagcctaccactctgtctccacctttgagaaacacgcatcatca
ggcaatgaagtggaactccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgaatctccctgctggtg
gctccagttcaggaacaggaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgatacaggcggggtttttcttgttgataag
aatcctcacaataacgcacagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtgttgtcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccattgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ349216_PreS1_P-D Feature FT:CDS FJ349216_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H113). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcaaagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccattgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ349218_PreS1_P-D Feature FT:CDS FJ349218_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H135). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaagtccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tggggttcaccccacctcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccctgccagcaaat
ccgcctcctgcagctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaactttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctgattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggattgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ349219_PreS1_P-D Feature FT:CDS FJ349219_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H138). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcaaagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttcaaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacacatcgtcaatcttctcgaggattggggtccct
gcgctgaacatggagaacatcacatcaggattcctagcacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcacggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggcatacatttga
>gnl|hbvcds|FJ349220_PreS1_P-D Feature FT:CDS FJ349220_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H144). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcaaagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
cgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ349228_PreS1_P-D Feature FT:CDS FJ349228_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C11). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcaaagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaacattccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ349229_PreS1_P-D Feature FT:CDS FJ349229_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C26). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaatac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctcctcctttgagaaaccctcatcctgg
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtcaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|FJ349230_PreS1_P-D Feature FT:CDS FJ349230_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C7). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaatac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctcctcctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctcctacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ349231_PreS1_P-D Feature FT:CDS FJ349231_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C22). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacagaccttgccagcaaat
ccgcctcctgcctcgaccaatcgccagtcaggaaggcaacctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtattttcctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcactgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggcttttagttatatggatgatgtggttttgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ349232_PreS1_P-D Feature FT:CDS FJ349232_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C51). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccaaacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccacctcctgcctccaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctctgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgacttctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ349233_PreS1_P-D Feature FT:CDS FJ349233_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C54). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaagaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcttggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcgactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ349234_PreS1_P-D Feature FT:CDS FJ349234_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C82). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagcattcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcctacgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaacctttcaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtatctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttctgctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcttgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ349235_PreS1_P-D Feature FT:CDS FJ349235_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C90). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacccctggccagacgccaacaaggtaggagctggagcattcgggc
tgggactcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctctgagaaacacccatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccaaagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgaagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtttccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ386590_PreS1_P-D Feature FT:CDS FJ386590_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 1841). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatgctacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaatatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaacctttggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562309_PreS1_P-D Feature FT:CDS FJ562309_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I200). Non-functional genomic sequence. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggaccattcgggc
cggggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaaaatcccggagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaacctgttcccactactgtctctcacatatcgkcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacctgtcctggttatcgttggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgtaaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562338_PreS1_P-D Feature FT:CDS FJ562338_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I192). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgaaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tggggttcaccccaccgcacggaggcctgttggggtggagccctcaggctcagggcatattacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctaccccactgtctccacctttgagagacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatctccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccyt
gcgctgaacatggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtgtgtcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgacttctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacagcatcttgagtc
cctttttactgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692506_PreS1_P-D Feature FT:CDS FJ692506_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D3_50157). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaatac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggggctggagcattcgggc
tggggttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactattgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692507_PreS1_P-D Feature FT:CDS FJ692507_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D3_50158). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaatac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggggctggagcattcgggc
tggggttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactattgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692532_PreS1_P-D Feature FT:CDS FJ692532_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D4_50053). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
caacaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tagggttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggacggcagcctaccccgctgtctccacctctgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaa
cctctatgtttccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcgtcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692533_PreS1_P-D Feature FT:CDS FJ692533_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D4_50064). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
caacaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tagggttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggacggcagcctaccccgctgtctccacctctgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcccatcgtcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ899792_PreS1_P-D Feature FT:CDS FJ899792_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D146-1). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctctccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggcgctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagagacacgcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagagacctgtatctccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggacctt
gcgctgaacatggagaacgtcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcgtcaaccaccggcacgggaccctgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcttgttgctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ904395_PreS1_P-D Feature FT:CDS FJ904395_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A10a). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
caacaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagcgggagcattcgggc
tggggttcaccccacctcacggaggtcttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcctccaccaatcgycagtcaggaaggcagccgaccccgctgtctccacctttgagagacactcatcctca
agccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtacttccctgctggtg
gctccagttcaggaacaataaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagartctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcatgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgttgtattgggggccaactctgcacaacatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ904399_PreS1_P-D Feature FT:CDS FJ904399_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A18). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
agcaaatccagattgggacttcaatcccaacaaggacacatggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ904402_PreS1_P-D Feature FT:CDS FJ904402_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A26). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
caaaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcagraacagcaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccyt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcgaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccattgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ904410_PreS1_P-D Feature FT:CDS FJ904410_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A54b). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
caacaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tggggttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaatagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttggcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcgtcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgttcaacatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ904412_PreS1_P-D Feature FT:CDS FJ904412_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A56). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaagctcagggcatactacaaaccttgccagcaaat
ccgcctccttcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcgaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ904415_PreS1_P-D Feature FT:CDS FJ904415_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A63). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctactcctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaggatccaagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcatcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgttgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ904418_PreS1_P-D Feature FT:CDS FJ904418_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A69a). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggacttttggggtggagccctcaagctcagggcatgctacaaaccttgccagcaaat
ccacctcctgcctctaccaatcgccagtcaggaaggcagcccacacctctgactccacctttgagaaacactcatcctca
ggccatgcagtggaactccacacccttccaccaaactctgcaagatcccaaagtgagcgacctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcgaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ904419_PreS1_P-D Feature FT:CDS FJ904419_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A70). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
caacaatcccgattgggacttcaatcccaacaaggacacttggccagatgccaacaaggtaggagctggagcattcgggc
tggggttcaccccaccgcacggcggccttttggggtggagccctcaggctcagggcataattcaaaccttgccagcaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgtttcaggcggggtgtttcttgttgacaag
aatcctcacaatgccgcagagtctagactcgtggtggacttctctcaattttctaggggggactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacttgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgttcagcatcttgagtc
cctttttaccgctgtttccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ904420_PreS1_P-D Feature FT:CDS FJ904420_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A71a). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctactcctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcargatccmagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcatcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgttgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ904421_PreS1_P-D Feature FT:CDS FJ904421_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A71b). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctactcctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcargatccmagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcatcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgttgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ904422_PreS1_P-D Feature FT:CDS FJ904422_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A76). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
cgggactcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccaccgttgagagacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggacctt
gcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccmtgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgc
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ904424_PreS1_P-D Feature FT:CDS FJ904424_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A79a). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgatcaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
taggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcttctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctgggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgacacctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ904426_PreS1_P-D Feature FT:CDS FJ904426_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B4). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcacccctcctcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
agccatgcagtggaactccacaacctttcaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcatcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcgcaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ904427_PreS1_P-D Feature FT:CDS FJ904427_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B6). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagcgttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctccggcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
agccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgaccactgtatctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgccttggcc
aaaattcgcagtccccgacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtacaaaaccttcggaaagaaattgcacctgtattcccatcccatcatcatgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ904431_PreS1_P-D Feature FT:CDS FJ904431_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B12). Non-functional genomic sequence. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcggac
cgggattcaccccacctcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgagtccacctttgagagacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgtggacaaa
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcacatcttgastc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ904432_PreS1_P-D Feature FT:CDS FJ904432_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B14). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
cgggaatcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctcaaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ904433_PreS1_C-D Feature FT:CDS FJ904433_PreS1_C-D of [Viruses] Hepatitis B Virus genotype D (isolate B15). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cacaaatccagattgggacttcaatcccaacaaggacccctggccagacgccaacaaggtaggagcgggagcattcgggc
tggggttcaccccaccgcacggaggccttttggggtggagcccgcaggctcaaggcataatacaaaccttgccagcaaat
ccgcctcctgcttctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctctgagagacactcatcctca
agccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtccatacagcatctwgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ904435_PreS1_P-D Feature FT:CDS FJ904435_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B27). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
caacaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tggggttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ904438_PreS1_P-D Feature FT:CDS FJ904438_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B32). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
caacaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tagggttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagccyacaccgctgtctccacctataagagacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggacctt
gcggtgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgaagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtgcaccaycttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ904439_PreS1_P-D Feature FT:CDS FJ904439_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B34). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccatcagttggatccagccttcagagcaaacac
caacaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tggggttcacaccaccccacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctactccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctgggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ904443_PreS1_P-D Feature FT:CDS FJ904443_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B46). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ904445_PreS1_P-D Feature FT:CDS FJ904445_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B62). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaagctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcttctaccaatcgccagtcaggaaggcaacctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaattccacaaccttccaccaaactctgcaagatcccagagtgaggggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagaatctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ904446_PreS1_P-D Feature FT:CDS FJ904446_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B64a). Non-functional genomic sequence. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgatcaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagccaaaaaggcagcctacacctctgtctccacctttgagagacactcatcctca
ggccatgcagtggaacatcacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctagaacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccctaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagttcactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacagcatcttgagtc
cctttttaccgctgtgaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ167301_PreS1_P-D Feature FT:CDS GQ167301_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate ZADGM452). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgcaagcaaat
ccgcctcctgcttctaccaatcgccagacgggaaggcagcctacccctctgtctccacctttgagagacactcatcctca
ggccgcgcagtggaactccacaactttccaacaaactctgcaagatcccagagtgagaggcctgaatctccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcgtggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttctcgttggttcttctggactatcgaggtatgtt
gcccgtttgtccggtaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccattgtctggcctttagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ167302_PreS1_P-D Feature FT:CDS GQ167302_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate ZADGM4521). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcttctaccaatcgccagacgggaaggcagcctacccctctgtctccacctttgagagacactcatcctca
ggccgtgcagtggaactccacaactttccaacaaactctgcaagatcccagagtgagaggcctgaatctccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccacatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgcgtgtcgtggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttctcgttggttcttctggactatcgaggtatgtt
gcccgtttgtccggtaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccattgtctggcctttagttatacggatgatgtggtattgggggccaagtctgtacagcaccttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183448_PreS1_P-D Feature FT:CDS GQ183448_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4629). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttccggaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcacactacaaaccgtgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcccacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaatcttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccaaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctatgattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183449_PreS1_P-D Feature FT:CDS GQ183449_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4591). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttccggaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcacactacaaaccgtgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcccacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccaaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctatgattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgttcaacaccttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183450_PreS1_P-D Feature FT:CDS GQ183450_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4589). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttccggaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcacactacaaaccgtgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcccacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccaaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctatgattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183451_PreS1_P-D Feature FT:CDS GQ183451_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4588). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttccggaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcacactacaaaccgtgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcccacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccaaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctatgattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183452_PreS1_P-D Feature FT:CDS GQ183452_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4590). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttccggaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcacactacaaaccgtgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcccacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtccatcttctcgaggattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccaaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctatgattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183453_PreS1_P-D Feature FT:CDS GQ183453_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4574). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttccggaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcacactacaaaccgtgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcccacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccaaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctatgattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183454_PreS1_P-D Feature FT:CDS GQ183454_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4582). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttccggaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcacactacaaaccgtgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcccacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccaaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctatgattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183455_PreS1_P-D Feature FT:CDS GQ183455_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4573). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttccggaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcacactacaaaccgtgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcccacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccaaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctatgattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183456_PreS1_P-D Feature FT:CDS GQ183456_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4572). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttccggaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcacactacaaaccgtgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcccacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccaaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctatgattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgttcagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183457_PreS1_P-D Feature FT:CDS GQ183457_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4583). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttccggaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcacactacaaaccgtgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcccacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccaaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctatgattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183458_PreS1_P-D Feature FT:CDS GQ183458_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4587). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcacactacaaaccgtgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcccacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccaaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctatgattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183459_PreS1_P-D Feature FT:CDS GQ183459_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4585). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttccggaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcacactacaaaccgtgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcccacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctatgattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183460_PreS1_P-D Feature FT:CDS GQ183460_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4584). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttccggaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcacactacaaaccgtgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcccacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctcgggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctgattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183461_PreS1_P-D Feature FT:CDS GQ183461_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4586). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttccggaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccgtgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcccacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctcgggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctgattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183462_PreS1_P-D Feature FT:CDS GQ183462_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4567). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttccggaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcacactacaaaccgtgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcccacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccaaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctatgattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183463_PreS1_P-D Feature FT:CDS GQ183463_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4613). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttccggaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcacactacaaaccgtgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcccacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccaaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctatgattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183464_PreS1_P-D Feature FT:CDS GQ183464_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4703). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttccggaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcacactacaaaccgtgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcccacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccaaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctatgattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183465_PreS1_P-D Feature FT:CDS GQ183465_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4614). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttccggaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaaggaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcacactacaaaccgtgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcccacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccaaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctatgattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183466_PreS1_P-D Feature FT:CDS GQ183466_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4577). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttccggaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcacactacaaaccgtgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcccacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccaaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctatgattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183467_PreS1_P-D Feature FT:CDS GQ183467_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4705). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttccggaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcacactacaaaccgtgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcccacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccaaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtgtg
ctgcgcggcatcatattactcttcctcttgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctgattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtc
cctttttaccgctgttaccaattttcttttttctttgggtatacatttaa
>gnl|hbvcds|GQ183468_PreS1_P-D Feature FT:CDS GQ183468_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4632). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttccggaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcacactacaaaccgtgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcccacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcaccataccaaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctatgattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183469_PreS1_P-D Feature FT:CDS GQ183469_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4602). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttccggaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcacactacaaaccgtgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcccacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctcgggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctgattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183470_PreS1_P-D Feature FT:CDS GQ183470_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4639). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggactcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcaacctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183471_PreS1_P-D Feature FT:CDS GQ183471_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4610). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctcgcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgacttctgttcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgaggc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183472_PreS1_P-D Feature FT:CDS GQ183472_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4691). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggacccagccttcagagcaaacac
cgcaaatccagattgggatttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtattttcctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctcgcccatatcgtccatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaa
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgacaactgttcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183473_PreS1_P-D Feature FT:CDS GQ183473_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4601). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
ctcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctaccccactgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctcgcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
ccttattaccgctgttaccatttttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183474_PreS1_P-D Feature FT:CDS GQ183474_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4594). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
ctcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggag
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgaggc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183475_PreS1_P-D Feature FT:CDS GQ183475_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4575). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
ctcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctaccccactgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggag
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183476_PreS1_P-D Feature FT:CDS GQ183476_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4603). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
ctcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagtaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctaccccactgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaatcttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctcgcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggag
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183477_PreS1_P-D Feature FT:CDS GQ183477_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4604). Non-functional genomic sequence. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
ctcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagtaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctaccccactgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaatatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtcttgactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgacaactgttcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183478_PreS1_P-D Feature FT:CDS GQ183478_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4605). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcattctacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctaccccactgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccactaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183479_PreS1_P-D Feature FT:CDS GQ183479_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4607). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
ctcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagtaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctaccccactgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgcgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggag
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183480_PreS1_P-D Feature FT:CDS GQ183480_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4609). Non-functional genomic sequence. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaatatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaag
aatcctcacaataccgcagagtcttgactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggac
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183481_PreS1_P-D Feature FT:CDS GQ183481_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4569). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
ctcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagtaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctaccccactgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactactgttcaaggag
cctctatgtatccctcttgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgc
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183482_PreS1_P-D Feature FT:CDS GQ183482_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4570). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
ctcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagtaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctaccccactgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggag
cctctatgtatccctcttgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183483_PreS1_P-D Feature FT:CDS GQ183483_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4566). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
ctcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagtaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctaccccactgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggag
cctctatgtatccctcttgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ183484_PreS1_P-D Feature FT:CDS GQ183484_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4598). Non-functional genomic sequence. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggcgcagggcataatacaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaacattccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgc
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgactttgggtatacatttaa
>gnl|hbvcds|GQ183485_PreS1_P-D Feature FT:CDS GQ183485_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4599). Non-functional genomic sequence. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggcctttttgggtggaaccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctaccccactgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctccaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtcttgactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ184322_PreS1_P-D Feature FT:CDS GQ184322_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate ZADGM4522). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaccaaat
ccgcctcctgcttctaccaatcgccagacgggaaggcagcctacccctctgtctccacctttgagagacactcatcctca
ggccgtgcagtggaactccacaactttccaacaaactctgcaagattccagagtgagaggcctgaatctccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtccctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcgtggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcgaggtatgtt
gcccgtttgtccggtaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccattgtctggcctttagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ205380_PreS1_P-D Feature FT:CDS GQ205380_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T1245). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cagaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tagggttcaccccaccgcacggaggccttttggggtggagcccgcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcagctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctctgagagacactcatcctca
ggccatgcagtggacctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcacggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ205382_PreS1_P-D Feature FT:CDS GQ205382_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T1360d). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cagaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tagggctcaccccaccgcacggaggccttttggggtggagcccgcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcagctaccaatcgccagtcaggaaggcagcctaccccactgtctccacctctgagagacactcatcctca
ggccatgcagtggacatccacaaccttccaccaagctctgcaagatcccagagtgagaggcctgtacttccctgctggtg
gctcaacttcaggaacagtaaaccctgttccgactactgcctctcccatattgtcaatcttctcgaagattggggaccct
gcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccagcttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcgaccaccagcacgggaccatgcagaacctgcatgactactgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ205384_PreS1_P-D Feature FT:CDS GQ205384_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T1434d). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaaccctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cagaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tagggttcaccccaccgcacggcggccatttggggtggagcccgcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcagctaccaatcgccagtcaggaaggcagcctaccccactgtctccacctctgagagacactcatcctca
ggccatgcagtggacctccacaaccttccaccaagctctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctcaacttcaggaacagtaaaccctgttccgactcctgcctctcccatattgtcaatcttctcgaagattggggaccct
gcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccggcttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcgaccaccagcacgggaccatgcagaacctgcatgactactgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|GQ205385_PreS1_P-D Feature FT:CDS GQ205385_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T1469). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cagaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tagggttcaccccaccgcacggaggccttttggggtggagcccgcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcagctaccaatcgccagtcaggaaggcagcctaccccactgtctccacctctgagagacactcatcctca
ggccatgcagtggacctccacaaccttccaccaagctctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctcaacttcaggaacagtaaaccctgttccgactactgcctctcccatattgtcaatcttctcgaagattggggaccct
gcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaatttcaggatcttcgaccaccagcacgggaccatgcagaacctgcatgactactgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacgaaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ205388_PreS1_P-D Feature FT:CDS GQ205388_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T1562). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cagaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tagggttcaccccaccgcacggaggccttttggggtggagcccgcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcagctaccaatcgccagtcaggaaggcagcctaccccactgtctccacctctgagagacactcatcctca
ggccatgcagtggacctccacaaccttccaccaagctctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctcaacttcaggaacagtaaaccctgttccgactactgcctctcccatattgtcaatcttctcgaagattggggaccct
gcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcgaccaccagcacgggaccatgcagaacctgcatgactactgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ205389_PreS1_P-D Feature FT:CDS GQ205389_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T1667). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccgcttggatccagccttcagagcaaacac
cagaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tagggttcaccccaccgcacggaggccttttggggtggagcccccaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcagctaccaatcgccagtcaggaaggcagcctaccccactgtctccacctctgagagacactcatcctca
ggccatgcagtggaactccacaaccttccaccaagctctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctcaacttcaggaacagtaaaccctgttccgactactgcctctcccatattgtcaatcttctcgaagattggggaccct
gcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcgaccaccagcacgggaccatgcagaacctgcatgactactgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacgaaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ377589_PreS1_P-D Feature FT:CDS GQ377589_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate J145). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccacctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ477452_PreS1_P-D Feature FT:CDS GQ477452_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P32). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
agcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatgcaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagagacactcatcctca
ggccatgcagtggaattccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaagattggggaccct
gtgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctgattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggcaaagtctgtaccgcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ477453_PreS1_P-D Feature FT:CDS GQ477453_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P39). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgatcaccagttggatccagccttcagagcaaacac
agcaaatccagattgggacttcaatcccaacaaggatacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcttctaccaatcgacagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
agccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gtgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttccaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcgtcctgggct
ttcggaaaattcctatgggaatgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgaggc
cctttttacagctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ477455_PreS1_P-D Feature FT:CDS GQ477455_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P73). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1167 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccacctcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcttctaccaatcgccagtcaggaaggcagcctaccccgctgactccacctttgggagacactcatcctct
ggcccagtggaagtccacaactttccaccaaactctgcaagatcccagggtgaaaggcctgtatttccctgctggtggct
ccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcg
ctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaat
cctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggaaccaccgtgtgtcttggccaaa
attcgcagtccccaacctccaatcactcaccaacctcctgtcctcaaacttgtcctggttatcgctggatgtgtctgcgg
cgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcc
cgtctgtcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacct
ctatgtatccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttc
ggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagg
gctttcccccattgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtccct
ttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ477456_PreS1_P-D Feature FT:CDS GQ477456_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P84). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
agcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccgtgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcaacccaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgaggggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcactgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggcttttagttatatggatgatgtggtattgggggccaagactgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ477457_PreS1_P-D Feature FT:CDS GQ477457_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P118). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcttctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaactttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtatctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ477458_PreS1_P-D Feature FT:CDS GQ477458_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P126). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcaaagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctctaccaatcgccagtcaggaagacagcctacccctccaactctacctttgagacacactcatcccca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaaaatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaa
aatcatcaaaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacaaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcttgctcaaggaa
cctctatgtatccctcctgttgctgtatcaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggcttttagttatatggatgatgtggtattgggggccaaatctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ477459_PreS1_P-D Feature FT:CDS GQ477459_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P127). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
tgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggggctggagccttcgggc
tgggattcaccccaccgcacggaggccttttagggtggagccctcaggctcagggcatactacaaaccttgccagaaaat
ccgcctcctgcctctaccaatcgccagtcagggaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggca
cctctatgtatccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ922000_PreS1_P-D Feature FT:CDS GQ922000_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 1B3552). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagaagccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgccaatcaggaaggcagccgactccactgtctccacctttgagagacactcatcctca
agccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgaggggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggtgtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctg
cggcattttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ922001_PreS1_P-D Feature FT:CDS GQ922001_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 2B3654). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctccaccaatccccagtcaggaaggcagcctaccccactgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgtttcgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ922002_PreS1_P-D Feature FT:CDS GQ922002_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 1B3624). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctaccccactgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctctcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ922003_PreS1_P-D Feature FT:CDS GQ922003_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 2B3225). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
caacaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tagggttcaccccaccgcacggaggccttttggggtggagccctcaggctcaaggcataatacaaactttgccagcaaat
ccgcctcctgcctctaccgatcgccagtcaggacggcagcctaccccgctgtctccacctctgagagtcacttatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcacacatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccgggatcatcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtgtacatttaa
>gnl|hbvcds|GQ922004_PreS1_P-D Feature FT:CDS GQ922004_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 2B3284). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
caacaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tagggttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaactttgccagcaaat
ccgcctcctgcctcaaccaatcgacagtcaggacggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctgtgg
nnnnnnnnnnnnnnnnnnnaaaccctgttccgactactgcctctcacacatcgttaatcttctcgaggattggggacctt
gtgcggaacatggagaacatcacatcaggattcctaggacccctgctcgygttacaggcggggtttttcttgttaacaag
aatcctcacaataccgaagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtgtacatttaa
>gnl|hbvcds|GQ922005_PreS1_P-D Feature FT:CDS GQ922005_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 2B2894). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
caacaatcccgattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tagggttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaactttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggacggcagcctaccccgctgtctccacctctgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcacacatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgttgtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcatcgaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcttgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
actttttaccgctgttaccaattttcttttgtctttgggtgtacatttaa
>gnl|hbvcds|GQ924652_PreS1_P-D Feature FT:CDS GQ924652_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate M89). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaatac
cgcaaatccagattgggacttcaatcccaacaaggacccctggccagacgccaacaaggtaggagctggagcattcgggc
tgggactcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgccagtcgggaaggcagcctaccccgctgtctccacctttgagaaacactcatccaca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgaaaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gtgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU357846_PreS1_P-D Feature FT:CDS GU357846_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Y10). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatccttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagccggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgaggaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaatatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctg
cggcgttttatcatcttcctcttcgtcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatctt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggtgcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggagccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU456635_PreS1_P-D Feature FT:CDS GU456635_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T26). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cacaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggctcactacaaaccttaccagcaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacacgcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgaaaagcctttatcttcctgctggtg
gctccagttcaggaacagtaacccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtattacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtgtgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU456636_PreS1_P-D Feature FT:CDS GU456636_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T7). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagatgccaacaaggtaggggctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccatgccagcaaat
ccacctcctgcctctaccaatcgccagtcaggcaggcagcctaccccgctgtctccacctttgagagacactcatcctca
ggctatgcagtggaacaccacaactttccaccaaactctgcaagatcccagagtgagagacctgtatctccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU456637_PreS1_P-D Feature FT:CDS GU456637_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T49). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggggctggagcatttggtc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactctgccagcaaat
ccacctcctgcctctaccaatcgacagtcaggacggcagcctaccccgctgtctccacctttgagaaacactcatcccca
ggccatgcagtggaactccacaacattccaccaaactctgcaagatcccagagtgggaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctaaactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcgtcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacaccatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU456638_PreS1_P-D Feature FT:CDS GU456638_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T35). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttgggatggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggcaggcagcctaccccactgtctccacccttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgaggggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctactcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggaatgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU456639_PreS1_P-D Feature FT:CDS GU456639_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T129). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggcggtcttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggcaggcagcctaccccgctgtctccacctttgagaaacacacatcccca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctcgggggaaccaccgtgtgtcttggcc
aaaattcgcagtgcccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcatgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatatggtattgggggccaaatctgaactgcatcttgagtc
cctttttaccgctgttaccaattttctgttgtctttgggtatacatttaa
>gnl|hbvcds|GU456640_PreS1_P-D Feature FT:CDS GU456640_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T12). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccaattggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggggctggagcattcgggc
tgggattcaccccaccgcacggaggccttttgggatggagccctcaggctcagggcatactgcaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccaaagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcatgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU456641_PreS1_P-D Feature FT:CDS GU456641_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T53). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatattacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacacacatcctca
ggccatgcagtggaactccacaaccttcaaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctccagtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaacctttggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU456643_PreS1_P-D Feature FT:CDS GU456643_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T52). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagcattcagagcaaacac
agcgaatcccgattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgccagtaccaatcgccagtcaggaaggcagcctaccccgctgactccacctttaagagacactcatcctca
ggccatgcagtggaactccacaacctttcatcaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctgggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgaagaatctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcaatttactagtgccatttgttcagtggttcgc
agggctttcccccattgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU456645_PreS1_P-D Feature FT:CDS GU456645_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T80). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctctccaccagcaatccgctgggattctttcccgaccatcagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggggctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactgcaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccggtcaggaagacagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaa
aatcctcacaataccgcagagtctagactcgtggtggacttctctcagttttctaggggaaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaacgaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccattgtttggctttcagttatatggacgatgtggtgttgggggccaaatctgtgtcgcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU456646_PreS1_P-D Feature FT:CDS GU456646_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T77). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
tgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggggctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactgcaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
agccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtgtacatttaa
>gnl|hbvcds|GU456647_PreS1_P-D Feature FT:CDS GU456647_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T130). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggggctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactgcaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcagggaggcagcctaccccgctgtctccacctctgagaaacacgcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU456648_PreS1_P-D Feature FT:CDS GU456648_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T85). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttgggatggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctcyaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU456649_PreS1_P-D Feature FT:CDS GU456649_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T57). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
ctcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggcccagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagtctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgggttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactggtggtggacttctctcaattttttagggggaacccccgtgtgtcttggcc
aaaattcgcagtccccaacttccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctatttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU456650_PreS1_P-D Feature FT:CDS GU456650_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T62). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgatcaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctacaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaatgccgaagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctgattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtgcaacatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU456651_PreS1_P-D Feature FT:CDS GU456651_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T34). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgatcaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcggac
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatattacaaaccttgccagcaaat
ccgcctcctgcctctaccaaccgccagtcaggaaggcagccgaccccgctgtctccacctttgagaaacactcatcctca
agcgatgcagtggaattccacaacattccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcactgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaacaccgtgtgtcttggcc
aaaattcgcagtccccaatctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacttgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacatgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaccatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU456652_PreS1_P-D Feature FT:CDS GU456652_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T44). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcacactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacaccaccttgagtc
catttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU456653_PreS1_P-D Feature FT:CDS GU456653_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T59). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacccctggccagacgccaacaaggtaggagctggagcattcgggc
cgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagagacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaagccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggtccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtatctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcgcgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtaccgcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU456654_PreS1_P-D Feature FT:CDS GU456654_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T39). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
agcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
cgggactcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgccgctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaattccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtgagccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcgtcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtc
cctttttaccgctgttaccaattttcttatgtctttgggtatacatttaa
>gnl|hbvcds|GU456655_PreS1_P-D Feature FT:CDS GU456655_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T95). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
tgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcttctaccaatcgccagtcaggaaggcagcctactcctctgtctccacctttgagagacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtgagccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaatatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU456656_PreS1_P-D Feature FT:CDS GU456656_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T9). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctctccaccagcaatcctctgggattctttcccgaccatcagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagatgccaacaaggtaggagctggagcattcgggc
taggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaagcaggcagcctacccctctgtctccacctttgagagacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtatctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtaccccatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU456657_PreS1_P-D Feature FT:CDS GU456657_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T83). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttccgagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcccacccctctgtctccacctttgagagacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactttgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtatctcccacatcgtcactcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcaaaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtgcaccatcttgagtc
cctatttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU456658_PreS1_P-D Feature FT:CDS GU456658_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T114). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
tgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagcgggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccaccgctgagaaacactcatcctca
ggccatgcagtggaattccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgagtgtcttggcc
aaaattcgcagtgcccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctgattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU456659_PreS1_P-D Feature FT:CDS GU456659_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T24). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgatcaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacttggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggcctgttggggtggagccctcaggctcagggcatactacaaaccttgccaacgaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagagacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatccaagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctcacacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtc
cctttttacagctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU456660_PreS1_P-D Feature FT:CDS GU456660_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T64). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
agcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactgcaaaccttgccaacaaat
ccgcctcctgcctcaaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctcacacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcgaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU456661_PreS1_P-D Feature FT:CDS GU456661_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T99). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcactccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcaacctacccctctgtctccacctttgagagacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctatttttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacatgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU456663_PreS1_P-D Feature FT:CDS GU456663_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T86). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacccctggccagacgccaacaaggtaggagctggagcattcgggc
cgggactcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctacctctaccaatcgccagacaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactctacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU456664_PreS1_P-D Feature FT:CDS GU456664_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T40). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacttggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctccaccaatcgtcagtcaggaaggcagcctacccctctgtctccacctttgagagacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggcttttagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU456665_PreS1_P-D Feature FT:CDS GU456665_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T76). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcaaggcatactacaaaccttgccaacaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctactccactgtctccacctctgagagacactcatcctca
ggctatgcagtggacttccacaactttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatctcctcgaggactggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctggtcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgaagagtctagactcgtggtggacttctctcagttttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacttgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactggtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggttttgggggccaaatctgtgcaacatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU456666_PreS1_P-D Feature FT:CDS GU456666_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T2). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctactcctctgtctccacctttgagagacactcatcctca
ggccatgcagtggaactccaccaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacttgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU456667_PreS1_P-D Feature FT:CDS GU456667_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T120). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctctaccaatcgccagtcaggaagacagcctacccctctgtctccacctttgagaaactctcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacacatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccgggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtc
cctttttaccgctgttaccaattttcttatgtctttgggcatacatttaa
>gnl|hbvcds|GU456668_PreS1_P-D Feature FT:CDS GU456668_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T21). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttccgagcaaacac
tgcaaatccagattgggacttcaatcccaacaaggacacatggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcatctaccaatcgccagtcagggaggcagcctacccctctgtctccacctttgagaaatactcatcctca
agccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctgcagtcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU456669_PreS1_P-D Feature FT:CDS GU456669_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T94). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactgcaaaccttgccaacaaat
ccgcctcctgcctctaccaatcgtcagtcaggaaggcagcctactcctctgtctccacctttgagaaacactcatcctca
agcaatgcagtggaactccacaaccttccaccaaaccctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgtcgagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU456670_PreS1_P-D Feature FT:CDS GU456670_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T27). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
agcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcacaccaccgcacggaggccttttgggatggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctccaccaatcgccagtcagggaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttccggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcactgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU456671_PreS1_P-D Feature FT:CDS GU456671_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T56). Non-functional genomic sequence. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggactcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcttctaccaatcgccagtcaggaagacagcctacccctctgtcttcacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggacctt
gcgcagaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtccgtacagcatcttgaggc
cctttttaccgctgtgaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU456673_PreS1_P-D Feature FT:CDS GU456673_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T75). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccaaacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctccgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaaccttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtattacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtttccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccattgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtaccgcatcttgagtc
cctttttaccgctgttaccaattttcttctgtctttgggtatacatttaa
>gnl|hbvcds|GU456674_PreS1_P-D Feature FT:CDS GU456674_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T16). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggacccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagatgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggtcttttggggtggagccctcaggctcagggcatacttcaaaccttgccaacaaat
ccgcctcctgcctctaccaatcgccagtcaggcaggcagcctacccctctgtctccacctttgagagacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtatcacacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctactcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagaatctagactcgtggtggacttctctcagttttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtatgtcctctaattccaggatcttcaacaaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcatgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU456675_PreS1_P-D Feature FT:CDS GU456675_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T13). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagcccgcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgaccactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtgttgggggccaagtctgtacaccatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU456676_PreS1_P-D Feature FT:CDS GU456676_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T98). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1164 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagcgggagcattcggac
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgactccacctttgagaaacacccatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccggagtgagaggcctccctgctggtggctcca
gttcaggaacagtaaaccctgttccgactactgtctctcacacatcgtcaaccttctcgaggattggggaccttgcgctg
aacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcct
cacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcgtggccaaaatt
cgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgt
tttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgt
ttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctcta
tgtatccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcgga
aaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggct
ttcccccactgtttggcttttagttatatggatgatgtggtattgggggccaaatctgtacagcatcttgagtccctttt
taccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU456677_PreS1_P-D Feature FT:CDS GU456677_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T46). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
tgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaatccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcccacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtatctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaa
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccctttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU456678_PreS1_P-D Feature FT:CDS GU456678_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T97). Complete genome. [Hepadnaviridae] (length=1176 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacttggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctctaccaatcgccagtcagggagacagcctacccctctgtctccacctttgagaaacactcatcctca
agccatgcagtggaactccacaaacttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaagattggggaccct
gcgctgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggctcttctggactgtcaaggtatgtt
gcccgtttgtcctctaactgcagccaacgggtcttcgaccaccagcacggaacagtgcagaacctgcacgactcctgctc
aaggaacctctatgtatctctcctgttgctgtacaaaaccttcgggaggaaattgcacctgtattcccatcccatcatcc
tgggctttcgcaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtg
gttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatct
tgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU456679_PreS1_P-D Feature FT:CDS GU456679_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T63). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacatggccagacgccaacaaggtaggagcgggagcattcgggc
tgggattcacaccacctcacggaggccttttggggtggagccctcaggctcaaggcacactacaaaccttgccaacgaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcccactcctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgaggggcctgtatttccctgctggtg
gctccagttcaggaacagtgaaccctgttccgactactgtctctcacacatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtc
cctttataccgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|GU456680_PreS1_P-D Feature FT:CDS GU456680_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T88). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccacctcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactcaacaaccttccaccaagctctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacacatcgtcaatcttctcgaggattggggaccct
gcgatgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU456681_PreS1_P-D Feature FT:CDS GU456681_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T79). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccacctcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctccggcctctaccaatcgccagtcaggaaggcagccgacccctctgtctccaccgttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgaccactgtctctcacacatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttttagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcatgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU456682_PreS1_P-D Feature FT:CDS GU456682_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T42). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcaaagcaaacac
tgcaaatccagattgggacttcaaccccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcggac
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcttctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacacgcatcctca
ggccatgcagtggaactccacaaccttccaccgaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttaggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggtgttcccccactgtttggcttttagttacatggatgatgtggtattgggggctaaatccgtttcacatcttcagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU456683_PreS1_P-D Feature FT:CDS GU456683_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T101). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcaaagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcgttcggac
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagccaacccctctgtctccacctttgagaaacactcatcctca
agccatgcagtggaactcaacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttgggtcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgttcagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU456684_PreS1_P-D Feature FT:CDS GU456684_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T60). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattccttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagatgccaacaaggtaggagccggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggacggcagcctactcctctgtctccaccgttgagaaacacgcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggactcctaggacccctgctcgtattacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcgtcaaccacaagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaactctgtacaacatcttgaagc
cctttttaccgctgttaccaattttcttttgtctctgggcatacatttaa
>gnl|hbvcds|HM750151_PreS1_P-D Feature FT:CDS HM750151_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GSD-8). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgaaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggcctgttggggtggagccctcaggctcagggcatattacaaactttgccagcaaat
ccgcctcctgtctccaccaatcgccagtcaggaaggcagcctaccccactgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaacttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtgtgtcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM750152_PreS1_P-D Feature FT:CDS HM750152_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate QHN-99). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM750153_PreS1_P-D Feature FT:CDS HM750153_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate XJW-12). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagatgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagcaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaatcttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM750154_PreS1_P-D Feature FT:CDS HM750154_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate XGW-23). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggcgctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcttgttgctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtatcgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM750155_PreS1_P-D Feature FT:CDS HM750155_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GSF-1). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcgtcaaccaccagcacgggtccctgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM750156_PreS1_P-D Feature FT:CDS HM750156_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GSF-12). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactccgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcgtcaaccaccagcacgggtccctgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HQ236014_PreS1_P-D Feature FT:CDS HQ236014_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate RS1). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tggggttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccaacaaat
ccgcctcctgcatccaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaactttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcgcagaacatggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagcctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HQ236015_PreS1_P-D Feature FT:CDS HQ236015_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate RS2). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cacaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tggggttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacacactttgccaacaaat
ccgcctcctgcatccaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacacgcatcctca
ggccatgcagtggaactccaccaccattcaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcgcagaacatggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaacaccgcagagcctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HQ236016_PreS1_P-D Feature FT:CDS HQ236016_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate RS3). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tggggttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacacactttgccaacaaat
ccgcctcctgcatccaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacacgcatcctca
ggccatgcagtggaactccacaactttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcagaaacagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggacctt
gcgcagaacatggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HQ700440_PreS1_P-D Feature FT:CDS HQ700440_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_AD05_1984). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|HQ700441_PreS1_P-D Feature FT:CDS HQ700441_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_AN10_1984). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|HQ700442_PreS1_P-D Feature FT:CDS HQ700442_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_AN12_1984). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccacctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|HQ700443_PreS1_P-D Feature FT:CDS HQ700443_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_AN12_1999). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccacctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|HQ700444_PreS1_P-D Feature FT:CDS HQ700444_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_AN19_1984). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaaaaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaattccacaaccttccaccaaacgctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctacttccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|HQ700445_PreS1_P-D Feature FT:CDS HQ700445_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_BU12_1984). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccatcaaacgctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccaattcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|HQ700446_PreS1_P-D Feature FT:CDS HQ700446_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_BU12_1999). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccatcaaacgctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccaattcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|HQ700447_PreS1_P-D Feature FT:CDS HQ700447_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_CH02_1984). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|HQ700448_PreS1_P-D Feature FT:CDS HQ700448_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_CH02_1999). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcagrattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctamttccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggcsaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|HQ700449_PreS1_P-D Feature FT:CDS HQ700449_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_GE06_1984). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccacctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactcyacaaccttccaccaaackctgcaagatcccagagtgagrggcctgtatttycctgctggtg
gctccagttcaggaacaktaaaccctgttccgactactgyctctcacatatcgtcaatcttctcgaggattggggaccct
gcrctgaacatggagarcaymacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggarctaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|HQ700450_PreS1_P-D Feature FT:CDS HQ700450_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_GE09_1984). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccacctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|HQ700451_PreS1_P-D Feature FT:CDS HQ700451_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_GI11_1984). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccacctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|HQ700453_PreS1_P-D Feature FT:CDS HQ700453_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_HA35_1984). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaaaaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcatatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|HQ700454_PreS1_P-D Feature FT:CDS HQ700454_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_HA53_1984). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
ckcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaacctttggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|HQ700455_PreS1_P-D Feature FT:CDS HQ700455_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_HA53_1999). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaacctttggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttkagtc
cctttttaccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|HQ700458_PreS1_P-D Feature FT:CDS HQ700458_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_HE35_1997). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
caacaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tagggttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcacat
ccgcctcctgcttctaccaatcgccagtcaggacgacagcctaccccgctgtctccacctctgaggaccactcatcctca
ggccatgcagtggaactccacaaccttccatcaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcatcgaccacaagcacgggaccctgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgttgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccacgtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HQ700459_PreS1_P-D Feature FT:CDS HQ700459_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_HE55_1993). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|HQ700463_PreS1_P-D Feature FT:CDS HQ700463_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_HI43_1984). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaaaaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacacgcatcctca
ggccatgcaatggaacgccacaaccttccaccaaacgctgcaagatcccagagtgagaggcctgtatctccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcactgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|HQ700464_PreS1_P-D Feature FT:CDS HQ700464_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_KA40_1984). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|HQ700466_PreS1_P-D Feature FT:CDS HQ700466_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_MI26_1984). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaaaaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|HQ700469_PreS1_P-D Feature FT:CDS HQ700469_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_MO59_1984). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaatactcatcctca
ggccatgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|HQ700470_PreS1_P-D Feature FT:CDS HQ700470_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_MO59_1999). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaatactcatcctca
ggccatgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|HQ700471_PreS1_P-D Feature FT:CDS HQ700471_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_MO70_1984). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaacgttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|HQ700472_PreS1_P-D Feature FT:CDS HQ700472_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_MO77_1997). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccggattgggacttcaatccccacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttctggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccacctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccgcctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccgccaaacgctgcaagatcccagagtgaaaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcgtggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtgtggcttttagttatatggacgatgtggtattgggggccaagtctgtacagcaccttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HQ700473_PreS1_P-D Feature FT:CDS HQ700473_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_PA31_1984). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacmcctggccagacgccaacaaggtaggagctggagcattcgggc
cgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacaccwcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctamttccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctctkggtatacatttaa
>gnl|hbvcds|HQ700474_PreS1_P-D Feature FT:CDS HQ700474_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_PA31_1999). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacccctggccagacgccaacaaggtaggagctggagcattcgggc
cgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctacttccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctcttggtatacatttaa
>gnl|hbvcds|HQ700477_PreS1_P-D Feature FT:CDS HQ700477_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_PE09_1984). Non-functional genomic sequence. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccaytgtttggctttcagttatatggatgatgtggtattgggggccaagwctgtacagcatcttgagtc
cctttttaccgctgtgaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|HQ700478_PreS1_P-D Feature FT:CDS HQ700478_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_PE09_1994). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaaaca
actctatgtatccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|HQ700479_PreS1_P-D Feature FT:CDS HQ700479_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_RA11_1984). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|HQ700480_PreS1_P-D Feature FT:CDS HQ700480_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_RA37_1984). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctatctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtgaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatrgatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|HQ700481_PreS1_P-D Feature FT:CDS HQ700481_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_RA37_1999). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggactcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctatctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagtgaaaggcctgtatttccctgctggtg
gctccagttcaggaacagtgaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtatcaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagwc
cctttttaccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|HQ700482_PreS1_P-D Feature FT:CDS HQ700482_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_TA40_1984). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|HQ700483_PreS1_P-D Feature FT:CDS HQ700483_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_TA120_1984). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagtgagaggcctatatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaaghctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|HQ700484_PreS1_P-D Feature FT:CDS HQ700484_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_TA229_1984). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|HQ700487_PreS1_P-D Feature FT:CDS HQ700487_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_TU25_1984). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccacctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctamttccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|HQ700488_PreS1_P-D Feature FT:CDS HQ700488_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_WA13_1984). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|HQ700510_PreS1_P-D Feature FT:CDS HQ700510_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NC_128225_2003). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaycaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgccagacaggaaggcagcctacaccgctgtctccacctttgagaaacacgcatcctca
ggccatgcagtggaattccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HQ700511_PreS1_P-D Feature FT:CDS HQ700511_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NC_164317_2001). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacatctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccacctcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtgtacatttaa
>gnl|hbvcds|HQ700512_PreS1_P-D Feature FT:CDS HQ700512_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NC_182089_2001). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HQ700513_PreS1_P-D Feature FT:CDS HQ700513_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NC_16600_2001). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggtcttttggggtggagccctcacgctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactactgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HQ700514_PreS1_P-D Feature FT:CDS HQ700514_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NC_1664337_2001). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactactgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HQ700553_PreS1_P-D Feature FT:CDS HQ700553_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_PE09_1999). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccrcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaacgctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcstggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaaaca
actctatgtatccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|HQ833465_PreS1_P-D Feature FT:CDS HQ833465_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Xinjiang HB6). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcaaactacaaaccttgccaacaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtattttcctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactactgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HQ833467_PreS1_P-D Feature FT:CDS HQ833467_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Xinjiang HB27). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcaacctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagaatctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaycaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttctkttgtctttgggtatacatttaa
>gnl|hbvcds|HQ833468_PreS1_P-D Feature FT:CDS HQ833468_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Xinjiang HB52). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagcaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtacaaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HQ833469_PreS1_P-D Feature FT:CDS HQ833469_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Xinjiang HB79). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
kgggaytcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcagactacaaaccttgccaacaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagagacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtcagaggcctgtatctccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgaggc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HQ833470_PreS1_P-D Feature FT:CDS HQ833470_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Xinjiang HB80). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtcagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaataccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HQ833471_PreS1_P-D Feature FT:CDS HQ833471_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Xinjiang HB97). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccmacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JF439692_PreS1_P-D Feature FT:CDS JF439692_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN132). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgccagacaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccgtgcagtggaattccacaaccttccaccaaactctgcaagatcccagagtgaggggcctgtatttccctgctggtg
gctccagttcaggagcagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggactcctaggaccccttctcgcgttacaggcggggtttttcttgttgacaaa
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggcactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtatctg
cggcgttttatcatattccccttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaa
cctctatgtatccctcatgttgctgtatcaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggccttagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JF439693_PreS1_P-D Feature FT:CDS JF439693_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN133). Partial genome (Contains: HBe, HBc, HBx, SHBs, Pol). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaagaacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgccagacaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtgaaattccacaaccttttaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggagcagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaaa
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaa
cctctatgtatccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggccttagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JF439694_PreS1_P-D Feature FT:CDS JF439694_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN134). Partial genome (Contains: HBx, SHBs, Pol). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgccagacaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtgaaattccacaacctttcaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggagcagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaaa
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggcactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtatctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaa
cctctacgtatctctcatgttgctgtatcaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggccttagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JF439695_PreS1_P-D Feature FT:CDS JF439695_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN135). Partial genome (Contains: HBe, HBc, HBx, SHBs, Pol). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaagaacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgccagacaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtgaaattccacaacctttcaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggagcagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaaa
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaa
cctctatgtatccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggccttagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JF439696_PreS1_P-D Feature FT:CDS JF439696_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN136). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgccagacaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccgtgcagtggaattccacaaccttccaccaaactctgcaagatcccagagtgaggggcctgtatttccctgctggtg
gctccagttcaggagcagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gttttgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaaa
aatcctcgcaataccgcagagtctagactcgtggtggacttctctcaattttctagggggcactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaactcgtcctggatatcgctggatgtatctg
cggcgttttatcatattccccttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgct
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaa
cctctatgtatccctcatgttgctgtatcaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggccttagcccgtttctcatggctcagtttactagtgccatttgctcagtggttcgt
agggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JF439699_PreS1_P-D Feature FT:CDS JF439699_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN142). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgccagacaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaattccacaacccttcaccaaactctgcaagatcccagagtgaggggcctgtatttccctgctggtg
gctccagttcaggagcagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaaa
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtatctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaa
cctctatgtatccctcatgttgctgtatcaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggccttagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JF439700_PreS1_P-D Feature FT:CDS JF439700_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN143). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgccagacaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaattccacaacctttcaccaaactctgcaagatcccagagtgaggggcctgtatttccctgctggtg
gctccagttcaggagcagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaaa
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggcactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtatctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactactgctcaaggaa
cctctatgtatccctcatgttgctgtatcaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggccttagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JF439701_PreS1_P-D Feature FT:CDS JF439701_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN144). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgccagacaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaattccacaacctttcaccaaactctgcaagatcccagagtgaggggcctgtatttccctgctggtg
gctccagttcaggagcagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaaa
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggcactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtatctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactactgctcaaggaa
cctctatgtatccctcatgttgctgtatcaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggccttagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JF439702_PreS1_P-D Feature FT:CDS JF439702_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN145). Partial genome (Contains: HBx, SHBs, Pol). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaagaacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgccagacaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtgaaattccacaacctttcaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggagcagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcctgttgacaaa
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaa
cctctatgtatccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggccttagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttctcttgtctttgggtatacatttaa
>gnl|hbvcds|JF439703_PreS1_P-D Feature FT:CDS JF439703_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN146). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgccagacaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccgtgcagtggaattccacaaccttccaccaaactctgcaagatcccagagtgaggggcctgtatttccctgctggtg
gctccagttcaggagcagtaaaccctgttccgactgctgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaaa
aatcctcgcaataccgcagagtctagactcgtggtggacttctctcaattttctagggggcactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtatctg
cggcgttttatcatattccccttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgct
gcccgttcgtcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaa
cctctatgtatccctcatgttgctgtatcaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggccttagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JF439704_PreS1_P-D Feature FT:CDS JF439704_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN149). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgtaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgccagacaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaattccacaacctttcaccaaactctgcaagatcccagagtgaggggcctgtatttccctgctggtg
gctccagttcaggagcagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaaa
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggcactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtatctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaa
cctctatgtatccctcatgttgctgtatcaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggccttagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JF439705_PreS1_P-D Feature FT:CDS JF439705_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN150). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgtaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgccagacaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaattccacaacctttcaccaaactctgcaagatcccagagtgaggggcctgtatttccctgctggtg
gctccagttcaggagcagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaaa
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggcactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtatctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaa
cctctatgtatccctcatgttgctgtatcaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggccttagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JF439706_PreS1_P-D Feature FT:CDS JF439706_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN152). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgtaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgccagacaggaaggcagcctaccccgctgtcttcacctttgagaaacactcatcctca
ggccatgcagtggaattccacaacctttcaccaaactctgcaagatcccagagtgaggggcctgtatttccctgctggtg
gctccagttcaggagcagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggactcctgggaccccttctcgtgttacaggcggggtttttcttgttgacaaa
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggcactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtatctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaa
cctctatgtatccctcatgttgctgtatcaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggccttagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JF439707_PreS1_P-D Feature FT:CDS JF439707_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN153). Partial genome (Contains: HBe, HBc, HBx, SHBs, Pol). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaagcacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggccgtttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgccagacaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtgaaattccacaacctttcaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggagcagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaaa
aatcctcacaataccgcagagtctcgactcgtggtggacttctctcaattttctagggggaactaccgtgtatcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaa
cctctatgtatccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggccttagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JF439708_PreS1_P-D Feature FT:CDS JF439708_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN154). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgtaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgccagacaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaattccacaacctttcaccaaactctgcaagatcccagagtgaggggcctgtatttccctgctggtg
gctccagttcaggagcagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaaa
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggcactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtatctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaa
cctctatgtatccctcatgttgctgtatcaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggccttagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttggatatacatttaa
>gnl|hbvcds|JF439709_PreS1_P-D Feature FT:CDS JF439709_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN155). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgtaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgccagacaggaaggcagcctaccccgctgtctccacctttgagaagcactcatcctca
ggccatgcagtggaattccacaacctttcaccaaactctgcaagatcccagagtgaggggcctgtatttccctgctggtg
gctccagttcaggagcagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaaa
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggcactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtatctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaa
cctctatgtatccctcatgttgctgtatcaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggccttagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JF439710_PreS1_P-D Feature FT:CDS JF439710_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN156). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgtaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgccagacaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaattccacaacctttcaccaaactctgcaagatcccagagtgaggggcctgtatttccctgctggtg
gctccagttcaggagcagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggatcggggaccct
gcgctgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaaa
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggcactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtatctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaa
cctctatgtatccctcatgttgctgtatcaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggccttagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JF439711_PreS1_P-D Feature FT:CDS JF439711_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN157). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgtaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgccagacaggaaggcagcctaccccgctgtcttcacctttgagaaacactcatcctca
ggccatgcagtggaattccacaacctttcaccaaactctgcaagatcccagagtgaggggcctgtatttccctgctggtg
gctccagttcaggagcagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggactcctgggaccccttctcgtgttacaggcggggtttttcttgttgacaaa
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggcactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtatctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaa
cctctatgtatccctcatgttgctgtatcaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggccttagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JF439712_PreS1_P-D Feature FT:CDS JF439712_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN158). Partial genome (Contains: HBe, HBc, HBx, SHBs, Pol). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaagaacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcccccaccaatcgccagacaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtgaaattccacaacctttcaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggagcagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaaa
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaa
cctctatgtatctctcatgttgctgtatcaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggccttagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JF439713_PreS1_P-D Feature FT:CDS JF439713_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN159). Partial genome (Contains: HBx, SHBs, Pol). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgccagacaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaattccacaacctttcaccaaactctgcaagatcccagagtgaggggcctgtagttccctgctggtg
gctccagttcaggagcagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaaa
aatcctcataataccgcagagtctagactcgtggtggacttctctcaattttctagagggcactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtactccaacttgtcctggatatcgctggatgtatctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaa
cctctatgtatcccccatgttgctgtatcaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggccttagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggttttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JF439715_PreS1_P-D Feature FT:CDS JF439715_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN163). Partial genome (Contains: HBe, HBc, HBx, SHBs). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaagaacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgccagacaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtgaaattccacaacctttcaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctgatg
gctccagttcaggagtagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaaa
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaa
cctctatgtatccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggccttagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JF439716_PreS1_P-D Feature FT:CDS JF439716_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN164). Partial genome (Contains: HBe, HBc, HBx, SHBs, Pol). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaagaacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgccagacaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtgaaattccacaacctttcaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggagcagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaaa
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaa
cctctatgtatccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggccttagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JF439717_PreS1_P-D Feature FT:CDS JF439717_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN166). Partial genome (Contains: HBe, HBc, HBx, SHBs, Pol). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggaactggagcattcgggc
tgggtttcaccccaccgcacggaagccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgccagacaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtgaaattccacaacctttcaccaaactctgcaagatcccagagtgaggggcctgtatttccctgctggtg
gctccagttcaggagcagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttaccggcggggtttttcttgttgacaaa
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtatctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagtacgggaccatgccgaacctgcatgactactgctcaaggaa
cctctatgtatccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggccttagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JF439718_PreS1_P-D Feature FT:CDS JF439718_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN167). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgccagacaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaattccacaacctttcaccaaactctgcaagatcccagagtgaggggcctgtatttccctgctggtg
gctccagttcaggagcagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaaa
aatcctcacaataccgcagaatctagactcgtggtggacttctctcaattttctagggggcactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtatctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaa
cctctatgtatccctcatgttgctgtatcaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggccttagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JF439719_PreS1_P-D Feature FT:CDS JF439719_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN172). Partial genome (Contains: HBe, HBc, HBx, SHBs, Pol). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgccagacaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtgaaattccacaacctttcaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggagcagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gctctgaacatggagaacatcacatcaggactcctaagaccccttctcgtgttaccggcggggtttttcttgttgacaaa
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgccctccaacttgtcctggatatcgctggatgtatctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaa
cctctatgtatccctcatgttgctgtatcaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggccttagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JF754588_PreS1_P-D Feature FT:CDS JF754588_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK61). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgatcaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagcgggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcgcactacaaaccttgccagcaaat
ccgcctcctgcttctaccaatcgtcagtcaggaaggcagcctactcctctgtctccgcctttgagaaacactcatcctca
ggctatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatctactcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtattggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtccaatgattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgacccctgctcaaggaa
cctctatgtatccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccctttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtgtcgcatcttgagtc
cctttataccgctgttaccaattttctgttgtctttgggtatacatttaa
>gnl|hbvcds|JF754590_PreS1_P-D Feature FT:CDS JF754590_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK41). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccacctcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctccggcctctaccaatcgccagtcaggaaggcaacctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagaccccagagtgaggggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgaccactgtctctcatatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcgcaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JF754591_PreS1_P-D Feature FT:CDS JF754591_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK38). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgcacaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JF754592_PreS1_P-D Feature FT:CDS JF754592_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK64). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcggac
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactccaaaccttgccagcaaat
ccgcctcctgcttctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaattccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtatctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcttaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccctgccggacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF754593_PreS1_P-D Feature FT:CDS JF754593_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK170). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcggac
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctgccaatcgccagtcaggaaggcagcctacccctctgtctccaccactgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccatcaaactctccaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagcttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JF754594_PreS1_P-D Feature FT:CDS JF754594_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK165). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacttggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccacctcacggaggccttttggggtggagccctcaagctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagccgacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaattccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaagccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JF754595_PreS1_P-D Feature FT:CDS JF754595_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK164). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacyaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JF754596_PreS1_P-D Feature FT:CDS JF754596_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK106). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcggac
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacacccatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JF754597_PreS1_P-D Feature FT:CDS JF754597_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK105). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagtcctcaggctcagggcataatacaaaacttgccagcgaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaattccacaacgttccatcaaactctgcaagatcccagggtgagaggcctgtatctccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttctactggactatcagggtatgtt
gcccgtgtgtcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JF754598_PreS1_P-D Feature FT:CDS JF754598_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK104). Non-functional genomic sequence. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggactcaccccaccgcacggaggccttttggggtggagccctcaagctcagggcatactacaaaccttgccagcaaat
ccgcctccggcctctaccaatcgccagtcaggaaggcagccgacccctctgtctccacctttgagagacactcatcctca
ggccatgcagtggaattccacaaccttccaccaaactctgcaagatcccagagtgagagacctgtatcaacctgctggtg
gctccagttcagaaacagtgaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcgtggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatctgcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcatgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agagctttcccccattgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacagcatcttgattc
cctttttaccgctgtaaccaattttcttttgtctctgggtatacagttaa
>gnl|hbvcds|JF754599_PreS1_P-D Feature FT:CDS JF754599_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK173). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatctccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaagattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactcccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcgtcaaccaccagcacgggaccatgcagaacctgcacgactactgctcaaggaa
cctctatgtatccatcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgg
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacagcatcttgagtc
cctttataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF754600_PreS1_P-D Feature FT:CDS JF754600_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK91). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagatgcaaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgtcaatcaggaaggcagcctacccccctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaattccacaactttccaccaaactctgcaagatcccagagtgaggggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctkctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcgtcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JF754601_PreS1_P-D Feature FT:CDS JF754601_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK88). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcactgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaacctttggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
aaggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JF754602_PreS1_P-D Feature FT:CDS JF754602_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK83). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgatcaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagatgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttgggatggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccacctcctgcctctaccaatcgccagtcaggacggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatacagtggaactccacaatcttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctaatcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JF754603_PreS1_P-D Feature FT:CDS JF754603_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK8). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccacaagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
tgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcacccctccgcacggaggccttttaggatggagccctcaggctcagggcatactacaaaccctgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccctgcagtggaactccacaaccttccacaacactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcgtcaacaaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaccaccttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JF754604_PreS1_P-D Feature FT:CDS JF754604_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK79). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctctgagaaacacgcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JF754605_PreS1_P-D Feature FT:CDS JF754605_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK77). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=1161 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagcattcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcctacgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagagacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggccctgctggtggctccagtt
caggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgtgctgaac
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgaagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgt
atccctcttgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtaccgcatcttgagtccctttttac
cgctgttaccaattttcttttgtctgtgggtatacatttaa
>gnl|hbvcds|JF754606_PreS1_P-D Feature FT:CDS JF754606_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK73). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1164 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcaaagcaaacac
cgcaaacccagattgggatttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
cgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagagacacgcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctccctgctggtggctcca
gttcaggaacagtaaaccctgttccgactactgtctctcacacatcgtcaatcttctcgaggattggggaccctgcgatg
aacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcct
cacaataccgaagagtctagactcgtggtggacttctctcaattttctagggggaacgaccgtgtgtcttggccaaaatt
cgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgt
tttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgt
ttgtcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctcta
tgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgga
aaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggct
ttcccccactgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctttt
taccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JF754607_PreS1_P-D Feature FT:CDS JF754607_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK67). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgcaaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcttctaccaatcgccagtcaggaagacagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctactcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JF754609_PreS1_P-D Feature FT:CDS JF754609_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK45). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggatttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcacaccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctactcctctgtctccacctttgagagacactcatcctca
agccatgcagtggaactccacaaccttccatcaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtcaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcgtcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgactc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JF754610_PreS1_P-D Feature FT:CDS JF754610_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK157). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggggctggagcattcgggc
tgggattcaccccaccgcacggaggtcttttggggtggagccctcaggctcaaggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagaaacacccatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccggagtgagaggcctgcatcacactgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcatgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccattgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JF754611_PreS1_P-D Feature FT:CDS JF754611_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK152). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctcccaatcgcaagacaagcaggcagcctaccccgctgtctccacctttgagagacactcatcctca
ggccatgcagtggaattccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggacctt
gtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgaagagtctagactcgtggtggacttctctcaattttctagggggaamcaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcarggtatgtt
gcccgtttgtcctctaattccaggatcttcgactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaacctttggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgt
aggtctttcccccattgtatggctttcagttatatggatgatgtggtattgggggccaagtctgcayagcatcttgagtc
ccttgttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JF754612_PreS1_P-D Feature FT:CDS JF754612_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK148). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacccctggccagacgccaacaaggtaggagctggagcattcgggc
cgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccaacaaat
ccgcctcctgcttctaccaatcgccagtcgggaaggcagcctacccctctgtctccacctttgagagacacccatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctgattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaccaccttgagtc
cctttacaccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF754614_PreS1_P-D Feature FT:CDS JF754614_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK6). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
cgggattcacaccaccgcacggaggccttttggggtggagccctcaggctcagggcataatgcaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgaraggcctgtattcccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgaatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JF754615_PreS1_P-D Feature FT:CDS JF754615_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK141). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcaaagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttgggatggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgggaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JF754617_PreS1_P-D Feature FT:CDS JF754617_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK131). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
tgcaaatccagattgggacttcaatcccaacaaagacacttggccagacgccaacaaggtaggagctggagcattcggga
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccgcctttgagggacacccatcctca
ggctatgcagtggaacaccataaacttccatcaaactctgcaagatcccagagtgagaggcctatatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacgcatcgtcaatcttatcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcagttttctaggggggactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtatctg
cggcgttttatcatctgcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtgcagcatcttgagtc
cctttttaccgctgttaccaattttcttatgtctctgggtatacatttaa
>gnl|hbvcds|JF754618_PreS1_P-D Feature FT:CDS JF754618_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK129). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcaaagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggccttagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JF754619_PreS1_P-D Feature FT:CDS JF754619_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK62). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactgcaaaccttgccagcaaat
ccgcctcctgcttctaccaatcgacagtcaggaaggcagcctacccctctgactccacctttgagagacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgccgaacatgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtacaaaaccttcggacggaaattgcacatgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccattgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctgtgggtatacatttaa
>gnl|hbvcds|JF754621_PreS1_P-D Feature FT:CDS JF754621_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK161). Non-functional genomic sequence. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tggggttcaccccaccgcacggaggccttttggggtggagccctcaagctcagggcataatgcaaaccctgccagcaaat
ccgcctcctgcatctaccactcgccagtcaggaagacagcctacaccactgtctccacctttgagagacactcatcctca
ggccatgcagtggaactccacaactttccaccaaagtctgcaagatcccagggtgaaaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactastgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtc
cctttttaccgctgtgaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JF754623_PreS1_P-D Feature FT:CDS JF754623_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK171). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgaatctccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaagattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcgtcaaccaccagcacgggaccatgcagaacctgcacgactactgctcaaggaa
cctctatgtatccatcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgg
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacagcatcttgagtc
cctttataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF754624_PreS1_P-D Feature FT:CDS JF754624_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK28). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JF754626_PreS1_P-D Feature FT:CDS JF754626_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK23). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcaaagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgccactaccaatcgccggtcaggaaggcagcctacccctctgtctccacctttgagagacactcatcctca
ggctatccagtggaactccagaaacttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacacatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggactaccgtgtgtcttggcc
gaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|JF754627_PreS1_P-D Feature FT:CDS JF754627_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK37). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcaaagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttgggttggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctactcctctgtctccacctttgagaaacactcatcctca
ggccatgtactggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctatatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JF754628_PreS1_P-D Feature FT:CDS JF754628_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK32). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcaaagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggcattttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JF754629_PreS1_P-D Feature FT:CDS JF754629_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK176). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccacctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagagacactcatcctca
ggccatgcagtggaactcaacaaccttccatcaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgatgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcttgctcaaggaa
cctctatgtatccctcctgttgttgtatcaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcgcaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggcattcccccactgcttggcttttagctatatggatgatgtggtattgggggccaagtctgcttcgcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JF754630_PreS1_P-D Feature FT:CDS JF754630_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK175). Non-functional genomic sequence. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccatcagcaatcctctgggattcttccccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacccctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctaccccgccaactccacctttgagaaacactcatcctca
agccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcttgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaatgccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtgtggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacaccttgattc
cctttttaccgctgttaccaattttcttttgtctttaggtatacatttaa
>gnl|hbvcds|JF754631_PreS1_P-D Feature FT:CDS JF754631_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK193). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagcattcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcctacgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagccaagaaggcagcctacccctcagtctccacctttgagagacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatattgtcaatcttctcgaggattggggaccct
gcgctgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgggtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcttgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggtgcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcaccttgagtc
cctttatactgctgtttccaattttcttatgtctgtgggtatacatttaa
>gnl|hbvcds|JF754632_PreS1_P-D Feature FT:CDS JF754632_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK186). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggacccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgtcagtcaggaaggcagcctaccccgctgtctccgcctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctatatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcatcaatcttcttgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaa
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgtt
gcccgtttgtcctctaattccaggatcctcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagcgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaccatcttgagtc
cctttataccgctgttaccaattttcttgtgtctttgggtatacatttaa
>gnl|hbvcds|JF754633_PreS1_P-D Feature FT:CDS JF754633_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK128). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggggctggagcattcgggc
tgggactcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaagaaagcctaccccgctgtctccacctttgagagacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|JF754634_PreS1_P-D Feature FT:CDS JF754634_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK12). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacttggccagatgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctccaccaatcgtcagtcaggaaggcagcccactcctctgtctccacctttgagagacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatccaagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaatrccgaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcgaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgttcagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF754635_PreS1_P-D Feature FT:CDS JF754635_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK113). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacttggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggcggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagagacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtattttcctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggactcctaggacccctactcgtgttacaggcggggtttttcttgttgacaca
agtcctcacaataccgcagagtctagactcgtggtggacttctctcagttttttagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctgtgggtatacatttaa
>gnl|hbvcds|JN040750_PreS1_P-D Feature FT:CDS JN040750_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919078). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacccttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatctccatgctggtg
gctccagttcagaaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaacaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcatgggatcatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN040751_PreS1_P-D Feature FT:CDS JN040751_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919047). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccacctcacggaggccttttggggtggagccctcaagctcagggcatactacaaaccttgccagcacat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatctccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacacatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgaagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactattgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN040753_PreS1_P-D Feature FT:CDS JN040753_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919064). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
cgggattcaccccgccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcttccaccaggcgccagacaggaaggcagcctacccctctgactccacctttgagagacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaaaatcccagagtgaaaggcctgtatatccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcaaaacctgcacgactcctgctcaaggaa
cctctatgaatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccattgtttggctttcagttatatcgatgatgtggtattgggggccaagtctgtacagcaccttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN040755_PreS1_P-D Feature FT:CDS JN040755_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919086). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattccttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggtcttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcttctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctctgagaaacactcatcctca
ggccatgcagtggaattccacaacattccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcaaaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatccccaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgc
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN040757_PreS1_P-D Feature FT:CDS JN040757_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919056). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtccggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaactttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcactgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgacccctgctcaaggaa
cctctatgtatccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgttgtattgggggccaagtctgtacaccatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|JN040758_PreS1_P-D Feature FT:CDS JN040758_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919037). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcggac
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgggaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctgggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactggtggtggacttctctcaattttctagggggaactaccgtgtgtcgtggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcatgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN040759_PreS1_P-D Feature FT:CDS JN040759_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919063). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtattttcctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatccggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgttggatgtgtctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN040761_PreS1_P-D Feature FT:CDS JN040761_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919002). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
agcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttcaaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgttgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacctgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN040762_PreS1_P-D Feature FT:CDS JN040762_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919007). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
agcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcttctaccaatcgccagtcaggaaggcaacctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagcaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaa
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtgttgggggccaagactgagcagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN040765_PreS1_P-D Feature FT:CDS JN040765_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919006). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcggac
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcttctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagagacacgcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtacttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN040766_PreS1_P-D Feature FT:CDS JN040766_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919046). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacttggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagcccgcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgaggggcctgtatctccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcgcatatcgtcaatcttctcgaggattggggaccct
gctctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactatcgaggtatgtt
gcccgtttgtcctctacttccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgttcctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN040767_PreS1_P-D Feature FT:CDS JN040767_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919019). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagagacacgcatcctca
ggccatgcagtggaactccacaacattccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctggacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN040768_PreS1_P-D Feature FT:CDS JN040768_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919051). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
tgcaaatccagattgggacttcaatcccaacaaggacaactggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctttatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggacctt
gcgccgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaatacctcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacttccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgt
actggtttcccccactgtttggcttttagttatatggatgatgtggtattgggggcgaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN040769_PreS1_P-D Feature FT:CDS JN040769_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919015). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggggctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcaaggcatactgcaaaccttgccagcaaat
tcgcctcctgcctccaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccaaagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatccggactcctaggacccctgctcgggttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctcaaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccctttgttcagtggttcgt
agggctttcccccactgcatggcttttagttatatggatgatgtggtattgggggccaagtctgtgcagcatcttgagtc
gctttttaccgctgttactaactttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN040770_PreS1_P-D Feature FT:CDS JN040770_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919087). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcggtc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaacttcacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN040771_PreS1_P-D Feature FT:CDS JN040771_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919013). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccacccgacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagaaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctactcctctgtctccaccgttgagaaacacgcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaatagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggcttttagttatatggatgatgtggtattgggggccaaatctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|JN040773_PreS1_P-D Feature FT:CDS JN040773_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919084). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagcctgcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccgcaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaaccttctcgaggattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggacccctactcgtgttacaggcggggtctttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcgtggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccattgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN040774_PreS1_P-D Feature FT:CDS JN040774_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919088). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcaaagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagatgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcaacctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaactttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggcttttagttatatggatgatgtggtattgggggcgaagtctgttcagcatcttgagtc
cctttataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN040775_PreS1_P-D Feature FT:CDS JN040775_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919049). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggactcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagaaaat
ccgcctcctgcctccaccaatcgccagtcaggcaggcagcctacccctctgtctccacctttgagaaacacgcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatctccctgctggtg
gctccagttcaggaacagtaaaccctgttccgaatactgtctctcccatatcgtcaatcttctcgaggattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtgctggttatcgctggatgtatctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggattgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatgtggatgatttggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN040777_PreS1_P-D Feature FT:CDS JN040777_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919017). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgccgctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaaaca
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN040778_PreS1_P-D Feature FT:CDS JN040778_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919038). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
tgcaaatccagattgggacttcaatcccaacaaggacacctggccagatgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggcggccttttgggatggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccggagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgttgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN040779_PreS1_P-D Feature FT:CDS JN040779_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919070). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccacctcacggaggccttttggggtggagccctcaggctcagggcacactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgtcagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaattccacaaccttccaccaaactctgcaagatcccagagtgacaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtatctcacatatcgtcaatcttctcgaggattggggaccct
gcgatgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtctttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccagggtatgtt
gcccgtatgtcctctacttccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgaatc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN040781_PreS1_P-D Feature FT:CDS JN040781_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919029). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagatgccaacaaggtaggagctggagcattcgggc
tggggttcaccccacctcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN040782_PreS1_P-D Feature FT:CDS JN040782_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919041). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
tgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagcgggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaattccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgaatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcgcatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacaacacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggttgacttctctcagttttctaggggagaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggcttttagttatatggatgatgtggtattgggggcgaagtctgtacagcatcttgagtc
cctttataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN040783_PreS1_P-D Feature FT:CDS JN040783_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919090). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttgggggggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaacaccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN040784_PreS1_P-D Feature FT:CDS JN040784_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919030). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggcgcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaaaatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgaagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccctaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcatgggct
ttcggaaaattcctatgggattgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN040785_PreS1_P-D Feature FT:CDS JN040785_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919022). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaacctgccagaaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN040786_PreS1_P-D Feature FT:CDS JN040786_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919035). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagctttcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgaagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccctaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcgaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggatcatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN040787_PreS1_P-D Feature FT:CDS JN040787_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919040). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagctttcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaatactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaatagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgaagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcgaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggatcatgcagaacctgcacgactcctgctcaaggaa
cctctatgactccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN040788_PreS1_P-D Feature FT:CDS JN040788_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919024). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagctttcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgaggggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgaagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcgaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggatcatgcagaacctgcacgactcctgctcgaggaa
cctctatgtctccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacagttaa
>gnl|hbvcds|JN040790_PreS1_P-D Feature FT:CDS JN040790_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919054). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcggac
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatctccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggcccct
gcgctgaacatggaaaacatcacatcaggattcctaggacccctgctcgagttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagaatctagactcgtggtggacttctctcaattttctagggggaaataccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccatcttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcaatttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN040791_PreS1_P-D Feature FT:CDS JN040791_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919082). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagatgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaacttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtatctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN040792_PreS1_P-D Feature FT:CDS JN040792_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919079). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgaggggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN040793_PreS1_P-D Feature FT:CDS JN040793_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919083). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacttggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctcgaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacacgcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagagacctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcactgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaa
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcgtggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccattgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttctgtctttgggtatacatttaa
>gnl|hbvcds|JN040794_PreS1_P-D Feature FT:CDS JN040794_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919075). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactcaacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttccggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN040795_PreS1_P-D Feature FT:CDS JN040795_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919003). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctctccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagccgaccccgctgtctccacctttgagaaccactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtattttcctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccacatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggcttttagttatatggatgatatggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN040796_PreS1_P-D Feature FT:CDS JN040796_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919018). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaactttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN040797_PreS1_P-D Feature FT:CDS JN040797_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919021). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccaaagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN040799_PreS1_P-D Feature FT:CDS JN040799_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919080). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggatttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagagacactcatcctca
ggccatgcagtggaactccaaaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctactcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggaaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctatttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN040800_PreS1_P-D Feature FT:CDS JN040800_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919012). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtattacaggcggggtttttcttgttgacaag
aatcctcacaacaccgaagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactactgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtgttgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN040801_PreS1_P-D Feature FT:CDS JN040801_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919042). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgccactaccaatcgccagtcaggaaggcagcctactccgctgactccacctttgagagacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcagaaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaacaccgaagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactactgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN040802_PreS1_P-D Feature FT:CDS JN040802_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919074). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
tgcaaatccagattgggacttcaatcccaacaaggacgcctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaccactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagtacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaacctttggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtc
cctttataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN040804_PreS1_P-D Feature FT:CDS JN040804_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919028). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=1167 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagcgggagcattcgggc
tgggattcaccccaccgcacggaggacttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagagacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttcgcgaggattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggaactaccgtgtgtcttggcc
aaaattcgcggtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgtt
gcccgtttgtcctctaattccagcttcaaataccagcacgggaccatgcagaacctgcacgactactgctcaaggaacct
ctacgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttc
ggaaaattcctatgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcagg
gctttcccccattgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacagcatcttgagtccct
ttttaccgctgttaccaattttcttatgtctttgggtatacatttaa
>gnl|hbvcds|JN040805_PreS1_P-D Feature FT:CDS JN040805_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919058). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagacttcagagcaaacac
agcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctacaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactattgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN040806_PreS1_P-D Feature FT:CDS JN040806_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919066). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacacacatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcactgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN040807_PreS1_P-D Feature FT:CDS JN040807_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919034). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcacaccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctggggt
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN040808_PreS1_P-D Feature FT:CDS JN040808_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919011). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggggctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactgcaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccgcaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagaatctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtgcccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttgggtcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|JN040809_PreS1_P-D Feature FT:CDS JN040809_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919014). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggggctggagctttcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactgcaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacacgcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgcatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtatgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccctttgttcaatggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaggc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN040810_PreS1_P-D Feature FT:CDS JN040810_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919060). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcatggaggccttctggggtggagccctcaggctcagggcatattacaaactttgccagcaaat
ccgcctcctgcctcgaccaatcgccagtcaggaagggagcctaccccgctgactccacctttgagagacactcatcctca
gtccatgcagtggaactccacaaccttccaccaaactctacaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgatgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttctatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgctgctgtacaaaacctttggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN040811_PreS1_P-D Feature FT:CDS JN040811_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919048). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaactttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccggatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaatacagcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN040812_PreS1_P-D Feature FT:CDS JN040812_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919027). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacatggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaatgccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtatctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaacaaccagcacgggaccatgcagaacttgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtatcgcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN040813_PreS1_P-D Feature FT:CDS JN040813_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919025). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaaccccaacaaggacacctggccagatgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaaccctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcgtggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN040814_PreS1_P-D Feature FT:CDS JN040814_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919032). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagcccgcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaacattccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaagattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggggtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN040815_PreS1_P-D Feature FT:CDS JN040815_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919073). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaaaac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtattttcctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtatctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtatcaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
gctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN040818_PreS1_P-D Feature FT:CDS JN040818_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919081). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagtgggatccagccttcagagcaaacac
agcaaacccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcattctacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggcaggcagcctaccccgctgtctccgcctttgaggaacactcatcctca
agccatgcagtggaactcaacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtacttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gtgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaa
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgtt
gcccgtttgtcctctaattccaggatcgtcaacaaccagcacgggaccatgcaggacctgcaccactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaaatctgttcaccatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN040819_PreS1_P-D Feature FT:CDS JN040819_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919067). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cacaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcatgcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccaccgtctccacctttgagaaacacacatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccacattgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccattgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtattcatttaa
>gnl|hbvcds|JN040820_PreS1_P-D Feature FT:CDS JN040820_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919010). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcaaagcaaacac
cgcaaacccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaattccacaaccttccaccaaactctgcaagatcccagagtaagaggcctgtatctccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcgtcaactaccagcacgggaccatgcagaacctgcacgactcttgctcaaggaa
cctctatgtatccctcctgttgctgtatcaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggactgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccattgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN040821_PreS1_P-D Feature FT:CDS JN040821_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919085). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcacactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagacaggaaggcagccgaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaacaccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaatctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN040822_PreS1_P-D Feature FT:CDS JN040822_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919044). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggactcaccccaccgcacggaggcctgttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagagacctgtatttccctgttggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaacaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccgacttgtcctgggtatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcgaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcatggctcagttttctagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagactgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttgtgtctttgggtatacatttaa
>gnl|hbvcds|JN040823_PreS1_P-D Feature FT:CDS JN040823_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919005). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagaaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctccgtctccacctttgagaaacacgcaccctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtatctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN040824_PreS1_P-D Feature FT:CDS JN040824_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919071). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacttggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtg
gctccagttcaggaacagtgaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggaaaacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaacaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN040826_PreS1_P-D Feature FT:CDS JN040826_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919055). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaaccctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggggctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaacattccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacacatcgtcaatcttctcgaggattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN040827_PreS1_P-D Feature FT:CDS JN040827_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919008). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaagacagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacattaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgcccgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgacgcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN040828_PreS1_P-D Feature FT:CDS JN040828_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919069). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggggctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactgcaaaccttgccagcaaat
ccgcctcctgcctctaccaatcggcagtcaggaaggcagcctaccccgttgtctccacctttaagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagaatctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN040829_PreS1_P-D Feature FT:CDS JN040829_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919089). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatccgca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtatctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttttagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN040830_PreS1_P-D Feature FT:CDS JN040830_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919052). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgatcaccagttggatccagccttcagagcaaatac
cgcaaatccagattgggacttcaatcccaacaaggactcctggccagacgccaacaaggtaggggctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatattacaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaattccacaacatttcaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaagattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacaccatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN257148_PreS1_P-D Feature FT:CDS JN257148_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHAMF). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcacactacaaaccttgccaacaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggacctt
gcactgaacatggagaacatcacatcaggattcctaggacccctgctcgggttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactcccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgatggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgtt
gcccgtttgtcctctaattccaggatcatcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccattgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN257149_PreS1_P-D Feature FT:CDS JN257149_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHSFN). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtyargaaggcagcctaccccgcagtctccacctttgagaracactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgaraggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcaraacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagwctgtacagcatcttgagtc
cctttttaccgctgtwaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN257150_PreS1_P-D Feature FT:CDS JN257150_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHABS). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacccctggccagacgccaacaaggtaggagctggagcattcgggc
cgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagmggcctgwatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccyt
gcgckgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaar
aatcctcacaataccgmagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaycatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN257151_PreS1_P-D Feature FT:CDS JN257151_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHHHR). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccaccgttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgacaactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN257152_PreS1_P-D Feature FT:CDS JN257152_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHRJB). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctatctccacctttgagaaacactcatcctca
ggccatgcagtggagctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccyt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgct
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagwctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN257153_PreS1_P-D Feature FT:CDS JN257153_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHHRS1). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1167 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccacctcacggaggccttttggggtggagccctcaggctcagggcatactacaaacyttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctcwgactccacctctgagrgacactcatcctca
ggcccagtggamywscamarmctttcaccaaactctgcaagatcccagagtgaraggcctgtattyccctgctggtggct
ccagttcaggaacagtaaaccctgttccgactactgyctctcacatatygtcaatcttctcgargaytggggaccttgcg
ccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaat
cctcacaataccgcagagtctagactcgtggtggacttctctcaattttctcgggggaacgaccgtgtgtcttggccaaa
attcgcagtccccaacctgcagtcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcgg
cgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttctgctggactatcaaggtatgttgcc
cgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgacgcctgctcaaggaacct
ctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttc
ggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagg
gctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgyacagcatcttgagtccct
ttttaccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN257155_PreS1_P-D Feature FT:CDS JN257155_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHJHM1). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaacccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccacctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN257159_PreS1_P-D Feature FT:CDS JN257159_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHMRW). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacaactggccagacgccaacaaggtaggagctggagcattcgggc
cgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccgtgccagcaaat
ccacctcctgcctctaccaatcgtcagtcaggaaggcagcctacccctctgactccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtattcccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggaytggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcraggtatgtt
gcccgtttgtcctctamttccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgttyctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccaytgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN257160_PreS1_P-D Feature FT:CDS JN257160_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHATR1). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggm
ygggaytcaccccaccgcacggaggcctkttggggtggagccctcaggctcagggcatactacaaaccttgccagaraat
ccgcctcctgcctcsaccaatcgccagtcaggaaggcaacctacycctctgtctccacctttgagaaacacccatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaaratcccavagtgagaggcctgtatttccctgctggtg
gctccagttcaggracagtaaaccctgttccgactactgtctctcmcatatcgtcaatcttcwcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcttgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccaytgtttggctttyagttatatggatgatgtggtattgggggccaaatctgtacarcatcttgaggc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN257162_PreS1_P-D Feature FT:CDS JN257162_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHSDQ). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccctgccagcaaat
ccgcctcctgcttctaccaatcgccagtcaggaaggcagccbacaccgttgtctccacctttgagaaacactcatcctca
ggccatgcagtggaaytccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgaccactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggrmmcaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcytgtcctccracttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactatcaaggtatgtt
gcccgtytgtcctctaattccaggatcytcaacwaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaastctgtryhgcatcttgagkc
cctttttwccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN257163_PreS1_P-D Feature FT:CDS JN257163_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHAZI). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagcccacaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctatatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatatt
gcccgtttgtcctctacttccaggatcttcaaccaccagcacgggaccatgcaaaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgctgctgtaccaaacctttggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN257165_PreS1_P-D Feature FT:CDS JN257165_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHHLL1). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttktggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcttctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagagacacccatcctca
ggccatgcagtggaactccacaaccttccaccaaactctacaagatcccagagtgaggggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttcagactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggaytcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcgaggtatgtt
gcccgtttgtcctmtgattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccaytgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtwtcgcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN257166_PreS1_P-D Feature FT:CDS JN257166_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHHLL2). Partial genome (Contains: HBe, HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1167 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttktggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcttctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagagacacccatcctca
ggccatgcagtggaactccacaaccttccaccaaactctacaagatcccagagtgaggggcctgtaccttgctggtggct
ccagttcaggaacagtaaaccctgttcagactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcg
ctgaacatggagaacatcacatcaggaytcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaat
cctcacaataccgaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaa
attcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcgg
cgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcgaggtatgttgcc
cgtttgtcctmtgattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacct
ctatgtatccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttc
ggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagg
gctttcccccaytgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtwtcgcatcttgagtccct
ttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN257169_PreS1_P-D Feature FT:CDS JN257169_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHAFF). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaacccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggactcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggagcagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN257170_PreS1_P-D Feature FT:CDS JN257170_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHJWB). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagcccacaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcccacccctctgtctccacctctgagagacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctcgggggaacgaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN257171_PreS1_P-D Feature FT:CDS JN257171_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHKML). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagctttcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN257172_PreS1_P-D Feature FT:CDS JN257172_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHMYD1). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaatac
cgcaaatccagattgggacttcaatcccaacaaggactcctggccagacgccaacaaggtaggagctggagcattcgggc
cgggaytcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacacccatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatctccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcaaggattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgttgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN257176_PreS1_P-D Feature FT:CDS JN257176_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHFRJ1). Complete genome. [Hepadnaviridae] (length=1170 residues).
atgggtcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacamctggccagacgccaacaaggtaggagctggagcattcgggc
ygggaytcaccccaccgcacggaggccttttggggwggagccctcaggctcagggcatactacamaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaracactcatcctca
ggcyatgcagtggaactmcacaaccttccaccaaactctgcaagatcccagagtgagaggcctgwmtttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacayatcgtcaatcttctcgaggattggggaccyt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccracttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcraggtatgtt
gcccgtttgtcctcwamttccarrmtcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccaytgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacmgcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN257177_PreS1_P-D Feature FT:CDS JN257177_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHFRJ2). Complete genome. [Hepadnaviridae] (length=1170 residues).
atgggtcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacamctggccagacgccaacaaggtaggagctggagcattcgggc
ygggaytcaccccaccgcacggaggccttttggggwggagccctcaggctcagggcatactacamaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaracactcatcctca
ggcyatgcagtggaactmcacaaccttccaccaaactctgcaagatcccagagtgagaggcctgwmtttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacayatcgtcaatcttctcgaggattggggaccyt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccracttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcraggtatgtt
gcccgtttgtcctcwamttccarrmtcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccaytgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacmgcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN257179_PreS1_P-D Feature FT:CDS JN257179_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHMJD1). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN257181_PreS1_P-D Feature FT:CDS JN257181_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHNDA). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaaaaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgccagtccggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaattccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaacaaccagcacgggaccatgccggacctgcatgactactgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN257182_PreS1_P-D Feature FT:CDS JN257182_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHMSL). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcgggatttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN257183_PreS1_P-D Feature FT:CDS JN257183_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHKSH). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctccggcctcwaccaatcgccagtcgggaaggcagcccaccccgctgtctccaccgttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatytccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttatcgaggattggggaccyt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgaagagtctagactcgtggtggacttctctcarttttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaartctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN257185_PreS1_P-D Feature FT:CDS JN257185_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHZYD). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN257186_PreS1_P-D Feature FT:CDS JN257186_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHDHM). Complete genome. [Hepadnaviridae] (length=1173 residues).
ggcatggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
caccgcaaacccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcg
ggctgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagca
aatccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccaccgttgagaarcactcatcc
tcaggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatctccctgctg
gtggctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggactggggac
cctgcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgac
aagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttg
gccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggktatcgctggatgtgt
ctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtat
gttgcccgtttgtcctcaaattccaggatcttcaacgaccagcacgggamcatgcagaacctgcacgactcctgctcaag
gaacctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgg
gctttcggaaaattcctatgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggtt
cgcagggctttcccccactgtttggctttcagttatrtggatgatgtggtattgggggccaagtctgtacagcatcttga
gtccctttttaccgctgttaccaattttcttctgtctttgggtatacatttaa
>gnl|hbvcds|JN257188_PreS1_P-D Feature FT:CDS JN257188_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHMLL2). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaacaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacccctggccagacgccaacaaggtaggagctggagcattcgggc
ygggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacmwaccktgccaacaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacmccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgaatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggwccct
gcactgaacatggagaacatcacatcaggrttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaycatgcagaacctgcacgactcctgctcaaggaa
cctctatgtmtccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN257190_PreS1_P-D Feature FT:CDS JN257190_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHYHY). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttctaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cacaaatccagattgggacttcaatcccaacaaggacacatggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcacccctccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagccgaccccgctgtctccacctttgaggaacactcatcctca
ggccatgcagtggaactccacaaccttccatcaaactctgcaagatcccagggtgcgaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggrgtgggcctcagcccgtttctcctggctcagtttactagtgccgtttgttcagtggttcgt
agggctttcccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttctkttgtctttgggtatacatttaa
>gnl|hbvcds|JN257193_PreS1_P-D Feature FT:CDS JN257193_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHRKN1). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
cgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctctgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN257195_PreS1_P-D Feature FT:CDS JN257195_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHHRS2). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1167 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccacctcacggaggccttttggggtggagccctcaggctcagggcatactacaaacyttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctcwgactccacctctgagrgacactcatcctca
ggcccagtggamywscamarmctttcaccaaactctgcaagatcccagagtgaraggcctgtattyccctgctggtggct
ccagttcaggaacagtaaaccctgttccgactactgyctctcacatatygtcaatcttctcgargaytggggaccttgcg
ccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaat
cctcacaataccgcagagtctagactcgtggtggacttctctcaattttctcgggggaacgaccgtgtgtcttggccaaa
attcgcagtccccaacctgcagtcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcgg
cgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttctgctggactatcaaggtatgttgcc
cgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgacgcctgctcaaggaacct
ctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttc
ggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagg
gctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgyacagcatcttgagtccct
ttttaccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN257196_PreS1_P-D Feature FT:CDS JN257196_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHABR1). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
agcaaacccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgttgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaargaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN257199_PreS1_P-D Feature FT:CDS JN257199_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHSOD2). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaacccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaattccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactattgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcttgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN257200_PreS1_P-D Feature FT:CDS JN257200_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHMNM). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggactcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactgcaaaccttgccagcaaat
ccgcctccggcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaacaaactctgcaagatcccagagtgagaggcctgtattcccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
tctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagttcactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN257201_PreS1_P-D Feature FT:CDS JN257201_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHFAD). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcggga
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatgctgcaaaccttgccagcaagt
ccgcctcctgcytctaccartcgccartcaggaaggcagcctaccccgctgtctccacctttgagagacactcatcctca
ggccatgcagtggggctccacaaccttccaccaaactctgcaagatcccaaagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgaagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccacgtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN257202_PreS1_P-D Feature FT:CDS JN257202_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHSLI). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaacccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttagggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccggtcaggaaggcagcctaccccgctgtcgccacctttgagagaaactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccaaagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggacctt
gcgctgaacatggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaacgaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccattgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN257203_PreS1_P-D Feature FT:CDS JN257203_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHJKF). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggaytcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcgaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagttcactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttctgttatctttgggtatacatttaa
>gnl|hbvcds|JN257205_PreS1_P-D Feature FT:CDS JN257205_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHRYD). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaacccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctacctctaccaatcgccagtcaggaaggcagcctaccccgctgactccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaacaaactctgcaagatcccagagtgagaggcctgtatctccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttctgtctttgggtatacatttaa
>gnl|hbvcds|JN257209_PreS1_P-D Feature FT:CDS JN257209_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHAMR2). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctctgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagkc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN370949_PreS1_P-D Feature FT:CDS JN370949_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NYX1). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1165 residues).
gcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcaaagcaaacaccgcaa
atccagactgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggt
ttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcc
tcctgcctccaccaatcgccagtcaggaaggctgcctaccccactgtctccacctttgagaaacactcatcctcaggcca
tgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctcc
agttcaggaacagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgct
gaacatggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcc
tcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaat
tcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcg
ttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccg
tttgtcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctct
atgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcgg
aaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggc
tttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtcccttt
ttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN370950_PreS1_P-D Feature FT:CDS JN370950_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NYX2). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1165 residues).
gcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcaaagcaaacaccgcaa
atccagactgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggt
ttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcc
tcctgcctccaccaatcgccagtcaggaaggctgcctaccccactgtctccacctttgagaaacactcatcctcaggcca
tgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctcc
agttcaggaacagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgct
gaacatggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcc
tcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaat
tcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcg
ttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccg
tttgtcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctct
atgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcgg
aaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggc
tttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtcccttt
ttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN370951_PreS1_P-D Feature FT:CDS JN370951_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NYX3). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1165 residues).
gcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcaaagcaaacaccgcaa
atccagactgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggt
ttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcc
tcctgcctccaccaatcgccagtcaggaaggctgcctaccccactgtctccacctttgagaaacactcatcctcaggcca
tgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctcc
agttcaggaacagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgct
gaacatggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcc
tcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaat
tcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcg
ttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccg
tttgtcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctct
atgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcgg
aaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggc
tttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtcccttt
ttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN370952_PreS1_P-D Feature FT:CDS JN370952_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NYX4). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1165 residues).
gcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcaaagcaaacaccgcaa
atccagactgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggt
ttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcc
tcctgcctccaccaatcgccagtcaggaaggctgcctaccccactgtctccacctttgagaaacactcatcctcaggcca
tgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctcc
agttcaggaacagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgct
gaacatggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcc
tcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaat
tcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcg
ttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccg
tttgtcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctct
atgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcgg
aaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggc
tttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtcccttt
ttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN370953_PreS1_P-D Feature FT:CDS JN370953_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NYX5). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1165 residues).
gcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcaaagcaaacaccgcaa
atccagactgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggt
ttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcc
tcctgcctccaccaatcgccagtcaggaaggctgcctaccccactgtctccacctttgagaaacactcatcctcaggcca
tgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctcc
agttcaggaacagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgct
gaacatggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcc
tcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaat
tcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcg
ttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccg
tttgtcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctct
atgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcgg
aaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggc
tttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtcccttt
ttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN370954_PreS1_P-D Feature FT:CDS JN370954_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NYX7). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1165 residues).
gcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcaaagcaaacaccgcaa
atccagactgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggt
ttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcc
tcctgcctccaccaatcgccagtcaggaaggctgcctaccccactgtctccacctttgagaaacactcatcctcaggcca
tgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctcc
agttcaggaacagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgct
gaacatggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcc
tcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaat
tcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcg
ttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccg
tttgtcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaaactct
atgtttccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcgc
aaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggc
tttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtcccttt
ttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604120_PreS1_P-D Feature FT:CDS JN604120_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 476-6642-7). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaagacaactggccagamgccaacaaggtaggggctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatgatacaaaccttgccagcaaat
ccgcctccggcatctaccaatcgccagtcgggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactttgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggracagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatctcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggcttttagttacatggatgatgtggtattgggggccaagtctgtacagcaccttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggyatacatttaa
>gnl|hbvcds|JN604139_PreS1_P-D Feature FT:CDS JN604139_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 478-7582-0). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctggggttctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacacaccttgccagcaaat
ccgcctcctgcacagaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctctgagagactctcatcctca
ggccgtgcagtggaactctacaaccttccaccaaactctacaaaatcccagggtgaaaggcctgcatccccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattgggggcctt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcagttttctaggggggaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcgcaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagttcagtttgttcagtggttcgt
agggctttcccccactgcttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604152_PreS1_P-D Feature FT:CDS JN604152_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 479-8250-0). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccaattggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcactccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaactttgccagcaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcccacccckctgtctccacctttgagagacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacastaaaccctgttccgactactgcctctccaatattgtcaatcttctcgaagattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgygttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcarttttctaggggggaacaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacmtgcacgaccactgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggykttcccccactgyttggctttcagytatatggatgatgtggtattgggggccaartctgtgcagcaccttgagtc
ccttttyaccgctgttwccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604161_PreS1_P-D Feature FT:CDS JN604161_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 477-1706-4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggactcctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctccatctaccaatcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaactttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcgcgrgaccatgcagaacctgcacgactactgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctmagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgyacagcatcttgagtc
cctttttaccgctgttaccaattttctkttgtctttgggtatacatttaa
>gnl|hbvcds|JN604170_PreS1_P-D Feature FT:CDS JN604170_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 477-9935-1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacttggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgccagacaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaattccacaacctttcaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggagcagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagagcatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgccggacctgcatgactactgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604174_PreS1_P-D Feature FT:CDS JN604174_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 478-0715-4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccaattggatccagccttcagagcaaacac
caacaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tagggttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgccagtcaggacggcagcctaccccgctgtctccacctctgagaaccactcatcctca
ggccatgcagtggaattccacaaccttccaccaaactctacaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggractaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctgattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604175_PreS1_P-D Feature FT:CDS JN604175_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 478-2872-0). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttcmaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
agcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
ygggmwtcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgccwcyaccaatcgccrgwcaggaaggcagcctaccccgctgtctccacctttgagagacackcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagargcctgtatytccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcatctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacyaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcaggacctgcacgactactgttcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaaractgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604189_PreS1_P-D Feature FT:CDS JN604189_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 479-3396-7). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcacaccacctcacggaggcctcttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
cctcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcayatatcgtcaatcttatcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtgtgtcctctaattccaggatcgtcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacarcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtgtacatttaa
>gnl|hbvcds|JN604206_PreS1_P-D Feature FT:CDS JN604206_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 476-5337-5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagatgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcaacctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttatcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604207_PreS1_P-D Feature FT:CDS JN604207_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 476-5625-4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cacaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tggggttcaccccacctcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccacctcctgcctctaccaatcgccagttaggaaggcagcctaccccgctgtctccacctctgagaagcactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaggatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgytggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgacgcctgctcaaggaa
cctctatgtatccctcctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacarcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatytaa
>gnl|hbvcds|JN604238_PreS1_P-D Feature FT:CDS JN604238_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 478-5785-2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctaggattctttcccgaccaccagttggatccagccttcagagcaaacac
tgcaaatccagattgggacttcaatcccaacaaggacacctggccaaacgccaacaaggtaggagcgggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
cctcctcctgcatctaccaatcgccagtcaggaaggcaacctaccccgctgtctccacctttgagaaatactcatcctca
ggccatgcagtggaactccacaactttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaagattggggaccct
gtgcggaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcattttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactactgctcaaggaa
cctctttacatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccctttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttactaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604239_PreS1_P-D Feature FT:CDS JN604239_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 478-5845-4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcacactacaaacyttgccaacaaat
ccgcctcctgcctctaccaatcgycagtcaggaaggcagcctaccccgctgwctccacctytgagagacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcagraacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggacctt
gcacygaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcttggttatcgttggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggawcatcaactaccagcacgggaccatgcagaacytgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacarcatcttgagtc
cctttttacygctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604245_PreS1_P-D Feature FT:CDS JN604245_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 479-0501-5). Partial genome (Contains: HBe, HBc, Pol). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattcttccccgaccaccagttggatccagccttcagagtaaatac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggaacattcgggc
tgggatacaccccaccgcacggaggccttttggggaggactcctcaggctcagggcatactgcaaaccatgtcagcaaat
ccgcctcctgcctctaccaagcgccagacaggaaggcagcctactcctctgtctccacctttgagagacacccatcctca
ggccatgcagtggaactccaaaatcttccaccaaactctgcaagttcccagagtgaaaggcctgtgtttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacacatcgtcaatcttctcgaagattggggaccct
gcgctgaacatggagaacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggaagagccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaaccagcacgactcctgctcaaggaa
cctctatgaatctctcctgttgctgtatcaaaccttcggatggaaattgcacctatattcccatcccatcatcttgggct
ttcgaaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttataccgctgtgaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|JN604250_PreS1_P-D Feature FT:CDS JN604250_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 479-2424-7). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattcttccccgaccaccagttggatccagccttcagagcaaacac
agcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgccagtcgggaaggcagcctaccccactgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctatatttccctgctggtg
gctccagttccggaacagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatccggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatatt
gcccgtttgtcctctacttccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaacctttggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggactgggcctcagcccgtttctcctggctcaagttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggcaaagtctgtaccgcatcttgagtc
cctttttactgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JN604259_PreS1_P-D Feature FT:CDS JN604259_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 477-1538-1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaaa
ccgcctcctgctaccaccactcgccagtcaggaagacagcctaccccgctgtctccgcctttgagagacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctacttccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgcttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604263_PreS1_P-D Feature FT:CDS JN604263_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 478-2854-8). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctctaccaatcgtcagtcaggaaggcagcctacccctctgtctccacctttgagaaacagtcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtagaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604265_PreS1_P-D Feature FT:CDS JN604265_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 480-0137-5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctctccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccgccgcacggaggccttttggggtggagccctcaggctcagggcacactacaaaccttgccaacaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcactgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcatcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604272_PreS1_P-D Feature FT:CDS JN604272_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 476-9621-8). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctaggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgccagacaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaattccacaacctttcaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggagcagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcgttgaacatggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
acccgtttgtcctctaatcccaggatcttcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JN604275_PreS1_P-D Feature FT:CDS JN604275_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 477-1046-4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacttggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccacctcctgcctccacaaatcgccagacaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaattccacaacctttcaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggagcagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtatttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggaacgaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgacaactgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604278_PreS1_P-D Feature FT:CDS JN604278_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 477-2774-0). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacatggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggagcccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccacctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604295_PreS1_P-D Feature FT:CDS JN604295_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 478-5530-1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacccttgagaaacactcatcctca
ggccatgcagtggaactccacaactttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604301_PreS1_P-D Feature FT:CDS JN604301_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 478-7936-9). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacttggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgccagacaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaattccacaacctttcaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggagcagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctawttccaggatcctcaaccaccagcacgggaccatgccggacctgcatgactactgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggrgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604312_PreS1_P-D Feature FT:CDS JN604312_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 479-6369-1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccatcagttggatccagccttcaaagcaaatac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctcaaccaatcgccagtcaggaaggcagcctacccctctctctccaccgttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggggaccct
gcactgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgkgkctg
cggcgttttatcatctgcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604313_PreS1_P-D Feature FT:CDS JN604313_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 479-6792-4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccaattggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccacacggaggccttttggggtggagccctcaggctcagggtatactacaaactctgccagcaaat
ccgcctcctgcctccaccaatcgccagacaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaattccacaacctttcaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggggcagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctgggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604318_PreS1_P-D Feature FT:CDS JN604318_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 480-0665-6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattttttcccgaccaccagttggatccagccttcagagcaaatac
cgcaaatccggattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggccttttggggtggagccctcaggcccaaggcatactacaaactttgccagcaaat
ccgcctcctgcctccaccaatcgacagtcrggaaggcagcctaccccgctgtctccacctttgagagacackcatcctca
agccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatctccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcacttatcatcaatcttctcgaggattggggaccct
gcgctgaatatggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtatttcttgttgacaag
aatcctcacaataccgcagaatctagactcgtggtggacttctctcaattttctagggggractaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatmttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgttcctcttggctcagtttastagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggaygatgtggttttgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN642126_PreS1_P-D Feature FT:CDS JN642126_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb9). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacatggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaac
ccgcctcctgcctctaccaatcgtcagtcaggaaggcagcctacccctctgtctccacctctgagaaacactcatcctca
ggccatgcagtggaactccacaactttccaccaaactctgcaagatcccagagtgagagacctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgagtcttggca
aaaattcgcagtccccaacctccaatcactcacaaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcattttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccattgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN642128_PreS1_P-D Feature FT:CDS JN642128_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb11). Non-functional genomic sequence. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggaacatccgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaggcaat
ccacctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccgcctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaa
aatcctcacaataccgaagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcaaaacctgcacgactcctgcacaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggggtgggtctcagcccgtttctcctggctcaatttactagtgccatttgttcagtggttcgt
agggcttttccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtc
cctttataccgctgtaaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN642129_PreS1_P-D Feature FT:CDS JN642129_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb12). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcattttacaaaccttgccagcaaat
ccgcctccggcctcaaccaatcgccagtcgggaaggcagccaacccctctgtctccacctttgagaaatactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctatatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtatctcacatatcgtcaatcttctcgaggattggggaccct
gcgcggaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtgtgtcctctaattccaggatcttcaacaaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcttgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgaacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN642130_PreS1_P-D Feature FT:CDS JN642130_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb13). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacccttggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcagggacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaagattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN642131_PreS1_P-D Feature FT:CDS JN642131_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb16). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
agcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacagtcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtagaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggagtggggaccct
gcgttgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccggcaagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctcgaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctgattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN642132_PreS1_P-D Feature FT:CDS JN642132_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb18). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacccttggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagagacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgaggggcctgtatttccctgctggtg
gctccagttcaggaacagtgaaccctgttccgaccactgtctctcacatatcgtcaatcttctcgaagattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttctatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgtt
gcccgtgtgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcatgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN642133_PreS1_P-D Feature FT:CDS JN642133_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb21). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcgaatccagattgggacttcaatcccaacaaagacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcacactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcgggaaggcagtctacccctctgtctccacctttgaggaacactcatcctca
ggccgtgcagtggaattccacagccttccaccaaactctgcaagatcccagagtgaagggcctgtattttcctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcgtggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcacctccttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
actcttcgtatccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN642134_PreS1_P-D Feature FT:CDS JN642134_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb22). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggatccttggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccaccgttgagaaacactcatcctca
ggccgtgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtgaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaagattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaacatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccgtcatcatgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtattcatttaa
>gnl|hbvcds|JN642135_PreS1_P-D Feature FT:CDS JN642135_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb24). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttgggatggagccctcaggctcagggcacactacagaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcaacctacccctctgactccacctttgagaatcactcatcctca
caccatgcagtggaattccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgttcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacgaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctgattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccctttgttcaatggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN642136_PreS1_P-D Feature FT:CDS JN642136_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb25). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagcgggagcattcggac
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaattccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaatatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaatctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcttcgaccaccagcacgggaccatgcagaacatgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttatgtctttgggtatacatttaa
>gnl|hbvcds|JN642138_PreS1_P-D Feature FT:CDS JN642138_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb28). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
cgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccaaagtgagaggcctgtatttccctgctggtg
gctccagctcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttgtagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctgtttatcgctggatgtgtctg
cggcattttatcatcatcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtctgtcctctaattccaggatcgacgaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtttccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcactttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JN642140_PreS1_P-D Feature FT:CDS JN642140_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb30). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgatcaccagttggatccagccttcagagcaaacac
cgcaaacccagattgggacttcaatcccaacaaggacacttggccagacgccaacaaggtaggagctggagcattcggac
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactgcaaaccctgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagccgaccccgctatctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctgggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttccacttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcccctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtgttgggggccaagtctggtcagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN642142_PreS1_P-D Feature FT:CDS JN642142_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb32). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagccaacac
agcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctctaagagacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatctcgtcaatcttctcgaggattggggaccct
gtgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtgcagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JN642143_PreS1_P-D Feature FT:CDS JN642143_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb33). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatgatacaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctactccgctgtctccacctttgagagaaactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtatctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaa
cctctatgtatccctcctgttgttgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN642144_PreS1_P-D Feature FT:CDS JN642144_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb34). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagcattcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggcttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcacctaccaatcgccagtcaagaaggcagcctaccccgctgtctccacctttgagaaacactcatcctct
ggccatgcagtggaactccacaacctttcaccaaactctgcaagatcccagggtgagggggctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctagaacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
taaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtc
cctttttaccgctgttaccaattttcttatatctttgggtatacatttaa
>gnl|hbvcds|JN642145_PreS1_P-D Feature FT:CDS JN642145_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb36). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaacccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
cgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaacactgcaagatcccaaagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctggtcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccattgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN642146_PreS1_P-D Feature FT:CDS JN642146_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb38). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcacactacaaaccttgccaacaaat
cagcctcctgcctctaccaaacgccagtcaggaaggcagcctaccccgctgtctccacctttgagagacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagagccctgtatctccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcactgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcatcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN642147_PreS1_P-D Feature FT:CDS JN642147_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb39). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatacttcaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgtcagtcaggaaggcaaccaacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaattccacaaccttccaccaaactctgcaggatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccagggtatgtt
gcccgtttgtcctctaattccaggatcttcgaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgctgttgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN642148_PreS1_P-D Feature FT:CDS JN642148_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb40). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaagacccctggccagacgccaacaaggtaggagctggagcattcgggc
tgggtttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaat
ccgcctcctgcatctaccaatcgccagtcaggaaggcagcctaccccgctgtctccaccactgagagacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctacaagatcccagggtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaatctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtatctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgc
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN642149_PreS1_P-D Feature FT:CDS JN642149_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb41). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaacccagattgggatttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctccaccaatcgccggtcaggaaggcagcctaccccgctgtctccacctttgagagacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatctccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgaagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggcttttagttatatggatgatgtggtcttgggggccaagactgtacagcatcttgagtc
cctttataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN642150_PreS1_P-D Feature FT:CDS JN642150_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb43). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
agcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccgtgccagcaaat
ccgcctcctgcctctaccaatcgccagtcgggaaggcagcctacccctctgtctccacctttgagaaacacgcatcctca
ggccatgcagtggaattccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatcttcctgctggtg
gctccagttcaggaacagtaaaccctgctccgactactgtctctcccatatcgtcaatcttctcgaggattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttgtagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggcttttagttatatggatgatgtggtattgggggccaaatctgtgtcgcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN642151_PreS1_P-D Feature FT:CDS JN642151_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb44). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacccttggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacacctctgtctccacctttgagaaatactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaagattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacagcatcttgagtc
cctttttactgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN642153_PreS1_P-D Feature FT:CDS JN642153_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb47). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggtcagacgccaacaaggtaggagctggagcattcgggc
tgggattcactccaccgcacggcggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagagacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccct
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcatgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccattgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtc
cctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN642154_PreS1_P-D Feature FT:CDS JN642154_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb48). Complete genome. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaacccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
cgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccacctcctgcctccaccaatcgccagtcaggaaggcagcctaccccactgtctccacctttgagagacactcatcctca
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtg
gctccagttcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaaactcctcgacgactggggaccct
gcgatgaacatggagaaaatcatatcagaacacctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtatctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcgaggtatgtt
gcccgtttgtcctctaattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtttccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacagcatcttgactc
cctttttaccgctgttaccaattttctgttatctttgggtatacatttaa
>gnl|hbvcds|JN642155_PreS1_P-D Feature FT:CDS JN642155_PreS1_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb49). Non-functional genomic sequence. [Hepadnaviridae] (length=1170 residues).
atggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctgg
ggccatgcagtggaactccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatctccctgctggtg
gctccagctcaggaacagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggacctt
gcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaag
aatcctcacaataccgaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcc
aaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctg
cggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtt
gcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaa
cctctatgtatccctcctgctgctgtaccaaacctttggacggaaattgcacctgtattcccatcccatcatcctgggct
ttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtgattcgt
agggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtaccgcatcttgagtc
cctttttactgctgttaccaattttcttttgtctttgggtatacatttaa