HBVdb

Dataset for nucleotide sequence PreS2 of genotype C

[Download (right click)] [Alignment] [Repertoires]

2951 sequence(s)

>gnl|hbvcds|AB014360_PreS2_P-C Feature FT:CDS AB014360_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 01D01HCC). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaa
ttcgcagtccccaacctgcaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacggttcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtgtggctttcagttatatggatgatgtggtattgggggccaagtctgtccaacatcttgagtccctt
tttacctctattaccaattttctgttgtctttgggtatacatttga
>gnl|hbvcds|AB014362_PreS2_P-C Feature FT:CDS AB014362_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 03D03HCC). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggccc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattacccattttcttttatctttgggtatacatttga
>gnl|hbvcds|AB014363_PreS2_P-C Feature FT:CDS AB014363_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 04D04HCC). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctttacctgcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacacatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctaractcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacagttcctgctcaaggaacctc
tatatttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctgttaccaatttccttttgtctttgggtatacatttga
>gnl|hbvcds|AB014364_PreS2_P-C Feature FT:CDS AB014364_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 05D05HCC). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtaaggggcctataccttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcamctc
tatgtttccctcttgttgctgtacaaaaccttcggacggcaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
twtacckctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB014365_PreS2_P-C Feature FT:CDS AB014365_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 01D06HCC). Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgactactgcctcgcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaccacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctaaactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggatcatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaaactc
tacgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtgtggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctt
tttacctctattaccaattttctgttgtctttgggtatacatttga
>gnl|hbvcds|AB014367_PreS2_P-C Feature FT:CDS AB014367_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 08D08HCC). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtaaggggcctatatttccctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatccggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagtacgggaacatgcaggacctgcacgattcctgctcaaggaacctc
tatgtttccctcctgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB014369_PreS2_P-C Feature FT:CDS AB014369_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 10D10HCC). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgctagaccccagagtgcggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacggagtctagactcgtggtggacttctctcaattttctaggggaagcacccamgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttstggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcaatggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB014371_PreS2_P-C Feature FT:CDS AB014371_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 12D12HCC). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgctagaccccagagtgaggggcctataccttcctgctggtggctc
cagttccggaacagcaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccgatttgtcctggctatcgcttgatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctamttccaggaacatcaacaaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB014372_PreS2_P-C Feature FT:CDS AB014372_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 13D13HCC). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatatcttcctgctggtggctc
caattccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaaaaatc
ctcacaataccacagagtctaractcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaaactc
tacgattccctcttgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB014374_PreS2_P-C Feature FT:CDS AB014374_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 15D15HCC). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatctactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB014376_PreS2_P-C Feature FT:CDS AB014376_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 17T02HCC). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaagggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB014377_PreS2_P-C Feature FT:CDS AB014377_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 18T03HCC). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctcgatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcatgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB014378_PreS2_P-C Feature FT:CDS AB014378_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 19Y01HCC). Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaactccaccacattccaccaagctctgttagatcccaaagtgaggggcctatatcttcctgctggtggctc
cagttccggaacagaaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagaggctagactcgtggtggacttctctcaattttctaggggaagcacccaagtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacaggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtcggtacaacatcgtgagtccctt
tttacckctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB014379_PreS2_P-C Feature FT:CDS AB014379_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 20Y02HCC). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcgtggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatyaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaaacacctc
tatgtttccctcttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtgtggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB014380_PreS2_P-C Feature FT:CDS AB014380_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 21Y03HCC). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgctaaaccccagagtaaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
cgcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagtacccaagtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcactaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactrccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcaactc
tatgtttccctcttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctattaccaattttcttatgtctttgggtatacatttga
>gnl|hbvcds|AB014381_PreS2_P-C Feature FT:CDS AB014381_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 22Y04HCC). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccaccaagctctgctacaccccagagtaaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttaccgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB014382_PreS2_P-C Feature FT:CDS AB014382_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 23Y05HCC). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtaaggggcctataccttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatattgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggarcacccaagtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctgggtatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcgaaacacctc
tatatttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB014383_PreS2_P-C Feature FT:CDS AB014383_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 24Y06HCC). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgctagaccccagagtaaggggcctctaccttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
agaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcgtggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcacctc
tatgtttccctcttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB014384_PreS2_P-C Feature FT:CDS AB014384_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 25Y07HCC). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtaaggggcctatacttccctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcgc
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactygtggtggacttctctcaattttctaggggaagcacccaagtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaacwaccagcacgggaccatgcaagacctgcacrattcctgctcaaggcacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB014385_PreS2_P-C Feature FT:CDS AB014385_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 26Y08HCC). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtaaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcactcaagtgtcctggcctaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccgacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcagaacacctc
tatgtttccctcttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccytt
tttacctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB014389_PreS2_P-C Feature FT:CDS AB014389_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 30Y12HCC). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgatagaccccagagtaaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcytccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcacctc
tatgtttccctcttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtgtggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttaccgctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB014391_PreS2_P-C Feature FT:CDS AB014391_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 32Y14HCC). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtaaggggcctatacttccctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcaccaaagtgtcctggccgaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaaacaactc
tatgtttccctcttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctrgctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB014392_PreS2_P-C Feature FT:CDS AB014392_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 33Y15HCC). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgctagaccccaaagtaaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcgcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctaaactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaaacacctc
tatgtttccctcttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB014393_PreS2_P-C Feature FT:CDS AB014393_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 34Y16HCC). Complete genome. [Hepadnaviridae] (length=846 residues).
atccagtggaactccacaacattccaccaagctctgctagaccccagagtaaggggcctataccttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccttgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcacctc
tatgtttccctcttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcattttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtgtggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB014394_PreS2_P-C Feature FT:CDS AB014394_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 35Y17HCC). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaagggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggacttccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB014396_PreS2_P-C Feature FT:CDS AB014396_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 37Y19HCC). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtaaggggcctatatcttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacaacaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaagcacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB014399_PreS2_P-C Feature FT:CDS AB014399_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 40Y22HCC). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtaaggggcctataccttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacataacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggcacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacckctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB026811_PreS2_P-C Feature FT:CDS AB026811_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Recipient 3;97.Feb.). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtaaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB026812_PreS2_P-C Feature FT:CDS AB026812_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Recipient 3;98.May). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtaaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB026813_PreS2_P-C Feature FT:CDS AB026813_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Recipient 3;97.Sep.). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtaaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB026814_PreS2_P-C Feature FT:CDS AB026814_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Donor 3;98.May). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtaaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB026815_PreS2_P-C Feature FT:CDS AB026815_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Recipient 2:full). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB031262_PreS2_P-C Feature FT:CDS AB031262_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV VietA-3). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagaatctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacgtcaaccaccagcatgggaccatgcaagacctgcacaactcctgctctaggaacctc
tatgtttccctcatgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB033550_PreS2_P-C Feature FT:CDS AB033550_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate NDR260). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
agaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacaacaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB033551_PreS2_P-C Feature FT:CDS AB033551_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SK300). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaaccttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagaaccgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttatctttgggtatacatttaa
>gnl|hbvcds|AB033552_PreS2_P-C Feature FT:CDS AB033552_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SK494). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaaccttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttatctttgggtatacatttaa
>gnl|hbvcds|AB033553_PreS2_P-C Feature FT:CDS AB033553_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SK619). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccaccaagctctgttagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacgaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttatctttgggtatacatttaa
>gnl|hbvcds|AB033556_PreS2_P-C Feature FT:CDS AB033556_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate AK66). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaaccttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttatctttgggtatacatttaa
>gnl|hbvcds|AB042282_PreS2_P-C Feature FT:CDS AB042282_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate NSS-1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaaaggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttctatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccctgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacgcaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB042283_PreS2_P-C Feature FT:CDS AB042283_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate NSS-2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaaaggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttctatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccctgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacgcaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB042284_PreS2_P-C Feature FT:CDS AB042284_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate NSS-3). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttctatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacctccactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB042285_PreS2_P-C Feature FT:CDS AB042285_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate NSS-4). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=846 residues).
atgcattggaactccataaaattccaccaaactctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggc
attttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB049610_PreS2_P-C Feature FT:CDS AB049610_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV AN29). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaaactctgctagatcccagagtgaggggcctatatcttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcat
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgtcgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggagcacccacgtgtcgtggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaaaacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgaggccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB050018_PreS2_P-C Feature FT:CDS AB050018_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgctagaccccagagtgcggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB074047_PreS2_P-C Feature FT:CDS AB074047_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-Th11). Complete genome. [Hepadnaviridae] (length=843 residues).
atgtggaattccagcacattccgccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctcaag
ttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaagactggggaccctgcaccga
acatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctc
acaataccacagagtctagactcgtggtggacttctctcaattttctaagggaaatacccgcgtgtcctggccaaaattc
gcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtt
ttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccgaggtatgttgcccgtt
tgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcgaaacatctctat
gtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaa
aattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctt
tcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacaccatcgtgaagcccttttt
accgctgttaccaattttcttttatctttgggcatacatctaa
>gnl|hbvcds|AB074755_PreS2_P-C Feature FT:CDS AB074755_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-Th44). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
aagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB074756_PreS2_P-C Feature FT:CDS AB074756_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-Th55). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
aagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB105173_PreS2_P-C Feature FT:CDS AB105173_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Hawaii 16). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB105174_PreS2_P-C Feature FT:CDS AB105174_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Hawaii 60). Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaactccaccacattccaccaagctctgttagatcccaaagtgaggggcctatatcttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagcctgtacaacatcttgaatccctt
tttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB106895_PreS2_P-C Feature FT:CDS AB106895_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate pHB4-4). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagcggaactccacaacattccaccaaactctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacaacaactaccagcacgggaccatgcaagacctgcacggttcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtgtacatttga
>gnl|hbvcds|AB111114_PreS2_P-C Feature FT:CDS AB111114_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgggttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagaggctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctcaaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctattaccaattttcttgtgtctttgggtatacatttga
>gnl|hbvcds|AB111118_PreS2_P-C Feature FT:CDS AB111118_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccaaagtaaggggcctataccttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaacaaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcacctc
tatgtttccctcttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB111119_PreS2_P-C Feature FT:CDS AB111119_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
gtgcagtggaaatccacaacattccaccaagctctgctagaccccagagtgaggggcctatattttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcaatttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB111120_PreS2_P-C Feature FT:CDS AB111120_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
gtgcagtggaaatccacaacattccaccaagctctgctagaccccagagtaaggggcctataccttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaacaaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcacctc
tatgtttccctcttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagcgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB111121_PreS2_P-C Feature FT:CDS AB111121_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaagggcctatattttcctgctggtggctc
cagttccggaacaataaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB111122_PreS2_P-C Feature FT:CDS AB111122_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaagggcctatattttcctgctggtggctc
cagttccggaacaataaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgttggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccacactgtttggctttcagttatatcgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB111123_PreS2_P-C Feature FT:CDS AB111123_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaagggcctatattttcctgctggtggctc
cagttccggaacaataaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccaaagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatcgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB111124_PreS2_P-C Feature FT:CDS AB111124_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatattgtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB111125_PreS2_P-C Feature FT:CDS AB111125_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatattgtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB111946_PreS2_P-C Feature FT:CDS AB111946_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-VT103). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactcaagcacattccaccaagctctgctagatcccaaagtgaggggcctataccttcctgctggtggctc
cagttccggaacagtaaaccctgttcagactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggtcccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctggggggagcccccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcatgggaccatgcaagacctgcacgacacctgctcaaggaacctc
tatgtttccctcttgttgctgtaccaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgaatccctt
tttaccgctgttaccaattttcttttgtctttgggtgtacatttaa
>gnl|hbvcds|AB112063_PreS2_P-C Feature FT:CDS AB112063_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-VT101). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccaaagtgaggggcctataccttcctgctggtggctc
cagttccggaacagtaaaccctgttcagactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgttctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcatgggaccatgcaagacctgcacgacacctgctcaaggaacctc
tatgtttccctcttgttgctgtacacaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgaatccctt
tttaccgctgttaccaattttcttttgtctttgggtgtacatttaa
>gnl|hbvcds|AB112065_PreS2_P-C Feature FT:CDS AB112065_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-VT140). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagaaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgtggccc
gtttgtcctctacttccaggaacatcaactaccatcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB112066_PreS2_P-C Feature FT:CDS AB112066_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-MY624). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtcaccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccatcacgggaccatgcaagacctgcacgaatcctgctcaaggaacctc
tatgtttccctcgtgctgctgtacaaaaccttcggacggaaatggcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaagccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB112348_PreS2_P-C Feature FT:CDS AB112348_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-MY656). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagaacccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgttctgtccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctctaggagactc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB112408_PreS2_P-C Feature FT:CDS AB112408_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-MY683). Non-functional genomic sequence. [Hepadnaviridae] (length=837 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggtcctgctggtggctcaagttccgg
aacagtaaaccctgttccgaccactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatgg
agagcaccgcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaata
ccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtc
cccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatca
tcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcct
ctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctctaggcatctctatgtttcc
ctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcc
tatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttccccc
actgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgaatccctttttacctct
attaccaattttctttcgtctttgggtatacatttaa
>gnl|hbvcds|AB112471_PreS2_P-C Feature FT:CDS AB112471_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-TH123). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
aagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctggacgaatcctgctcaaggaacctc
tatgtttccctcatgttggtggacaaaaccttgggacggaaaatgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB112472_PreS2_P-C Feature FT:CDS AB112472_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-TH124). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggactgtactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggctcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB113875_PreS2_P-C Feature FT:CDS AB113875_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatatcttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtatctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB113876_PreS2_P-C Feature FT:CDS AB113876_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatatcttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtatctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB113878_PreS2_P-C Feature FT:CDS AB113878_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
acgcagtggaattccacaacattccaccaggctctactagatcccagagtgaggggcctatatcttcctgctggtggctc
cagttccggaacagcaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcgtggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactgccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttaccgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB113879_PreS2_P-C Feature FT:CDS AB113879_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccggg
ctttcccccactgtttggctttcagttatatggatgatatggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB115417_PreS2_P-C Feature FT:CDS AB115417_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-O47). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaactttccaccaagctctgctagaccccaaattgaggggcctgtactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagaatctagactcgtggtggacttctcacagttttctagggggaacacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttggtggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagtacgggaccatgcaagacctgcacgattcctgctcaaagcacctc
tatgtttccctcttggtggtggacaaaaccttcggacggaaattgcacttgtattcccatcccatcgtcctgggctttcg
caagaatcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
cttccccccactgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB117758_PreS2_P-C Feature FT:CDS AB117758_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-CB10). Complete genome. [Hepadnaviridae] (length=846 residues).
atgctgtggaactccgcaacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
aagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB176642_PreS2_P-C Feature FT:CDS AB176642_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-115). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccaccaagctctgctagatcccagagtaaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggyggcgtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccaagtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggc
gttytatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtgtggctttcagttatatggatgatgtggtattgggggccaagtctgctcaacatcttgagtccctt
tttacckctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB182589_PreS2_P-C Feature FT:CDS AB182589_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CH:Mat-Ko). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactcctcaacattccaccaagctctgctagatcccagagtgaggggcctgtattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaactctttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB195930_PreS2_P-C Feature FT:CDS AB195930_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
acgcagtggaattccacaacattccaccaggctctactagatcccagagtgaggggcctatatcttcctgctggtggctc
cagttccggaacagcaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcgtggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactgccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcgtatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttaccgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB195931_PreS2_P-C Feature FT:CDS AB195931_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
acgcagtggaattccacaacattccaccaggctctactagatcccagagtgaggggcctatatcttcctgctggtggctc
cagttccggaacagcaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcgtggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggatatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttaccgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB195932_PreS2_P-C Feature FT:CDS AB195932_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
acgcagtggaattccacaacattccaccaggctctactagatcccagagtaaggggcctatatcttcctgctggtggctc
cagttccggaacagcaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcgtggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggatatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcattccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttaccgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB195936_PreS2_P-C Feature FT:CDS AB195936_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
gtgcagtggaactccacaacattccaccaggctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacagttcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB195937_PreS2_P-C Feature FT:CDS AB195937_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
gtgcagtggaactccacaacattccaccaggctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccgaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacagttcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcgtcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB195938_PreS2_P-C Feature FT:CDS AB195938_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
gtgcagtggaactccacaacattccaccaggctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccgaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacagttcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcgtcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB195942_PreS2_P-C Feature FT:CDS AB195942_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaaactctgctagatcccagagtgaggagcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttctcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB195943_PreS2_P-C Feature FT:CDS AB195943_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaaactctgctagatcccagagtgaggagcctatattttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacctcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB195944_PreS2_P-C Feature FT:CDS AB195944_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaaactctgctagatcccagagtgaggagcctatattttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacctcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB195945_PreS2_P-C Feature FT:CDS AB195945_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccaccaaactctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccgtcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB195947_PreS2_P-C Feature FT:CDS AB195947_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccaccaagctctcctagatcccagagtgaggggcctatatttccctgctggtggctc
cagttcaggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB195948_PreS2_P-C Feature FT:CDS AB195948_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccaccaagctctcctagatcccagagtgaggggcctatatttccctgctggtggctc
cagttcaggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB195949_PreS2_P-C Feature FT:CDS AB195949_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
gtgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB195952_PreS2_P-C Feature FT:CDS AB195952_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggattggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttaccgctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB195953_PreS2_P-C Feature FT:CDS AB195953_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctataccttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggattggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttaccgctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB195954_PreS2_P-C Feature FT:CDS AB195954_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctataccttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggattggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttaccgctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB198076_PreS2_P-C Feature FT:CDS AB198076_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatccaagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB198077_PreS2_P-C Feature FT:CDS AB198077_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB198078_PreS2_P-C Feature FT:CDS AB198078_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB198079_PreS2_P-C Feature FT:CDS AB198079_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcartggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB198080_PreS2_P-C Feature FT:CDS AB198080_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB198081_PreS2_P-C Feature FT:CDS AB198081_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctggtagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB198082_PreS2_P-C Feature FT:CDS AB198082_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacaataaaccctgttccgactactgcctctcccacatcgtcaatcttcttgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB198083_PreS2_P-C Feature FT:CDS AB198083_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccgggacagtaagccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB202071_PreS2_P-C Feature FT:CDS AB202071_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB205123_PreS2_P-C Feature FT:CDS AB205123_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-CN578-1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcggtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgccccacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggagtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacaccaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttcctagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB205124_PreS2_P-C Feature FT:CDS AB205124_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-TJ3-1-1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB205125_PreS2_P-C Feature FT:CDS AB205125_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-VH34-1). Complete genome. [Hepadnaviridae] (length=846 residues).
