HBVdb

Dataset for nucleotide sequence PreS2 of genotype C

[Download (right click)] [Edit] [Sequences] [Repertoires]

2951 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


KF873544_PreS2_P-C      atacagtggaactccacwacattccaccaagctctgacagatcccagagy
KU679947_PreS2_P-C      atgcagtggaactccacagcattccatcaagctctacaagatcccagagt
KU679957_PreS2_P-C      atgcagtggaactccacagcattccatcaagctctacaagatcccaragt
KU679936_PreS2_P-C      rtgcagtggaattccacagcattccatcaagctctgcaagatcccagagt
KF873520_PreS2_P-C      atgcagtggaactccacagcattccatcaagctctgcaagatcccagagt
KF873514_PreS2_P-C      atgcagtggaactccacagcattccatcaagctctgcaagatcccagagt
KF873516_PreS2_P-C      atgcagtggaactccacagcattccatcaagctctgcaagatcccaaagt
KU679951_PreS2_P-C      atgcagtggaactcctcagcattccatcaagctctacaagaccccagagt
KF873528_PreS2_P-C      atgcagtggaactcctcagcattccatcaagctctacaagatcccagagt
KF873526_PreS2_P-C      atgcagtggaactcctcagcattccatcaagctctacaagatcccagagt
KF873529_PreS2_P-C      atgcagtggaactcctcagcattccatcaagctctacaagatcccagagt
KF873536_PreS2_P-C      atgcagtggaactccacagcatttcaccaagctctgcaagatcccagagt
KU679960_PreS2_P-C      atgcaatggaactccacaacatttcaccaaactctgcaagatcccagagt
KU679937_PreS2_P-C      atgcagtggaactccacagcatttcaccaagcyctgcaagatcccagagt
KF873539_PreS2_P-C      atgcagtggaactccacagcatttcaccaagctctgcaagatcccagagt
KF873541_PreS2_P-C      atgcagtggaactccacagcatttcaccaagctctgcaagatcccagagt
JQ040167_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KX276846_PreS2_P-C      atgcagtggaactcaagcacattccaccaagctctgttagatcccagagk
KX276855_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KX276982_PreS2_P-C      atgcagtgaaactccaccacattccaccaagctctgctagaccccagagt
KX276992_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagaccccaaagt
KX276988_PreS2_P-C      atgcagtggaactccacaacgttccaccaagctctgctagacccctgagt
KJ717799_PreS2_P-C      atacagtggaactccacaacatttcatcaagcttgcctagatcccagagt
KJ803790_PreS2_P-C      atacagtggaactccacaacatttcatcaagcttgcctagatcccagagt
GQ924620_PreS2_C-C      atgcaatggaactccacaacatttcatcaagctctgctagatcccagagt
KJ173335_PreS2_P-C      atgcagtggaactccacaacatttcatcaagctctactagatcccagagt
JN370955_PreS2_P-C      atgcagtggaactccaccacatttcaccaagtcctgctagatcccagagt
JN827414_PreS2_P-C      atgcagtggaactccacaacatttcatcaagctctgctagatcccagagt
JN827415_PreS2_P-C      atgcagtggaactccacaacatttcatcaagctctgctagatcccagagt
AF241410_PreS2_P-C      atgcagtggaattccacaacatttcatcaagctctgctagatcccagagt
AF241411_PreS2_P-C      atgcagtggaattccacaacatttcatcaagctctgctagatcccagagt
GQ924622_PreS2_P-C      atacagtggaattccacaacatttcatcaagctctgctagatcccagagt
AB241111_PreS2_P-C      atgcagtggaactccacaacatttcatcaagctctgctagatcccagagt
AP011101_PreS2_P-C      atgcagtggaactccacaacatttcatcaagctctgctagatcccagagt
AP011099_PreS2_P-C      atgcagtggaactccacaacatttcatcaagctctgctagatcccagagt
EU410079_PreS2_P-C      nttcagtggaactccaccacatttcatcaagctctgctagatcccagagt
AB241110_PreS2_P-C      atgcagtggaactccacaacatttcatcaagctctgctagatcccagagt
EU410081_PreS2_P-C      atgcagtggaactccacaacatttcatcaagctctgctagatcccagagt
JN604226_PreS2_P-C      atgcagtggaactccacaacatttcatcaagctctgctagatcccagagt
AP011100_PreS2_P-C      atgcagtggaactccacaacatttcatcaagctctgctagatcccagagt
EU410080_PreS2_P-C      atgcagtggaactccacaacatttcatcaagctctgctagatcccagagt
KR014082_PreS2_P-C      atgcagtggaactccacaacatttcatcaagctctgctagatcccagagt
KR013871_PreS2_P-C      atgcagtggaactccacaacatttcatcaagctctgctagatcccagagt
KR014083_PreS2_P-C      atgcagtggaactccacaacatttcatcaagctctgctagatcccagagt
KR014078_PreS2_P-C      atgcagtggaactccacaacatttcatcaagctctgctagatcccagagt
KR013870_PreS2_P-C      atgcagtggaactccacaacatttcatcaagctctgctagatcccagagt
KR014077_PreS2_P-C      atgcagtggaactccacaacatttcatcaagctctgctagatcccagagt
JQ341632_PreS2_P-C      atgcagtggaactccacaacctttcatcaagctctgctagatcccagagt
KJ717833_PreS2_P-C      atgcagtggaactccacaacatttcatcaagctctgctagatcccagagt
FJ562245_PreS2_P-C      atgcagtggaactcaacaacattcctccaagctctgctagatcccaaagt
DQ993690_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctactagatcccagagt
JQ040132_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ386626_PreS2_P-C      atacactgccactccacgctattccaccaagttctgcgagatcccttagt
KC792868_PreS2_P-C      atacagtggaactgcacaatattccaccaagctctgctagatcccagagt
KY363258_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KR014137_PreS2_P-C      atgcagtggaactccacaaccttccaccaagctctgctagatcccagagt
DQ141661_PreS2_P-C      atgcagtggaattccacaaacttccaccaagctctgctagatcccagagt
KY363260_PreS2_P-C      gtgcagtggaattccaccacatttcaccaagctctgctagatcccagggt
AY220702_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB670259_PreS2_P-C      atgcaccgsatctccaccacattccaccaagctctgctagatcccagagt
KC792759_PreS2_P-C      gtgcagtggaattccacaacattccaccaagctctgctagaccccagagt
JQ027322_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB670237_PreS2_P-C      atgcagtggaattcaacaacattccaccaagctctgctagatcccagagt
JX026877_PreS2_P-C      gtgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC792753_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KC792710_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
EU939659_PreS2_P-C      gtgcagtggacttccacaacattccaccaaactctgctagaccccagagt
AB697502_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ899772_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MG826122_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
EU939603_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ899773_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
JQ040149_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaycccagagt
EU093902_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccaaagt
KC792857_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU939646_PreS2_P-C      gtgaagtggaactccacaacattccaccaagctctgctagaccccagagt
KC793195_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctactagaccccagagt
FJ715360_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964318_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964321_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964326_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964327_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964333_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964329_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964319_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964322_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964323_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964324_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964325_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964328_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964330_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964331_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964332_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964320_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ386592_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
AB670241_PreS2_P-C      acacagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ715415_PreS2_P-C      gtgcagtggaactccacaacattccacaaagctctgctagacccccgagt
FJ715416_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KJ173309_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ562228_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ562339_PreS2_P-C      atgcagtggaactccacaaccttccaccaagctctgctagaccccagagt
AB014399_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ787455_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ787456_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ715418_PreS2_P-C      gtgcagtggaactccacaacattccacaaagctctgctagacccccgagt
FJ715391_PreS2_P-C      gtgcagtggaactccacaacattccacaaagctctgctagacccccgagt
FJ715351_PreS2_P-C      gtgcagtggaactccacaacattccacaaagctctgctagacccccgagt
FJ715390_PreS2_P-C      gtgcagtggaactccacaacattccacaaagctctgctagacccccgagt
D23681_PreS2_P-C        acgcagtggaactccacaacattccaccaagctctgctagaccccagagt
EU939561_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ032336_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccaaagt
FJ032338_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccaaagt
FJ032339_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccaaagt
FJ715359_PreS2_P-C      atgcagtggaactccacaacattccaccaagctttgctagaccccagagt
AF533983_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
AB670258_PreS2_P-C      atgcagtggaactccacaacattccaccaaactctgctagaccccagagt
KC774290_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
EU939614_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
AB367414_PreS2_P-C      atacagtggaactccacaacattccaccaagctctgctagaccccagagt
KJ173334_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ715368_PreS2_P-C      atgcagtggaactccacaacattccacaaagctctgctagacccccgagt
KY470977_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY470973_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY470971_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctaggccccagagt
KY470972_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctaggccccagagt
KY470966_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY470965_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY470969_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY470974_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY470976_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY470975_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY470968_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY470967_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY470970_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY470978_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY470979_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ386650_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
LC279274_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KM875423_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
GQ377631_PreS2_P-C      atgcagtggaactccagcacattccaccaaactctgctagatcccagagt
FJ562279_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU939600_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
AY206384_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KC774284_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccaaagt
GQ377605_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KY470894_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY470901_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY470902_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KJ173435_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctggaccccagagt
KJ173436_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctggaccccagagt
GQ377530_PreS2_P-C      atgcagtggaactccacaacattccaccaagctcttctagaccccagagt
FJ715352_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ715353_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ562261_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ386591_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB670307_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
AB670269_PreS2_P-C      atgcaatggaactccacaacattccaccaagctctgctagaccccagagt
KY881736_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881737_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881738_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881739_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881742_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881743_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881744_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881748_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881749_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881750_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881751_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881754_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881755_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881758_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881762_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881763_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881764_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881765_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881766_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881767_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881768_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881769_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881770_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881771_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881772_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881773_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881774_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881775_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881776_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881777_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881972_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
GQ377524_PreS2_P-C      atacagtggaactccacaaaattccaccaagctctgctagaccccagagt
FJ562337_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagaccccagagt
AB300372_PreS2_P-C      atgcagtggaactccacaaccttccaccaaactctgctagaccccagagt
KU964185_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964186_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964187_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964188_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964191_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964192_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964194_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964195_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964196_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964197_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964198_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964189_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964190_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964193_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964199_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
JQ040162_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctactagaccccagagt
AF461357_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
AF461363_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
KJ173291_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KJ173292_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KJ173303_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MG893560_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY470905_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY470895_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY470899_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY470903_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
JX429904_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ899777_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ715344_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ715343_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ562248_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ386609_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AY582136_PreS2_P-C      atgcagtggaactccacaacattccaccaaactctgctagaccccagagt
AB670282_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
AB300359_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
KJ173331_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KJ173332_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KT284759_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
GQ377551_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KX276960_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
GQ377584_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
JQ040172_PreS2_P-C      atrcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU963897_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KJ173301_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KJ173302_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KJ173289_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU963886_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU963887_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU963888_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU963889_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU963890_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU963891_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU963892_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU963893_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU963894_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU963895_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU963896_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU963898_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU963899_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KJ173337_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
GQ377583_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KJ173437_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KJ173438_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY470904_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY470900_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY470897_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY470896_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU963878_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU963880_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU963877_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctactagaccccagagt
KU963876_PreS2_P-C      atgcagtggaactccacaacattccaccaagttctgctagaccccagagt
KU963879_PreS2_P-C      atgcagtggaactccacaacattccaccaagttctgctagaccccagagt
KU963881_PreS2_P-C      atgcagtggaactccacaacattccaccaagttctgctagaccccagagt
KU963884_PreS2_P-C      atgcagtggaactccacaacattccaccaagttctgctagaccccagagt
KU963872_PreS2_P-C      atgcagtggaactccacaacattccaccaaactctgctagaccccagagt
KU963873_PreS2_P-C      atgcagtggaactccacaacattccaccaaactctgctagaccccagagt
KU963871_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU963874_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU963875_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU963882_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU963885_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KJ173287_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KC774357_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KC774293_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
JX504546_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
GQ377578_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ715342_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KC774361_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ562324_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ386619_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
EU939618_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
AB198077_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
AB300365_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ562283_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KC774248_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KJ173310_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
EU093900_PreS2_P-C      gtgcagtggaactccacaactttccaccaagctctgctagatcccagagt
FJ787470_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ787471_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KX276831_PreS2_P-C      atgcagtggaactccacaacattccaccaagctttgctagatcccagagt
AB367392_PreS2_P-C      gtgcagtggaactccacaacattccgccaagctctgctagatcccagagt
AB014372_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB367434_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
AB014380_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctaaaccccagagt
KC792656_PreS2_P-C      ac---gtggacctacacaacattccaccaagctctgctagaccccaaagt
KC792700_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagaccccaaagt
D28880_PreS2_P-C        atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
S75184_PreS2_P-C        atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KC774205_PreS2_P-C      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KC774217_PreS2_P-C      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
FJ562241_PreS2_P-C      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KC774219_PreS2_P-C      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KC774352_PreS2_P-C      atgcagtggaactccacaacttttcaccaaactctgcaagatcccagggt
AB367416_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccaaagt
AB367803_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccaaagt
FJ386647_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
AB697494_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
AB367395_PreS2_P-C      atgcagtggaactccaccacattccaccaaactctgctagatcccagagt
AB367396_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
AB033553_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgttagatcccagagt
AB033551_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
AB033552_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
AB033556_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
AB367424_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
KF485389_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
AB176642_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
AB014378_PreS2_P-C      atacagtggaactccaccacattccaccaagctctgttagatcccaaagt
JX125372_PreS2_P-C      atgcagtggaactccacaactttccaccaagctctgctagatcccagagt
D23682_PreS2_P-C        atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
D23683_PreS2_P-C        atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB367402_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
JF828923_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
JF828931_PreS2_P-C      atgcagtgaaattccacaacattccaccaagctctgctagatcccagagt
JF828929_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
JF828924_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
