HBVdb

Dataset for nucleotide sequence PreS2 of genotype C

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
ATGCAGTGGAACTCCAcaACaTTCCACCAAGCTCTGCTAGAtCCCAGAGTGAGGGGCCTaTAcTTTCCTGCTGGTGGCTC
gca  a     t    gc  t  t  t  ga    at    c  a a   acaa  t  c  tcac              
                    c                                      g                    
                    g                                      t                    

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                   *  *                                                         
CAGTTCCGGAACAGTAAACCCTGTTCCGACTACTGCCTCaCCCATATCGTCAATCTTCTCGAGGACTGGGGACCCTGCAC
a     a  g    c  g            c t  t   t    cc  a          t  a  t            g 
              g                                                                 
                                                                                

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *     *   *                **     *  *    *        *            *  *         * 
CGAAcATGGAGAaCACaACATCAGGATTCCTAGGACCCCTGCTCGTGTTACAGGCGGGGTTTTTCTTGTTGACAAGAATC
    t       g   cg                           c           t               a    
    a                                                                           
                                                                                

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*             **  *    *     *       *               **            *            
CTCACAATACCACAGAGTCTAGACTCGTGGTGGACTTCTCTCAATTTTCTAGGGGGAGCACCCACGTGTCCTGGCCAAAA
           g g                             g           a      aga               
                                                                t               
                                                                                

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
             *        *           *           *     *     **    *     *         
---TTcGCAGTCCCCAACCTCCAATCACTCACCAACCTCTTGTCCTCCAAtTTGTCCTGGcTATCGCTGGATGTGTCTGC
     t                       t  t      c        g cc        t     t             
                                                            a                   
                                                                                

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
          **     *        * *         *     * *      *       **  *         *    
GGCGTTTTATCATaTTCCTCTTCATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTGGACTACCAAGGTATGTTG
      c      c                            c      a g       g       t gg         
                                                                                
                                                                                

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   *     *                                                       *              
CCCGTTTGTCCTCTACTTCCAG------GAA---CAT------CAACtACCAGCACGGGaCCATGCAAGACCTGCACGAt
               a              t    ta       g  c  a ct  a  g  c    ga        a c
                                   c           a                               g
                                                                                

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                 *                    *       *                 *     *    *   *
TCCTGCTCAAGGAACCTCTATGTTTCCCTCTTGTTGCTGTACAAAACCTTCGGACGGAAAcTGCACTTGTATTCCCATCC
aa        a c a     c a       a  c                     a    t     c             
                                                                                
                                                                                

       650       660       670       680       690       700       710       720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*                           ***                                                 
CATCATCcTGGGCTTTCGCAAGATTCCTATGGGAGTGGGCCTCAGTCCGTTTCTCCTGGCTCAGTTTACTAGTGCCATTT
    g  t t        t  a                                 a                c       
       a                                               t                        
                                                                                

       730       740       750       760       770       780       790       800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   *              *                    *     *        *     *                   
GTTCAGTGGTTCGTAGGGCTTTCCCCCACTGTTTGGCTTTCAGTTATATGGATGATGTGGTATTGGGGGCCAAGTCTGTA
        a    cc                 c          c  cg t           t        g   a     
                                                                                
                                                                                

       810       820       830       840       850       860    
....:....|....:....|....:....|....:....|....:....|....:....|....
   *     *      *              *        *           *    *      
CAACATCTTGAgTCCCTTTTTACCtCTaTTACCAATTTTCTTTTGTCTTTGGGTATACATTTgA
           ag      a    g  g             gc a   c           c a 
                                                                
                                                                
© 1998-2022Legal notice