acgcagtggaactccagcacattccaccaagctctgctagatcccagagtgcggggcctctaccttcctgctggtggctc
cagttccggaacagtaaaccctgttccgaccactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgctgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccactattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB222714_PreS2_P-C Feature FT:CDS AB222714_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate UZNVC7). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcctgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB222715_PreS2_P-C Feature FT:CDS AB222715_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate UZNVC7M). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcctgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB241110_PreS2_P-C Feature FT:CDS AB241110_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate PhLC03). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacatttcatcaagctctgctagatcccagagtaaggggcctatactttcctgctggtggctc
cagttccggaacagcaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctaattccaggaacatccacaacaagcacgggaccatgcaaaacctgcacgactcctgctcaaggcacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctgttaccaattttcttttgtctttgggtatacatctga
>gnl|hbvcds|AB241111_PreS2_P-C Feature FT:CDS AB241111_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate PhLC14). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacatttcatcaagctctgctagatcccagagtaaggggcctatactttcctgctggtggctc
cagttccggaacagcaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctaattccaggaacatccacaacaagcacgggaccatgcaagacctgcacgactcctgctcaaggcacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagcgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB246344_PreS2_P-C Feature FT:CDS AB246344_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatattgtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB246345_PreS2_P-C Feature FT:CDS AB246345_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcaatggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatatcttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB246346_PreS2_P-C Feature FT:CDS AB246346_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctataccttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatctcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcactaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacttcaaccaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccactgtttccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB247916_PreS2_P-C Feature FT:CDS AB247916_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
aagttccggaactgtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctcgactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctccttactcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB288026_PreS2_P-C Feature FT:CDS AB288026_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccgaaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttggcagtccccaacctcaaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB298720_PreS2_P-C Feature FT:CDS AB298720_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BAJT2006-1S). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaaaggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttaccgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB298721_PreS2_P-C Feature FT:CDS AB298721_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BAJT2006-1C). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaaaggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttaccgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB299858_PreS2_P-C Feature FT:CDS AB299858_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccaaagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttacctctattaccaattttcttttatctttgggtatacatttga
>gnl|hbvcds|AB300359_PreS2_P-C Feature FT:CDS AB300359_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtgtggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB300360_PreS2_P-C Feature FT:CDS AB300360_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggtctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaaccttttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccttgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaggtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB300361_PreS2_P-C Feature FT:CDS AB300361_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient3). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgctagatcccagagtgagaggcctatattttcctgctggtggctc
cagttccggaacagtacaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB300362_PreS2_P-C Feature FT:CDS AB300362_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient4). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB300363_PreS2_P-C Feature FT:CDS AB300363_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient5). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
aagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB300365_PreS2_P-C Feature FT:CDS AB300365_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient7). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB300368_PreS2_P-C Feature FT:CDS AB300368_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient10). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
taagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB300372_PreS2_P-C Feature FT:CDS AB300372_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient14). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaaccttccaccaaactctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggcttccg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB362932_PreS2_P-C Feature FT:CDS AB362932_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtattacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaaaacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB365451_PreS2_P-C Feature FT:CDS AB365451_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BOL196). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatatcttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgccttacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB367392_PreS2_P-C Feature FT:CDS AB367392_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 1). Complete genome. [Hepadnaviridae] (length=846 residues).
gtgcagtggaactccacaacattccgccaagctctgctagatcccagagtgaggggcctatatcttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgggttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagacttgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcaggt
ctttcccccactgtgtggctttcagttatgtggatgatgtggttttgggggcgaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttctttcgtctttgggtatacatttga
>gnl|hbvcds|AB367394_PreS2_P-C Feature FT:CDS AB367394_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 3/Adefovir-treated Pt. 8). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttcgggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaggacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB367395_PreS2_P-C Feature FT:CDS AB367395_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 4). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccaccaaactctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagcaaaccctgttccgactactgcctcacccatatcgtcaaccttctcgaggattggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgttggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcgtcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB367396_PreS2_P-C Feature FT:CDS AB367396_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 5). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagcaaaccctgttccgactactgcctcacccatatcgtcaaccttctcgaggattggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatctgtcctggctatcgttggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggactgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB367397_PreS2_P-C Feature FT:CDS AB367397_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 6). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcattggaattccacaacattccaccaagctctgctagaccccagagtgcggggcctataccttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
agaacatggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggattgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB367398_PreS2_P-C Feature FT:CDS AB367398_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 7/Adefovir-treated Pt. 20). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgattactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggattgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB367399_PreS2_P-C Feature FT:CDS AB367399_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 8/Adefovir-treated Pt. 29). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatatcttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
agaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB367401_PreS2_P-C Feature FT:CDS AB367401_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 10/Adefovir-treated Pt. 9). Complete genome. [Hepadnaviridae] (length=846 residues).
acgcagtggaactccacaacattccacaaagctatgctagatcccagagtgaggggcctatatcttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcactaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttctatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttctgttgtctttgggtatacatttga
>gnl|hbvcds|AB367402_PreS2_P-C Feature FT:CDS AB367402_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 11). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaagggcctatacttccctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgagtcctgctcaaggaacctc
tatgtttccctcttgctgctgtacaaaacctacggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcatggctcagttcactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB367403_PreS2_P-C Feature FT:CDS AB367403_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 12/Adefovir-treated Pt. 17). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagtacgggaccatgcaaaacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB367404_PreS2_P-C Feature FT:CDS AB367404_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 13/Adefovir-treated Pt. 22). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaggctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggattgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB367406_PreS2_P-C Feature FT:CDS AB367406_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 15/Adefovir-treated Pt. 7). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccagactctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccgggacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacttgcaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccagggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tacgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcgtgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB367407_PreS2_P-C Feature FT:CDS AB367407_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 16/Adefovir-treated Pt. 11). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgttggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB367410_PreS2_P-C Feature FT:CDS AB367410_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 19/Adefovir-treated Pt. 19). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatatcttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggattggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtggctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB367411_PreS2_P-C Feature FT:CDS AB367411_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 20). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacgcaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggttttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB367412_PreS2_P-C Feature FT:CDS AB367412_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 21). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctttgctagatcccagagtgaggggcctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggttttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB367414_PreS2_P-C Feature FT:CDS AB367414_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 23/Adefovir-treated Pt. 3). Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttatgtctttgggtatacatttga
>gnl|hbvcds|AB367416_PreS2_P-C Feature FT:CDS AB367416_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 25). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccaccaagctctgctagatcccaaagtgaggggcctatattttcctgctggtggctc
cagttccggtacagcaaaccctgttccgactactgcctcacccatatcgtcaaccttctcgaggattggggaccctgcgc
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagaggctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtggctgcggc
gttctatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtgtggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB367417_PreS2_P-C Feature FT:CDS AB367417_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 26). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactcaacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcgc
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactacaaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaatttccttttgtctttgggtatacatttaa
>gnl|hbvcds|AB367418_PreS2_P-C Feature FT:CDS AB367418_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 27/Adefovir-treated Pt. 21). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacatttcaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaacatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatattgatgatttggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttgtgtctttgggtatacatttga
>gnl|hbvcds|AB367420_PreS2_P-C Feature FT:CDS AB367420_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 29). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacatttcaccaggctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagtaccaaagtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
tttacctctattaccaattttctgtcttctttgggtatacatttga
>gnl|hbvcds|AB367421_PreS2_P-C Feature FT:CDS AB367421_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 30). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggacttccacaacattccaccaagcactgctagatcccggagtgaggggcctgtattatcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgacctggatatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcccgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatagatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttctttcatctttgggtatacatttga
>gnl|hbvcds|AB367422_PreS2_P-C Feature FT:CDS AB367422_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 31/Adefovir-treated Pt. 12). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaaactctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaaaatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtctggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB367423_PreS2_P-C Feature FT:CDS AB367423_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 32/Adefovir-treated Pt. 28). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaaactctgctagatcccagagtgaggggtctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggatatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtggggctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB367424_PreS2_P-C Feature FT:CDS AB367424_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 33). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagcaaaccctgttccgactactgcctcacccatatcgtcaaccttctcgaggattggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgttggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB367427_PreS2_P-C Feature FT:CDS AB367427_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 36/Adefovir-treated Pt. 18). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctgtattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB367431_PreS2_P-C Feature FT:CDS AB367431_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 40). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctgtattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgttggatgtgtctgcggc
gttctatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatcgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB367432_PreS2_P-C Feature FT:CDS AB367432_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 41). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctgtattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgaggccctt
tttaccgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB367434_PreS2_P-C Feature FT:CDS AB367434_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 43/Adefovir-treated Pt. 26). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggactctgtac
cgaacatggagaacacagcatccggatccctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccgaaa
ttcgcagtccccaacctccaatcactcactaacctcttgtcctccaatttgtcctgggtatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccgaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttatctttgggtatacatttaa
>gnl|hbvcds|AB367435_PreS2_P-C Feature FT:CDS AB367435_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 44/Adefovir-treated Pt. 23). Non-functional genomic sequence. [Hepadnaviridae] (length=840 residues).
acgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctacctgctggtggctccagttc
cggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaaca
tggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcaca
ataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgcgtgtcctggccaaaattcgca
gtccccaacctccaatcactcactaacctcttgtcctccaacttgtcctggctatcgatggatgtgtctgcggcgtttta
tcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgt
cctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtt
tccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagat
tcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcc
cccactgtgtggctttcagttatattgatgatgtggtattgggggccaagactgtacaacatcttgagtccctttttacc
tctattaccaattttcttgtgtctttgggtatacatttaa
>gnl|hbvcds|AB367803_PreS2_P-C Feature FT:CDS AB367803_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ADVT Pt. 13). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccaccaagctctgctagatcccaaagtgaggggcctatattttcctgctggtggctc
cagttccggtacagcaaaccctgttccgactactgcctcacccatatcgtcaaccttctcgaggattggggaccctgcgc
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagaggctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtggctgcggc
gttctatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtgtggctttcagttatattgatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
tttacctctattacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB367804_PreS2_P-C Feature FT:CDS AB367804_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ADVT Pt. 6). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctgtattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggatatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgaggccctt
tttaccgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB368297_PreS2_P-C Feature FT:CDS AB368297_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctgtattttcctgctggtggctc
cagttccggaacagtacaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactgtcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatctttggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttaccgctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB426467_PreS2_P-C Feature FT:CDS AB426467_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccaaagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttacctctattaccaattttcttttatctttgggtatacatttga
>gnl|hbvcds|AB471848_PreS2_P-C Feature FT:CDS AB471848_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate F1S-F). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB471849_PreS2_P-C Feature FT:CDS AB471849_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate F1S-C2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB471850_PreS2_P-C Feature FT:CDS AB471850_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate F1S-C1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB471851_PreS2_P-C Feature FT:CDS AB471851_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate F2NK-F). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttaccgctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB471852_PreS2_P-C Feature FT:CDS AB471852_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate F2S-C2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttaccgctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB471853_PreS2_P-C Feature FT:CDS AB471853_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate F2S-C3). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttaccgctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB485808_PreS2_P-C Feature FT:CDS AB485808_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-IT). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatctcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB485810_PreS2_P-C Feature FT:CDS AB485810_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate FEP2). Complete genome. [Hepadnaviridae] (length=846 residues).
gtgcggtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB493839_PreS2_P-C Feature FT:CDS AB493839_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 08UC). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaagctctgctagatcccagagtgaggggcctttattttcctgctggtggctc
cagttccggaacagtaaaccctgttctgactattgcctctcccatatcgtcaatcttctcgtggactggggaccctgcac
cgaacatggagagcacaacatccggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccatgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaacgaccaccacaggaccttgcaagacctgcacaattcctgctcaaggaacctc
tatgtttccctcctgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB493844_PreS2_P-C Feature FT:CDS AB493844_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 43UC). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacgttccaccaagctctgctagatcccagagtgaggggcctttattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactattgcctctcccatctcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatccggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccatgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccgatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacggggccttgcaagacctgcacaattcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctatacaacatcttgagtccctt
tatacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB640730_PreS2_P-C Feature FT:CDS AB640730_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Ehime-EPCH-HBV-C1-HN). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB642095_PreS2_P-C Feature FT:CDS AB642095_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BFJT2000-1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatatttccctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB642097_PreS2_P-C Feature FT:CDS AB642097_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BFJT2003-1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtatttcttgttgacaagaatc
ctcacaataccaaagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtktggctttcagttatatggatgatgtggtattggggrcaargtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB642099_PreS2_P-C Feature FT:CDS AB642099_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BFJT2005-1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatctcctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctcgatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB642100_PreS2_P-C Feature FT:CDS AB642100_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BFJT2006-1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaggctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670237_PreS2_P-C Feature FT:CDS AB670237_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattcaacaacattccaccaagctctgctagatcccagagtgagaggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctggttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactyaccaacctcttgtcctccaacttgwcctggctatcgctggatgtgtctgcrgc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagtacgggaccatgcaagacctgcacgactcctgctcaarrcacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcmtgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctattaccaattttctgwtgtctttgggtatacatttga
>gnl|hbvcds|AB670238_PreS2_P-C Feature FT:CDS AB670238_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
agaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccctaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccgaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggcccatgcaaggcctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670239_PreS2_P-C Feature FT:CDS AB670239_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.3). Complete genome. [Hepadnaviridae] (length=846 residues).
gtgaagtggaagtccacaacattccaccaggctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttctgttgtctttgggtatacatttga
>gnl|hbvcds|AB670240_PreS2_P-C Feature FT:CDS AB670240_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.4). Complete genome. [Hepadnaviridae] (length=846 residues).
gtgaagtggaagtccacaacattccaccaggctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttctgttgtctttgggtatacatttga
>gnl|hbvcds|AB670241_PreS2_P-C Feature FT:CDS AB670241_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.5). Complete genome. [Hepadnaviridae] (length=846 residues).
acacagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctataccttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcytgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgyaggg
ctttcccccactgtttggctttcagttatatggatgatrtggtattgggggcmaagtctgtacaacatcttgagtccctt
twtacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670242_PreS2_P-C Feature FT:CDS AB670242_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.6). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactygtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaayttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgatccctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttaccgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670243_PreS2_P-C Feature FT:CDS AB670243_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.7). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
acgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670246_PreS2_P-C Feature FT:CDS AB670246_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.10). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccacaaagctctgacagatcccagagtgaggggcctatatcttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggcgagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcagc
attttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctccacttccaggaacatcaactaccagcacgggaccatgcaagaactgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcgtcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctccataaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670247_PreS2_P-C Feature FT:CDS AB670247_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.11). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB670248_PreS2_P-C Feature FT:CDS AB670248_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.12). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgacagatcccagagtgaggggcctatatcttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggcgagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcrgc
attttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctccacttccaggaacatcaactaccagcacgggaccatgcaagaactgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcgtcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctccataaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670249_PreS2_P-C Feature FT:CDS AB670249_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.13). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccaaagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaayttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacttcaactaccagcacgggaccatgcaagacctgcacgaytcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670251_PreS2_P-C Feature FT:CDS AB670251_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.15). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670252_PreS2_P-C Feature FT:CDS AB670252_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.16). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB670253_PreS2_P-C Feature FT:CDS AB670253_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.17). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaggctctgctagatcccaaagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgcgttacaggcggggtttttcttgttgacaagaatc
ctcacaatactaaagaatctagactcgtggtggacttctctcagttttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
attttatcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670254_PreS2_P-C Feature FT:CDS AB670254_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.18). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctataccttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtgattcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctcgattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670256_PreS2_P-C Feature FT:CDS AB670256_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.20). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670258_PreS2_P-C Feature FT:CDS AB670258_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.22). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaaactctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtggctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacggttcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670259_PreS2_P-C Feature FT:CDS AB670259_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.23). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcaccgsatctccaccacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccttgcac
agaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggagcacccaagtgtcttggccaaag
ttcgcagtccccaacctgcaatcactcaccaacctcttgtcctccgacttgtcctggctatcgctggatgtgtctgcggc
gttctatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcgactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtgtggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttaccgctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670260_PreS2_P-C Feature FT:CDS AB670260_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.24). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccatgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaaactc
tacgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcaatggttcgcaggg
ctttcccccactgtttggctttcaggtatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670261_PreS2_P-C Feature FT:CDS AB670261_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.25). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcaccaatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670262_PreS2_P-C Feature FT:CDS AB670262_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.26). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactcaacaacattccaccaagctctgctagatcccagagtgaggggcctatatcttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggcaaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB670263_PreS2_P-C Feature FT:CDS AB670263_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.27). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgcctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB670264_PreS2_P-C Feature FT:CDS AB670264_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.28). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactattgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcactaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttaccgctattaccaattttcttttatctttgggtatacatttga
>gnl|hbvcds|AB670265_PreS2_P-C Feature FT:CDS AB670265_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.29). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccgaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccgaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670266_PreS2_P-C Feature FT:CDS AB670266_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.30). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgctagatcccagagtgaggggcctatatyttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670267_PreS2_P-C Feature FT:CDS AB670267_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.31). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcgc
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcargacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670269_PreS2_P-C Feature FT:CDS AB670269_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.33). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcaatggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
twtacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670270_PreS2_P-C Feature FT:CDS AB670270_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.34). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaggctctgctagatcccagagtgaggggcctatatgttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctattaccaattttcttatgtctttgggtatacatttaa
>gnl|hbvcds|AB670272_PreS2_P-C Feature FT:CDS AB670272_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.36). Complete genome. [Hepadnaviridae] (length=846 residues).
gtgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
agaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatcgatgatgtggttttgggggccaagactgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670273_PreS2_P-C Feature FT:CDS AB670273_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.37). Complete genome. [Hepadnaviridae] (length=846 residues).
acgaagtggaactccacaacattccaccaggttctgctagatcccagagtgaggggcctatatcttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaaytcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670274_PreS2_P-C Feature FT:CDS AB670274_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtcagcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatatggtattgggggcaaagtctgtacaacatcttgagtccctt
tatacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670275_PreS2_P-C Feature FT:CDS AB670275_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgagaggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcacyaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttaccgctgttaccaattttcttttttctttgggtatacatttga
>gnl|hbvcds|AB670276_PreS2_P-C Feature FT:CDS AB670276_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.3). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670277_PreS2_P-C Feature FT:CDS AB670277_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.4). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccaccacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacaacaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaccctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670278_PreS2_P-C Feature FT:CDS AB670278_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.5). Complete genome. [Hepadnaviridae] (length=846 residues).
gtgcagtggaactccacaacattcctccaaactctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670279_PreS2_P-C Feature FT:CDS AB670279_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.6). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgagaggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagtacgggaccatgcaagacctgcacgactgctgctcaaggaaactc
tacgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaggccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670281_PreS2_P-C Feature FT:CDS AB670281_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.8). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaggctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacagttcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670282_PreS2_P-C Feature FT:CDS AB670282_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.9). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattactgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670283_PreS2_P-C Feature FT:CDS AB670283_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.10). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB670285_PreS2_P-C Feature FT:CDS AB670285_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.12). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcgc
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgstgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670287_PreS2_P-C Feature FT:CDS AB670287_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.14). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670288_PreS2_P-C Feature FT:CDS AB670288_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.15). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatatttccctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB670289_PreS2_P-C Feature FT:CDS AB670289_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.16). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccasyaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagantc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670290_PreS2_P-C Feature FT:CDS AB670290_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.17). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctatattatcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttctgctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctccattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670291_PreS2_P-C Feature FT:CDS AB670291_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.18). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagaggctagactcgtggttgacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtctgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattacccattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670292_PreS2_P-C Feature FT:CDS AB670292_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.19). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670294_PreS2_P-C Feature FT:CDS AB670294_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.21). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgacctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttctgctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcccctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670295_PreS2_P-C Feature FT:CDS AB670295_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.22). Complete genome. [Hepadnaviridae] (length=846 residues).
gtgtgttggaacaccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagtacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggctcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctrttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670297_PreS2_P-C Feature FT:CDS AB670297_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.24). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgccttacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtgtggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670298_PreS2_P-C Feature FT:CDS AB670298_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.25). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactcgacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgcgttacaggcgggatttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacgtcaactaccagcacgggaccatgcaagacctgcacgaatcctgccaacggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggttttgggggcgaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggcatacatttga
>gnl|hbvcds|AB670300_PreS2_P-C Feature FT:CDS AB670300_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.27). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccgaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccgaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670301_PreS2_P-C Feature FT:CDS AB670301_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.28). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatatcttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgcttgatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctt
tttacctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670302_PreS2_P-C Feature FT:CDS AB670302_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.29). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtaaggggcctatatcttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaggacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670305_PreS2_P-C Feature FT:CDS AB670305_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.32). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcgc
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670306_PreS2_P-C Feature FT:CDS AB670306_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.33). Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgcaggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttgtggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670307_PreS2_P-C Feature FT:CDS AB670307_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.34). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgtctcacccacatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcactaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670309_PreS2_P-C Feature FT:CDS AB670309_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.36). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacatttcaccaagctctgctagatcccagagtgaggggcctatatcttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
tgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctactgccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtgattcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgcacaacatcttgagtccctt
tatacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670310_PreS2_P-C Feature FT:CDS AB670310_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.37). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670311_PreS2_P-C Feature FT:CDS AB670311_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.38). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctcttctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttgcctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB675674_PreS2_P-C Feature FT:CDS AB675674_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 10A33). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactcaacaactttccaccaagctctgctagatcccagagtaaggggcctttactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgaccactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggatcaacaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaccctc
tatgtttccctcttgttgctgttcaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttaccgctgttaccacttttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB675675_PreS2_P-C Feature FT:CDS AB675675_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 10A34). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactcaacaactttccaccaagctctgctagatcccagagtaaggggcctttactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgaccactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggatcaacaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaccctc
tatgtttccctcttgttgctgttcaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttaccgctgttaccacttttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB675677_PreS2_P-C Feature FT:CDS AB675677_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 10A39). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctcttctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB697490_PreS2_P-C Feature FT:CDS AB697490_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate No5). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaaactctgctcgatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggactgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB697494_PreS2_P-C Feature FT:CDS AB697494_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate No9). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccaccaagctctgctagatcccagagtaaagggcctatattttcctgctggtggctc
cagttccggaacagcaaaccctgttccgactactgcctcacccatatcgtcaaccttctcgaggattggggaccttgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcactaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB697500_PreS2_P-C Feature FT:CDS AB697500_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate No17). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacaggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB697502_PreS2_P-C Feature FT:CDS AB697502_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate No20). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgtkgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaaccttttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaycaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtgtggctttcagttatatggatgatgtggtkatkggggccaagactgtacaccatcttgastccctt
tttaccgctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB697510_PreS2_P-C Feature FT:CDS AB697510_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate No33). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccatcaaactctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaatagtaaaccctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttaccgctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB713885_PreS2_P-C Feature FT:CDS AB713885_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate YOGHhbv84). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaggctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactattgcctcacccatatcgtcaatcttctcgaagactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgatggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgagatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtgtctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB713890_PreS2_P-C Feature FT:CDS AB713890_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate YOGHhbv105). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaggctctgctagatcccagagtgaggggtctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacacatatcgtcaatcttctcgaagactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaaccttttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggcacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB900099_PreS2_P-C Feature FT:CDS AB900099_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
gtgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaagggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagtacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcactaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB900109_PreS2_P-C Feature FT:CDS AB900109_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaaytccacaacattccaccaagctctgctagatcccagagtgaggggcctgtattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccgcgtgtcgtggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgttggatgtgtctgcggc
gttctatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tayaccgctattaccaattttcttttgtctctgggtatacatttga
>gnl|hbvcds|AB900113_PreS2_P-C Feature FT:CDS AB900113_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacggagtctagactcgtggtggacttctctcagttttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtgcccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggc
attttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggctcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaacgaccagtacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB900115_PreS2_P-C Feature FT:CDS AB900115_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccatcaagctctgctagatcccagagtgaggggcctatatcttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB900116_PreS2_P-C Feature FT:CDS AB900116_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaggctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB931170_PreS2_P-C Feature FT:CDS AB931170_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2P_HB11-0921). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactcctcaacattccaccaagctctgctagatcccagagtgaggggcctgtattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctcaaatttgtcctggctatcgttggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttctgctggactggaaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagtacgggaccatgcaagacctgcacgattcctgctcaagggacctc
tatgtttccctcttgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB931171_PreS2_P-C Feature FT:CDS AB931171_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2S_HB11-0922). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactcctcaacattccaccaagctctgctagatcccagagtgaggggcctgtattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactgtcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagtacgggaccatgcaagacctgcacgattcctgctcaagggacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB971714_PreS2_P-C Feature FT:CDS AB971714_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HB11-1026). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagcacggggccatgcaggacctgcacgactcttgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB971715_PreS2_P-C Feature FT:CDS AB971715_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HB11-1027). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagcacggggccatgcaggacctgcacgactcttgttcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF068756_PreS2_P-C Feature FT:CDS AF068756_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
aagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF182802_PreS2_P-C Feature FT:CDS AF182802_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactctacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatgcagaacacaacatcaggattcctaggacccctgctcgcgttacaggcggggttttccttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactacaaaggtatgttgccc
gtttgtcctcttcttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcccgctcaaggaaactc
tacgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcaatccgtttctcctggctcagtttactagttccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctattaccaatttcctgttgtctttgggcatacatttga
>gnl|hbvcds|AF182803_PreS2_P-C Feature FT:CDS AF182803_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcgtcttcttgttggttcttctggactaccgaggtatgttgccc
gtttgtcctcttcttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaaactc
tacgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcaatccgtttctcctggctcagtttactagtgccatttgttcagtgggtcgtaagg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctattaccaatttcctgttgtctttgggcatacatttga
>gnl|hbvcds|AF182804_PreS2_P-C Feature FT:CDS AF182804_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcaatggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattctctagggggagcacccaagtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctcttcttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaaactc
tacgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctattaccaatttcctgttgtctttgggcatacatttga
>gnl|hbvcds|AF223954_PreS2_P-C Feature FT:CDS AF223954_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ea1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgttagatcccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF223955_PreS2_P-C Feature FT:CDS AF223955_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ea2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaggacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF223956_PreS2_P-C Feature FT:CDS AF223956_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ea3). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF223957_PreS2_P-C Feature FT:CDS AF223957_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ea4). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF223958_PreS2_P-C Feature FT:CDS AF223958_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ea5). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
tgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF223959_PreS2_P-C Feature FT:CDS AF223959_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ea6). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF223960_PreS2_P-C Feature FT:CDS AF223960_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ea7). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatacgttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctcaaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtgtgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF223961_PreS2_P-C Feature FT:CDS AF223961_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ea8). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF241410_PreS2_P-C Feature FT:CDS AF241410_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 3270). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacatttcatcaagctctgctagatcccagagtaaggggcctatactttcctgctggtggctc
cagttccggaacagcaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgtac
cgaaaatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctaattccaggaacatcaacaacaagcacgggaccatgcaagacctgcacgactcctgctcaaggcacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccttt
tttacctctgttaccaattttcttctgtctttgggtatacatttga
>gnl|hbvcds|AF241411_PreS2_P-C Feature FT:CDS AF241411_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 8290). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacatttcatcaagctctgctagatcccagagtaaggggcctatactttcctgctggtggctc
cagttccggaacagcaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgtac
cgaaaatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctaattccaggaacatcaacaacaagcacgggaccatgcaagacctgcacgactcctgctcaaggcacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacmtctwgagtccctt
tttacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF286594_PreS2_P-C Feature FT:CDS AF286594_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttctgtctttgggtatacatttaa
>gnl|hbvcds|AF363961_PreS2_P-C Feature FT:CDS AF363961_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccaaagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggcttccg
caagattcctatgggagttggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AF384371_PreS2_P-C Feature FT:CDS AF384371_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate G376-7). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactacaaccacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctatcaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AF384372_PreS2_P-C Feature FT:CDS AF384372_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate G376-A6). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=852 residues).
atgcagtggaactccaccacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactacaactacaaccacgggaccatgcaagacctgcacgattcctgctcaagg
aacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttggg
ctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttc
gtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgag
tccctttttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AF411408_PreS2_P-C Feature FT:CDS AF411408_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atacagtggaattccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacaggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AF411411_PreS2_P-C Feature FT:CDS AF411411_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atacagtggaattccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacaggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AF411412_PreS2_P-C Feature FT:CDS AF411412_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
gtgcagtggaactccacaacattccaccaagctctgttagaccccagagtgaggggcctataccttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccaagtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcgactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AF458664_PreS2_P-C Feature FT:CDS AF458664_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C84). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtcaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacttccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AF458665_PreS2_P-C Feature FT:CDS AF458665_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C733). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacaacaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaagaatc
ctcacaatacctcagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggt
gttttatcatattcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AF461357_PreS2_P-C Feature FT:CDS AF461357_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate FH5). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccatgtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AF461358_PreS2_P-C Feature FT:CDS AF461358_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate FH8). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtaaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcgcgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttttcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AF461359_PreS2_P-C Feature FT:CDS AF461359_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate c16). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtaaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcgcgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AF461363_PreS2_P-C Feature FT:CDS AF461363_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C8). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccatgtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AF473543_PreS2_P-C Feature FT:CDS AF473543_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2e). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagcacgggaccctgcaagacctgcacaattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF533983_PreS2_P-C Feature FT:CDS AF533983_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactgggggccctgccc
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacagtaccacagagtctagactcgcggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggacgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AJ748098_PreS2_P-C Feature FT:CDS AJ748098_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient Z1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcacctcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AP011097_PreS2_P-C Feature FT:CDS AP011097_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AP011098_PreS2_P-C Feature FT:CDS AP011098_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
agaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AP011099_PreS2_P-C Feature FT:CDS AP011099_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacatttcatcaagctctgctagatcccagagtaagaggcctatacttccctgctggtggctc
cagttccggaacagcaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctaattccaggaacatccacaacaagcacgggaccatgcaagacctgcacgactcctgctcaaggcacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AP011100_PreS2_P-C Feature FT:CDS AP011100_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacatttcatcaagctctgctagatcccagagtaaggggcctatactttcctgctggtggctc
cagttccggaacagcaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctaattccaggaacatccacaacaagcacgggaccatgcaagacctgcacgactcctgctcaaggcacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctgttaccaattttcttttgtctttgggtgtacatttga
>gnl|hbvcds|AP011101_PreS2_P-C Feature FT:CDS AP011101_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacatttcatcaagctctgctagatcccagagtaaggggcctatattttcctgctggtggctc
cagttccggaacagcaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatt
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctaattccaggaacatccacaacaagcacgggaccatgcaagacctgcacgactcctgctcaaggcacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tttacctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AP011106_PreS2_P-C Feature FT:CDS AP011106_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaaactctgctagatcccagagtcaggggcctctattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgacttctgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AP011107_PreS2_P-C Feature FT:CDS AP011107_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacatttcaccaggctctgctggatcccagagtgaggggcctctattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgacttctgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY057947_PreS2_P-C Feature FT:CDS AY057947_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Tibet705). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaaccttccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacgtgtattcccatcccatcatcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY066028_PreS2_P-C Feature FT:CDS AY066028_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate FH4). Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaattccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccacgtcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY167090_PreS2_P-C Feature FT:CDS AY167090_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Ib). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattgcaccaagctctgctagaccccagagtgagggggctatacttccctgctggtggctc
cagctccggaacagtaaaccctgttccgactattgtctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctatttccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY167091_PreS2_P-C Feature FT:CDS AY167091_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Ic). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggtctgtattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctt
tttaccgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY167096_PreS2_P-C Feature FT:CDS AY167096_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate IIIa). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaaaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY167099_PreS2_P-C Feature FT:CDS AY167099_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate IVb). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctctattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagaacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctaaactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaaatgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY206376_PreS2_P-C Feature FT:CDS AY206376_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
ctgaagtggaactccacaactttccaccaagctctgctagatcccaaagtgaggggcctttactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaatactacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacggggccatgcaaggcctgcacgactcctgctcaaggaaactc
tacgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtctggcttttagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctt
tttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY206379_PreS2_P-C Feature FT:CDS AY206379_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
ctgaagtggaactccacaactttccaccaagctctgctagatcccaaagtgaggggcctttactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaatactacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacggggccatgcaaggcctgcacgactcctgctcaaggaaactc
tacgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtctggcttttagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctt
tttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY206381_PreS2_P-C Feature FT:CDS AY206381_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgcgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacggagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagatacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY206382_PreS2_P-C Feature FT:CDS AY206382_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttcttctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaactttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY206384_PreS2_P-C Feature FT:CDS AY206384_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgttggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caaaattcctatggaagtgtgcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY206386_PreS2_P-C Feature FT:CDS AY206386_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctgtatcttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacaacaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtaccaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtangg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttaccgctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY206388_PreS2_P-C Feature FT:CDS AY206388_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, Pol). [Hepadnaviridae] (length=846 residues).
atacagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaaattcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgagtccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggccttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggtccgtaggg
ctttcccccactgtgtggctttcagttatatggatgatgtggtattaggggccaagtctgtacaacatcgtgaggccctt
tttaccactattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY206389_PreS2_P-C Feature FT:CDS AY206389_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
tcaggaagacactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcactaacctcttgtcctccgatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcaccctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttaccgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY206392_PreS2_P-C Feature FT:CDS AY206392_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgagaggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaatttcctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctt
tttacctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY220699_PreS2_P-C Feature FT:CDS AY220699_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaactccacaacattccaccaaactctgctagaccccagagtgaggggcctatacattcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccaagtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactacaaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttctttggtctttgggtatacatttga
>gnl|hbvcds|AY220700_PreS2_P-C Feature FT:CDS AY220700_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=837 residues).