JF828926_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
JF828930_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
JF828925_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgttagatcccagagt
JF828921_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
JF828922_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
JF828928_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
AB670246_PreS2_P-C      atgcagtggaactccacaacattccacaaagctctgacagatcccagagt
AB670248_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgacagatcccagagt
GQ475355_PreS2_P-C      atgcagtggaactccaccacgttccatcaasctstgmtagattccagagt
AB367435_PreS2_P-C      acgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB111114_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
JN604133_PreS2_P-C      atgcagtggaactccaccacattccatcaagctctgctagatcccagagt
AB670238_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
JF828916_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
JF828919_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
KF214655_PreS2_P-C      atgcagtggaactctgcaacattccaccaagctctgctagatcccagagt
AY641563_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccaaagt
AY641559_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctactagatcccagagt
AB670260_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
AB367427_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
JF828918_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
JF828920_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
JF828917_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
JF828913_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
JF828915_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
AB367411_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
JF828937_PreS2_P-C      atacagtggaattccacaacattccaccaagctctgctagatcccagagt
AB670275_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB367432_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB367804_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EF137802_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
AY247031_PreS2_P-C      atgcagtggaactccacaacatttcaccaagctttgctagatcccagagt
AB697490_PreS2_P-C      atgcagtggaactccacaacattccaccaaactctgctcgatcccagagt
AB367403_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB195943_PreS2_P-C      atgcagtggaactccacaacattccaccaaactctgctagatcccagagt
AB195944_PreS2_P-C      atgcagtggaactccacaacattccaccaaactctgctagatcccagagt
KY363281_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
AB670242_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB367410_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB042285_PreS2_P-C      atgcattggaactccataaaattccaccaaactctgctagatcccagagt
AY641562_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB195947_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctcctagatcccagagt
AB195948_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctcctagatcccagagt
AB670272_PreS2_P-C      gtgcagtggaactccaccacattccaccaagctctgctagatcccagagt
AB106895_PreS2_P-C      atgcagcggaactccacaacattccaccaaactctgctagatcccagagt
AB111123_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB111121_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB111122_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KF779242_PreS2_P-C      atgcagtggaactccacaactttccaccaagctctgctagatcccagagt
JN604254_PreS2_P-C      atgcagtggaactcaacaacattccaccaagctctgctagatcccagagt
FJ562319_PreS2_P-C      atgcagtggaactccaaaacattccaccaagctctgctagatcccagagt
DQ536412_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
AB670291_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB367394_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KY363278_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
KY363279_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
AB367422_PreS2_P-C      atgcagtggaactccacaacattccaccaaactctgctagatcccagagt
JX125374_PreS2_P-C      atgcaatggaactccacaactttccaccaagctctgctagatcccagagt
JX125375_PreS2_P-C      atgcaatggaactccacaactttccaccaagctctgctagatcccagagt
KY363280_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
FJ562230_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KY363264_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
GQ475350_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
AB365451_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
GQ872211_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EF137803_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
D50520_PreS2_P-C        atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
D10055_PreS2_P-C        atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
AB900115_PreS2_P-C      atgcagtggaactccaccacattccatcaagctctgctagatcccagagt
AB670301_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB670290_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
AB471851_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
AB471852_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
AB471853_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
AB367398_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB195945_PreS2_P-C      atgcagtggaactccaccacattccaccaaactctgctagatcccagagt
AB042282_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB042283_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB014394_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
LC279253_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB182589_PreS2_P-C      atgcagtggaactcctcaacattccaccaagctctgctagatcccagagt
DQ536410_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
KY363275_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
KY363274_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
JN604215_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
GQ475323_PreS2_P-C      atgcagtggaactccacgacattccaccaagctctgctagatcccagagt
GQ377541_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
D50519_PreS2_P-C        atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AY641560_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
AB670310_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB670278_PreS2_P-C      gtgcagtggaactccacaacattcctccaaactctgctagatcccagagt
AB670267_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
AB670266_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
AB670262_PreS2_P-C      atgcagtggaactcaacaacattccaccaagctctgctagatcccagagt
AB195942_PreS2_P-C      atgcagtggaactccacaacattccaccaaactctgctagatcccagagt
AB113879_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
AB014374_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
GQ475338_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB670263_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB642095_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
DQ683578_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB670306_PreS2_P-C      atacagtggaactccacaacattccaccaagctctgctagatcccagagt
JX125366_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
JN315779_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
GQ475357_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
GQ475342_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
GQ475317_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
AB670285_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
AB670305_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
AB670265_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB670300_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
GQ475325_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
JX125370_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgttagatcccagagt
GQ475354_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
GQ475347_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
GQ475344_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
GQ475332_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
GQ475322_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
GQ475316_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
GQ475327_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
GQ475334_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
D50517_PreS2_P-C        atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
D50518_PreS2_P-C        atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB670292_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB670288_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB670252_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB222714_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB222715_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB026815_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
AB014376_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB485808_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AF286594_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
JN604281_PreS2_P-C      atgcagtggaactccaccacattccatcaagctctgctagatcccagagt
GQ475313_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
GQ475315_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
JQ341662_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
GQ475312_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
AB697500_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
AB670256_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
AB640730_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
GQ475311_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
GQ475320_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
JX125371_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
JX125373_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB670243_PreS2_P-C      acgcagtggaactccacaacattccaccaagctctgctagatcccagagt
JN604246_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
GQ475337_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
D12980_PreS2_P-C        atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB670247_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB670283_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
LC279251_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
GQ475324_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
GQ872210_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
GQ475319_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB014377_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctcgatcccagagt
JN604131_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctcgatcccagagt
GQ475339_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB300362_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
GQ475305_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
GQ475329_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
GQ475346_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AY206388_PreS2_P-C      atacagtggaactccacaacattccaccaagctctgctagaccccagagt
KX276959_PreS2_P-C      acgcagtggaactccacaacattccaccaagctctgctagaccccaaagt
JX661497_PreS2_P-C      gcgcagtggaactccataacattccaccaagctctgctagaccccagagt
AB014369_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
KC792746_PreS2_P-C      rtgcrgtggaactccacaacattccrccaagctctgctagaccccagagt
AY206386_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC792817_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881810_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctggaccccagagt
KY881818_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881807_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881814_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881811_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881803_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881806_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ386673_PreS2_P-C      acgcagtggaactccacaacattccaccaagctctgctagaccccaaagt
KJ173319_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgatagaccccagagt
KJ173321_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KR013975_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KR013969_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KR013800_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KR013799_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KR013801_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KR013974_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KC792853_PreS2_P-C      atacagtggaactccacaacattccaccaagctctgttagaccccagagt
KR013827_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
JF436920_PreS2_P-C      atgcagtggaactccacaacattccaacaagctctgctagaccccagagt
KY881805_PreS2_P-C      atgcagtggaactccacaacattccaccaatctctgctagaccccagagt
KU964341_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctattagaccccagagt
AB014379_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
AY220699_PreS2_P-C      atacagtggaactccacaacattccaccaaactctgctagaccccagagt
FJ562340_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
EU939545_PreS2_P-C      acgcagtggaactccacaacattccaccaagctctgctagaccccagagt
AY220700_PreS2_P-C      ---------aactccacaacattccaccaagctctgctagaccccagagt
FJ386653_PreS2_P-C      atacagtggaactccacaacattccaccaagctctgctagaccccagagt
EU919169_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccaaagt
AB014371_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
EU919168_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
JX504534_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccggagt
FJ032345_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccaaagt
EU554541_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccaaagt
EU554542_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccaaagt
KU963915_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU963916_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU963917_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU963918_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU963919_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU963921_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU963922_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU963923_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU963924_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU963925_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU963926_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU963927_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU963928_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU963929_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU963920_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
EU522068_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
AF411412_PreS2_P-C      gtgcagtggaactccacaacattccaccaagctctgttagaccccagagt
AY167090_PreS2_P-C      atgcagtggaactccacaacattgcaccaagctctgctagaccccagagt
KR013809_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KR013810_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KR013815_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KR013811_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KR013812_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KR013814_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KR013813_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KC774301_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
JX429903_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
EU439016_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
EU939655_PreS2_P-C      atgcagtggaattccacaacattccaccaagctcttctagaccccagagt
EU939656_PreS2_P-C      atgcagtggaattccacaacattccaccaagctcttctagaccccagagt
AB205123_PreS2_P-C      atgcggtggaactccacaacattccaccaagctctgctagaccccagagt
KR013859_PreS2_P-C      gtgcagtggaactctacaacattccaccaagcactgctagaccccagagt
KR013862_PreS2_P-C      gtgcagtggaactctacaacattccaccaagcactgctagaccccagagt
KR013860_PreS2_P-C      gtgcagtggaactctacaacattccaccaagcactgctagaccccagagt
KR013861_PreS2_P-C      gtgcagtggaactctacaacattccaccaagcactgctagaccccagagt
KR014048_PreS2_P-C      atgcagtggaactccataacattccaccaagctctgctagaccccagagt
GQ377636_PreS2_P-C      atgcagtggaactccacaacattccaccaagcactgctagaccccagagt
JQ040154_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881815_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ562335_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ562251_PreS2_P-C      ttgcagtggaactccacaacattccaccaagctcttctagaccccagagt
FJ562235_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
AY206392_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
AB670249_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
KR014092_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
FJ562266_PreS2_P-C      atgcagtggaattccacaacattccaccaagctcttctagaccccagagt
AB198083_PreS2_P-C      atgcagtggaactccaccactttccaccaagctctgctagaccccagagt
KU964355_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
KU964353_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
KU964350_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
KU964354_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
KU964359_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
KU964365_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
KU964352_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
KU964357_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
KU964360_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
KU964361_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
KU964356_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
KU964362_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
EU939556_PreS2_P-C      acgcagtggaactccacaacattccaccaagctctgctagaccccaaagt
EU872002_PreS2_P-C      atacagtggaactccacaacattccaccaaactctgctagaccccagagt
EU872000_PreS2_P-C      atacagtggaactccacaacattccaccaaactctgctagaccccagagt
EU872001_PreS2_P-C      atacagtggaactccacaacattccaccaaactctgctagaccccagagt
EU872003_PreS2_P-C      atacagtggaactccacaacattccaccaaactctgctagaccccagagt
EU872004_PreS2_P-C      atacagtggaactccacaacattccaccaaactctgctagaccccagagt
FJ562272_PreS2_P-C      atgcaatggaactccacaacattccaccaagctctgctagaccccagagt
JQ040131_PreS2_P-C      atgcaatggaactccacaacattccaccaagctctgctagaccccagagt
KJ173281_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
KJ173282_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
KY881816_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881809_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964364_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
KC774224_PreS2_P-C      atgcagtggaactcctcaacattccaccaagctctgctagaccccagagt
GQ377642_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ386651_PreS2_P-C      atgcactggaactccacaacattccaccaagctctgctagaccccagagt
FJ386632_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ386595_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
EU554536_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
AB299858_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccaaagt
AB426467_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccaaagt
AB288026_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
KY881817_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881804_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KJ598703_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
D23680_PreS2_P-C        atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KC792706_PreS2_P-C      atgcagtggaactccaccacattccaacaagctctgctagaccccagagt
JX504539_PreS2_P-C      atacagtggaactccacaactttccaccaagctctgctagaccccagagt
GQ377552_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU939605_PreS2_P-C      agtcagtggaactcaacaacattccaccaagctctgctagaccccagagt
EU939613_PreS2_P-C      aygcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ787462_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881813_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgccagaccccagagt
KY881812_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881802_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KJ173305_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
KC793026_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctggaccccagagt
KC774218_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
KC774210_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
JX429915_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
JQ341648_PreS2_P-C      atgcagtggaattccacaacattccatcaagctctgctagaccccagagt
FJ715389_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ562313_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ562308_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ032361_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
EU939570_PreS2_P-C      atgcaatggaattccacaacattccaccaagctctgctagaccccagagt
EU939555_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
EU439015_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
AF363961_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccaaagt
AB198080_PreS2_P-C      atgcagtggaattccacagcattccaccaagctctgctagaccccagagt
EU939642_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KC774231_PreS2_P-C      atgcagtggaactccataacattccaccaagctctgctagaccccagagt
KC774199_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ562281_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
JX504536_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ386659_PreS2_P-C      gtgcagtggaattccacaacattccaccaagctctgctagacccccgagt
LC279275_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
LC318702_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
EU939595_PreS2_P-C      gtgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KJ173295_PreS2_P-C      atgcaatggaactccacaacattccaccaagctctgctagaccccagagt
KJ173311_PreS2_P-C      atgcaatggaactccacaacattccaccaagctctgctagaccccagagt
KJ173312_PreS2_P-C      atgcaatggaactccacaacattccaccaagctctgctagaccccagagt
LC318703_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KT284755_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KJ598693_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
KJ173396_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KJ173318_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