aactccacaacattccaccaagctctgctagaccccagagtgaggggcctataccttcctgctggtggctccagttccgg
aacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatgg
agaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaata
ccacagagtctagactcgtggtggacttctctcagttttctagggggagcacccacgtgtcctggccaaaattcgcagtc
cccaacctccaatcactcaccaacctcttgtcctccaatttgacctggctatcgctggatgtgtctgcggcgttttatca
tattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcct
ctacttccaggaacatcaactaccagcacgggaacatgcaagacctgcacgattcctgctcaaggaacctctatgtttcc
ctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcc
tatgagagtgggcctcagtccgtttctcctggctcaatttactagtgccatttgttcagtggttcgtaaggctttccccc
actgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctct
attaccaattttcttttgtctttgggtacacatttga
>gnl|hbvcds|AY220701_PreS2_P-C Feature FT:CDS AY220701_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgaccactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttatcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggcaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtgattcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctccacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY220702_PreS2_P-C Feature FT:CDS AY220702_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgaccactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccaacacgggaccatgcaaaacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttga
caagattcctatgggagtgggcctcaatccgtttctcctgactcaatttactagtgccatttgttcaatggttcgtaagg
ctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctattaccaattttcttgtgtctttgggtatacatttga
>gnl|hbvcds|AY247031_PreS2_P-C Feature FT:CDS AY247031_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KUHB84). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacatttcaccaagctttgctagatcccagagtgaggggcctctattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaagactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY247032_PreS2_P-C Feature FT:CDS AY247032_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KUHB95). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
caattccggaacagtaaaccctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtgtggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY306136_PreS2_P-C Feature FT:CDS AY306136_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate H85). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttcccgaggactggggaccctgcac
tgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtcggcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY582136_PreS2_P-C Feature FT:CDS AY582136_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaaactctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY596107_PreS2_P-C Feature FT:CDS AY596107_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Ib-1). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaacttcacaaccttccaccaaactctgttagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagcacggggccatgcaagacttgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggattgggcctcagtccgtttctcatggctaagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY596108_PreS2_P-C Feature FT:CDS AY596108_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Ib-2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY641558_PreS2_P-C Feature FT:CDS AY641558_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate He74). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccccgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY641559_PreS2_P-C Feature FT:CDS AY641559_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate He53). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccaccaagctctactagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcctggctcaatttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaggccctt
tatacctctattaccaattttcttgtgtctttgggtatacatttga
>gnl|hbvcds|AY641560_PreS2_P-C Feature FT:CDS AY641560_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate He100). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY641561_PreS2_P-C Feature FT:CDS AY641561_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate He127). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaagccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY641562_PreS2_P-C Feature FT:CDS AY641562_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate He82). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaaacacctc
tatttttccctcttgttgctgtacaaaaccttcggacgcaaactgcacttgtattcccatcccatcgtcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY641563_PreS2_P-C Feature FT:CDS AY641563_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate He52). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccaccaagctctgctagatcccaaagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcgactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatttggtattgggggccaaatctgtacaacatctggagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY862869_PreS2_P-C Feature FT:CDS AY862869_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate H8). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccactattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|D00630_PreS2_P-C Feature FT:CDS D00630_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctgtgctagatcccagagtgaggggcctatatcttcctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggcccaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcctgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|D10055_PreS2_P-C Feature FT:CDS D10055_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcctggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacagaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcaatttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|D12980_PreS2_P-C Feature FT:CDS D12980_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttggtgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|D23680_PreS2_P-C Feature FT:CDS D23680_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate B4-HBVST1). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgacctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacaggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattacccattttcttttatctttgggtatacatttga
>gnl|hbvcds|D23681_PreS2_P-C Feature FT:CDS D23681_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C4-HBVST2). Complete genome. [Hepadnaviridae] (length=846 residues).
acgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgcttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattacccattttcttttatctttgggtatacatttga
>gnl|hbvcds|D23682_PreS2_P-C Feature FT:CDS D23682_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate B5-HBVKO1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgactattgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttctcgttgacaagaatc
cacacaatactacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttctatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactacaaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtgtggctttcagttatatggatgatgtggtattgggggcaaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|D23683_PreS2_P-C Feature FT:CDS D23683_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C5-HBVKO2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgactattgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttctcgttgacaagaatc
cacacaatactacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttctatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactacaaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtgtggctttcagttatatggatgatgtggtattgggggcaaggtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtattcatttga
>gnl|hbvcds|D23684_PreS2_P-C Feature FT:CDS D23684_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C6-TKB588). Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaactccacaacattccaccaagctctgctagaccccagagtaaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaccacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcacctc
tatgtttccctcttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|D28880_PreS2_P-C Feature FT:CDS D28880_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Plasma 1992-085-9434). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatacttccctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatctcctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgggttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagacttgtggtggacttctctcaattttctagggggagcacccaagtgtcctggcctaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctcgatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacaccaactaccagcacaggaccatgcaagacctgcacgagtcctgctcaaggaaactc
tacgtttccctcttgttgctgtacaaaaccttcggacggaaactgcatttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccattgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctt
tttaccgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|D50517_PreS2_P-C Feature FT:CDS D50517_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|D50518_PreS2_P-C Feature FT:CDS D50518_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|D50519_PreS2_P-C Feature FT:CDS D50519_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatatcttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtattacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctgggtcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|D50520_PreS2_P-C Feature FT:CDS D50520_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatatcttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtattacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctc
tacgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ089757_PreS2_P-C Feature FT:CDS DQ089757_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK2342). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaagggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaagatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccraaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtaggg
ctttcccccaytgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaycttgaayccctt
tttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089758_PreS2_P-C Feature FT:CDS DQ089758_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1733). Complete genome. [Hepadnaviridae] (length=846 residues).
gtgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactattgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaaaatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtccaccaacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacggggccatgcaagacctgcacgagtcctgctcaaggaaactc
tacgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgaatccctt
tttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089759_PreS2_P-C Feature FT:CDS DQ089759_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1512). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgatagatcccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctggttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctgtaaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089760_PreS2_P-C Feature FT:CDS DQ089760_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK454). Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactgtcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089761_PreS2_P-C Feature FT:CDS DQ089761_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK515). Complete genome. [Hepadnaviridae] (length=846 residues).
rtgcagtggaattccagcacattccaccaagctctgctagatcccagagtgaggggcctataccttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcagtcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctgcttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgaatccctt
tttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089762_PreS2_P-C Feature FT:CDS DQ089762_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1644). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagaacattccaccaagctctgctagatcccagagtgaagggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccrcgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgaatccctt
tttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089763_PreS2_P-C Feature FT:CDS DQ089763_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1048). Complete genome. [Hepadnaviridae] (length=846 residues).
acgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgcttgatgtatctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089764_PreS2_P-C Feature FT:CDS DQ089764_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK967). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctataccttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacaggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089765_PreS2_P-C Feature FT:CDS DQ089765_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK428). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatacttccctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089766_PreS2_P-C Feature FT:CDS DQ089766_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK553). Complete genome. [Hepadnaviridae] (length=846 residues).
acgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaagggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttctatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccamggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
yaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089767_PreS2_P-C Feature FT:CDS DQ089767_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1663). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgatagatcccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccaagtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctctggtcctccaayttgtcctggttatcgctggatgtgtctgcggc
gttytatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactacaaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccattgtttggctttcagttatatggatgatgtggtattgggggccamgtctgtacaacatcttgaatccctt
tttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089768_PreS2_P-C Feature FT:CDS DQ089768_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1814). Complete genome. [Hepadnaviridae] (length=846 residues).
acacagtggaactccagcacattccaccaagctctgatagatcccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccaagtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaaccttttgtcctccaacttgtcctggttatcgctggatgtgtctgcggc
gttytatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactacaaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccattgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089769_PreS2_P-C Feature FT:CDS DQ089769_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK430). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcgtgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089770_PreS2_P-C Feature FT:CDS DQ089770_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1272). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggttc
cagttccggaacagtaaaccctgttccgaytactgcctctcccatatcgtcaatcttctcgaggaytggggaccctgcac
cgaatatggaaagcaccatatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089771_PreS2_P-C Feature FT:CDS DQ089771_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1629). Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcactacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|DQ089772_PreS2_P-C Feature FT:CDS DQ089772_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK910). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaaactctgctagatcccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccctgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctgttaccaattttcttttatctttgggtatacatttaa
>gnl|hbvcds|DQ089773_PreS2_P-C Feature FT:CDS DQ089773_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1193). Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaactccaaaacattccaccaagctctgctagatcccagagtgaggggcctataccttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttatcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccaagtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctcaaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089775_PreS2_P-C Feature FT:CDS DQ089775_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK290). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccccgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgstgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccattgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089776_PreS2_P-C Feature FT:CDS DQ089776_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK884). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggkagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactgccaaggtatgttgccc
gtttgtcctctgcttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctattaccaattttcttgtgtctttgggtatacatttaa
>gnl|hbvcds|DQ089777_PreS2_P-C Feature FT:CDS DQ089777_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1159). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcaatggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggtagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactgccaaggtatgttgccc
gtttgtcctctgcttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctattaccaattttcttgtgtctttgggtatacatttaa
>gnl|hbvcds|DQ089778_PreS2_P-C Feature FT:CDS DQ089778_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1442). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaacacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
cggttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tataccgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089779_PreS2_P-C Feature FT:CDS DQ089779_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK554). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089780_PreS2_P-C Feature FT:CDS DQ089780_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK947). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactycagcacattccaccaagctctgctagatcccagagtgaggggcckttaccttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttggttgttcttckggactaccgaggtatgttgccc
gtttgtcctcyacttccaggaacatcaactaccagcaygggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtgrttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089781_PreS2_P-C Feature FT:CDS DQ089781_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1476). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089782_PreS2_P-C Feature FT:CDS DQ089782_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK2032). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089783_PreS2_P-C Feature FT:CDS DQ089783_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1402). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcaatggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctataccttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tataccgctattaccaattttcttgtgtctttgggtatacatttaa
>gnl|hbvcds|DQ089784_PreS2_P-C Feature FT:CDS DQ089784_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1285). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctactagatcccagagtaaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccakgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089785_PreS2_P-C Feature FT:CDS DQ089785_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1386). Complete genome. [Hepadnaviridae] (length=846 residues).
gtgcggtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgtwacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggc
gttctatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaccatcttgagtccctt
tataccgctattaccaattttcttgtgtctttgggtatacatttaa
>gnl|hbvcds|DQ089786_PreS2_P-C Feature FT:CDS DQ089786_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK2074). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgagtactgcctctcccatatcgtcaatcttcgcgaggactggggaccctgcac
cgaatatggagagcatctcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctattaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|DQ089787_PreS2_P-C Feature FT:CDS DQ089787_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK352). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccaaagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089788_PreS2_P-C Feature FT:CDS DQ089788_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK820). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcaatggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctataccttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatctccctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactacaagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtcttgggggccaagtctgtacaacatcttgaatccctt
tataccgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089789_PreS2_P-C Feature FT:CDS DQ089789_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK926). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcaatggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
cagttcmggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089790_PreS2_P-C Feature FT:CDS DQ089790_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1248). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactcaagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgataactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactacaaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaaggcctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggtctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccactattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089791_PreS2_P-C Feature FT:CDS DQ089791_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1205). Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaactccarcacattccaccaagctctgccagatcccagagtgaggggcctatatcttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaaratggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaacyaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtmcaacatcttgaatccctt
tttaccgctrttaccaattttctttkgtctttgggtatacatataa
>gnl|hbvcds|DQ089792_PreS2_P-C Feature FT:CDS DQ089792_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK870). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagattccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgaytcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggcmaagtctgtacaacatcttgaatccctt
ttwaccgctattaccaattttcttttrtctttgggtatacatttaa
>gnl|hbvcds|DQ089793_PreS2_P-C Feature FT:CDS DQ089793_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK343). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ089795_PreS2_P-C Feature FT:CDS DQ089795_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1465). Complete genome. [Hepadnaviridae] (length=849 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaagcttctcgaggactggggaccctgcac
cgaacatggagaacacaatatcargattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaaattcaacaaccaccagcacggggccatgcaagacctgcacgactcctgctcaaggaac
ctctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctt
tcgcaagattcctatgggagtgggsctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgta
gggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtcc
ctttttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089796_PreS2_P-C Feature FT:CDS DQ089796_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK751). Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcgcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccgcgtgtcctggccaaaa
ttcgcggtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacctcaacmaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089797_PreS2_P-C Feature FT:CDS DQ089797_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1169). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacaatccaccaagctctgctagatcccagagtgaggagcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaaacttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaakcactcactaatctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcgtcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtcttgggggccaagwctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ089799_PreS2_P-C Feature FT:CDS DQ089799_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK734). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactctacaacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggatcatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctgttaccaattttcttttgtctttgggtatacatctga
>gnl|hbvcds|DQ089801_PreS2_P-C Feature FT:CDS DQ089801_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK2100). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacgttccaccaagctctgctagatcccagagtgaggggcctgtattttcctgctggtggctc
cagttccggaacagtaagccctgttccgactactgcctctcccatctcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ089802_PreS2_P-C Feature FT:CDS DQ089802_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1371). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccaccaagctttgctagatcccagagtgaggggcctgtatkttcctgctggtggctc
cagttccggagcagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgaatcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttaccgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ089803_PreS2_P-C Feature FT:CDS DQ089803_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK931). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactcaagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
aagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggatccctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacaacaactaccagcacgggaccatgcaagacctgcacgaatcctgctcaagggacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089804_PreS2_P-C Feature FT:CDS DQ089804_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK262). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgttagatcccagagtgaggggcctatactttcctgctggtggctc
aagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcaccacatcaggattcctagkacccctgctcgcgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctcgggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtccaccaatttgtcctggttatcgctggatgtgtctgcggc
gttctatcatattcctcttcatcctgctgctatgcctcatcttctcgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctattaccaattttcttatgtctttgggtatacatttaa
>gnl|hbvcds|DQ141656_PreS2_P-C Feature FT:CDS DQ141656_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate EIH46AChinese). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccctgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ141657_PreS2_P-C Feature FT:CDS DQ141657_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2051Java). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctctattttcctgctggtggctc
cagttccggaacagtaaaccctgttcagacttctgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcaggggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttacctctgataccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ141658_PreS2_P-C Feature FT:CDS DQ141658_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Alr016East). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaaacttccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttcttgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattactgctcaaggaacctc
tatgtttccctcttgttgctggacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccacttttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141659_PreS2_P-C Feature FT:CDS DQ141659_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Alr062East). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaaacttccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttcttgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattactgctcaaggaacctc
tatgtttccctcttgttgctggacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctattaccacttttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141660_PreS2_P-C Feature FT:CDS DQ141660_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Alr198East). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctctattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgacttctgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctgttaccaattttcttttgtctttgggtatacatctga
>gnl|hbvcds|DQ141661_PreS2_P-C Feature FT:CDS DQ141661_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SBT35East). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaaacttccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttcttgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaggacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccattgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ141662_PreS2_P-C Feature FT:CDS DQ141662_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2076Chinese). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgcaagatcccagagtgaggggcctgtattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttacatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ141663_PreS2_P-C Feature FT:CDS DQ141663_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2074Chinese). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccatatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141664_PreS2_P-C Feature FT:CDS DQ141664_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate EIHM5Chinese). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
aagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcggggtggacttctctcaattttctagggggaacacccgcgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141665_PreS2_P-C Feature FT:CDS DQ141665_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate EIH40AChinese). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacaataaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgaatcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141666_PreS2_P-C Feature FT:CDS DQ141666_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate EIH22AChinese). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
aagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcgga
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaaaacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgaacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141667_PreS2_P-C Feature FT:CDS DQ141667_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Alr006East). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
aagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcacaaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatctcgaagccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141668_PreS2_P-C Feature FT:CDS DQ141668_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SBT47East). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
aagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ246215_PreS2_P-C Feature FT:CDS DQ246215_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate GZ-DYH). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatatgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ315781_PreS2_P-C Feature FT:CDS DQ315781_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate EI0398). Non-functional genomic sequence. [Hepadnaviridae] (length=843 residues).
atgcagtgctccagcacattccaccaggctctactagatcccagagtgaagggcctatactttcctgctggtggctcaag
ttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccga
atatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctc
acaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattt
gcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtt
ttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtt
tgtcctctacttccaggaacatcaactacaagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctat
gtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaa
gattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctt
tcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatcccttttt
acctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ315783_PreS2_P-C Feature FT:CDS DQ315783_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate EI03188). Non-functional genomic sequence. [Hepadnaviridae] (length=843 residues).
atgcagtgctccagcacattccaccaggctctactagatcccagagtgaagggcctatactttcctgctggtggctcaag
ttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccga
atatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctc
acaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcaccgacgtgtcctggccaaaattt
gcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtt
ttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcgaggtatgttgcccgtt
tgtcctctacttccaggaacatcaactacaagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctat
gtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaa
gattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctt
tcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatcccttttt
acctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ370438_PreS2_P-C Feature FT:CDS DQ370438_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Z6-1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatatttacctgctggtggctc
cagttccggaacaataaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaacatgcaagacctgcacaattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacattcga
>gnl|hbvcds|DQ370439_PreS2_P-C Feature FT:CDS DQ370439_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Z6-2). Partial genome (Contains: MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
gtgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacaataaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacacgcgtgtcctggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gattgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ377160_PreS2_P-C Feature FT:CDS DQ377160_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WJT16). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgaagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtccagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgatgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ377161_PreS2_P-C Feature FT:CDS DQ377161_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WJT14). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtctccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttcaaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ377162_PreS2_P-C Feature FT:CDS DQ377162_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WJT20). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgccgctacgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ377163_PreS2_P-C Feature FT:CDS DQ377163_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WJT32). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcacaaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ377164_PreS2_P-C Feature FT:CDS DQ377164_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WJT5). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgcgttacaggcggggtttttctcgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgttcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagatccctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ377165_PreS2_P-C Feature FT:CDS DQ377165_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WJT35). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaaccccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccagggtatgttgccc
gtttgtcctctacttccaggaacatcaactacccgcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtctctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ478885_PreS2_P-C Feature FT:CDS DQ478885_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CHN-D12). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cggttccggaacagtcaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaagtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagcacggggccatgcaagacttgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ478899_PreS2_P-C Feature FT:CDS DQ478899_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CHN-D20). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctgtattttcctgctggtggctc
cagttccggaacagtacaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtatctgcggc
gttttatcatactcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcgaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgttcctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ478900_PreS2_P-C Feature FT:CDS DQ478900_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CHN-H172). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacaataaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaggaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgcagctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgagtcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccgtcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ478901_PreS2_P-C Feature FT:CDS DQ478901_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CHN-H155). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcactttccaccaggctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgggttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttaacatattcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcaacttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggaggatgtggtattgggggccaagactgtacaacatcttgactccctt
tttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ536410_PreS2_P-C Feature FT:CDS DQ536410_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate JeF339). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctctattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttaccgctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ536412_PreS2_P-C Feature FT:CDS DQ536412_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate JeF339). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttcggactactgcctcacccatatcgtcaatcttctcgaggactggggaccttgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattccccttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttaccgctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ683578_PreS2_P-C Feature FT:CDS DQ683578_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
taaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtgcaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ890381_PreS2_P-C Feature FT:CDS DQ890381_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcaatggaactccaccacatttcaccaaactctgctagatcccaaagtgaggggcctatatcttcctgttggtggctc
cagttccggaacagtaaaccctgttccgactattgcctcacccatatcgtcaatcttctcgaagactggggaccctgcac
agaacatggagagcacaacatcagggttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggttttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttctgtctttgggtatacatttga
>gnl|hbvcds|DQ922649_PreS2_P-C Feature FT:CDS DQ922649_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtcggcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggccttagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ922650_PreS2_P-C Feature FT:CDS DQ922650_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tacgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgcttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ922651_PreS2_P-C Feature FT:CDS DQ922651_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcgcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggacgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ975272_PreS2_P-C Feature FT:CDS DQ975272_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atacagtggaactccacaacattccaccaagcactgctagaccccagagtgaggggcctataccttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcgtggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacttgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ975273_PreS2_P-C Feature FT:CDS DQ975273_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatacttccctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ975274_PreS2_P-C Feature FT:CDS DQ975274_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaccattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttttcctagttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgcgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactacaagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacagaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtaccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ980547_PreS2_P-C Feature FT:CDS DQ980547_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggagcatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggccttagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ986375_PreS2_P-C Feature FT:CDS DQ986375_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccatcaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactacagcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaatctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ993181_PreS2_P-C Feature FT:CDS DQ993181_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
gtgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgaccactgcctcgcccatatcgtcaatcttctcgaggactggggtccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctgtcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccagggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggcaactgcacttgtattcccatcccatcatcctgggctttcg
caagcttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtgattcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ993690_PreS2_P-C Feature FT:CDS DQ993690_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 204-1113-Nature1.1-unSero). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctactagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtataccctgttccgactactgcctctcccctatcgtcaatcttctcgaggactggggaccctgcgc
cgaacatggagaacacaacatcatgattcctaggacccctgctcgtgatacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccaattgtcctggccaaaa
ttcgaagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctactcccaggaacatcaaccaccagctggggtccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
taagattcctatgggagtgggccacagtccgtttctcctggttcagtttactagtgccatttgtccagtggttcgtaggg
ctttcccccactgtatggctttcagttatatggatgatgtggtattgcgggccaagactgtacaacatcttgagtccctt
tttacctcaattaccaattttcttttgccattgggtatacatttaa
>gnl|hbvcds|DQ993691_PreS2_P-C Feature FT:CDS DQ993691_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 4007-0803-Nature2.2-unSero). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgagtcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ993692_PreS2_P-C Feature FT:CDS DQ993692_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 4007-0810-Nature2.1-unSero). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgaatcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ993693_PreS2_P-C Feature FT:CDS DQ993693_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 232-1125-Nature1.1-unSero). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF137802_PreS2_P-C Feature FT:CDS EF137802_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgtttcgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcactaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgccgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccaccccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatctggagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EF137803_PreS2_P-C Feature FT:CDS EF137803_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgctcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatctggagtccctt
tttacctctattaccaattttcttttgtctttgggcatacatttga
>gnl|hbvcds|EF384200_PreS2_P-C Feature FT:CDS EF384200_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CUIT-01). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atacagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
aagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF384206_PreS2_P-C Feature FT:CDS EF384206_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CUIT-07). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atrcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
aagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgatggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF494379_PreS2_P-C Feature FT:CDS EF494379_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate TW8585). Complete genome. [Hepadnaviridae] (length=846 residues).
gtgcagtggaactccaacacattccaccaagctctgctagatcccagagtgaggggcctataccttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgaatccctt
tttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF536065_PreS2_P-C Feature FT:CDS EF536065_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcactaaccttttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EF536066_PreS2_P-C Feature FT:CDS EF536066_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctgtactttcctgctggtggctc
cggttccggaacagtaaaccctgttccgactactgcctctcccatatcgccaatcttctcgaggactggggaccctgcac
cgaacatggagaacacgacatcaggattcctaggacccctgctcgtgttgcaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgcggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcactaaccttttgtcctctaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcatggctcagtttcttagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EF688062_PreS2_P-C Feature FT:CDS EF688062_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate GZ28-1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcactacatcaggattcctaggacccctgctcgcgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU075315_PreS2_P-C Feature FT:CDS EU075315_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S194-A11). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccacatcgtcaagcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcactaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaagctatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU075334_PreS2_P-C Feature FT:CDS EU075334_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S216-5). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctactagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU075335_PreS2_P-C Feature FT:CDS EU075335_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S216-9). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctactagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU075336_PreS2_P-C Feature FT:CDS EU075336_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S216-49). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctactagaccccagagtgaagggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU075337_PreS2_P-C Feature FT:CDS EU075337_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S216-B6). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctactagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccttgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtgattcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU075338_PreS2_P-C Feature FT:CDS EU075338_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S216-B9). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctactagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacataacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU075339_PreS2_P-C Feature FT:CDS EU075339_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S216-C4). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctactagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtgattcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU075340_PreS2_P-C Feature FT:CDS EU075340_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S216-C5). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctactagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgattactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtgattcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU075342_PreS2_P-C Feature FT:CDS EU075342_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S216-C14). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctactagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU082428_PreS2_P-C Feature FT:CDS EU082428_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S245-A1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU082429_PreS2_P-C Feature FT:CDS EU082429_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S245-A2). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU082430_PreS2_P-C Feature FT:CDS EU082430_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S245-A3). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU082431_PreS2_P-C Feature FT:CDS EU082431_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S245-B4). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU082432_PreS2_P-C Feature FT:CDS EU082432_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S245-B6). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcacattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU082435_PreS2_P-C Feature FT:CDS EU082435_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S245-B12). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagcacgtggccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU086837_PreS2_P-C Feature FT:CDS EU086837_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S246-1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccaccaagctctactagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccgaaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactacaaccacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU086838_PreS2_P-C Feature FT:CDS EU086838_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S246-3). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccaccaagctctactagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgacctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactacaaccacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU086839_PreS2_P-C Feature FT:CDS EU086839_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S246-5). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccaccaagctctactagaccccagagtgaggggcctataccttcctgctggtggctc
cagttccggaacaataaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactacaaccacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU086840_PreS2_P-C Feature FT:CDS EU086840_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S249-3). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=844 residues).
gcagtggaactccacaacattccaccaagccctgctagatcccagagtgaggggcctatatcttcctgctggtggctcca
gttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccg
aacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcct
cacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatt
cgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgt
tttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgt
ttgtcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctcta
tgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgca
agattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggct
ttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttt
tacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU086841_PreS2_P-C Feature FT:CDS EU086841_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S249-A1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=844 residues).
gcagtggaactccacaacattccaccaagccctgctagatcccagagtgaggggcctatattttcctgctggtggctcca
gttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccg
aacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcct
cacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatt
cgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgt
tttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgt
ttgtcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctcta
tgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgca
agattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggct
ttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttt
tacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU086842_PreS2_P-C Feature FT:CDS EU086842_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S249-A6). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
gcgcagtggaattccacaacattccaccaagccctgttagatcccagagtgaggagcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU086843_PreS2_P-C Feature FT:CDS EU086843_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S249-A9). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
gcgcagtggaactccacaacattccaccaagccctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU086844_PreS2_P-C Feature FT:CDS EU086844_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S249-A12). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
gcgcagtggaactccacaacattccaccaagccctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU086845_PreS2_P-C Feature FT:CDS EU086845_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S249-B3). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
gcgcagtggaactccacaacattccaccaagccctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttcccccttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU086846_PreS2_P-C Feature FT:CDS EU086846_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S249-B4). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
gcgcagtggaactccacaacattccaccaagccctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU086847_PreS2_P-C Feature FT:CDS EU086847_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S249-B7). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
gcgcagtggaactccacaacattccaccaagccctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU086852_PreS2_P-C Feature FT:CDS EU086852_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S251-C1). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagcaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctagttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttatctttgggtatacatttga
>gnl|hbvcds|EU093881_PreS2_P-C Feature FT:CDS EU093881_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S385-3). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctactagaccccagagtgaggggcctatactttcctgctggtggctc
cagctccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctactatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtaatgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU093882_PreS2_P-C Feature FT:CDS EU093882_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S385-2). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctactagaccccagagtgaggggcctatactttcctgctggtggctc
cagctccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctactatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtaatgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU093883_PreS2_P-C Feature FT:CDS EU093883_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S385-4). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctactagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttcgggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgtacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU093895_PreS2_P-C Feature FT:CDS EU093895_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S402-13). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atacagtggaactccacaacattccaacaaactctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcaatggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU093896_PreS2_P-C Feature FT:CDS EU093896_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S402-14). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atacagtggaactccacaacattccaacaaactctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaagacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU093898_PreS2_P-C Feature FT:CDS EU093898_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S402-4). Partial genome (Contains: LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=846 residues).
atacagtggaactccacaacattccaacaaactctgcttgatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcaatggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttag
>gnl|hbvcds|EU093900_PreS2_P-C Feature FT:CDS EU093900_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S403-6). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
gtgcagtggaactccacaactttccaccaagctctgctagatcccagagtgaggggcctatatcttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgggttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagaggctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtatctgcggg
gttttatcatattcctcttcatcctgctgctatgcctcatctgcttgttggttcttgtggactcccgaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagcacggggccctgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacgcaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU093902_PreS2_P-C Feature FT:CDS EU093902_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S404-24). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccaaagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccaaagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttgctagtgacatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU093903_PreS2_P-C Feature FT:CDS EU093903_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S406-16). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctactagatcccagagtgaagggcctatattttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gtttcatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttag
>gnl|hbvcds|EU093906_PreS2_P-C Feature FT:CDS EU093906_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S406-13). Partial genome (Contains: SHBs, Pol, HBSP). [Hepadnaviridae] (length=840 residues).
atgcagtggaactccacaacattccaccaagctctactagatcccagagtgaggggcctaattgctggtggctccagttc
aggaacagtaaaccctgttccgactattgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaaca
tggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcaca
ataccacagaatctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgca
gtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttta
tcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgt
cctctacttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtt
tccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagat
tcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcc
cccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacc
tctattaccaattttcttttgtctttgggtatacatttag
>gnl|hbvcds|EU093907_PreS2_P-C Feature FT:CDS EU093907_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S408-9). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
gtgcagtggaactccacaacattccaccaagctctactagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccccgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttag
>gnl|hbvcds|EU093908_PreS2_P-C Feature FT:CDS EU093908_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S410-7). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctactagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacggagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccctactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttag
>gnl|hbvcds|EU093909_PreS2_P-C Feature FT:CDS EU093909_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate X441-8). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctactagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacgacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttag
>gnl|hbvcds|EU093910_PreS2_P-C Feature FT:CDS EU093910_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S205-2). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctactagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagcctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttcgggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU093911_PreS2_P-C Feature FT:CDS EU093911_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S205-3). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctactagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaggacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU093912_PreS2_P-C Feature FT:CDS EU093912_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S205-9). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctactagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcggtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU093913_PreS2_P-C Feature FT:CDS EU093913_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S259-1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctactagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttctcccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU093914_PreS2_P-C Feature FT:CDS EU093914_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S259-5). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctactagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccattcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU093915_PreS2_P-C Feature FT:CDS EU093915_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S259-12). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggtactccacaacattccaccaagctctactagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttcgggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggtccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagcgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU093916_PreS2_P-C Feature FT:CDS EU093916_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S265-1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaggctctactagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU093917_PreS2_P-C Feature FT:CDS EU093917_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S265-5). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctactagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttaccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgggtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU093918_PreS2_P-C Feature FT:CDS EU093918_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S265-14). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctactagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU305540_PreS2_P-C Feature FT:CDS EU305540_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate G67-123). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgcaggtggctc
cagttccggaacagtaaaccctgttccgactactacctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU305541_PreS2_P-C Feature FT:CDS EU305541_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate G67-190). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatacgttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctaggctcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccattatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU305542_PreS2_P-C Feature FT:CDS EU305542_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate G67-1251). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtctgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306671_PreS2_P-C Feature FT:CDS EU306671_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtaaggggcctctattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgacttctgcctctcacatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctgtcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU306672_PreS2_P-C Feature FT:CDS EU306672_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtaaggggcctctattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgacttctgcctctcacatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttctatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU306673_PreS2_P-C Feature FT:CDS EU306673_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacatttcaccaagctttgctagatcccagagtgcggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtccgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU306674_PreS2_P-C Feature FT:CDS EU306674_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacatttcaccaagctttgctagatcccagagtgcagggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagcccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU306675_PreS2_P-C Feature FT:CDS EU306675_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacatttcaccaagctttgctagatcccagagtgcagggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU306685_PreS2_P-C Feature FT:CDS EU306685_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
gagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306687_PreS2_P-C Feature FT:CDS EU306687_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
aagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306688_PreS2_P-C Feature FT:CDS EU306688_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
aagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccaccacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306689_PreS2_P-C Feature FT:CDS EU306689_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
aagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcgcaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306690_PreS2_P-C Feature FT:CDS EU306690_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
aagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcgccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306691_PreS2_P-C Feature FT:CDS EU306691_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
aagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaatctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306694_PreS2_P-C Feature FT:CDS EU306694_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
aagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306713_PreS2_P-C Feature FT:CDS EU306713_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgccatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306714_PreS2_P-C Feature FT:CDS EU306714_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306719_PreS2_P-C Feature FT:CDS EU306719_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgtcc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306720_PreS2_P-C Feature FT:CDS EU306720_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
ccgttccggaacagtaaaccctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306721_PreS2_P-C Feature FT:CDS EU306721_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaatactacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggatcatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306722_PreS2_P-C Feature FT:CDS EU306722_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagcactgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306724_PreS2_P-C Feature FT:CDS EU306724_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctggtcgtgttataggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacctacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatccatttaa
>gnl|hbvcds|EU306725_PreS2_P-C Feature FT:CDS EU306725_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttaccggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306726_PreS2_P-C Feature FT:CDS EU306726_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgcgttacaggcggggtttttctcgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306727_PreS2_P-C Feature FT:CDS EU306727_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcacaaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggcccagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306728_PreS2_P-C Feature FT:CDS EU306728_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgcgttacaggcggggtttttctcgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306729_PreS2_P-C Feature FT:CDS EU306729_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactactaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgatgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcccggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU410079_PreS2_P-C Feature FT:CDS EU410079_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ph109). Complete genome. [Hepadnaviridae] (length=846 residues).
nttcagtggaactccaccacatttcatcaagctctgctagatcccagagtaaggggcctayactttcctgctggtggctc
cagttccggaacagcaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctaattccaggaacatccacaacaagcacgggaccatgcaagacctgcacgactcctgctcaaggcacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU410080_PreS2_P-C Feature FT:CDS EU410080_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ph76). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacatttcatcaagctctgctagatcccagagtaaggggcctatactttcctgctggtggctc
cagttccggaacagcaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctaattccaggaacatccacaacaagcacgggaccatgcaagacctgcacgactcctgctcaaggcacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU410081_PreS2_P-C Feature FT:CDS EU410081_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ph80). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacatttcatcaagctctgctagatcccagagtaaggggcctatactttcctgctggtggctc
cagttccggaacagcaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctaattccaggaacatccacaacaagcacgggaccatgcaaaacctgcacgactcctgctcaaggcacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctgttaccaattttcttttgtctttgggtatacatctga
>gnl|hbvcds|EU439005_PreS2_P-C Feature FT:CDS EU439005_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgactatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgacctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatccagctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU439015_PreS2_P-C Feature FT:CDS EU439015_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctataccttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacataacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU439016_PreS2_P-C Feature FT:CDS EU439016_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacataacatcaggattcctaggacccccgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactaaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactaccagggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttattgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU498227_PreS2_P-C Feature FT:CDS EU498227_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate JL). Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaactccagcacattccacaaagctctgctagatccccgagtgaggggcccatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgatgactggggaccctgcac
cgaatatggagagcaccacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcaaaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttctatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactacaaaggtatgttgccc
gtttgtcctctacttccaggaacaacaactaccagcaggggaccatgcaggacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaactttcggacgcaaattgcacttgtattcccatcccaacatctggggctttcg
caaaattcctatgggggtcggcctcagtccgtttctcctggctcaattcactagtgccatttgttcagtggttcgaagag
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaagccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU522068_PreS2_P-C Feature FT:CDS EU522068_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient 5N). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactcccgaggtatgttgcgc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtatccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU522071_PreS2_P-C Feature FT:CDS EU522071_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient 7T). Complete genome. [Hepadnaviridae] (length=846 residues).
acgcagtggaactccacaacattccaacaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
caattccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacattaccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU547562_PreS2_P-C Feature FT:CDS EU547562_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate MC05). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatc
ctcacaatactacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
rttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactrtcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggcccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttaccgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU554535_PreS2_P-C Feature FT:CDS EU554535_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S472-20). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggagcctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU554536_PreS2_P-C Feature FT:CDS EU554536_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S472-24). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagacttgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggagcatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggccccagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU554537_PreS2_P-C Feature FT:CDS EU554537_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S541-13). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgccttacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgccgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU554538_PreS2_P-C Feature FT:CDS EU554538_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S541-15). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU554539_PreS2_P-C Feature FT:CDS EU554539_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S541-21). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU554540_PreS2_P-C Feature FT:CDS EU554540_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S304-10). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctttgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaagccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgttcccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctt
tttaccgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU554541_PreS2_P-C Feature FT:CDS EU554541_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S696-1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccaaagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccgatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccacggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggcccagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttacctctattaccaattttcttttttctttgggtatacatttga
>gnl|hbvcds|EU554542_PreS2_P-C Feature FT:CDS EU554542_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S696-4). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccaaagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccgatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccacggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttacctctattaccaattttcttttttctttgggtatacatttga
>gnl|hbvcds|EU560438_PreS2_P-C Feature FT:CDS EU560438_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2-B74). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagcactgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacgcagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggtaacacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcccctacttccaggaacatcaaccaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatttggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU560439_PreS2_P-C Feature FT:CDS EU560439_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 7-B74). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagcactgctagatcccaaagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttccagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccgatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagtgcgggaccatgcaagacctgcacgagtcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU560440_PreS2_P-C Feature FT:CDS EU560440_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1-S869). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtaaggggcctatatcttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggttcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU560441_PreS2_P-C Feature FT:CDS EU560441_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 4-S869). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactacaaccacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctatcaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU562215_PreS2_P-C Feature FT:CDS EU562215_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 11). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctacacagttcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagcccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU562216_PreS2_P-C Feature FT:CDS EU562216_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 13). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tccgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtatctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttgactttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU562217_PreS2_P-C Feature FT:CDS EU562217_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 16). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacagttcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU562218_PreS2_P-C Feature FT:CDS EU562218_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 7). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatccaagagtgaggggtctatatttccctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggctatcgctggatgtatctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU570067_PreS2_P-C Feature FT:CDS EU570067_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 18-S541). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctgtcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggagactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttatctttgggtatacatttga
>gnl|hbvcds|EU570068_PreS2_P-C Feature FT:CDS EU570068_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 26-S541). Complete genome. [Hepadnaviridae] (length=846 residues).
ttgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccaccgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU570072_PreS2_P-C Feature FT:CDS EU570072_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1-B74). Complete genome. [Hepadnaviridae] (length=846 residues).
acgcagtggacctccacaacattccaccaagcactgctagatcccagagtgaggggcctatatcttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatatgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccattatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU570073_PreS2_P-C Feature FT:CDS EU570073_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 8-S698). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgttggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaa
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaaactc
tacgtttccctcttgttgctgtataaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggaatgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU570074_PreS2_P-C Feature FT:CDS EU570074_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 11-S698). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgttggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaa
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaaactc
tacgtttccctcttgttgctgtataaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggaatgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU579442_PreS2_P-C Feature FT:CDS EU579442_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 6). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtaaggggcctatatcttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacgataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggttcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctattaccaattttcttatgtctttgggtatacatttga
>gnl|hbvcds|EU579443_PreS2_P-C Feature FT:CDS EU579443_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccaccaagctctgctagaccccagagtgagaggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactattgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU589336_PreS2_P-C Feature FT:CDS EU589336_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1175-1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactattgcctcacccatatcgtcaatcttctcgaggactggggaccctgtac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcagggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttctttggtctttgggtatacatttga
>gnl|hbvcds|EU670263_PreS2_P-C Feature FT:CDS EU670263_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ph105). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgagaggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccacatcgtcaaccttctcgaggactggggaccctgcac
tgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccatgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggatcatcaaccaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU717212_PreS2_P-C Feature FT:CDS EU717212_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D26K-7). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatatttccctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacgcaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU717215_PreS2_P-C Feature FT:CDS EU717215_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Q67K-1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggactcctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttccagggggagcacccaagtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgccaacggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgtacttgcattcccatcccatcgtcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU796069_PreS2_P-C Feature FT:CDS EU796069_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcccatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcttcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcactaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacctcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagcttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctctgggtatacatttga
>gnl|hbvcds|EU796070_PreS2_P-C Feature FT:CDS EU796070_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atacagtggaattccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacaggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagactgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU796072_PreS2_P-C Feature FT:CDS EU796072_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atacagtggaattccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacaggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagactgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU871969_PreS2_P-C Feature FT:CDS EU871969_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 6-024-1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggagtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccgaggtatgttgccc
gtttgtcctcttcttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaaactc
tacgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctattaccaatttcctgttgtctttgggcatacatttga
>gnl|hbvcds|EU871970_PreS2_P-C Feature FT:CDS EU871970_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 6-024-3). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggtctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccgaggtatgttgccc
gtttgtcctcttcatccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaaactc
tacgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctattaccaatttcctgttgtctttgggcatacatttga
>gnl|hbvcds|EU871971_PreS2_P-C Feature FT:CDS EU871971_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 6-024-5). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatgctttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccaaagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctcttcttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaaactc
tacgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctattaccaattttctgttgtctttgggtatacatttga
>gnl|hbvcds|EU871972_PreS2_P-C Feature FT:CDS EU871972_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 6-024-8). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaagactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccgaggtatgttgccc
gtttgtcctcttcttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaaactc
tacgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgctatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctattaccaatttcctgttgtctttgggcatacatttga
>gnl|hbvcds|EU871973_PreS2_P-C Feature FT:CDS EU871973_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 6-024-99-5). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggactcctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccaagtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctcttcttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaaactc
tacgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctattaccaatttcctgttgtctttgggcatacatttga
>gnl|hbvcds|EU871974_PreS2_P-C Feature FT:CDS EU871974_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 6-024A-1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacgcctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctcttcttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaaactc
tacgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctattaccaatttcctgttgtctttgggcatacatttga
>gnl|hbvcds|EU871975_PreS2_P-C Feature FT:CDS EU871975_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 6-024A-8). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccaaagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactacaaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU871976_PreS2_P-C Feature FT:CDS EU871976_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 179-04-3). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggaaaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatctttggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU871977_PreS2_P-C Feature FT:CDS EU871977_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 252-2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccaaagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactacaaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU871978_PreS2_P-C Feature FT:CDS EU871978_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 252-95-2). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcaatggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctataccttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacagacggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU871979_PreS2_P-C Feature FT:CDS EU871979_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 252-95-4). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccagaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU871980_PreS2_P-C Feature FT:CDS EU871980_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 318-01-5). Complete genome. [Hepadnaviridae] (length=846 residues).
gtgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatacttccatgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacggagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacctcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU871982_PreS2_P-C Feature FT:CDS EU871982_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 318-96-2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU871998_PreS2_P-C Feature FT:CDS EU871998_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 530-00-5). Complete genome. [Hepadnaviridae] (length=846 residues).
gtgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatacttccatgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacggagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacctcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU872000_PreS2_P-C Feature FT:CDS EU872000_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 530-92-2). Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaactccacaacattccaccaaactctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgtctcacccatatcgtcaatctcctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactatttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU872001_PreS2_P-C Feature FT:CDS EU872001_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 530-92-8). Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaactccacaacattccaccaaactctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgtctcacccatatcgtcaatctcctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU872002_PreS2_P-C Feature FT:CDS EU872002_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 530-97-1). Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaactccacaacattccaccaaactctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgtctcacccatatcgtcaatctcctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttccctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcccccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatgcatttga
>gnl|hbvcds|EU872003_PreS2_P-C Feature FT:CDS EU872003_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 530-97-2). Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaactccacaacattccaccaaactctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgtctcacccatatcgtcaatctcctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU872004_PreS2_P-C Feature FT:CDS EU872004_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 530-97-3). Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaactccacaacattccaccaaactctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgtctcacccatatcgtcaatctcctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU872008_PreS2_P-C Feature FT:CDS EU872008_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 252A-8). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaaattcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU872010_PreS2_P-C Feature FT:CDS EU872010_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 252-92-3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU872012_PreS2_P-C Feature FT:CDS EU872012_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 318-99-5). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atacagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttctaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttaccgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU881996_PreS2_P-C Feature FT:CDS EU881996_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient17). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccaaagtgaggggcctatatttccctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagcacggggacatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctattaccaattttcttatgtctttgggtatacatttaa
>gnl|hbvcds|EU882005_PreS2_P-C Feature FT:CDS EU882005_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient22). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
acgcagtggaactccacaacattccaccaagctctactagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccgggacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU916204_PreS2_P-C Feature FT:CDS EU916204_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1.1). Partial genome (Contains: HBx, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaaactctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctggactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttctaggaacatcaacaaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtgattcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatgcatttga
>gnl|hbvcds|EU916210_PreS2_P-C Feature FT:CDS EU916210_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S2.4). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggccttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttctgtctttgggtatacatttga
>gnl|hbvcds|EU916219_PreS2_P-C Feature FT:CDS EU916219_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S5.1). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaagccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacctctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaacaccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagatctgcacaattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU916222_PreS2_P-C Feature FT:CDS EU916222_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S5.4). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaagccctgttccgactactgcctcacccatatcgtcaatcttctcgagggctggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtatccccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU916223_PreS2_P-C Feature FT:CDS EU916223_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S6.1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccatcaagctctgctagatcccaaagtgaggggcctatattttcctgctggtggatc
cagttcaggaacagtaagccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggactgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU916224_PreS2_P-C Feature FT:CDS EU916224_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S6.2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccatcaagctctgctagatcccaaagtgaggggcctatattttcctgctggtggatc
cagttcaggaacagtaagccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggactgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU916225_PreS2_P-C Feature FT:CDS EU916225_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S6.3). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaagactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctc
tatgtttccctcttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagcgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtccgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU916229_PreS2_P-C Feature FT:CDS EU916229_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S7.4). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccaaagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaatacctcagagtctagactcgtggtggacttctctcaatttctagggggaagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcctgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU916233_PreS2_P-C Feature FT:CDS EU916233_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SWT1.1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctggaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgaccactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcgctcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU916234_PreS2_P-C Feature FT:CDS EU916234_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SWT1.2). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctggaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgaccgctgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccacgcaagacctgcacgagtcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtataacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU916237_PreS2_P-C Feature FT:CDS EU916237_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SWT2.2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
ctgttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacagcatcaggatccctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagcacgggaccatgcaggacctgcacgattcctgctcaaggaacctc
tatgtttccctcctgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU916238_PreS2_P-C Feature FT:CDS EU916238_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SWT2.3). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagcacgggaccatgcaggacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU919164_PreS2_P-C Feature FT:CDS EU919164_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient24). Partial genome (Contains: HBx, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccccaacattccaccaagctctgctagatcccagagtgaggggcccatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctaacaataccacagagtctaggctcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtgattcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU919168_PreS2_P-C Feature FT:CDS EU919168_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient26). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccaggtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgaatcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacagaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU919169_PreS2_P-C Feature FT:CDS EU919169_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient26). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccaaagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggggaccctgtac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccaggtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacagcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggcatacatttga
>gnl|hbvcds|EU939536_PreS2_P-C Feature FT:CDS EU939536_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C3). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatatcttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcacttaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcgactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU939538_PreS2_P-C Feature FT:CDS EU939538_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C9). Complete genome. [Hepadnaviridae] (length=846 residues).
gtgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU939539_PreS2_P-C Feature FT:CDS EU939539_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C22). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatatcttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgggttacaggcggggtttttcttgttgacaagaatc
ctcacaatactacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
attttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatttggtattgggggcgaagtctgtacaacatcttgagtccctt
tttaccgctattaccaattttcttttgtctttgggtattcatttga
>gnl|hbvcds|EU939540_PreS2_P-C Feature FT:CDS EU939540_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C24). Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcacmaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939541_PreS2_P-C Feature FT:CDS EU939541_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C25). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU939542_PreS2_P-C Feature FT:CDS EU939542_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C26). Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaactccacaacattccaccaagctctgctagatcccagagtcagaggcctatatcttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggggaccctgcgc
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagaatctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcactaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggctcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctgttaccaattttcttttatctttgggtatccatttga
>gnl|hbvcds|EU939543_PreS2_P-C Feature FT:CDS EU939543_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C38). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccacagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacatgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU939544_PreS2_P-C Feature FT:CDS EU939544_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C39). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctataccttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttgggtcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacacttga
>gnl|hbvcds|EU939545_PreS2_P-C Feature FT:CDS EU939545_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C41). Complete genome. [Hepadnaviridae] (length=846 residues).
acgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggatatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactgccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatattgatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939546_PreS2_P-C Feature FT:CDS EU939546_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C44). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaaactctgctagaccccagagtgagaggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgggttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcactaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccgaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU939548_PreS2_P-C Feature FT:CDS EU939548_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C46). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaaactctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU939549_PreS2_P-C Feature FT:CDS EU939549_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C49). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgatagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtgattcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU939550_PreS2_P-C Feature FT:CDS EU939550_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C55). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatatttycctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcactcaagtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgcacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU939552_PreS2_P-C Feature FT:CDS EU939552_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C57). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaactttccaccaagctctgctagatccaagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagtacgggaccctgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcctgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU939554_PreS2_P-C Feature FT:CDS EU939554_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C61). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcactggatgtgtctgcggc
attttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU939555_PreS2_P-C Feature FT:CDS EU939555_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C63). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttstggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtgattcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU939556_PreS2_P-C Feature FT:CDS EU939556_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C64). Non-functional genomic sequence. [Hepadnaviridae] (length=837 residues).
acgcagtggaactccacaacattccaccaagctctgctagaccccaaagtgaggggtcctgctggtggctccagttccgg
aacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatgg
agaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaata
ccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtc
cccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatca
tattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcct
ctacttccaggaacgtcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttcc
ctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatctttggctttcgcaagattcc
tatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttccccc
actgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctct
attaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU939561_PreS2_P-C Feature FT:CDS EU939561_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C70). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatatcttcctgttggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcactaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcaatggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU939562_PreS2_P-C Feature FT:CDS EU939562_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C75). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU939563_PreS2_P-C Feature FT:CDS EU939563_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C76). Complete genome. [Hepadnaviridae] (length=846 residues).
acgcagtggaattccacaacattccaccaagctctgctagaccccagagtgaggggcctataccttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctgttacmaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU939564_PreS2_P-C Feature FT:CDS EU939564_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C77). Complete genome. [Hepadnaviridae] (length=846 residues).
gtgaagtggaactccacaacgttccaccaagctctgctagatcccagagtgaggggcctataccttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactcctgcctcgcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaaaacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggttttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939566_PreS2_P-C Feature FT:CDS EU939566_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C88). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgaccactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaagacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacagaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU939567_PreS2_P-C Feature FT:CDS EU939567_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C91). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctataccttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatattgatgatgtggtattgggggcgaagtctgtacaccatcttgagtccctt
tttaccgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU939568_PreS2_P-C Feature FT:CDS EU939568_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C93). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccaaagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataacacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatatgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU939569_PreS2_P-C Feature FT:CDS EU939569_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C102). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactctacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctc
tatgtttccctcgtgatgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU939570_PreS2_P-C Feature FT:CDS EU939570_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C103). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcaatggaattccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcgc
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU939571_PreS2_P-C Feature FT:CDS EU939571_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C104). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgagaggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcacttaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttaccgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU939572_PreS2_P-C Feature FT:CDS EU939572_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C105). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggattggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatc
ctcacaataccacagagtctagactcgtggttgacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcatgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU939573_PreS2_P-C Feature FT:CDS EU939573_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C106). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatccaagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaagactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctc
tatgtttccctcttgctgttgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU939578_PreS2_P-C Feature FT:CDS EU939578_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C119). Complete genome. [Hepadnaviridae] (length=846 residues).
acgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacttgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU939579_PreS2_P-C Feature FT:CDS EU939579_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C120). Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccgggacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgcgttacaggcggggtttttctcgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgactcctgctcgaggaaactc
tacgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttatctttgggtatacatttga
>gnl|hbvcds|EU939582_PreS2_P-C Feature FT:CDS EU939582_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate B25). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatatcttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcaccaaagtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcatgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatttggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939584_PreS2_P-C Feature FT:CDS EU939584_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate B107). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttcttgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcagc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccacaaccacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtgattcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU939585_PreS2_P-C Feature FT:CDS EU939585_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate B126). Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatatcttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccaggtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939586_PreS2_P-C Feature FT:CDS EU939586_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate B142). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
acgcagtggaactccacaacagtccaccaagctctgctagaccccagagtgaggggcctataccttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagtacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939587_PreS2_P-C Feature FT:CDS EU939587_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatatcttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctatttccaattttcttttgtctctgggtatacatttga
>gnl|hbvcds|EU939588_PreS2_P-C Feature FT:CDS EU939588_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C173). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacgacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccgaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacagttcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggttttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU939590_PreS2_P-C Feature FT:CDS EU939590_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C127). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcaatggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaaaacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU939591_PreS2_P-C Feature FT:CDS EU939591_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C131). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcaatggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaaaacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU939592_PreS2_P-C Feature FT:CDS EU939592_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C141). Complete genome. [Hepadnaviridae] (length=846 residues).
acgcagtggaactccacaacattccaccaaactctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgcgttacaggcggggtttttctcgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU939593_PreS2_P-C Feature FT:CDS EU939593_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C144). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatccaagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939594_PreS2_P-C Feature FT:CDS EU939594_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C146). Complete genome. [Hepadnaviridae] (length=846 residues).
acgcagtggaactccccaacgttccaccaaactctgctagatcccagagtgaggggcctataccttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaggacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttatctttgggtatacatttga
>gnl|hbvcds|EU939595_PreS2_P-C Feature FT:CDS EU939595_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C147). Complete genome. [Hepadnaviridae] (length=846 residues).
gtgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU939596_PreS2_P-C Feature FT:CDS EU939596_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C149). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccaaagtgagaggtctatactttcctgctggtggctc
cagttccggaacagcaaaccctgttccgactattgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgccctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctcgatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU939597_PreS2_P-C Feature FT:CDS EU939597_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C151). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgttagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattctctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU939599_PreS2_P-C Feature FT:CDS EU939599_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C172). Non-functional genomic sequence. [Hepadnaviridae] (length=843 residues).