KJ173288_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
JX661493_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccaaagt
JX429918_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
JX026884_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
GQ377597_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ715355_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ562327_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ562242_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
FJ386618_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ032360_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
EU554535_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
AB050018_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
FJ715357_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
EU939562_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KC774320_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KC774318_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KC774226_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
JX504545_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
HM750140_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ386574_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ032359_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
AY596108_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
KC774315_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
FJ386644_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
JQ040163_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KC774237_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KC792803_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KC792941_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KJ173391_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KJ173392_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KJ173395_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KC774310_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
GQ377580_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ715376_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ715375_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ715374_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KC774295_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KC774326_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KJ598690_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
KJ598688_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
KJ598691_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
KJ598695_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
KJ598696_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
KJ598697_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
KJ598701_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
KJ598694_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
KJ173317_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
KJ173306_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
KJ598689_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
KJ598698_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
KJ598699_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
KJ598702_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
LC373511_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgcgagaccccagagt
LC373512_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
EU939542_PreS2_P-C      atacagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ899767_PreS2_P-C      atacagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ562299_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgatacatgccggagt
FJ386617_PreS2_P-C      aygcagtggaattccacaacattccaccaagctctgctagatccaagagt
EU939657_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
X52939_PreS2_P-C        atgcagtggaactccacaacattccaccaagctctgctagatccaagagt
FJ386589_PreS2_P-C      atgcagtggaattccacaactttccaccaggctctgctagatccaagagt
AB670298_PreS2_P-C      atgcagtggaactcgacaacattccaccaagctctgctagatcccagagt
AB113878_PreS2_P-C      acgcagtggaattccacaacattccaccaggctctactagatcccagagt
AB195930_PreS2_P-C      acgcagtggaattccacaacattccaccaggctctactagatcccagagt
AB195931_PreS2_P-C      acgcagtggaattccacaacattccaccaggctctactagatcccagagt
AB195932_PreS2_P-C      acgcagtggaattccacaacattccaccaggctctactagatcccagagt
AB670264_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB670274_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KR013868_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
FJ386620_PreS2_P-C      atgcagtggaactccacaacgttccaccaagctctgctagatccaaaagt
FJ386625_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ562307_PreS2_P-C      atgcagtggaactccacaacattccaccaggctctgctagatccaagagt
FJ386689_PreS2_P-C      atgcagtggaactccacaactttccaccaagctctgctagatccaagagt
EU939552_PreS2_P-C      atgcagtggaactccacaactttccaccaagctctgctagatccaagagt
KU964219_PreS2_P-C      atgcagtggaactccacaactttccaccaagctctgctagatccaagagt
KU964214_PreS2_P-C      atgcagtggaactccacaactttccaccaagctctgctagatccaagagt
HM750139_PreS2_P-C      atgcagtggaactccacaactttccaccaagctctgctagatccaagagt
KU964227_PreS2_P-C      atgcagtggaactccacaactttccaccaagctctgctagatccaagagt
KU964220_PreS2_P-C      atgcagtggaactccacaactttccaccaagctctgctagatccaagagt
KU964215_PreS2_P-C      atgcagtggaactccacaactttccaccaagctctgctagatccaagagt
KU964223_PreS2_P-C      atgcagtggaactccacaactttccaccaagctctgctagatccaagagt
KU964226_PreS2_P-C      atgcagtggaactccacaactttccaccaagctctgctagatccaagagt
KU964217_PreS2_P-C      atgcagtggaactccacaactttccaccaagctctgctagatccaagagt
KU964218_PreS2_P-C      atacagtggaactccacaactttccaccaagctctgctagatccaagagt
KU964224_PreS2_P-C      atgcagtggaactccacaactttccaccaagctctgctagatccaagagt
KU964225_PreS2_P-C      atgcagtggaactccacaactttccaccaagctctgctagatccaagagt
KU964228_PreS2_P-C      atgcagtggaactccacaactttccaccaagctctgctagatccaagagt
KU964216_PreS2_P-C      atgcagtggaactccacaactttccaccaagctctgctagatccaagagt
KU964222_PreS2_P-C      atacagtggaactccacaactttccaccaagctctgctagatccaagagt
KC774260_PreS2_P-C      atgcagtggaactccacaactttccaccaagctctgctagatccaagagt
KC774267_PreS2_P-C      atgcagtggaactccacaactttccaccaagctctgctagatccaagagt
MH818373_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
JQ040161_PreS2_P-C      atrcagtggaactccacaacattccaccaagctctgctagaycccagagt
FJ562301_PreS2_P-C      acgcagtggaactccacaacattccaccaagctctgctagatccaagagt
FJ386613_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatccaagagt
KT284758_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatccaagagt
KT284757_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatccaagagt
EU939612_PreS2_P-C      atacagtggaactccacaacattccaccaagctctgctagatccaagagt
FJ386672_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatccaagagt
GQ377554_PreS2_P-C      atgcagtggaactccacgacattccaccaagctctgctagatccaagagt
GQ377570_PreS2_P-C      atgcagtggaactccacgacattccaccaagctctgctagatccaagagt
GQ377618_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
GQ377562_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatccaaaagt
FJ715422_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU562218_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatccaagagt
FJ715395_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatccaagagt
FJ715397_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatccaagagt
FJ715392_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ715424_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ562225_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatccaagagt
FJ032331_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatccaagagt
GQ377545_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatccaagagt
EU939593_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatccaagagt
AB198076_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatccaagagt
GQ377585_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatccaagagt
KC774329_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatccaagagt
FJ899783_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctactagatcccagagt
EU939651_PreS2_P-C      atgcagtggaacaccacaacattccaccaagctctgctagatcccagagt
EU939539_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ787466_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccatagt
FJ787464_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ787465_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ787467_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccatagt
JX036326_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
JX036327_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
KC774191_PreS2_P-C      atgcagtggaactccacaacattccaccaagcactgctagatcccagagt
KC774213_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgttagatcccagagt
KC774214_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgttagatcccagagt
KC774335_PreS2_P-C      atgcaatggaactccacaacattccaccaagctctgctagatcccagagt
KC774254_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC774189_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC774277_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC774211_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
HM750136_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC774256_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EF536066_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU547562_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
DQ089797_PreS2_P-C      atgcagtggaactccacaacaatccaccaagctctgctagatcccagagt
GQ377620_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB697510_PreS2_P-C      atgcagtggaactccaccacattccatcaaactctgctagatcccagagt
EU306724_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
DQ377165_PreS2_P-C      atgcagtggaaccccacaacattccaccaagctctgctagatcccagagt
EU439005_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU306729_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
DQ377164_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
DQ377160_PreS2_P-C      atgaagtggaactccacaacattccaccaagctctgctagatcccagagt
EU306726_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU306728_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU306722_PreS2_P-C      atgcagtggaactccacaacattccaccaagcactgctagatcccagagt
EU306721_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
DQ377161_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
DQ377162_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU306713_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU306725_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU306720_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU306719_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU306714_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
DQ377163_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU306727_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU939607_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctactagatcccagagt
KC792716_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU939594_PreS2_P-C      acgcagtggaactccccaacgttccaccaaactctgctagatcccagagt
KC774269_PreS2_P-C      atgaagtggaactccacaacattccaccaagctctgctagatcccagagt
KY470880_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KY470879_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KY470875_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KY470892_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatccccgagt
KY470885_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KY470873_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KY470886_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KY470888_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KY470891_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KY470882_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KY470890_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KY470887_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KY470874_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KY470877_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KY470889_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KY470876_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KY470878_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KY470881_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KY470884_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KY470883_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ787468_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ787469_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KJ173313_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KJ173314_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC774278_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctactagatcccagagt
KC774345_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctactagatcccagagt
KC774200_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
HM750141_PreS2_P-C      atgcagtggaactctacaacattccaccaagctctgctagatcccagagt
KC774196_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC774336_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC774187_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
KC774348_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC774342_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC774337_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
GQ377533_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC774261_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC774262_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC774287_PreS2_P-C      atgcagtggaactccacaactttccaccaagctctgctagatcccagagt
GQ227692_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
GQ227697_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ715372_PreS2_P-C      atgcagtggaactccataacattccaccaagctctgctagatcccagagt
FJ715371_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ715398_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ715400_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC774355_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
GQ259588_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
GQ227693_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
GQ227694_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
GQ227695_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
GQ227696_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU916223_PreS2_P-C      atgcagtggaactccacaacattccatcaagctctgctagatcccaaagt
EU916224_PreS2_P-C      atgcagtggaactccacaacattccatcaagctctgctagatcccaaagt
JX560520_PreS2_P-C      atgcagtggaactccacaacattccatcaagctctgctagatcccaaagt
FJ562306_PreS2_P-C      atgcagtggaactccacaacattccaccaaactctgctagatcccagagt
EU916219_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB367423_PreS2_P-C      atgcagtggaactccacaacattccaccaaactctgctagatcccagagt
KC774319_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC774242_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ386602_PreS2_P-C      acgcagtggaactccacaacattccaccaagctctgctagatcccagagt
JX504542_PreS2_P-C      atgcaatggaactccacaacattccaccaagctctgctagatcccagagt
EF536065_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU939550_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ899765_PreS2_P-C      gtgcagtggagctccacaacattccaccaagctctgctagatcccagagt
FJ899761_PreS2_P-C      gtgcagtggaactccacgacattccaccaagctctgctagatcccagagt
FJ899764_PreS2_P-C      gtgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ899789_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU939647_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctggatcccagagt
EU939536_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
JQ040144_PreS2_P-C      gtgcagtggaactccacaacattccaccaagctctactagatcccagagt
EU939597_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgttagatcccagagt
FJ562221_PreS2_P-C      atacagtggaactccacaacattccaccaagctctgctagatcccagagt
GQ377518_PreS2_P-C      atgcagtggaattccacaactttccaccaagctctgctagatcccagagt
JQ040155_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KU964043_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964042_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964034_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964035_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964036_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964037_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964038_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964040_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964041_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964044_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964045_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964046_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964047_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964048_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964039_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ562264_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ562243_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ715366_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagggt
FJ715365_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagggt
FJ715364_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagggt
FJ715367_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagggt
KC774354_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU916222_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC774209_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ899788_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU939615_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ386678_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC792771_PreS2_P-C      atgcagtggaactccamaacattccaccaagctctgctagatcccagagt
KC792658_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC774206_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB195949_PreS2_P-C      gtgcagtggaactccacaacattccaccaagctctgctagatcccagagt
JX125365_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC774190_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ899763_PreS2_P-C      atacagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ899775_PreS2_P-C      atacagtggaactccacaacattccaccaagctctgctagatcccagagt
EU939540_PreS2_P-C      atacagtggaactccacaacattccaccaagctctgctagatcccagagt
KP027477_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KT284756_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
JQ040165_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
GQ377517_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ386576_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU939538_PreS2_P-C      gtgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU939616_PreS2_P-C      gtgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ562318_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
HM011481_PreS2_P-C      --gcagtggaactccacaacattccaccaagctctgttagatcccagagt
KX276839_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgttagatcccagagt
FJ032355_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ032356_PreS2_P-C      atgcagtggaactccccaacattccaccaagctctgctagaccccagagt
KU964358_PreS2_P-C      atgcagtggaattccacaacattccgccaagctnnnnnnnnnnnnnnnnn
KU964349_PreS2_P-C      atgcagtggaattccacaacattccgccaagctnnnnnnnnnnnnnnnnn
KU964363_PreS2_P-C      atgcagtggaattccacaacattccgccaagctnnnnnnnnnnnnnnnnn
KU964184_PreS2_P-C      atacagtggagctccacaacattccaccaagctctnnnnnnnnnnnnnnn
KU964182_PreS2_P-C      atacagtggaactccacaacattccaccaagctctnnnnnnnnnnnnnnn
KU964174_PreS2_P-C      atacagtggaactccacaacattccaccaagctctnnnnnnnnnnnnnnn
KU964176_PreS2_P-C      atacagtggaactccacaacattccaccaagctctnnnnnnnnnnnnnnn
KU964178_PreS2_P-C      atacagtggaactccacaacattccaccaagctctnnnnnnnnnnnnnnn
KU964181_PreS2_P-C      atacagtggaactccacaacattccaccaagctctnnnnnnnnnnnnnnn
KU964183_PreS2_P-C      atacagtggaactccacaacattccaccaagctctnnnnnnnnnnnnnnn
KU964179_PreS2_P-C      atacagtggaactccacaacattccaccaagctctnnnnnnnnnnnnnnn
HQ700517_PreS2_P-C      atgcagtggaactccaccacattccatcaagctctrctagatcccagagt
KC793107_PreS2_P-C      atacagtggaactccacaacattccaccaarctctgctagaccccagagt
KC793103_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU939644_PreS2_P-C      atgcaatggaactccacaacattccaccaagctctgctagaccccagagt
KC774353_PreS2_P-C      atgcagtggaactccacaacattccaccaaactctgctagatcccagagt
AF182802_PreS2_P-C      atgcagtggaactctacaacattccaccaagctctgctagaccccagagt
KC793074_PreS2_P-C      atgcagtggaactccacaacattccatcaagctctgctagatcccagagt
JQ341634_PreS2_P-C      atgcagtggaactccacaacattccacmaagctctgctagatcccagagt
GQ377608_PreS2_P-C      atacagtggaactccaccacattccaccaagctctgctagaccccaaagt
EU939596_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccaaagt
KC793040_PreS2_P-C      atacattggaactccacaacattccaccaagctctgctagaccccagagt
AB014367_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KY363252_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KY363253_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KR014008_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU939571_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KR014016_PreS2_P-C      atacagtggaactccacaacattccaccaagctctgctagatccctgagt
KR014017_PreS2_P-C      atacagtggaactccacaacattccaccaagctctgctagatcccagagt
KR014010_PreS2_P-C      acgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KR014011_PreS2_P-C      acgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KR014018_PreS2_P-C      atacagtggaactccacaacattccaccaagctctgctagatcccagagt
KR014012_PreS2_P-C      atacagtggaactccacaacattccaccaagctctgctagatcccagagt
KR014015_PreS2_P-C      atacagtggaactccacaacattccaccaagctctgctagatcccagagt
GQ475351_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccaaagt
AB670279_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KY363284_PreS2_P-C      atgcagtggaactcaacaacattccaccaagctctgctagatcccagagt
JN604258_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB300361_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
GQ475328_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgatagatcccagagt
AB298720_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB298721_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ032351_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ386605_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccakagt
KY881973_PreS2_P-C      atgcagtggaactccacaacattccaccaaactctgctagaccccagagt
KY882003_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881979_PreS2_P-C      atgcaatggaactccacaacattccaccaagctctgctagaccccagagt
KY881884_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccaaagt
KY881960_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccaaagt
KY881883_PreS2_P-C      atacggtggaactccacaacattccaccaagctctgctagaccccagagt
KR013874_PreS2_P-C      atacagtggaactccacaacattccaccaagctctgctagaccccagagt
KR013872_PreS2_P-C      atacagtggaactccacaacattccaccaagctctgctagaccccagagt
KR013876_PreS2_P-C      atacagtggaactccacaacattccaccaagctctgctagaccccagagt
KR013877_PreS2_P-C      atacagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881978_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881892_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881885_PreS2_P-C      atgcaatggaactccacaacattccaccaagctctgctagaccccagagt
KY882002_PreS2_P-C      atgcaatggaactccacaacattccaccaagctctgctagaccccagagt
KY881876_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881872_PreS2_P-C      atgcaatggaactccacaacattccaccaagctctgctagaccccagagt
KY881888_PreS2_P-C      atgcagtggaactccacaacattccaccaaactctgctagaccccagagt
KY881874_PreS2_P-C      atgcagtggaactccacaacattccaccaaactctgctagaccccagagt
KY881886_PreS2_P-C      atgcagtggaactccacaacattccaccaaactctgctagaccccagagt
KY881878_PreS2_P-C      atgcaatggaactccacaacattccaccaagctctgctagaccccagagt
KY881997_PreS2_P-C      atgcagtggaactccacaacattccaccaaactctgctagatcccagagt
KY881882_PreS2_P-C      atgcagtggaactccacaacattccaccaaactctgctagaccccagagt
KY881889_PreS2_P-C      atgcagtggaactccacaacattccaccaaactctgctagaccccagagt
KY881991_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881890_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881887_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KY881881_PreS2_P-C      atgcaatggaactccacaacattccaccaagctctgctagaccccagagt
KY881974_PreS2_P-C      atgcaatggaactccacaacattccaccaagctctgctagaccccagagt
KY881875_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KY881989_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KY881873_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881871_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881870_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881987_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881891_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccaaagt
KY881877_PreS2_P-C      atgcaatggaactccacaacattccaccaagctctgctagaccccagagt
KY881962_PreS2_P-C      atgcaatggaactccacaacattccaccaagctctgctagaccccagagt
KY881990_PreS2_P-C      atgcaatggaactccacaacattccaccaagctctgctagaccccagagt
KY881879_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881966_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881971_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881994_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881981_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctaggccccagagt
KY881880_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881993_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY882001_PreS2_P-C      atacagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881961_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881988_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881980_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
EU570072_PreS2_P-C      acgcagtggacctccacaacattccaccaagcactgctagatcccagagt
KR013769_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KR013767_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccaaagt
KR013765_PreS2_P-C      atgcagtggaactccacaacattccaccaagcactgctagatcccagagt
KR013764_PreS2_P-C      atgcagtggaactccacaacattccaccaaactctgctagatcccagagt
KR013766_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KR013761_PreS2_P-C      atgcagtggaactccacaacattccatcaagctctgctagatcccagagt
KR013762_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KR013768_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KR013763_PreS2_P-C      atgcagtggaactccacaacattccaccaaactccgctagatcccagagt
KC774340_PreS2_P-C      atgcagtggaactccacaaccttccaccaaactctgctagatcccagagt
JX429913_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU560438_PreS2_P-C      atgcagtggaactccacaacattccaccaagcactgctagatcccagagt
EU560439_PreS2_P-C      atgcagtggaactccacaacattccaccaagcactgctagatcccaaagt
DQ478899_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KR013796_PreS2_P-C      atgcagtggaactccacaacatttcaacaagctctgctagatcccagagt
KR013795_PreS2_P-C      atgcagtggaactccacaacatttcaacaagctctgctagatcccagagt
KR013794_PreS2_P-C      atgcagtggaactccacaacatttcaacaagccctgctagatcccagagt
KR013792_PreS2_P-C      atgcagtggaactccacaacatttcaacaagctctgctagatcccagagt
KR013793_PreS2_P-C      atgcagtggaactccacaacatttcaacaagctctgctagatcccagagt
EU093906_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctactagatcccagagt
AY057947_PreS2_P-C      atgcagtggaactccacaaccttccaccaagctctgctagatcccagagt
GQ475356_PreS2_P-C      atacagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ562255_PreS2_P-C      atgcagtggaactccacaaccttccaccaagccctgctagatcccagagt
EU939592_PreS2_P-C      acgcagtggaactccacaacattccaccaaactctgctagatcccagagt
KC774356_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
GU357845_PreS2_P-C      atgcagtggaactccacaatcttccaccaagccctgctagatcccagagt
KC793187_PreS2_P-C      atgcagtggaattccacaaccttccaccaagccctgctagatcccagagt
GQ377593_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU093903_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctactagatcccagagt
JX026888_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ386603_PreS2_P-C      atgcagtggaactccacaacattccaccactctctgctagatcccagagt
GQ377538_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU717212_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU306673_PreS2_P-C      atgcagtggaactccacaacatttcaccaagctttgctagatcccagagt
EU306674_PreS2_P-C      atgcagtggaactccacaacatttcaccaagctttgctagatcccagagt
EU306675_PreS2_P-C      atgcagtggaactccacaacatttcaccaagctttgctagatcccagagt
JQ040166_PreS2_P-C      atgcagtggaactccacaactttccaccaagctctgctagatcccagagt
HM011465_PreS2_P-C      atgcagtggaactccacaacattccaccaagcccttctagatcccagagt
GQ377623_PreS2_P-C      atgcagtggaactccacgacattccaccaagctctgctagatcccagagt
KC774279_PreS2_P-C      atgcagtggaactccacaaccttccaccaaaccctgctagatcccagagt
FJ562280_PreS2_P-C      atgcagtggaactccacaacattccaccaaactctgctagatcccagagt
KC774232_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
MG893557_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KR013781_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC774274_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC774252_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
JX661491_PreS2_P-C      atgcagtggaactccacaacatttcaccaagctctgctagatcccagagt
JX026880_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU916237_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU570067_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KR013780_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
JX429905_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU939578_PreS2_P-C      acgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KR013961_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KR013797_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KR013798_PreS2_P-C      atgcagtggaactccacaacgttccaccaagctctgctagatcccagagt
KR013786_PreS2_P-C      atgcagtggaactccacaacattccaccaagccctgctagatcccagagt
KR013785_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC774223_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC774182_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC774180_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
JX026878_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
GQ377531_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU554537_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU916238_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KT284753_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KR013783_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KR013782_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KR013779_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KR013784_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KM213037_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC793039_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgttagatcccagagt
KC774313_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU570068_PreS2_P-C      ttgcagtggaactccacaacattccaccaagctctgctagatcccagagt
MH094411_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KY022423_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC774334_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC774275_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
HM011489_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
GQ377603_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU554538_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU554539_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU939541_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC774257_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC774259_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
GQ377523_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ787452_PreS2_P-C      atacagtggaactccacaacattccaccaagctctgctagaccccagagt
EU717215_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KR013869_PreS2_P-C      atgcagtggaactccaccacattccaccaagcactgctagaccccagagt
KR013865_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagaccccagggt
FJ386661_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagaccccagagt
KR013863_PreS2_P-C      atacagtggaactccaccacattccaccaagctctgctagaccccagagt
FJ562292_PreS2_P-C      atgcaatggaaccccaccacattccaccaagctctgctagaccccagagt
KR013866_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagaccccagagt
KX276981_PreS2_P-C      atgcaatggaactccacaacattccaccaagctctgctagaccccagagt
KR013867_PreS2_P-C      atacagtggaactccaccacattccacaaaactctgctagaccccagagt
EU939584_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagaccccagagt
KX276986_PreS2_P-C      atgcagtggaactccacaacgttccaccaagctctgctagacccctgagt
KX276994_PreS2_P-C      atgcagtggaactccacaacgttccaccaagctctgctagacccctgagt
KR013864_PreS2_P-C      atacagtggaactccaccacattccaccaagctctgctagaccccagagt
GQ377571_PreS2_P-C      atgcagtggaactccacaacattccaccaggctctgctagaccccagagt
EU086839_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctactagaccccagagt
EU086837_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctactagaccccagagt
EU086838_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctactagaccccagagt
KC793019_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagaccccagagt
GQ377615_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
JX661496_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KJ173432_PreS2_P-C      atgcagtggaattccaccacattccaccaagctctgctagaccccagagt
KJ173431_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagaccccagagt
GQ377599_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagaccccagagt
AF384371_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagaccccagagt
EU560441_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagaccccagagt
FJ787486_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagaccccagagt
FJ899776_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagaccccagagt
AF384372_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagaccccagagt
EU871971_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
AF182803_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
AF182804_PreS2_P-C      atgcaatggaactccacaacattccaccaagctctgctagaccccagagt
EU871974_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
EU871973_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
EU871970_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
EU871969_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
EU871972_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KF053170_PreS2_P-C      atgcagtggaactccacaacgttccaccaaactctgctagatcccagagt
KJ803762_PreS2_P-C      atgcagtggaactccacaacgttccaccaaactctgctagatcccagagt
HM011479_PreS2_P-C      atgcagtggaaytccacaacattccaccaagctctgctagatcccagagt
KX276837_PreS2_P-C      atgcagtggaaytccacaacattccaccaagctctgctagatcccagagt
EU939564_PreS2_P-C      gtgaagtggaactccacaacgttccaccaagctctgctagatcccagagt
AY596107_PreS2_P-C      atgcagtggaacttcacaaccttccaccaaactctgttagatcccagagt
KJ598679_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctactagaccccagagt
KJ598686_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctactagaccccagagt
FJ787439_PreS2_P-C      atacagtggaactctacaacattccaccaagctctgctagatcccagagt
FJ787479_PreS2_P-C      atacagtggaactctacaacattccaccaagctctgctagatcccagagt
FJ787441_PreS2_P-C      atacagtggaactctacaacattccaccaagctctgctagatcccagagt
FJ899770_PreS2_P-C      gtgcagtggaactccacaacattccaccaagctctgctagaccccagagt
EU939563_PreS2_P-C      acgcagtggaattccacaacattccaccaagctctgctagaccccagagt
FJ899771_PreS2_P-C      acgcagtggaattccacaacattccaccaagctctgctagaccccagagt
FJ899769_PreS2_P-C      acgcagtggaattccacaacattccaccaagctctgctagaccccagagt
KX276968_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagaccccagagt
EU916233_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctggaccccagagt
EU916234_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctggaccccagagt
KR013772_PreS2_P-C      atgcagtggaacgccacaacattccaccaaactctgctggaccccagagt
KR013909_PreS2_P-C      atgcagtggaactccacaacattccaccaaactctgctggaccccagagt
KR013908_PreS2_P-C      atgcagtggaactccacaacattccaccaaactctgctggaccccagagt
KR013776_PreS2_P-C      atgcagtgggactccacaacattccaccaaactctgctggaccccagagt
KR013773_PreS2_P-C      atgcagtggaactccacaacattccaccaaactctgctggaccccagagt
KR013771_PreS2_P-C      atgcagtggaactccacaacattccaccaaactctgctggaccccagagt
KR013774_PreS2_P-C      atgcagtggaactccacaacattccaccaaactctgctggaccccagagt
GQ377526_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctactagaccccagagt
FJ386597_PreS2_P-C      atacagtggaactccacaacattccaccaagctctactagaccccagagt
FJ562273_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctactagaccccaaagt
FJ562265_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctactagaccccagagt
KJ598687_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctactagaccccagagt
KJ598715_PreS2_P-C      atgcagtggaattccacaacattccaacaagctctactagaccccagagt
KJ598714_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctactagaccccagagt
KJ598719_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctactagaccccagagt
KJ598710_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctacaagaccccagagt
KJ598718_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctactagaccccagagt
KJ598707_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctactagaccccagagt
KJ598717_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctactagaccccagagt
KJ598712_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctactagaccccagagt
KJ598705_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctactagaccccagagt
KJ598706_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctactagaccccagagt
KJ598708_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctactagaccccagagt
KJ598711_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctactagaccccagagt
KJ598713_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctactagaccccagagt
KJ598709_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctactagaccccagagt
KY881819_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KJ598716_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctactagaccccagagt
EU093915_PreS2_P-C      atgcagtggtactccacaacattccaccaagctctactagaccccagagt
KJ598681_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctactagaccccagagt
EU939604_PreS2_P-C      atgcagtggaactccacaacattccaccaagctttactagaccccagagt
EU093881_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctactagaccccagagt
EU093882_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctactagaccccagagt
EU093908_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctactagaccccagagt
KJ598680_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctactagaccccagagt
EU093917_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctactagaccccagagt
EU093911_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctactagaccccagagt
EU093910_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctactagaccccagagt
EU093883_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctactagaccccagagt
EU075340_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctactagaccccagagt
EU075339_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctactagaccccagagt
EU075338_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctactagaccccagagt
EU075337_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctactagaccccagagt
EU093907_PreS2_P-C      gtgcagtggaactccacaacattccaccaagctctactagaccccagagt
EU093909_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctactagaccccagagt
EU093916_PreS2_P-C      atgcagtggaactccacaacattccaccaggctctactagaccccagagt
EU093914_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctactagaccccagagt
EU093913_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctactagaccccagagt
EU093912_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctactagaccccagagt
EU075336_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctactagaccccagagt
EU075335_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctactagaccccagagt
EU075334_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctactagaccccagagt
EU075342_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctactagaccccagagt
EU093918_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctactagaccccagagt
KC774327_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctactagaccccagagt
KC792740_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881976_PreS2_P-C      atacagtggaactccaccacattccaccaagctctgctagatcccagagt
KY881968_PreS2_P-C      atacagtggaactccaccacattccaccaagctctgctagatcccagagt
KY881915_PreS2_P-C      atacagtggaactccaccacattccaccaagctctgctagatcccagagt
KY881998_PreS2_P-C      atacagtggaactccaccacattccaccaagctctgctagatcccagagt
KY881964_PreS2_P-C      atacagtggaactccaccacattccaccaagctctgctagatcccagagt
KY881999_PreS2_P-C      atacagtggaactccaccacattccaccaagctctgctagatcccagagt
KY881970_PreS2_P-C      atacagtggaactccaccacattccaccaagctctgctagatcccagagt
KY881965_PreS2_P-C      atacagtggaactccaccacattccaccaagctctgctagatcccagagt
KY881996_PreS2_P-C      atacagtggaactccaccacattccaccaagctctgctagatcccagagt
KY881995_PreS2_P-C      atacagtggaactccaccacattccaccaagctctgctagatcccagagt
KY881992_PreS2_P-C      atacagtggaactccaccacattccaccaagctctgctagatcccagagt
KY881983_PreS2_P-C      atacagtggaactccaccacattccaccaagctctgctagatcccagagt
KY881925_PreS2_P-C      atacagtggaactccaccacattccaccaagctctgctagatcccagagt
KY881916_PreS2_P-C      atacagtggaactccaccacattccaccaagctctgctagatcccagagt
KY881917_PreS2_P-C      atacagtggaactccaccacattccaccaagctctgctagatcccagagt
KY881919_PreS2_P-C      atacagtggaactccaccacattccaccaagctctgctagatcccagagt
KY881921_PreS2_P-C      atacagtggaactccaccacattccaccaagctctgctagatcccagagt
KY881923_PreS2_P-C      atacagtggaactccaccacattccaccaagctctgctagatcccagagt
KY881924_PreS2_P-C      atacagtggaactccaccacattccaccaagctctgctagatcccagagt
KY881926_PreS2_P-C      atacagtggaactccaccacattccaccaagctctgctagatcccagagt
KY881927_PreS2_P-C      atacagtggaactccaccacattccaccaagctctgctagatcccagagt
KY881928_PreS2_P-C      atacagtggaactccaccacattccaccaagctctgctagatcccagagt
KY881929_PreS2_P-C      atacagtggaactccaccacattccaccaagctctgctagatcccagagt
KY881930_PreS2_P-C      atacagtggaactccaccacattccaccaagctctgctagatcccagagt
KY881931_PreS2_P-C      atacagtggaactccaccacattccaccaagctctgctagatcccagagt
KY881932_PreS2_P-C      atacagtggaactccaccacattccaccaagctctgctagatcccagagt
KY881933_PreS2_P-C      atacagtggaactccaccacattccaccaagctctgctagatcccagagt
KY881934_PreS2_P-C      atacagtggaactccaccacattccaccaagctctgctagatcccagagt
KY881935_PreS2_P-C      atacagtggaactccaccacattccaccaagctctgctagatcccagagt
KY881936_PreS2_P-C      atacagtggaactccaccacattccaccaagctctgctagatcccagagt
KY881938_PreS2_P-C      atacagtggaactccaccacattccaccaagctctgctagatcccagagt
KY881963_PreS2_P-C      atacagtggaactccaccacattccaccaagctctgctagatcccagagt
KY881969_PreS2_P-C      atacagtggaactccaccacattccaccaagctctgctagatcccagagt
KY881977_PreS2_P-C      atacagtggaactccaccacattccaccaagctctgctagatcccagagt
KY881982_PreS2_P-C      atacagtggaactccaccacattccaccaagctctgctagatcccagagt
KY881986_PreS2_P-C      atacagtggaactccaccacattccaccaagctctgctagatcccagagt
KY882000_PreS2_P-C      atacagtggaactccaccacattccaccaagctctgctagatcccagagt
KY881975_PreS2_P-C      atacagtggaactccaccacattccaccaagctctgctagatcccagagt
KY881959_PreS2_P-C      atacagtggaactccaccacattccaccaagctctgctagatcccagagt
KY881918_PreS2_P-C      atacagtggaactccaccacattccaccaagctctgctagatcccagagt
KY881920_PreS2_P-C      atacagtggaactccaccacattccaccaagctctgctagatcccagagt
KY881922_PreS2_P-C      atacagtggaactccaccacattccaccaagctctgctagatcccagagt
KY881937_PreS2_P-C      atacagtggaactccaccacattccaccaagctctgctagatcccagagt
KY881939_PreS2_P-C      atacagtggaactccaccacattccaccaagctctgctagatcccagagt
KY881941_PreS2_P-C      atacagtggaactccaccacattccaccaagctctgctagatcccagagt
KY881942_PreS2_P-C      atacagtggaactccaccacattccaccaagctctgctagatcccagagt
KY881943_PreS2_P-C      atacagtggaactccaccacattccaccaagctctgctagatcccagagt
KY881967_PreS2_P-C      atacagtggaactccaccacattccaccaagctctgctagatcccagagt
KY881985_PreS2_P-C      atacagtggaactccaccacattccaccaagctctgctagatcccagagt
KY881940_PreS2_P-C      atacagtggaactccaccacattccaccaagctctgctagatcccagagt
KC774358_PreS2_P-C      atgcagtggaactccacaacattccaccaaactctgctagaccccagagt
AB014391_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
AB014385_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KC792680_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964014_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964012_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964011_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964017_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964018_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964016_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964013_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964019_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964015_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KC875261_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccctagagt
FJ386612_PreS2_P-C      atacagtggaactccacaacattccaccaagctctgctagaccccagagt
KC793024_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC792902_PreS2_P-C      atgcagtggaactccacaacattccaccaagcactgctagatcccagagt
JQ040145_PreS2_P-C      atgcartggaactccacaacattccaccaagctctgctagaccccagagt
GQ377628_PreS2_P-C      atgcagtggaactccacagcattccatcaagctctgctagaccccagagt
FJ032334_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
DQ089796_PreS2_P-C      atacagtggaactccacaacattccaccaagctctgctagatcccagagt
AB014389_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgatagaccccagagt
KR013844_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KR013842_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KR013845_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KR013848_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgccagatcccagagt
KR013847_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KR013849_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ562276_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
AB014384_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ032340_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ032341_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ787453_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ787454_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MG826143_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AY206389_PreS2_P-C      tcaggaagacactccacaacattccaccaagctctgctagatcccagagt
AB367417_PreS2_P-C      atgcagtggaactcaacaacattccaccaagctctgctagatcccagagt
DQ975274_PreS2_P-C      atgcagtggaactccacaccattccaccaagctctgctagaccccagagt
AB014393_PreS2_P-C      atccagtggaactccacaacattccaccaagctctgctagaccccagagt
AB014382_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
DQ089795_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ787448_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccggagt
FJ032350_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB111120_PreS2_P-C      gtgcagtggaaatccacaacattccaccaagctctgctagaccccagagt
AB014392_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccaaagt
AB014364_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KC875263_PreS2_P-C      atgcagtggaactccacaacattccaccaagctccgctagaccccagagt
KC793202_PreS2_P-C      atgcagtggaaytccacaacattccaccaagctctgctrgaccccagagt
JQ341643_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU939568_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccaaagt
EU570073_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
EU570074_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KR013791_PreS2_P-C      atgcagtggaattccacaacattccatcaagctctgctagatcccagagt
KC793097_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU579443_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagaccccagagt
AF458665_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
EU560440_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU579442_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB670302_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KU964169_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964177_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964170_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964173_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964175_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964171_PreS2_P-C      atgcagtggaactacacaacattccaccaagctctgctagaccccagagt
KU964172_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
DQ141658_PreS2_P-C      atgcagtggaattccacaaacttccaccaagctctgctagatcccagagt
DQ141659_PreS2_P-C      atgcagtggaattccacaaacttccaccaagctctgctagatcccagagt
KC793142_PreS2_P-C      atcaagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ787447_PreS2_P-C      gtgcagtggaactccacaacattccaccaagctctgctagaccccagagt
EU881996_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccaaagt
AB900099_PreS2_P-C      gtgcagtggaactccacaacattccaccaagctctgctagaccccagagt
AB014383_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
KR014049_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KF053175_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KJ803769_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC875262_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KC774281_PreS2_P-C      atgcagtggaactccacaacattccgccaagctctgctagaccccagagt
JQ040152_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgttagatcccagagt
FJ715404_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
EU939567_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
EU919164_PreS2_P-C      atgcagtggaactccccaacattccaccaagctctgctagatcccagagt
EU589336_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagaccccagagt
AB367397_PreS2_P-C      atgcattggaattccacaacattccaccaagctctgctagaccccagagt
AB111118_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccaaagt
KX276838_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KR013846_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KJ410521_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagaccccagagt
EU916204_PreS2_P-C      atgcagtggaactccacaacattccaccaaactctgctagaccccagagt
JQ040139_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgttagaccccagagt
KU964004_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KC793093_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
JQ341610_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AY066028_PreS2_P-C      atacagtggaattccacaacattccaccaagctctgctagaccccagagt
AF411408_PreS2_P-C      atacagtggaattccacaacattccaccaagctctgctagaccccagagt
AF411411_PreS2_P-C      atacagtggaattccacaacattccaccaagctctgctagaccccagagt
EU796070_PreS2_P-C      atacagtggaattccacaacattccaccaagctctgctagaccccagagt
EU796072_PreS2_P-C      atacagtggaattccacaacattccaccaagctctgctagaccccagagt
KR013943_PreS2_P-C      atgcagtggaattccacaacattccatcaagctctgctagatcccagagt
KC792862_PreS2_P-C      atrcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB300360_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB014381_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctacaccccagagt
KJ410510_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccaaagt
KC792834_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ386630_PreS2_P-C      atgcaatggaattccacaacattccaccaagctctgctagaccccagagt
EU939582_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC793119_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC793108_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC792691_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KC774197_PreS2_P-C      atgcagtggaactccacaacattccatcaagctctgctagatcccagagt
GQ377609_PreS2_P-C      atgcagtggaactccacaacattccaacaaactctgctagatcccagagt
EU939546_PreS2_P-C      atgcagtggaactccacaacattccaccaaactctgctagaccccagagt
EU939543_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccacagt
EU796069_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
DQ478900_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
D00630_PreS2_P-C        atgcagtggaactccacaacattccaccaagctgtgctagatcccagagt
AY306136_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
AB014362_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ715405_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ715406_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU093895_PreS2_P-C      atacagtggaactccacaacattccaacaaactctgctagatcccagagt
EU093898_PreS2_P-C      atacagtggaactccacaacattccaacaaactctgcttgatcccagagt
KC793035_PreS2_P-C      atgcagtggaactccacaacattccaccaagcgctgctagatcccagagt
KC774311_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ386614_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
AB670289_PreS2_P-C      atgcagtggaactccaccacattccasyaagctctgctagatcccagagt
FJ386604_PreS2_P-C      atgcagtggaactccccaacattccaccaagctctgctagaccccagagt
FJ787437_PreS2_P-C      atgcagtggaactccccaacattccaccaagctctgctagaccccagagt
MG826124_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KR013875_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KR013858_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ386579_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
EU939658_PreS2_P-C      atgcagtggaactcaacaacattccaccaagctctgctagatcccagagt
EU939586_PreS2_P-C      acgcagtggaactccacaacagtccaccaagctctgctagaccccagagt
DQ089799_PreS2_P-C      atgcagtggaactctacaacattccaccaagctctgctagatcccagagt
AB971714_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB971715_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KR014043_PreS2_P-C      atacagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ032346_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
DQ975272_PreS2_P-C      atacagtggaactccacaacattccaccaagcactgctagaccccagagt
D23684_PreS2_P-C        atacagtggaactccacaacattccaccaagctctgctagaccccagagt
AB670277_PreS2_P-C      atgcagtggaattccaccacattccaccaagctctgctagatcccagagt
AB014396_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
EU871980_PreS2_P-C      gtgcagtggaactccacaacattccaccaagctctgctagaccccagagt
EU871998_PreS2_P-C      gtgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KC774289_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ562238_PreS2_P-C      atacagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ386685_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
EU939640_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
JX504541_PreS2_P-C      gtgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ562325_PreS2_P-C      atacagtggaactccacaacattccaccaagctctgctagatcccagagt
EU916229_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccaaagt
KJ598740_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
KJ598749_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
KJ598743_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
KJ598752_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
KJ598746_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
KJ598741_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
KJ598742_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
KJ598744_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
KJ598745_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
KJ598747_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
KJ598748_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
KJ598750_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
KJ598754_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
KJ598751_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
KJ598753_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
KR013984_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KJ173316_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KF779300_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccaaagt
KC792923_PreS2_P-C      atgcagtggaactccaccacattccatcaagckctgctagaccccagagt
KC792790_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC774271_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
JX429917_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
JX504544_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
JQ040141_PreS2_P-C      atgcagtggaactccacaacattccaccaaactctgctagatcccagagt
HM011500_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
GQ377546_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ715381_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ715421_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ562269_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
FJ518813_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ386663_PreS2_P-C      atgcagtgaaactccacaacattccaccaagctctgctagaccccagagt
EU939619_PreS2_P-C      atgcagtggaactccacaacattccaccaagctttgctagaccccaaagt
DQ478885_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AY206382_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AY206381_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
AB670254_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
EU871975_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
EU871977_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KR013804_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KC774283_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
JN604140_PreS2_P-C      atgcagtggaaytccacaacattccaccaagctctgctagatcccagagt
EU075315_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
DQ986375_PreS2_P-C      atgcagtggaactccaccacattccatcaagctctgctagaccccagagt
KC792799_PreS2_P-C      atrcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC792682_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccaaagt
EU939585_PreS2_P-C      atacagtggaactccacaacattccaccaagctctgctagatcccagagt
JQ040168_PreS2_P-C      acgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ386662_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ386596_PreS2_P-C      acgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ386687_PreS2_P-C      acgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU872012_PreS2_P-C      atacagtggaactccacaacattccaccaagctctgctagaccccagagt
EU871976_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KC793100_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU939611_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
EU872008_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964201_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964204_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964206_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964207_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964208_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964209_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964210_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964211_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964212_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964213_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964202_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964203_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964205_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ386628_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ787445_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MG893553_PreS2_P-C      atgcagtggaactctacaacattccaccaagctctgctagaccccagagt
KY470927_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KR013805_PreS2_P-C      atgcagtggacctccacaacattccaccaagctctgctagaccccagagt
KC793050_PreS2_P-C      atgcaatggaactccacaacattccaccaagctctgctagaccccagagt
KC792965_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC792679_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
JX429916_PreS2_P-C      atgcagtggagctccacaacattccaccaagctctgctagaccccagagt
HM750131_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccaaagt
GQ377624_PreS2_P-C      atgcagtggaactccacaacattccaccaagctcttctagaccccagagt
FJ562315_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ562293_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ562285_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ562284_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ386657_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ386627_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ386577_PreS2_P-C      atgcagtggaactcaacaacattccaccaaactctgctagaccccagagt
FJ032332_PreS2_P-C      atgcagtgaaactccacaacattccaccaagctctgctagatcccagagt
EU939610_PreS2_P-C      atgcaatggaactccacaacattccaccaagctctgctagaccccagagt
EU939609_PreS2_P-C      atgcagtggaactccacaacattccaacaagctctgctagaccccagagt
EU916210_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
EU086842_PreS2_P-C      gcgcagtggaattccacaacattccaccaagccctgttagatcccagagt
AB246345_PreS2_P-C      atgcaatggaactccacaacattccaccaagctctgctagaccccagagt
EU871978_PreS2_P-C      atgcaatggaactccacaacattccaccaagctctgctagaccccagagt
AB195953_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
AB195954_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881984_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KT284754_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
EU939544_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
LC279276_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU086840_PreS2_P-C      --gcagtggaactccacaacattccaccaagccctgctagatcccagagt
EU086847_PreS2_P-C      gcgcagtggaactccacaacattccaccaagccctgctagatcccagagt
EU086845_PreS2_P-C      gcgcagtggaactccacaacattccaccaagccctgctagatcccagagt
EU086841_PreS2_P-C      --gcagtggaactccacaacattccaccaagccctgctagatcccagagt
EU086843_PreS2_P-C      gcgcagtggaactccacaacattccaccaagccctgctagatcccagagt
EU086844_PreS2_P-C      gcgcagtggaactccacaacattccaccaagccctgctagatcccagagt
EU086846_PreS2_P-C      gcgcagtggaactccacaacattccaccaagccctgctagatcccagagt
KR013803_PreS2_P-C      atacagtggaactccacaacattccaccaagctctgctagaccccaaagt
FJ715379_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ562239_PreS2_P-C      atacagtggaactccacaacattccaccaagctctgctagaccccagagt
LC279250_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KC774333_PreS2_P-C      atgcagtggaactccacaacatttcaccaagctctgctagaccccagagt
KR013808_PreS2_P-C      gtgcagtggaactccacaacattccaccaagctctgctagaccccagagt
AF461358_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
AF461359_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
AB026811_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
AB026813_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
AB026814_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
AB026812_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
LC279259_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
LC279252_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY470930_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KY470929_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KY470925_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KX276964_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagaccccagagt
KU964200_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KR013834_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KR013832_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KR013802_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KJ173446_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KJ173443_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KJ173444_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KJ173304_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KJ173307_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KJ173308_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KC793201_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC792968_PreS2_P-C      atgcartggaactccamaacattccaccaagctctgctagaccccagagt
KC774359_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagaccccagagt
KC774292_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KC774286_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KC774264_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC774203_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
GQ377600_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
GQ377575_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
GQ377543_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ715378_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ715377_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ715358_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ562249_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ562233_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU939554_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
EU086852_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
DQ980547_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
DQ975273_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
DQ922649_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
AY167096_PreS2_P-C      atgcagtggaactccaaaacattccaccaagctctgctagatcccagagt
AF458664_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
AB670311_PreS2_P-C      atgcagtggaactccacaacattccaccaagctcttctagaccccagagt
AB195952_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ715402_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC774339_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC774331_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC774240_PreS2_P-C      atgcagtggaactccacaacatttcaccaagctctgctagatcccagagt
GQ377527_PreS2_P-C      atgcagtggaactccacaacatttcaccaagctctgctagatcccagagt
FJ715409_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ562332_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU939652_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ386587_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ715382_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ715383_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ715403_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ715407_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB111124_PreS2_P-C      atacagtggaactccacaacattccaccaagctctgctagatcccagagt
AB111125_PreS2_P-C      atacagtggaactccacaacattccaccaagctctgctagatcccagagt
AB246344_PreS2_P-C      atacagtggaactccacaacattccaccaagctctgctagatcccagagt
KF485390_PreS2_P-C      atacagtggaactccacaacattccaccaagctctgctagatcccagagt
KM359441_PreS2_P-C      atacagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ386670_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
DQ922651_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