atgcagtgaaacacaacattccaccaagctctgctagatcccagagtgaggggcctgtattttcctgctggtggctccag
ttccggaactgtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccga
acatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctc
acaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattc
gcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtt
ttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtt
tgtcctcttcttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctat
gtttccctcttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaa
gattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctt
tcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttat
accgctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU939600_PreS2_P-C Feature FT:CDS EU939600_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C176). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgctagaccccagagtgaggggcctataccttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU939601_PreS2_P-C Feature FT:CDS EU939601_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C177). Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939603_PreS2_P-C Feature FT:CDS EU939603_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C183). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggaytcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggctcttctggactgtcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaaccttcggacgsaaactgcacttgtattcccatcccatcgtcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagygccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU939604_PreS2_P-C Feature FT:CDS EU939604_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C192). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctttactagaccccagagtgaggggcctatactttcctgatggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctatacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU939605_PreS2_P-C Feature FT:CDS EU939605_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C200). Complete genome. [Hepadnaviridae] (length=846 residues).
agtcagtggaactcaacaacattccaccaagctctgctagaccccagagtgaggggcctataccttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU939607_PreS2_P-C Feature FT:CDS EU939607_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C207). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctactagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggaggggtttttctcgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcacaaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttatctttgggcattcatttaa
>gnl|hbvcds|EU939609_PreS2_P-C Feature FT:CDS EU939609_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C209). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaacaagctctgctagaccccagagtgaggggcctatacttccctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU939610_PreS2_P-C Feature FT:CDS EU939610_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C211). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcaatggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctcttcttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU939611_PreS2_P-C Feature FT:CDS EU939611_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C212). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcaccmaagtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaacaaccagcacaggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU939612_PreS2_P-C Feature FT:CDS EU939612_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C213). Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaactccacaacattccaccaagctctgctagatccaagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttatctttgggtatacatttga
>gnl|hbvcds|EU939613_PreS2_P-C Feature FT:CDS EU939613_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C214). Complete genome. [Hepadnaviridae] (length=846 residues).
aygcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctttattttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU939614_PreS2_P-C Feature FT:CDS EU939614_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C217). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctttatcttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactgccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaacaaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU939615_PreS2_P-C Feature FT:CDS EU939615_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C226). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaagccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaaytcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU939616_PreS2_P-C Feature FT:CDS EU939616_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C228). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
gtgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacctcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU939617_PreS2_P-C Feature FT:CDS EU939617_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C229). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccgggacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctt
tataccgctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU939618_PreS2_P-C Feature FT:CDS EU939618_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C230). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaagggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU939619_PreS2_P-C Feature FT:CDS EU939619_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C233). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctttgctagaccccaaagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcggtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgcacaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939625_PreS2_P-C Feature FT:CDS EU939625_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C167). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaactttccaccaagctctgctagatcccagagtgaggggcctttactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggggaccctgtac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactgtcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacggggccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttaccgctgttaccgcttttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939626_PreS2_P-C Feature FT:CDS EU939626_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D158). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaactttccaccaagctctgctagatcccagagtgaggggcctttactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaaccttttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactmtcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacggggccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttaccgctgttaccamttttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939640_PreS2_P-C Feature FT:CDS EU939640_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C239). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccgggacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcaccaaagtgtcctggccaaaa
ttcgcagtccccaacctscaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU939642_PreS2_P-C Feature FT:CDS EU939642_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D20). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatacactcttgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU939644_PreS2_P-C Feature FT:CDS EU939644_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D36). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcaatggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagtacccaagtgtcctggccaaaa
ttcgcagtccccaaccttcaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctgcttccaggaacatcaactaccagcacgggaccatgcaagacctgcaccaatcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
taagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggttttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU939646_PreS2_P-C Feature FT:CDS EU939646_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D88). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
gtgaagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaagaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctataaccaattttctgttgtctttgggtatacatttga
>gnl|hbvcds|EU939647_PreS2_P-C Feature FT:CDS EU939647_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D90). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctggatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgccttacccatatcgtcaatcttctcgaggattggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggcctaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU939648_PreS2_P-C Feature FT:CDS EU939648_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D96). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggggaccctgcac
tgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU939649_PreS2_P-C Feature FT:CDS EU939649_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D98). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccataacattccaccaagctctgctagatcccagagtaaggggcctatattttcctgctggtggctc
cagttccggaatagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccaagtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
taagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU939651_PreS2_P-C Feature FT:CDS EU939651_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D104). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaacaccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcacttaccaacctcttgtcctccaacttgtcctggctatcgctggatgtatctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacaacaactaccagcacgggaccatgcaagacctgcacgactcctgctcaagggacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU939652_PreS2_P-C Feature FT:CDS EU939652_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D107). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939653_PreS2_P-C Feature FT:CDS EU939653_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D109). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgctagatcccagagtgaagggcctatattttcctgctggtggctc
cagttccggaacaataaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacgcaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU939654_PreS2_P-C Feature FT:CDS EU939654_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D115). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atacagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatatcttcctgctggtggctc
cagttccggaacagtaaaccctgttccgaccactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU939655_PreS2_P-C Feature FT:CDS EU939655_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D116). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctcttctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagttggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU939656_PreS2_P-C Feature FT:CDS EU939656_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D117). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctcttctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagttggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU939657_PreS2_P-C Feature FT:CDS EU939657_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D139). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccgatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaaactc
tacttttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcgtcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccattgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgaggccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU939658_PreS2_P-C Feature FT:CDS EU939658_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D142). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactcaacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaagtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttcactcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtgattcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939659_PreS2_P-C Feature FT:CDS EU939659_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D165). Complete genome. [Hepadnaviridae] (length=846 residues).
gtgcagtggacttccacaacattccaccaaactctgctagaccccagagtgaggggcctataccttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttccagggggagcacccaggtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ023639_PreS2_P-C Feature FT:CDS FJ023639_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_C04-0968). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaacacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
aagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatctyctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacrggaggggtttttctygttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaacaaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgaatccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023641_PreS2_P-C Feature FT:CDS FJ023641_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_C04-1237). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
aagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023642_PreS2_P-C Feature FT:CDS FJ023642_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_C04-1257). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
aagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023643_PreS2_P-C Feature FT:CDS FJ023643_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_C04-1306). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaaaatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023644_PreS2_P-C Feature FT:CDS FJ023644_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_C04-1318). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaaaatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023645_PreS2_P-C Feature FT:CDS FJ023645_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_M04-0071). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
aagttccggaacattaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaagacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggacttccacggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttacctctattaccaattttcttttatctttgggtatacatttaa
>gnl|hbvcds|FJ023646_PreS2_P-C Feature FT:CDS FJ023646_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_M04-0201). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcaatggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccgcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgcttctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtaccaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ023647_PreS2_P-C Feature FT:CDS FJ023647_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_M04-0214). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctactagatcccagagtgaggggcctatactttcctgctggtggctc
aagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023648_PreS2_P-C Feature FT:CDS FJ023648_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_M04-0273). Complete genome. [Hepadnaviridae] (length=846 residues).
ataaagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatacattcctgctggtggctc
aagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccgaggtatgttgccc
gtttgtcctctacttccaggaacatcaacyaccagcacgggaccatgcaagacctgcacgastcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023649_PreS2_P-C Feature FT:CDS FJ023649_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_M04-0289). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
aagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgttggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023650_PreS2_P-C Feature FT:CDS FJ023650_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_M04-0341). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcttatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023653_PreS2_P-C Feature FT:CDS FJ023653_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_M04-0909). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023654_PreS2_P-C Feature FT:CDS FJ023654_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_C04-1412). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctcttctagatcccagagtgaggggcctatactttcctgctggtggctc
aagttccgggacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcctgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023656_PreS2_P-C Feature FT:CDS FJ023656_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_M04-0938). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcaatggaactccagcacattccaccaagctctactagatcccagagtgaggggcctatactttcctgctggtggctc
aagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023657_PreS2_P-C Feature FT:CDS FJ023657_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_M04-0987). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
aagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023658_PreS2_P-C Feature FT:CDS FJ023658_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_M04-1116). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
aagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ032331_PreS2_P-C Feature FT:CDS FJ032331_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S193-1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatccaagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcctgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ032332_PreS2_P-C Feature FT:CDS FJ032332_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S265-10). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtgaaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcactaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgcacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ032333_PreS2_P-C Feature FT:CDS FJ032333_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S359-7). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatatttccctgctggtggctc
cagttccggaacagtaagccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggttcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctctgggtatacatttga
>gnl|hbvcds|FJ032334_PreS2_P-C Feature FT:CDS FJ032334_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S445-3). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgccc
gtttgtcctctacttccaggatcatcaaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagcgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ032336_PreS2_P-C Feature FT:CDS FJ032336_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S462-4). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccaaagtgaggggcctataccttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacggggccatgcaagaccagcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgcttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggccttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ032338_PreS2_P-C Feature FT:CDS FJ032338_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S462-7). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccaaagtgaggggcctataccttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ032339_PreS2_P-C Feature FT:CDS FJ032339_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S462-9). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccaaagtgaggggcctataccttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ032340_PreS2_P-C Feature FT:CDS FJ032340_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S529-1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaagggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacgataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccaagtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacgggaactgcacttgtattcccatcccatcatcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcctggttcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttaccgctgttaccaattttcttttgtctttgggtacacatttga
>gnl|hbvcds|FJ032341_PreS2_P-C Feature FT:CDS FJ032341_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S529-6). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaagggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccaagtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcctggttcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttaccgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ032345_PreS2_P-C Feature FT:CDS FJ032345_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S696-3). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccaaagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgccaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccgatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccacggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttacctctattaccaattttcttttttctttgggtatacatttga
>gnl|hbvcds|FJ032346_PreS2_P-C Feature FT:CDS FJ032346_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S732-3). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcatctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtataaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ032350_PreS2_P-C Feature FT:CDS FJ032350_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S943-1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttcttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatacaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggcttttagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttctggtgtctttgggtatacatttga
>gnl|hbvcds|FJ032351_PreS2_P-C Feature FT:CDS FJ032351_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S943-5). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggattggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacgcaaactgcacttgtattcccatcccatcatcctgggcttccg
caagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttctggtgtctttgggcatacatttga
>gnl|hbvcds|FJ032355_PreS2_P-C Feature FT:CDS FJ032355_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1030-8). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
tgaacatggagaacacaacatcaggattcctaggacccccgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcactattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggactgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ032356_PreS2_P-C Feature FT:CDS FJ032356_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1030-9). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccccaacattccaccaagctctgctagaccccagagtgaggggcctacactttcctgctggtggctc
cggttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
tgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggcggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcactattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggactgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ032359_PreS2_P-C Feature FT:CDS FJ032359_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1634-1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtaaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ032360_PreS2_P-C Feature FT:CDS FJ032360_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1634-2). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtaaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacacggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgagctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ032361_PreS2_P-C Feature FT:CDS FJ032361_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1634-7). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtaaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaaccactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagcttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacccctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ349225_PreS2_P-C Feature FT:CDS FJ349225_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate H94). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagatcccagagtgagaggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgttggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttacctctattaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|FJ386574_PreS2_P-C Feature FT:CDS FJ386574_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1743). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ386575_PreS2_P-C Feature FT:CDS FJ386575_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1745). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcgcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatctga
>gnl|hbvcds|FJ386576_PreS2_P-C Feature FT:CDS FJ386576_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1746). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacctcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ386577_PreS2_P-C Feature FT:CDS FJ386577_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1747). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactcaacaacattccaccaaactctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ386579_PreS2_P-C Feature FT:CDS FJ386579_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1762). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatatcttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggactgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ386587_PreS2_P-C Feature FT:CDS FJ386587_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1812). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ386588_PreS2_P-C Feature FT:CDS FJ386588_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1828). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ386589_PreS2_P-C Feature FT:CDS FJ386589_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1830). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaactttccaccaggctctgctagatccaagagtgaggggcctatatttccctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagagtc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggatatcgctggatgtatctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggatcatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ386591_PreS2_P-C Feature FT:CDS FJ386591_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1869). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaaggcctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcggtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ386592_PreS2_P-C Feature FT:CDS FJ386592_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1870). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatacttacctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctargacccctgctcgtgttacaggcggggttttccttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ386595_PreS2_P-C Feature FT:CDS FJ386595_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1879). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccgaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ386596_PreS2_P-C Feature FT:CDS FJ386596_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1887). Complete genome. [Hepadnaviridae] (length=846 residues).
acgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatatcttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ386597_PreS2_P-C Feature FT:CDS FJ386597_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1888). Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaactccacaacattccaccaagctctactagaccccagagtgaggggcctataccttcctgctggtggctc
cagttccggaacaataaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
tttaccgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ386598_PreS2_P-C Feature FT:CDS FJ386598_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1889). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctcaaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ386601_PreS2_P-C Feature FT:CDS FJ386601_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1912). Complete genome. [Hepadnaviridae] (length=846 residues).
atccaatggaactccgcaacgttccaccaagctctgctagatccccgagtgaggggcttatattttcctgctggtggctc
cttctccggaacagtaaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaggacctgcacgattactgctcaaggaacctc
tatgtttccctcttgttgctgtaccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ386602_PreS2_P-C Feature FT:CDS FJ386602_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1914). Complete genome. [Hepadnaviridae] (length=846 residues).
acgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgcgttacaggcggggcttttctcgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ386603_PreS2_P-C Feature FT:CDS FJ386603_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1949). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccactctctgctagatcccagagtgaggggcctatattttgctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaggacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ386604_PreS2_P-C Feature FT:CDS FJ386604_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1950). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccccaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacatgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatctttggctttcg
caagattcctatgggagtgggcctcagtccgtttctcatggttcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ386605_PreS2_P-C Feature FT:CDS FJ386605_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1965). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccakagtgaggggcctatattttcctgctggtggctc
cagttccggaacartaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
tgaacatggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgaagccctt
tttacctctgttaccaattttcttttgtctctgggtatacatctaa
>gnl|hbvcds|FJ386607_PreS2_P-C Feature FT:CDS FJ386607_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1967). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaggctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
aagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcactcaagtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactacaaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggattgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ386609_PreS2_P-C Feature FT:CDS FJ386609_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1999). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatccactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ386611_PreS2_P-C Feature FT:CDS FJ386611_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2018). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactctacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcactcacgtgtcctggccgaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccagggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacagttcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcgtcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaccatcttgagtccctt
tttacctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ386612_PreS2_P-C Feature FT:CDS FJ386612_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2019). Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctataccttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tacgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttctttggtctttgggtatacatttga
>gnl|hbvcds|FJ386613_PreS2_P-C Feature FT:CDS FJ386613_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2039). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgctagatccaagagtgaggggcctctattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggatcatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ386614_PreS2_P-C Feature FT:CDS FJ386614_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2040). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctctactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaacgaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggttttgggggcgaagtctgtacaacatcttgagtccctt
tttacctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ386617_PreS2_P-C Feature FT:CDS FJ386617_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2093). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
aygcagtggaattccacaacattccaccaagctctgctagatccaagagtgaggggcctatatcttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgacctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgccgccatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctccacttccaggatcatcaacaaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcttggttcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctattaccaattttcttgtgtctttgggtatacatttga
>gnl|hbvcds|FJ386618_PreS2_P-C Feature FT:CDS FJ386618_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2111). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaraatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ386619_PreS2_P-C Feature FT:CDS FJ386619_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2119). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ386620_PreS2_P-C Feature FT:CDS FJ386620_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2121). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacgttccaccaagctctgctagatccaaaagtgaggggcctctattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagtacgggaccctgcaagacctgcacggttcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ386623_PreS2_P-C Feature FT:CDS FJ386623_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2165). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaactttccaccaagctctgctagatcccagagtgaggggcctttactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcggttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ386624_PreS2_P-C Feature FT:CDS FJ386624_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2187). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgcggggcctatattttcctgctggtggctc
cagttccggaacagtaagccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcaccaaagtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacttgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacgcaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ386625_PreS2_P-C Feature FT:CDS FJ386625_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2190). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttcgcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcactaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ386626_PreS2_P-C Feature FT:CDS FJ386626_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2205). Complete genome. [Hepadnaviridae] (length=846 residues).
atacactgccactccacgctattccaccaagttctgcgagatcccttagttgcgggtggatattttcctgctggaggatc
cagttctggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctygttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgcagctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgaggccctt
tttaccgctattaccaattttcttttgtctttgggtatacatctga
>gnl|hbvcds|FJ386627_PreS2_P-C Feature FT:CDS FJ386627_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2242). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
caattccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaag
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ386628_PreS2_P-C Feature FT:CDS FJ386628_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2255). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctataccttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggattgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ386630_PreS2_P-C Feature FT:CDS FJ386630_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2336). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcaatggaattccacaacattccaccaagctctgctagaccccagagtgaggggcctatatcttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgyctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggagcctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ386631_PreS2_P-C Feature FT:CDS FJ386631_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2359). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcaatggaactccacaacattccaccaagctttgctagatcccagagtgaggggcctatatcttcctgctggtggctc
cagttccggaacaataaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacagttcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttaccgctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ386632_PreS2_P-C Feature FT:CDS FJ386632_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2370). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagacttgtggtggacttctctcaattttctaggggaagcacccaagtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ386637_PreS2_P-C Feature FT:CDS FJ386637_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2151). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ386638_PreS2_P-C Feature FT:CDS FJ386638_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2015). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgaccactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtctttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgacctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaatctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattccgatgggagtgggcctcagtccgtttctcctgactcagtttactagtgccatttgttcagtgattcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctattaccaattttcttgtgtctttgggtatacatttga
>gnl|hbvcds|FJ386639_PreS2_P-C Feature FT:CDS FJ386639_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1929). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|FJ386644_PreS2_P-C Feature FT:CDS FJ386644_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S737). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ386647_PreS2_P-C Feature FT:CDS FJ386647_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2400). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccaccaagctctgctagatcccagagtgaggggcctatatsttcctgctggtggctc
cagttccggaacagcaaaccctgttccgactactgcctcacccacatcgtcaatcttctcgaggattggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcgtcctgggctttcg
caagattccaatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ386650_PreS2_P-C Feature FT:CDS FJ386650_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2468). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggtctataccttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgagtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctgactcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ386651_PreS2_P-C Feature FT:CDS FJ386651_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2476). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcactggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacagcgtcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaacctacggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ386652_PreS2_P-C Feature FT:CDS FJ386652_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2518). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacaataaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggcacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ386653_PreS2_P-C Feature FT:CDS FJ386653_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S3). Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgtctcacccatatcgtcaaccttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctattaccaattttcttgtgtctttgggtatacatttga
>gnl|hbvcds|FJ386657_PreS2_P-C Feature FT:CDS FJ386657_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S165). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ386659_PreS2_P-C Feature FT:CDS FJ386659_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S219). Complete genome. [Hepadnaviridae] (length=846 residues).
gtgcagtggaattccacaacattccaccaagctctgctagacccccgagtgaggggcctataccttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ386661_PreS2_P-C Feature FT:CDS FJ386661_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S251). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccaccaagctctgctagaccccagagtcaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgcgttacaggcggggttttccttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactacaaccacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtattcatttga
>gnl|hbvcds|FJ386662_PreS2_P-C Feature FT:CDS FJ386662_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S269). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccaagtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ386663_PreS2_P-C Feature FT:CDS FJ386663_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S307). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtgaaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgamtactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ386664_PreS2_P-C Feature FT:CDS FJ386664_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S310). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaaatttccaccaagctctgctagatcccagagtgaggggcctttactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ386665_PreS2_P-C Feature FT:CDS FJ386665_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S359). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatatttccctgctggtggctc
cagttccggaacagtaagccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggttcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctctgggtatacatttga
>gnl|hbvcds|FJ386670_PreS2_P-C Feature FT:CDS FJ386670_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S454). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtkgtggacttctctcaattttctagggggagcacccacgtgtcgtggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ386671_PreS2_P-C Feature FT:CDS FJ386671_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S586). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaagccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaatctccaatcactcactaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ386672_PreS2_P-C Feature FT:CDS FJ386672_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S606). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatccaagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttatctttgggtatacatttga
>gnl|hbvcds|FJ386673_PreS2_P-C Feature FT:CDS FJ386673_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S633). Complete genome. [Hepadnaviridae] (length=846 residues).
acgcagtggaactccacaacattccaccaagctctgctagaccccaaagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcartcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgcagctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcgactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagttcactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttaccgctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ386678_PreS2_P-C Feature FT:CDS FJ386678_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1147). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaagccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ386679_PreS2_P-C Feature FT:CDS FJ386679_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1217). Complete genome. [Hepadnaviridae] (length=846 residues).
acgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatatcttcctgctggtggctc
cagttccggaacagtaaaccctgttccgaccactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ386685_PreS2_P-C Feature FT:CDS FJ386685_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1568). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgctagatcccagagtgaagggtctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatctcctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ386687_PreS2_P-C Feature FT:CDS FJ386687_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1600). Complete genome. [Hepadnaviridae] (length=846 residues).
acgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatatcttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ386689_PreS2_P-C Feature FT:CDS FJ386689_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1649). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaactttccaccaagctctgctagatccaagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagtacgggaccctgcaagacctgcacgaatcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtactgggggccaaaaatgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ518813_PreS2_P-C Feature FT:CDS FJ518813_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatacttccctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctattaccaattttcttgtgtctttgggtatacatttga
>gnl|hbvcds|FJ562218_PreS2_P-C Feature FT:CDS FJ562218_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctttattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ562221_PreS2_P-C Feature FT:CDS FJ562221_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I13). Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcacttaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562225_PreS2_P-C Feature FT:CDS FJ562225_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I19). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatccaagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ562228_PreS2_P-C Feature FT:CDS FJ562228_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I33). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacggagtctagactcgtggtggacttctctcaattttctagggggagtacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttctatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtccaacatcttgagtccctt
tttacctctattaccaattttcttctttctttgggtatacatttga
>gnl|hbvcds|FJ562230_PreS2_P-C Feature FT:CDS FJ562230_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I38). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaag
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctc
tatgtttccctcttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcatgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ562232_PreS2_P-C Feature FT:CDS FJ562232_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I45). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctc
tatgtttccctcttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ562233_PreS2_P-C Feature FT:CDS FJ562233_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I48). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaagccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562235_PreS2_P-C Feature FT:CDS FJ562235_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I50). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtgtacatttga
>gnl|hbvcds|FJ562238_PreS2_P-C Feature FT:CDS FJ562238_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I62). Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcactggaccatgcaagacctgcacgatacctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttctgtctttgggtatacatttga
>gnl|hbvcds|FJ562239_PreS2_P-C Feature FT:CDS FJ562239_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I64). Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactacaaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562241_PreS2_P-C Feature FT:CDS FJ562241_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I67). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaaccttcttgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccaccacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ562242_PreS2_P-C Feature FT:CDS FJ562242_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I68). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcatgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ562243_PreS2_P-C Feature FT:CDS FJ562243_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I71). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacagggggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcacttaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttatctttgggtatacatttga
>gnl|hbvcds|FJ562244_PreS2_P-C Feature FT:CDS FJ562244_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I72). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggttcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ562245_PreS2_P-C Feature FT:CDS FJ562245_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I73). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactcaacaacattcctccaagctctgctagatcccaaagtgaggggcctatatcttcctgctggtggctc
cggttccggaacagtaaaccctgttccgactactgcctctcccatatcgttaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacattaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactaaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcagc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaacatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttactgctgtacaaaactttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatagatgatatagtgttgggggccaagtctgtacaacatcttgaggccctt
ttcacctctattaccaattttcttttttctttgggtatacatttga
>gnl|hbvcds|FJ562248_PreS2_P-C Feature FT:CDS FJ562248_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I76). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccgaaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ562249_PreS2_P-C Feature FT:CDS FJ562249_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I79). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctt
tttacctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ562250_PreS2_P-C Feature FT:CDS FJ562250_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I83). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaactttccaccaagctctgctagatcccagagtaaggggcctttactttcctgctggtggctc
cagttccggaacagcaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgkgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgactccctt
tttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562251_PreS2_P-C Feature FT:CDS FJ562251_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I84). Complete genome. [Hepadnaviridae] (length=846 residues).
ttgcagtggaactccacaacattccaccaagctcttctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactacaagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ562252_PreS2_P-C Feature FT:CDS FJ562252_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I85). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562255_PreS2_P-C Feature FT:CDS FJ562255_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I92). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaaccttccaccaagccctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatc
ctcacaatactacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctgttactaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ562256_PreS2_P-C Feature FT:CDS FJ562256_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I95). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactctacaactttccaccaagctctgctagatcccagagtaaggggcctttactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccaggagtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactgtcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacggggccatgcaagacatgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttaccgctgttaccaattttcttttgtctttgggtatccatttaa
>gnl|hbvcds|FJ562258_PreS2_P-C Feature FT:CDS FJ562258_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I97). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggatcatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ562261_PreS2_P-C Feature FT:CDS FJ562261_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I109). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatgactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtattcatttga
>gnl|hbvcds|FJ562264_PreS2_P-C Feature FT:CDS FJ562264_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I114). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcag
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ562265_PreS2_P-C Feature FT:CDS FJ562265_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I116). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctactagaccccagagtgaggggcctataccttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtcggcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcgtgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ562266_PreS2_P-C Feature FT:CDS FJ562266_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I118). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctcttctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatctcctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccaccacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ562268_PreS2_P-C Feature FT:CDS FJ562268_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I121). Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaactccacaactttccacaaagctctgctagatccaagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccytgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ562269_PreS2_P-C Feature FT:CDS FJ562269_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I122). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagcaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtgtgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ562272_PreS2_P-C Feature FT:CDS FJ562272_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I125). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcaatggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctttattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggatcatcaaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ562273_PreS2_P-C Feature FT:CDS FJ562273_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I127). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctactagaccccaaagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctmacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttctatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatccactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ562274_PreS2_P-C Feature FT:CDS FJ562274_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I128). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggtctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ562275_PreS2_P-C Feature FT:CDS FJ562275_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I129). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ562276_PreS2_P-C Feature FT:CDS FJ562276_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I130). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcwcccayatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcgtgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagtacgggaccatgcaagacctgcacagttcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagttcactagtgccatttgttcagtggctcgtaggg
ctttcccccactgtttggctttcagttatatcgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ562279_PreS2_P-C Feature FT:CDS FJ562279_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I140). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562280_PreS2_P-C Feature FT:CDS FJ562280_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I141). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaaactctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacaggaccttgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562281_PreS2_P-C Feature FT:CDS FJ562281_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I143). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggatcatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562282_PreS2_P-C Feature FT:CDS FJ562282_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I144). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaagactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctc
tatgtttccctcttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ562283_PreS2_P-C Feature FT:CDS FJ562283_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I145). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ562284_PreS2_P-C Feature FT:CDS FJ562284_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I146). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562285_PreS2_P-C Feature FT:CDS FJ562285_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I147). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cggttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatatggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562288_PreS2_P-C Feature FT:CDS FJ562288_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I153). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcttatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ562291_PreS2_P-C Feature FT:CDS FJ562291_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I163). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctctattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccagggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ562292_PreS2_P-C Feature FT:CDS FJ562292_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I164). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcaatggaaccccaccacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctagcacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatatatctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactacaaccacgggaccatgcaagacctgcacgattcctgttcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ562293_PreS2_P-C Feature FT:CDS FJ562293_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I167). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ562295_PreS2_P-C Feature FT:CDS FJ562295_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I169). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcaccggaactccacaacattccaccaagctctgctagatcctttagcggggggcctatattttcctgcaggtggctc
cagttccggaacagtaaaccctgttccgaccactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttacatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ562298_PreS2_P-C Feature FT:CDS FJ562298_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I174). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacgttccaccaagctctgctagatcccagagtgaggggcctgtattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatctcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ562299_PreS2_P-C Feature FT:CDS FJ562299_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I175). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgatacatgccggagtgaggggtctatattttcctgctggtggctc
cacttccggaacagcaaaacctgctcccactactgccacagccatatcggcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggatcatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562300_PreS2_P-C Feature FT:CDS FJ562300_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I182). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcag
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacttcaactaccagcacgggaccatgcaagacctgcacgatacctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FJ562301_PreS2_P-C Feature FT:CDS FJ562301_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I185). Complete genome. [Hepadnaviridae] (length=846 residues).
acgcagtggaactccacaacattccaccaagctctgctagatccaagagtgaggggcctatatttccctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtactgggggcgaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatataa
>gnl|hbvcds|FJ562304_PreS2_P-C Feature FT:CDS FJ562304_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I190). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacgacattccaccaagctctgctagatcccagagtgaggggcctatatcttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ562306_PreS2_P-C Feature FT:CDS FJ562306_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I196). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaaactctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcacttaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggatcatcaactaccagcacgggaccatgcaagacatgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ562307_PreS2_P-C Feature FT:CDS FJ562307_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I197). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaggctctgctagatccaagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
tttgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ562308_PreS2_P-C Feature FT:CDS FJ562308_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I199). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatattttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctcyacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ562310_PreS2_P-C Feature FT:CDS FJ562310_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I201). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaacttcacaacattccaccaagctctgttagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgttctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtggggctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ562313_PreS2_P-C Feature FT:CDS FJ562313_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I204). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaawtttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgcagctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ562315_PreS2_P-C Feature FT:CDS FJ562315_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I207). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttcttgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactgccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ562318_PreS2_P-C Feature FT:CDS FJ562318_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I211). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacctcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ562319_PreS2_P-C Feature FT:CDS FJ562319_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I212). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaaaacattccaccaagctctgctagatcccagagtgaggggcctatatttccctgctggtggctc
cagttccggaacagtgaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacggggccatgcaaaacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ562320_PreS2_P-C Feature FT:CDS FJ562320_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I213). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcaatggaactccacaacattccaccaagctctgctagatccaaragtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgagcatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatatgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tttaccgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562323_PreS2_P-C Feature FT:CDS FJ562323_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I217). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaactttccaccaagctctgctagatcccagagtgaggggcctttactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttaccgctgttaccaattttcttttgtctttgggtgtacatttaa
>gnl|hbvcds|FJ562324_PreS2_P-C Feature FT:CDS FJ562324_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I219). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ562325_PreS2_P-C Feature FT:CDS FJ562325_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I223). Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccaggtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctt
tttacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562327_PreS2_P-C Feature FT:CDS FJ562327_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I228). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatacttccctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ562329_PreS2_P-C Feature FT:CDS FJ562329_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I230). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ562330_PreS2_P-C Feature FT:CDS FJ562330_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I231). Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaactccacaacattccaccaagctttgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccagggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ562332_PreS2_P-C Feature FT:CDS FJ562332_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I42). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcactaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562333_PreS2_P-C Feature FT:CDS FJ562333_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I78). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagccctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttcgagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ562334_PreS2_P-C Feature FT:CDS FJ562334_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I82). Complete genome. [Hepadnaviridae] (length=846 residues).
atccagtggaactccacaacgttccaccaagctctgctagatccccgagtgaggggcttatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgagtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaggacctgcacgaatactgctcaaggaaactc
tatgtttccctcttgttgctgtaccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ562335_PreS2_P-C Feature FT:CDS FJ562335_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I108). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgggttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaag
ttcgcagtccccaacctccaagcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ562337_PreS2_P-C Feature FT:CDS FJ562337_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I173). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctargacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ562339_PreS2_P-C Feature FT:CDS FJ562339_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I205). Partial genome (Contains: HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaaccttccaccaagctctgctagaccccagagtgagggacctatacttccctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattccaatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ562340_PreS2_P-C Feature FT:CDS FJ562340_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I220). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatacttccctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagaggctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaataggacaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatctccttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaaacacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttaccgctgttaccaattttcttatgtctttgggtatacatttga
>gnl|hbvcds|FJ715341_PreS2_P-C Feature FT:CDS FJ715341_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC11). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaactttccaccaagctctgctagatcccagagtgaggggcctttactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggggactctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttccagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttaccgctgttaccaattttcttttatctttgggtatacatttaa
>gnl|hbvcds|FJ715342_PreS2_P-C Feature FT:CDS FJ715342_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC12). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ715343_PreS2_P-C Feature FT:CDS FJ715343_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC13). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacgggaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagttcctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ715344_PreS2_P-C Feature FT:CDS FJ715344_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC14). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgccaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactgccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ715350_PreS2_P-C Feature FT:CDS FJ715350_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC33). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgactactgcctcaccaatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaacaaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|FJ715351_PreS2_P-C Feature FT:CDS FJ715351_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC41). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
gtgcagtggaactccacaacattccacaaagctctgctagacccccgagtgaggggcctataccttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcaccttcttgttagttcttctggactaccaaggtatgctgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ715352_PreS2_P-C Feature FT:CDS FJ715352_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC42). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctataccttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ715353_PreS2_P-C Feature FT:CDS FJ715353_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC43). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctataccttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ715355_PreS2_P-C Feature FT:CDS FJ715355_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC52). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttcttgaggactggggaccctgcac
cgaacatggataacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ715357_PreS2_P-C Feature FT:CDS FJ715357_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC54). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttcttgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ715358_PreS2_P-C Feature FT:CDS FJ715358_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC55). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttcttgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttcttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ715359_PreS2_P-C Feature FT:CDS FJ715359_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC61). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctttgctagaccccagagtgaggggcctataccttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctaggctcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaag
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaagttgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ715360_PreS2_P-C Feature FT:CDS FJ715360_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC62). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctataccttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactaccgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgcgttacaggcggggtttttctcgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccgacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcaccttcttgttggtccttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttatctttgggtatacatttga
>gnl|hbvcds|FJ715364_PreS2_P-C Feature FT:CDS FJ715364_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC72). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagggtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcgc
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacctcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaccctc
tatgtttccctctcgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ715365_PreS2_P-C Feature FT:CDS FJ715365_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC73). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagggtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcgc
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacctcaactaccagcacaggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ715366_PreS2_P-C Feature FT:CDS FJ715366_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC74). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagggtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcgc
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gctttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacctcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagcttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ715367_PreS2_P-C Feature FT:CDS FJ715367_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC75). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagggtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcgc
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacctcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ715368_PreS2_P-C Feature FT:CDS FJ715368_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC81). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccacaaagctctgctagacccccgagtgaggggcctataccttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaacaaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ715370_PreS2_P-C Feature FT:CDS FJ715370_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC83). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgactactgcctcaccaatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaacaaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|FJ715371_PreS2_P-C Feature FT:CDS FJ715371_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVM11). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacctctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacctgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FJ715372_PreS2_P-C Feature FT:CDS FJ715372_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVM12). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccataacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctctcccataccgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgctacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacctgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FJ715374_PreS2_P-C Feature FT:CDS FJ715374_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVM21). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgcccaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ715375_PreS2_P-C Feature FT:CDS FJ715375_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVM22). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ715376_PreS2_P-C Feature FT:CDS FJ715376_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVM23). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgggtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ715377_PreS2_P-C Feature FT:CDS FJ715377_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVM31). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagcaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaaccccttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattggaggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ715378_PreS2_P-C Feature FT:CDS FJ715378_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVM32). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagcaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaaccactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccagggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ715379_PreS2_P-C Feature FT:CDS FJ715379_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVM33). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagcaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacgaaaactgcacttgtattcccatcccatcatcctggactatcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ715380_PreS2_P-C Feature FT:CDS FJ715380_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVM34). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagcaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ715381_PreS2_P-C Feature FT:CDS FJ715381_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVM41). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttctgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcatgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gttcgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttaccgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ715382_PreS2_P-C Feature FT:CDS FJ715382_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVM42). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ715383_PreS2_P-C Feature FT:CDS FJ715383_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVM43). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ715389_PreS2_P-C Feature FT:CDS FJ715389_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVM62). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctagccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcct
gtttgtcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caagattcatatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ715390_PreS2_P-C Feature FT:CDS FJ715390_PreS2_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVM63). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
gtgcagtggaactccacaacattccacaaagctctgctagacccccgagtgaggggcctataccttcctgctggtggctc
cagttccggaacagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcac
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcaccttcttgttagttcttctggactaccaaggtatgctgccc
gtttgtcctctactcccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctc
tatgttt