DQ922650_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KJ173393_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KJ173394_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KF053172_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KJ803765_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ386639_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
DQ993691_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
DQ993692_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
V00867_PreS2_P-C        atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
KJ173441_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KJ173442_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KJ173327_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KJ173328_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC792961_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC792940_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC792792_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC792708_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC792704_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC774316_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC774229_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
JQ341665_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
JQ341636_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU082435_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU082432_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
DQ993693_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU082428_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU082429_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU082430_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU082431_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
GQ924633_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC792655_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC792690_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC792695_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC792776_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC792921_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC792962_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KJ790199_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KX276835_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC792999_PreS2_P-C      atacagtggaactccacaacattccaccaagctctgctagatcccagagt
KJ173433_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KJ173434_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ562252_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
AB642099_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY470933_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgatagatcccagagt
JX429909_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
HM750132_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ562218_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB675677_PreS2_P-C      atgcagtggaactccacaacattccaccaagctcttctagatcccagagt
JQ688404_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KJ173426_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KY470926_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KY470934_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC774338_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
HM750134_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
HM750135_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
LC279247_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
LC279248_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
LC279249_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC774268_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KC774276_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
GQ377619_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KP784761_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
AB670261_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
LC279258_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MG893558_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
LC279261_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
LC279260_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
LC279262_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
LC279246_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
LC279245_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
LC090200_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964002_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KR013873_PreS2_P-C      atgcagtggaactccacgacattccaccaagctctgctagaccccagagt
KR013833_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KR013831_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KR013830_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KR013829_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KR013828_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KR013807_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KJ173430_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KJ173429_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KJ173315_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KJ173293_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KC774347_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctggaccccagagt
KC774249_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctggaccccagagt
JX661492_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
JX429912_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
JQ341658_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
GU434374_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagaccccagagt
GQ377637_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
GQ377621_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
GQ377574_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
GQ377515_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ715380_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KC774360_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ562274_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ562258_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ562244_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ386598_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
EU871982_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
EU871979_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
DQ141656_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
AB198079_PreS2_P-C      atgcartggaactccacaacattccaccaagctctgctagaccccagagt
AB471848_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
AB471849_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
AB471850_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
AB670276_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
EU872010_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ386637_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ562275_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ562329_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
GQ377521_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
GQ377579_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
GQ377617_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
GQ377640_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
JX429906_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
JX661495_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KC774241_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KC774312_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KC774314_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KJ173294_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KJ173427_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KJ173428_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU963992_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU963996_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU963997_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KX276991_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagaccccagagt
KX276989_PreS2_P-C      atgcagtggaattccacaactttccaccaagctctgctagatcccagagt
KX276980_PreS2_P-C      atgcagtggaactccacaactttccaccaaactctgctagatcccagagt
KX276993_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagaccccagagt
AB675674_PreS2_P-C      atgcagtggaactcaacaactttccaccaagctctgctagatcccagagt
AB675675_PreS2_P-C      atgcagtggaactcaacaactttccaccaagctctgctagatcccagagt
AY206376_PreS2_P-C      ctgaagtggaactccacaactttccaccaagctctgctagatcccaaagt
AY206379_PreS2_P-C      ctgaagtggaactccacaactttccaccaagctctgctagatcccaaagt
KX276985_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagaccccagagt
FJ562250_PreS2_P-C      atgcagtggaactccacaactttccaccaagctctgctagatcccagagt
FJ562256_PreS2_P-C      atgcagtggaactctacaactttccaccaagctctgctagatcccagagt
KX276983_PreS2_P-C      atgcagtggaactccacaacgttccaccaagctctgctagacccctgagt
FJ386623_PreS2_P-C      atgcagtggaactccacaactttccaccaagctctgctagatcccagagt
KC774306_PreS2_P-C      atgcagtggaactccacaacttttcaccaagctctgctagatcccagagt
FJ787451_PreS2_P-C      atgcagtggaactccacaactttccaccaagctctactagatcccagagt
FJ787450_PreS2_P-C      atgcagtggaactccacaactttccaccaagctctactagatcccagagt
KX276963_PreS2_P-C      atgcagtggaactccacaactttccaccaagctctgctagatcccagagt
KC774207_PreS2_P-C      atgcagtggaactccacaactttccaccaaactctgctagatcccagagt
KX276984_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagaccccagagt
KR013882_PreS2_P-C      atacagtggaactccacaactttccaccaagctctgctagatcccagagt
KX276965_PreS2_P-C      atgcagtggaactccacaacgttccaccaagctctgctagaccccaaagt
KX276961_PreS2_P-C      atgcagtgaaactccaccacattccaccaagctctgctagaccccagagt
KX276966_PreS2_P-C      atgcagtgaaactccaccacattccaccaagctctgctagaccccagagt
KX276973_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KC774221_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
KX276976_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KC774238_PreS2_P-C      atgcagtggaactccacaactttccaccaagctctgctagatcccagagt
KC774202_PreS2_P-C      atgcagtggaactccacaactttccaccaagctctgctagatcccagagt
FJ386664_PreS2_P-C      atgcagtggaactccacaaatttccaccaagctctgctagatcccagagt
KC774253_PreS2_P-C      atgcaatggaactccacaactttccaccaagctctgctagatcccagagt
KC774304_PreS2_P-C      atgcagtggaactccacaactttccaccaagctctgctagatcccagagt
EU939625_PreS2_P-C      atgcagtggaattccacaactttccaccaagctctgctagatcccagagt
KR013890_PreS2_P-C      atgcagtggaactccacaactttccaccaagctctgctagatcccagagt
FJ715341_PreS2_P-C      atgcagtggaactccacaactttccaccaagctctgctagatcccagagt
EU939626_PreS2_P-C      atgcagtggaactccacaactttccaccaagctctgctagatcccagagt
KR013993_PreS2_P-C      atgcagtggaactccacaactttccaccaggctctgctagatcccaaagt
KR013818_PreS2_P-C      atgcagtggaactccacaactttccaccaggctctgctagatcccaaagt
KC774302_PreS2_P-C      atgcagtggaactccacaactttccaccaggctctgctagatcccagagt
KR013817_PreS2_P-C      atgcagtggaactccacaactttccaccaggctctgctagatcccaaagt
KC774308_PreS2_P-C      atgcagtggaactccacaactttccaccaggctctgctagatcccagagt
KR013819_PreS2_P-C      atgcagtggaactccacaactttccaccaggctctgctagatcccaaagt
KC774303_PreS2_P-C      atgcagtggaactccacaactttccaccaagctctgctagatcccagagt
KC774179_PreS2_P-C      atgcagtggaactccccgactttccaccaagctccgctaaatcccagagt
KC774297_PreS2_P-C      atgcagtggaactccccgactttccaccaagctccgctaaatcccagagt
KT364751_PreS2_P-C      atgcagtggaactccacaactttccaccaagctctgctagatcccagagt
KC774300_PreS2_P-C      atgcagtggaactccacaactttccaccaaactctgctagatcccagagt
KC774296_PreS2_P-C      atgcggtggaactccacaactttccaccaagctctgctagatcccagagt
KC774325_PreS2_P-C      atgcagtggaactccacaactttccaccaagctctgctagatcccagagt
KC774351_PreS2_P-C      atgcagtggaactccacaacttttcaccaagctctactagatcccagagt
KC774321_PreS2_P-C      atgcagtggaactccacaactttccaccaagctctgctagatcccagagt
KC774288_PreS2_P-C      atgcagtggaactccacaactttccaccaaactctgctagatcccagagt
GQ377591_PreS2_P-C      atgcagtggaactccacaactttccaccaagctctgctagatcccagagt
KC774204_PreS2_P-C      atgcagtggaactccacaactttccaccaagctctgctagatcccagagt
GQ377529_PreS2_P-C      atgcagtggaactccacaactttccaccaagctctgctagatcccagagt
KC774330_PreS2_P-C      atgcaatggaactccacaactttccaccaagctctgctagatcccagagt
KT364752_PreS2_P-C      atgcaatggaactccacaactttccaccaagctctgctagatcccagagt
KC774285_PreS2_P-C      atgcagtggaactccacaactttccaccaagctctgctagatcccagagt
KX276979_PreS2_P-C      atgcagtggaactccacaactttccaccaagctctgctagatcccagagt
KC774280_PreS2_P-C      atgcagtggaactccacaactttccaccaagctctgctagatcccagagt
FJ562323_PreS2_P-C      atgcagtggaactccacaactttccaccaagctctgctagatcccagagt
KC774282_PreS2_P-C      atgcagtggaactccacaactttccaccaagctctgctagatcccagagt
KC774298_PreS2_P-C      atgcagtggaactccacaactttccaccaagctctgctagatcccagagt
AB493839_PreS2_P-C      atgcagtggaactccaccactttccaccaagctctgctagatcccagagt
AB493844_PreS2_P-C      atgcagtggaactccacaacgttccaccaagctctgctagatcccagagt
MG826139_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
MG826140_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctaggtcccaaagt
MG826136_PreS2_P-C      atacagtggaactccaccacattccaccaagctctgctagatcccagagt
MG826137_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
MG826128_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
MG826138_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
MG826132_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
MG826134_PreS2_P-C      atgcagtggacctccacaacattccaccaagctctgctagatcccagagt
MG826129_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
DQ141657_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AP011107_PreS2_P-C      atgcagtggaactccacaacatttcaccaggctctgctggatcccagagt
MG826135_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
MG826131_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AP011106_PreS2_P-C      atgcagtggaactccacaacattccaccaaactctgctagatcccagagt
DQ141660_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
MG826133_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU306671_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU306672_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
X75665_PreS2_P-C        atgcagtggaactccacaacattccaacaagctctgcaggatcccagagt
HQ700562_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
HQ700570_PreS2_P-C      gtgcagtggaactccacaacattccaccaagctctgctagatcccagagt
HQ700504_PreS2_P-C      atgcartggaactccacaacattccaccaagctctgctagatcccagrgt
HQ700568_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
HQ700563_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
JN604222_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
HQ700574_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
HQ700556_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
HQ700564_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
HQ700573_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
HQ700502_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
HQ700565_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
HQ700545_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
HQ700529_PreS2_P-C      atrcagtggaactccacaactttccaccaagctctactagatcccagagt
GQ358158_PreS2_C-C      atgcagtggaactccacaacattccaccaagctctgctagatcctcgagt
GQ358157_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcctcgagt
HQ700522_PreS2_P-C      atgcagtggaactccacaactttccaccaagctctgctagatccccgagt
HQ700543_PreS2_P-C      atgcagtggaactccacaactttccaccaagctctgctagatccacgagt
HQ700516_PreS2_P-C      atgcagtggaactccaccaccttccaccaagctctgctagatcccagagt
HQ700576_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccaragt
HQ700506_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KF779327_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
HQ700457_PreS2_P-C      atgcagtggaattccacaacattccaccaagctmtgctagatcccagagk
HQ700490_PreS2_P-C      atacagtggaattccacagcattccaccaagctctgctagatcccagagt
HQ700567_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
HQ700495_PreS2_P-C      atgcaatggaattccacaacattccaccaagctctgctagatcccagagt
HQ700496_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
HQ700569_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
HQ700577_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
HQ700476_PreS2_P-C      atgcagtggaatgccacaacattccaccaagctctgctagatcccagagt
HQ700456_PreS2_P-C      atgcagtggaatgccacaacattccaccaagctctgctagatcccagagt
HQ700475_PreS2_P-C      atgcagtggaatgccacaacattccaccaagctctgctagatcccagagt
HQ700578_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
HQ700571_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
HQ700575_PreS2_P-C      atgcagtggaattccacaacattccamcaagctctgctagatcycagagt
HQ700566_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
HQ700555_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
HQ700572_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
HQ700544_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
HQ700558_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
HQ700561_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
HQ700559_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
AB115417_PreS2_P-C      atgcagtggaactccacaactttccaccaagctctgctagaccccaaatt
EU093896_PreS2_P-C      atacagtggaactccacaacattccaacaaactctgctagatcccagagt
KC793046_PreS2_P-C      atgcagtggaactccacaacatttcatcaagctctgctaaatcccaaagt
KY363261_PreS2_P-C      gtgcagtggaattccaccacatttcaccaagctctgctagatcccagagt
KC792818_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctaaatcccagagt
AB713890_PreS2_P-C      atgcagtggaactccacaacattccaccaggctctgctagatcccagagt
KC792995_PreS2_P-C      ataaagtggaattccacaacattccaccaagctctgctagatcccagagt
KC792911_PreS2_P-C      atgcagtggaactccacaacattccaccaarccctgctagatcccagagt
KJ598726_PreS2_P-C      atgcagtggaattccacaacatttcaccaagctctgctagatcccagagt
KU964236_PreS2_P-C      atgcagtggaactccacaacatttcaccaagctctgctagatcccagagt
KJ598720_PreS2_P-C      atgcagtggaattccacaacatttcaccaagctctgctagatcccagagt
KU964238_PreS2_P-C      atgcagtggaactccacaacatttcaccaagctctgctagatcccagagt
KU964243_PreS2_P-C      atgcagtggaactccacaacatttcaccaagctctgctagatcccagagt
KC774235_PreS2_P-C      atgcagtggaattccacaacatttcatcaagctctgctagatcccagagt
KY470987_PreS2_P-C      atgcagtggaactccacaacctttcaccaagctctgctagatcccagagt
KY470985_PreS2_P-C      atgcagtggaactccacaacctttcaccaagctctgctagatcccagagt
KY470980_PreS2_P-C      atgcagtggaactccacaacctttcaccaagctctgctagatcccagagt
KY470981_PreS2_P-C      atgcagtggaactccacaacctttcaccaagctctgctagatcccagagt
KY470982_PreS2_P-C      atgcagtggaactccacaacctttcaccaagctctgctagatcccagagt
KY470984_PreS2_P-C      atgcagtggaactccacaacctttcaccaagctctgctagatcccagagt
KY470988_PreS2_P-C      atgcagtggaactccacaacctttcaccaagctctgctagatcccagagt
KY470983_PreS2_P-C      atgcagtggaactccacaacctttcaccaagctctgctagatcccagagt
KY470986_PreS2_P-C      atgcagtggaactccacaacctttcaccaagctctgctagatcccagagt
KY470990_PreS2_P-C      atgcagtggaactccacaacctttcaccaagctctgctagatcccagagt
KY470991_PreS2_P-C      atgcagtggaactccacaacctttcaccaagctctgctagatcccagagt
GQ377555_PreS2_P-C      atgcagtggaactccacgacatttcaccaagctctgctagatcccagagt
KJ598670_PreS2_P-C      atgcaatggaattccacaacatttcaccaagctctgctagatcccagagt
KJ598678_PreS2_P-C      atgcaatggaattccacaacatttcaccaagctctgctagatcccagagt
KJ598674_PreS2_P-C      atgcaatggaattccacaacatttcaccaagctctgctagatcccagagt
KJ598669_PreS2_P-C      atgcaatggaattccacaacatttcaccaagctctgctagatcccagagt
KJ598665_PreS2_P-C      atgcaatggaattccacaacatttcaccaagctctgccagatcccagagt
KJ598663_PreS2_P-C      atgcaatggaattccacaacatttcaccaagctctgctagatcccagagt
KJ598666_PreS2_P-C      atgcaatggaattccacaacatttcaccaagctctgctagatcccagagt
KJ598667_PreS2_P-C      atgcaatggaattccacaacatttcaccaagctctgctagatcccagagt
KJ598668_PreS2_P-C      atgcaatggaattccacaacatttcaccaagctctgctagatcccagagt
KJ598671_PreS2_P-C      atgcaatggaattccacaacatttcaccaagctctgctagatcccagagt
KJ598672_PreS2_P-C      atgcaatggaattccacaacatttcaccaagctctgctagatcccagagt
KJ598673_PreS2_P-C      atgcaatggaattccacaacatttcaccaagctctgctagatcccagagt
KJ598676_PreS2_P-C      atgcaatggaattccacaacatttcaccaagctctgctagatcccagagt
KJ598677_PreS2_P-C      atgcaatggaattccacaacatttcaccaagctctgctagatcccagagt
KJ598664_PreS2_P-C      atgcaatggaattccacaacatttcaccaagctctgctagatcccagagt
JX504537_PreS2_P-C      atgcagtggaactccacaacatttcaccaagctctgctagatcccagagt
KJ598737_PreS2_P-C      atgcagtggaattccacaacatttcaccaagctctgctagatcccagagt
KJ598739_PreS2_P-C      atgcagtggaattccacaacatttcaccaagctctgctagatcccagagt
KU964242_PreS2_P-C      atgcagtggaactccacaacatttcaccaagctctgctagatcccagagt
KU964237_PreS2_P-C      atgcagtggaactccacaacatttcaccaagctctgctagatcccagagt
KU964235_PreS2_P-C      atgcagtggaactccacaacatttcaccaagctctgctagatcccagagt
KU964230_PreS2_P-C      atgcagtggaactccacaacatttcaccaagctctgctagatcccagagt
KJ598733_PreS2_P-C      atgcagtggaattccacaacatttcaccaagctctgctagatcccagagt
KJ598732_PreS2_P-C      atgcagtggaattccacaacatttcaccaagctctgctagatcccagagt
KJ598730_PreS2_P-C      atgcagtggaattccacaacatttcaccaagctctgctagatcccagagt
KJ598727_PreS2_P-C      atgcagtggaattccacaacatttcaccaagctctgctagatcccagagt
KJ598736_PreS2_P-C      atgcagtggaattccacaacatttcaccaagctctgctagatcccagagt
KJ598721_PreS2_P-C      atgcagtggaattccacaacatttcaccaagctctgctagatcccagagt
KJ598725_PreS2_P-C      atgcagtggaattccacaacatttcaccaagctctgctagatcccagagt
KJ598735_PreS2_P-C      atgcagtggaattccacaacatttcaccaagctctgctagatcccagagt
KU964239_PreS2_P-C      atgcagtggaactccacaacatttcaccaagctctactagatcccagagt
KU964231_PreS2_P-C      atgcagtggaactccacaacatttcaccaagctctactagatcccagagt
KU964232_PreS2_P-C      atgcagtggaactccacaacatttcaccaagctctactagatcccagagt
KU964233_PreS2_P-C      atgcagtggaactccacaacatttcaccaagctctactagatcccagagt
KU964240_PreS2_P-C      atgcagtggaactccacaacatttcaccaagctctactagatcccagagt
KU964229_PreS2_P-C      atgcagtggaactccacaacatttcaccaagctctactagatcccagagt
KJ598734_PreS2_P-C      atgcagtggaattccacaacatttcaccaagctctactagatcccagagt
KJ598731_PreS2_P-C      atgcagtggaattccacaacatttcaccaagctctactagatcccagagt
KJ598723_PreS2_P-C      atgcagtggaattccacaacatttcaccaagctctactagatcccagagt
KJ598729_PreS2_P-C      atgcagtggaattccacaacatttcaccaagctctactagatcccagagt
KJ598724_PreS2_P-C      atgcagtggaattccacaacatttcaccaagctctactagatcccagagt
KU964241_PreS2_P-C      atgcagtggaactccacaacatttcaccaagctctactagatcccagagt
KU964234_PreS2_P-C      atgcagtggaactccacaacatttcaccaagctctactagatcccagagt
KJ598738_PreS2_P-C      atgcagtggaattccacaacatttcaccaagctctactagatcccagagt
KJ598722_PreS2_P-C      atgcagtggaattccacaacatttcaccaagctctactagatcccagagt
KJ598728_PreS2_P-C      atgcagtggaattccacaacatttcaccaagctctactagatcccagagt
KU963911_PreS2_P-C      atgcagtggaactccacaacatttcatcaagctctgctagatcccagagt
KU963900_PreS2_P-C      atgcagtggaactccacaacatttcatcaagctctgctagatcccagagt
KU963901_PreS2_P-C      atgcagtggaactccacaacatttcatcaagctctgctagatcccagagt
KU963902_PreS2_P-C      atgcagtggaactccacaacatttcatcaagctctgctagatcccagagt
KU963903_PreS2_P-C      atgcagtggaactccacaacatttcatcaagctctgctagatcccagagt
KU963905_PreS2_P-C      atgcagtggaactccacaacatttcatcaagctctgctagatcccagagt
KU963906_PreS2_P-C      atgcagtggaactccacaacatttcatcaagctctgctagatcccagagt
KU963907_PreS2_P-C      atgcagtggaactccacaacatttcatcaagctctgctagatcccagagt
KU963908_PreS2_P-C      atgcagtggaactccacaacatttcatcaagctctgctagatcccagagt
KU963909_PreS2_P-C      atgcagtggaactccacaacatttcatcaagctctgctagatcccagagt
KU963910_PreS2_P-C      atgcagtggaactccacaacatttcatcaagctctgctagatcccagagt
KU963912_PreS2_P-C      atgcagtggaactccacaacatttcatcaagctctgctagatcccagagt
KU963913_PreS2_P-C      atgcagtggaactccacaacatttcatcaagctctgctagatcccagagt
KU963914_PreS2_P-C      atgcagtggaactccacaacatttcatcaagctctgctagatcccagagt
KU963904_PreS2_P-C      atgcagtggaactccacaacatttcatcaagctctgctagatcccagagt
KF495606_PreS2_P-C      atgcagtggaactccacaacatttcaccaagctctgctagatcccagagt
KY670782_PreS2_P-C      atgcagtggaactccacgacatttcaccaagctctgctagatcccagagt
MG826127_PreS2_P-C      atgcagtggaactccacgacatttcaccaagctctgctagatcccagagt
KJ598662_PreS2_P-C      gtgcagtggaattccacaacatttcaccaagctctgctagatcccagagt
HM011493_PreS2_P-C      atgcagtggaaytccacaacatttcaccaagctctgctagatcccagagt
JQ412089_PreS2_P-C      atgcagtggaactccacaacatttcaccaagctctgctagatcccagagt
KY629631_PreS2_P-C      atgcagtggaactccacaacatttcaccaagctctgctagatcccagagt
MG826126_PreS2_P-C      atgcagtggaattccacaacatttcaccaagctctgctagatcccagagt
KY629637_PreS2_P-C      atgcagtggaactccacaacatttcaccaggctctgctagatcccagagt
FJ562300_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KJ173333_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KJ717821_PreS2_P-C      acgcagtggaactccaggggcctatacctagctctggcagatcccagagt
KJ803809_PreS2_P-C      acgcagtggaactccaggggcctatacctagctctggcagatcccagagt
AB670253_PreS2_P-C      atgcagtggaactccacaacattccaccaggctctgctagatcccaaagt
KR819180_PreS2_P-C      atgcagtggaactccacaacattccaccaggctctgctagatcccagagt
AB367420_PreS2_P-C      atgcagtggaattccacaacatttcaccaggctctgctagatcccagagt
EU939588_PreS2_P-C      atgcagtggaactccacgacattccaccaagctctgctagatcccagagt
FJ899778_PreS2_P-C      atgcagtggaactccacgacattccaccaagctctgctagatcccagagt
FJ386631_PreS2_P-C      atgcaatggaactccacaacattccaccaagctttgctagatcccagagt
FJ787449_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KR013789_PreS2_P-C      atgcagtggaactccacaacattccaccaggctctgctagatcccagagt
KR013942_PreS2_P-C      atgcagtggaactccacaacattccaccaggctctgctaggtcccagagt
KR013788_PreS2_P-C      atgcagtggaactccacaacattccaccaggctctgctagatcccagagt
KR013790_PreS2_P-C      atgcagtggaactccacaacattccaccaggctctgctagatcccagagt
AB713885_PreS2_P-C      atgcagtggaactccacaacattccaccaggctctgctagatcccagagt
KC793123_PreS2_P-C      atacggtggaactccacaacattccaccaagctctgctagatcccagagt
FJ787442_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ787443_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU939617_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
FJ787457_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ787458_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB670270_PreS2_P-C      atgcagtggaactccacaacattccaccaggctctgctagatcccagagt
EU939653_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
AB195937_PreS2_P-C      gtgcagtggaactccacaacattccaccaggctctgctagatcccagagt
AB195938_PreS2_P-C      gtgcagtggaactccacaacattccaccaggctctgctagatcccagagt
AB670273_PreS2_P-C      acgaagtggaactccacaacattccaccaggttctgctagatcccagagt
KY363286_PreS2_P-C      atgcagtggaactccacaacattccaccaggctctgctagatcccagagt
KY363287_PreS2_P-C      atgcagtggaactccacaacattccaccaggctctgctagatcccagagt
KC792669_PreS2_P-C      atrcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC793051_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC774225_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
DQ370439_PreS2_P-C      gtgcagtggaactccacaacattccaccaagctctgctagatcccagagt
DQ370438_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
JX429914_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ386652_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
GQ377577_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
GQ377601_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB198082_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KM229703_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ562304_PreS2_P-C      atgcagtggaactccacgacattccaccaagctctgctagatcccagagt
AB670239_PreS2_P-C      gtgaagtggaagtccacaacattccaccaggctctgctagatcccagagt
AB670240_PreS2_P-C      gtgaagtggaagtccacaacattccaccaggctctgctagatcccagagt
KJ598641_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
KJ598660_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
KJ598642_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
KJ598644_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
KJ598637_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
KJ598655_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
KJ598653_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
KJ598640_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
KJ598645_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
KJ598648_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
KJ598650_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
KJ598654_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
KJ598657_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
KJ598659_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
KJ598652_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
KJ598651_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
KJ598646_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
KJ598635_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
KJ598636_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
KJ598639_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
KJ598647_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
KJ598649_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
KJ598656_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
KJ598658_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
KJ598661_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
KJ598638_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
KC774245_PreS2_P-C      atgcagtggaactcaacaacattccaccaagctctgctagatcccagagt
AB367404_PreS2_P-C      atgcagtggaactccacaacattccaccaggctctgctagatcccagagt
EU939573_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatccaagagt
GQ475309_PreS2_P-C      atacagtggaaatccacaacattccaccaggctctgctagatcccagagt
MH891502_PreS2_P-C      atgcagtggaactccacaacattccatcaggctctgctagatcccagagt
KJ173296_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB195936_PreS2_P-C      gtgcagtggaactccacaacattccaccaggctctgctagatcccagagt
EU916225_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ562282_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
GQ377572_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
JX560519_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU939569_PreS2_P-C      atgcagtggaactctacaacattccaccaagctctgctagatcccagagt
MH887433_PreS2_P-C      atgcagtggaactccacaacattccaccaggctctgctagatcccagagt
KC774272_PreS2_P-C      atgcagtggaactcaacaacattccaccaagctctgctagatcccagagt
AB670281_PreS2_P-C      atgcagtggaactccacaacattccaccaggctctgctagatcccagagt
AB642100_PreS2_P-C      atgcagtggaactccacaacattccaccaggctctgctagatcccagagt
AB900116_PreS2_P-C      atgcagtggaactccacaacattccaccaggctctgctagatcccagagt
HQ622095_PreS2_P-C      atgcagtggaactccacaactttccaccaggctctgctagatcccagagt
KC774243_PreS2_P-C      atgcagtggaactcaacaacattccaccaagctctgctagatcccagagt
KC774346_PreS2_P-C      atgcagtggaactcaacaacattccaccaagctctgctagatcccagagt
GQ377528_PreS2_P-C      atgcagtggaactcaacaacattccaccaagctctgctagatcccagagt
FJ386588_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB198081_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctggtagatcccagagt
FJ562232_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB900109_PreS2_P-C      atgcagtggaaytccacaacattccaccaagctctgctagatcccagagt
KX276836_PreS2_P-C      gtgmagtggaacytcacaamattccacmaagctctgctaratcccaragt
AB900113_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ562320_PreS2_P-C      atgcaatggaactccacaacattccaccaagctctgctagatccaaragt
DQ089802_PreS2_P-C      atgcagtggaactccaccacattccaccaagctttgctagatcccagagt
EU522071_PreS2_P-C      acgcagtggaactccacaacattccaacaagctctgctagatcccagagt
FJ386624_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
GQ372968_PreS2_P-C      atgcagcggaactccacaacattccaccaagctctgctagatcccagagt
KC792926_PreS2_P-C      atgcagtggaactccacaacgttccaccaagctctgctagatcccagagt
KC792880_PreS2_P-C      gtgcagtggaactccacaacgttccaccaagctctgctagatcccagagt
KJ598761_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KJ598756_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagggt
KJ598757_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagggt
KJ598765_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagggt
KJ598767_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KJ598773_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KJ598777_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KJ598768_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KJ598769_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccaaagt
KJ598775_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KJ598770_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KJ598772_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KJ598766_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KJ598771_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KJ598780_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KJ598779_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KJ598776_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KJ598774_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KJ598778_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC792775_PreS2_P-C      atgcagtggaactcaacgacattccaccaagctctgctagatcccagagt
KC793003_PreS2_P-C      aygcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC792672_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
GQ377632_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
AB368297_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB931170_PreS2_P-C      atgcagtggaactcctcaacattccaccaagctctgctagatcccagagt
AB931171_PreS2_P-C      atgcagtggaactcctcaacattccaccaagctctgctagatcccagagt
KC793129_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB367431_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
MK321266_PreS2_P-C      atgcagtggaactccacaacatttcaccaagctctgctagatcccagagt
MK720629_PreS2_P-C      atgcagtggaactccacaacatttcaccaagctctgctagatcccagagt
MK720630_PreS2_P-C      atgcagtggaactccacaacatttcaccaagctctgctagatcccagagt
KC792873_PreS2_P-C      atgcagtggaactccacaacgttccaccaagctctgctagatcccagagt
EU882005_PreS2_P-C      acgcagtggaactccacaacattccaccaagctctactagatcccagagt
KC792762_PreS2_P-C      atgcagtggaactccacaacgttccaccaagctctgctagatcccagagt
KU964032_PreS2_P-C      atgcagtggaactccacaacgttccaccaagctctgctagatcccagagt
KU964020_PreS2_P-C      atgcagtggaactccacaacgttccaccaagctctgctagatcccagagt
KU964021_PreS2_P-C      atgcagtggaactccacaacgttccaccaagctctgctagatcccagagt
KU964022_PreS2_P-C      atgcagtggaactccacaacgttccaccaagctctgctagatcccagagt
KU964023_PreS2_P-C      atgcagtggaactccacaacgttccaccaagctctgctagatcccagagt
KU964024_PreS2_P-C      atgcagtggaactccacaacgttccaccaagctctgctagatcccagagt
KU964025_PreS2_P-C      atgcagtggaactccacaacgttccaccaagctctgctagatcccagagt
KU964026_PreS2_P-C      atgcagtggaactccacaacgttccaccaagctctgctagatcccagagt
KU964027_PreS2_P-C      atgcagtggaactccacaacgttccaccaagctctgctagatcccagagt
KU964028_PreS2_P-C      atgcagtggaactccacaacgttccaccaagctctgctagatcccagagt
KU964029_PreS2_P-C      atgcagtggaactccacaacgttccaccaagctctgctagatcccagagt
KU964030_PreS2_P-C      atgcagtggaactccacaacgttccaccaagctctgctagatcccagagt
KU964031_PreS2_P-C      atgcagtggaactccacaacgttccaccaagctctgctagatcccagagt
KU964033_PreS2_P-C      atgcagtggaactccacaacgttccaccaagctctgctagatcccagagt
DQ089801_PreS2_P-C      atgcagtggaactccacaacgttccaccaagctctgctagatcccagagt
FJ562298_PreS2_P-C      atgcagtggaactccacaacgttccaccaagctctgctagatcccagagt
KU964049_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KU964050_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KU964051_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KU964052_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KU964053_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KU964054_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KU964055_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KU964056_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KU964057_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KU964058_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KU964059_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KU964060_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KU964061_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KU964062_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KU964063_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KJ410508_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
MG826125_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AY167091_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC792793_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctactagatcccagagt
DQ141662_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgcaagatcccagagt
KC792713_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC792739_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
DQ890381_PreS2_P-C      atgcaatggaactccaccacatttcaccaaactctgctagatcccaaagt
EU670263_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC792831_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctggcagatcccagagt
AB014365_PreS2_P-C      atacagtggaactccaccacattccaccaagctctgctagatcccagagt
AB367421_PreS2_P-C      atgcagtggacttccacaacattccaccaagcactgctagatcccggagt
KR013919_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccaaagt
FJ386638_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KR013915_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ386601_PreS2_P-C      atccaatggaactccgcaacgttccaccaagctctgctagatccccgagt
AB367406_PreS2_P-C      atgcagtggaactccacaacattccaccagactctgctagatcccagagt
AB367401_PreS2_P-C      acgcagtggaactccacaacattccacaaagctatgctagatcccagagt
AB049610_PreS2_P-C      atgcagtggaattccacaacattccaccaaactctgctagatcccagagt
FJ562310_PreS2_P-C      atgcagtggaacttcacaacattccaccaagctctgttagatcccagagt
FJ386611_PreS2_P-C      atgcagtggaactctacaacattccaccaagctctgctagatcccagagt
GQ377557_PreS2_P-C      atgcagtggaactccacaacattccaccaaactctgctagatcccagagt
FJ386607_PreS2_P-C      atgcagtggaactccacaacattccaccaggctctgctagatcccagagt
AB014363_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
GU721029_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB014360_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
FJ562295_PreS2_P-C      atgcaccggaactccacaacattccaccaagctctgctagatcctttagc
EU939579_PreS2_P-C      atacagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ899774_PreS2_P-C      atacagtggaactccacaacattccaccaagctctgctagatcccagagt
DQ993181_PreS2_P-C      gtgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ562334_PreS2_P-C      atccagtggaactccacaacgttccaccaagctctgctagatccccgagt
KC793110_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KU964064_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964065_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964066_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964067_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964068_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964069_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964070_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964071_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964072_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964073_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964074_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964075_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964077_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964078_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964334_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964336_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964337_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964338_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964339_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964340_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964342_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964343_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964344_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964345_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964346_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964347_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964348_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964076_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
EU939649_PreS2_P-C      atgcagtggaactccataacattccaccaagctctgctagatcccagagt
EU939599_PreS2_P-C      atgcagtgaaa---cacaacattccaccaagctctgctagatcccagagt
KC774265_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB367412_PreS2_P-C      atgcagtggaactccacaacattccaccaagctttgctagatcccagagt
AB642097_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
AB367418_PreS2_P-C      atgcagtggaactccaccacatttcaccaagctctgctagatcccagagt
KR013853_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgccagatcccagagt
KR013923_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcacagagt
KR013778_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KR013777_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagc
FJ787474_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB670309_PreS2_P-C      atgcagtggaactccaccacatttcaccaagctctgctagatcccagagt
AB670295_PreS2_P-C      gtgtgttggaacaccacaacattccaccaagctctgctagatcccagagt
KC774343_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
JN604231_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AY220701_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KY363254_PreS2_P-C      acgcagtggaactcccccacattccaccaagctctgctagatcccagagt
EU554540_PreS2_P-C      atgcagtggaactccacaacattccaccaagctttgctagatcccagagt
GQ475353_PreS2_P-C      atgcagtggaacaccacaacattccaccaagctctgctagatcccagagt
AB113875_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB113876_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB111119_PreS2_P-C      gtgcagtggaaatccacaacattccaccaagctctgctagaccccagagt
KC774194_PreS2_P-C      atgcagtggaattccacaatattccaccaagctctgctagatcccagagt
JX661489_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
JQ027323_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
HM750137_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU939601_PreS2_P-C      atacagtggaactccacaacattccaccaagctctgctagatcccagagt
EU939572_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU562216_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB367399_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB362932_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ032333_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ386665_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
GQ377559_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatccaagagt
LC279256_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
AB042284_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
LC279254_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
LC279257_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
LC279255_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KF214652_PreS2_P-C      atgcagtggaa---cacaacattccaccaagctctgctagatcccaaagt
AB300368_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ562268_PreS2_P-C      atacagtggaactccacaactttccacaaagctctgctagatccaagagt
KR013852_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KY363282_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KY363283_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC792927_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccaaagt
KC774215_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatccaagagt
KC774216_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatccaagagt
JX429907_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
HM750138_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
GQ377586_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ562333_PreS2_P-C      atgcagtggaactccacaacattccaccaagccctgctagatcccagagt
EU939549_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgatagatcccagagt
AY641561_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
AY641558_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
JN400087_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
JN400088_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
JN400089_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AY247032_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
AB367407_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB485810_PreS2_P-C      gtgcggtggaactccacaacattccaccaagctctgctagatcccagagt
AB033550_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
GQ377535_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
GQ377553_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ715350_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ715370_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ562330_PreS2_P-C      atacagtggaactccacaacattccaccaagctttgctagatcccagagt
FJ386679_PreS2_P-C      acgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU939654_PreS2_P-C      atacagtggaactccacaacattccaccaagctctgctagatcccagagt
AB670294_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KY363268_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
KR013851_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KR013850_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC774309_PreS2_P-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
KC774270_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC774266_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC774247_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctactagatcccagagt
KC774208_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
JQ341670_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
GQ475336_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
GQ475331_PreS2_P-C      atgcagtggaactccaccacatttcaccaagctctgctagatcccagagt
GQ377540_PreS2_P-C      atgcagtggaactccacgacattccaccaagctctgctagatcccagagt
FJ562291_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ562288_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ386671_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU939587_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU939566_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU939648_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
GQ475318_PreS2_P-C      atgcagtggaactcccccacatttcaccaagctctgctagatcccagagt
GQ475306_PreS2_P-C      atgcagtggaactccaccacatttcaccaagctctgctagatcccagagt
GQ475308_PreS2_P-C      atgcagtggaactccaccacatttcaccaagctctgctagatcccagagt
GQ475310_PreS2_P-C      atgcagtggaactccaccacatttcaccaagctctgctagatcccagagt
JN604148_PreS2_P-C      atgcagtggaattccacaacatttcaccaagctctgctagatcccagagt
JQ040151_PreS2_P-C      aygcagtggaactccacaacattccaccaagctctgctagatcccagagt
X04615_PreS2_P-C        atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KJ173439_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KJ173440_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC774299_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC774239_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC774195_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC774192_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC774185_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
JX661490_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
GQ475330_PreS2_P-C      atgcagtggaactccacaaccttccaccaagctctgctagatcccagagt
GQ475321_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
EU939590_PreS2_P-C      atgcaatggaactccacaacattccaccaagctctgctagatcccagagt
EU939591_PreS2_P-C      atgcaatggaactccacaacattccaccaagctctgctagatcccagagt
EU939548_PreS2_P-C      atgcagtggaactccacaacattccaccaaactctgctagatcccagagt
EU562215_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB670297_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB670287_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB670251_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB202071_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ386575_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC774184_PreS2_P-C      atgcagtggaactccacaactttccaccaagctctgctagatcccagagt
GQ475341_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU562217_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC774255_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC774244_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC774233_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC774220_PreS2_P-C      atgcagtggaactccacaactttccaccaagctctgctagatcccagagt
GQ475349_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
GQ475345_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
GQ475307_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
GQ377616_PreS2_P-C      atgcagtggaactccacaactttccaccaagctctgctagatcccagagt
GQ377563_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
GQ377598_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
JX661488_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KJ173283_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KJ173284_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
GQ377514_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AP011098_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB205124_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB198078_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
GQ475348_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
MG893556_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
DQ089793_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
GQ475314_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC774181_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC774250_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC774251_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
GQ377576_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
JQ341635_PreS2_P-C      atgcaatggannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
KX276850_PreS2_P-C      atrcagtggaactccagcgcaktccaccaagctctgctagatcccagagt
EU498227_PreS2_P-C      atacagtggaactccagcacattccacaaagctctgctagatccccgagt
HM011488_PreS2_P-C      atgcagtggaactccagcacattccaycaagctctrctagatcccagagt
AB074047_PreS2_P-C      atg---tggaattccagcacattccgccaagctctgctagatcccagagt
JQ027324_PreS2_P-C      atgcagtggaattccagcacattccaccaagctctgctagatcccagagt
KF053181_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KJ803774_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
HM011495_PreS2_P-C      atgcartggaaytccagcacattccaccaagctctcctagatcccagagt
KJ717804_PreS2_P-C      atgcagtggaactccaacacattccaccaagctctgctagatcccagagt
KJ803794_PreS2_P-C      atgcagtggaactccaacacattccaccaagctctgctagatcccagagt
GQ924642_PreS2_P-C      gtgaagtggaactccagcacattccaccaaactctgctagatcccagggt
KF053168_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KJ803760_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KY470908_PreS2_P-C      atgcggtggaactccagcacattccaccaagctctgctagaccccagagt
KY470911_PreS2_P-C      atgcggtggaactccagcacattccaccaagctctgctagaccccagagt
KF053173_PreS2_P-C      atacagtggaactccagcacattccaccaagctctgctagatcccagagt
KJ803766_PreS2_P-C      atacagtggaactccagcacattccaccaagctctgctagatcccagagt
MK286461_PreS2_P-C      atgcagtggaactccagcacattccaccaagctcwgctagatcccagagt
JN604135_PreS2_P-C      atgcagtggaactacagaacattccaccaagctctgctagatcccagagt
KF214673_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KF053161_PreS2_P-C      atgcagtggaactccagcacattccacaatgctctgctagatcccagagt
KJ803754_PreS2_P-C      atgcagtggaactccagcacattccacaatgctctgctagatcccagagt
JQ341657_PreS2_P-C      atgcagtggaactccagcacattccaccaagctcnnnnnnnnnnnnnnnn
KF214671_PreS2_P-C      gtgcagtggaactccagcgcattccaccaaactctgctagatcccagagt
MF925403_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KJ717839_PreS2_P-C      acgcagtggaactccacaacgttccaccaagctctgctagatcccagagt
KJ803823_PreS2_P-C      acgcagtggaactccacaacgttccaccaagctctgctagatcccagagt
FJ023639_PreS2_P-C      atgcagtggaactccaacacattccaccaagctctgctagatcccagagt
JQ027317_PreS2_P-C      ryrcagtggaactccagcacattccaccaagctctgctagatcccagagt
KX276848_PreS2_P-C      atgaagtggaattccagcacattccaccaagctctgctagatcccagagt
AB112471_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KX276844_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KR013927_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
EF384206_PreS2_P-C      atrcagtggaactccacaacattccaccaagctctgctagatcccagagt
GQ924658_PreS2_P-C      acgcagtgg------ggcacattccaccaagctctgctaggtcccagagt
JN827423_PreS2_P-C      atgcagtggaactccagcatattccaccaagctctgctagatcccagagt
KJ717826_PreS2_P-C      atgcaatggaactccagcacattccaccaagctctgctagatcccagagt
KJ803813_PreS2_P-C      atgcaatggaactccagcacattccaccaagctctgctagatcccagagt
KJ717823_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KJ717828_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KJ803811_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KJ803815_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KJ717827_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KJ803814_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KX276847_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148526_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148512_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ801497_PreS2_P-C      atgcaatggaactccagcacattccaccaagcgctgctagatcccagagt
KP148561_PreS2_P-C      atgcagtggaactccagtacattccaccaagctctgctagatcccagagt
KP148559_PreS2_P-C      atgcagtggaactccagcacattccaccaaactctgctagatcccagagt
KP148521_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148524_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148493_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148487_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148481_PreS2_P-C      atgcagtggaactccagcacattccaccgagctctgctagatcccagagt
KP148476_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctggatcccagagt
KP148474_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148470_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KX765830_PreS2_P-C      atgcagtggaacaccagcacattccaccaagctctgctagatcccagagt
KP148568_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148567_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148543_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148534_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148519_PreS2_P-C      atgcaatggaactccagcacattccaccaagctctgctagatcccagagt
KP148530_PreS2_P-C      atgcaatggaactccagcacattccaccaagctctgctagatcccagagt
KP148514_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagattccagagt
KP148513_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148492_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148473_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148472_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148477_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
FJ023649_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
FJ023643_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
FJ023644_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
MF925387_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
AB300363_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ801519_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KX765826_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KX765837_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KX765848_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KX765850_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
EF384200_PreS2_P-C      atacagtggaactccagcacattccaccaagctctgctagatcccagagt
GQ924604_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
AB074755_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KF053167_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KF053169_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KJ803759_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KJ803761_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
GQ924615_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148563_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148546_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148560_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148520_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148529_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148465_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148564_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148575_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148570_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148566_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148555_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148551_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148548_PreS2_P-C      atgcagtggagctccagcacattccaccaagctctgctagatcccagagt
KP148545_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148537_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctactagatcccagagt
KP148535_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148532_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148525_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148489_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148557_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148483_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148491_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148482_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148554_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148475_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148469_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148466_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148463_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148315_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148464_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148462_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148468_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148471_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148479_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148480_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148488_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148517_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148523_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148528_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148531_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148538_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148540_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148547_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148549_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148552_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148558_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148562_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148571_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148572_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148573_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KP148574_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
GQ358153_PreS2_P-C      atgcagtggaactccagcacattccaccaatctctgctagatcccagagt
KF053164_PreS2_P-C      atacagtggaactccagcacattccaccaaactctgaaagattccagagt
KJ803757_PreS2_P-C      atacagtggaactccagcacattccaccaaactctgaaagattccagagt
JQ801491_PreS2_P-C      atgcagtggaactccagcacatttcaccaagctctgctagatcccagagt
DQ089804_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgttagatcccagagt
JQ341656_PreS2_P-C      ntgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ341778_PreS2_P-C      ---cagtggaactccagcacattccaccaagctctgctagatcccagagt
KC315399_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgttagatcccagagt
KF053184_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KJ803777_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KJ717791_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JN604129_PreS2_P-C      atgcagtggaaytccagcacattccaccaagctctgctagatcccagagt
HM011468_PreS2_P-C      atgcaatggaactccagcacattccaccaagctctgctagatcccagagt
HM011491_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KX276854_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
GQ855376_PreS2_P-C      atgcagtggaactccagcacattccaccaaactctgctagatcccagagt
AY167099_PreS2_P-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
KJ717825_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KJ803812_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KF214670_PreS2_P-C      atacagtggaactccagcacattccaccaagctctgctagatcccagagt
MF925409_PreS2_P-C      atgcagtggaactccaacacattccaccaagctctgctagatcccagagt
KF214675_PreS2_P-C      atgcagtggaactccagcaccttccaccaagctctgctagatcccagagt
AB112066_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KF053183_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KJ803776_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ801472_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
GQ222203_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctaggtcccagagt
DQ089803_PreS2_P-C      atgcagtggaactcaagcacattccaccaagctctgctagatcccagagt
JN604243_PreS2_P-C      gcgcagtggaactccagcacattccaccaagctttactagatcccagagt
DQ315781_PreS2_P-C      atgcagtg---ctccagcacattccaccaggctctactagatcccagagt
DQ315783_PreS2_P-C      atgcagtg---ctccagcacattccaccaggctctactagatcccagagt
GQ924643_PreS2_P-C      gtgcagtggaactcccacacattccaccaagctgtactaaatcccaaagt
JN827418_PreS2_P-C      atgcagtggaactccaacacattccaccaagctctgctagatcccagagt
JN827421_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctactagatcccagagt
AB112408_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ801493_PreS2_P-C      atgcagtggaactccagcacattccaccaagctttgctagatcccagagt
JQ801481_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccaaagt
KX765828_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ801515_PreS2_P-C      atgcagtggaattccaccacattccaccaagctctgctagatcccagagt
MF488701_PreS2_P-C      atgcattggaactccagcacattccaccaagctctgctagatcccagagt
JN827420_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB112348_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagaacccagagt
JN827424_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JN827425_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KU051424_PreS2_P-C      atgcagtggaactcaagtacattccaccaagctctgctagatcccagagt
FJ023648_PreS2_P-C      ataaagtggaactccagcacattccaccaagctctgctagatcccagagt
KX765855_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JN604232_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
FJ023646_PreS2_P-C      atgcaatggaactccagcacattccaccaagctctgctagatcccagagt
FJ023645_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KC875268_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KX765819_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccaaagt
KX765847_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KY470912_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KX774504_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctcgatcccagagt
KF214667_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ801473_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ341661_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccaaagt
KY470914_PreS2_P-C      atgcagtggaattccagcacattccaccaagctctgctagatcccagagt
KF053176_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccaaagt
KT366464_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KF053193_PreS2_P-C      atgcaatggaactccaacacattccacacagctctgctagatcccagagt
MH220971_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
MF925395_PreS2_P-C      atgcagtggaactccaacacattccaccaagctctgctagatcccagagt
MF925359_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
MF925374_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KX765849_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctactagatcccagagt
KX765842_PreS2_P-C      atgcagtggaactccagcactttccacaaagctctgctagatcccagagt
KX765834_PreS2_P-C      atgcagtggaactccaacacattccaccaagctctgctagatcccagagt
JQ429078_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JN827422_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JN604147_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgytagatcccagagt
GQ924650_PreS2_P-C      atgcagtggaattccagcacattccaccaagctctgctagatcccagagt
KY470913_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KY470910_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KY470918_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KY470906_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgttagatcacagagt
KY470920_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KY470909_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KY470907_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KY470917_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KT987425_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KT987426_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KT307718_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KT307719_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KU051427_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KU051426_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ801498_PreS2_P-C      atacagtggaactccagcacattccaccaagctctgctagatcccagagt
GQ924616_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KJ410505_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
GQ184326_PreS2_P-C      atgcaatggaactccagcacattccaccaagctctgctagatcccagagt
DQ141667_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KJ717834_PreS2_P-C      atgttctggaactctctgacattccaccaagctctgctagatcccagagt
KJ803818_PreS2_P-C      atgttctggaactctctgacattccaccaagctctgctagatcccagagt
MG826123_PreS2_P-C      atgcagtggaattccagcactttccaccaagctctgctagatcccagagt
AB247916_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
AB117758_PreS2_P-C      atgctgtggaactccgcaacattccaccaagctctgctagatcccagagt
MK628732_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
MF925365_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KY470936_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KY470937_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KY470916_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KX765852_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KX765821_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KT987423_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagggt
KT366463_PreS2_P-C      atgcagtggaactcaagcacattccaccaagctctgctagatcccagagt
KF214676_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KC875270_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccaaagt
KC774236_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ801509_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ801488_PreS2_P-C      atgcagtggaactccagaacattccaccaagctctgctggatcccagagt
FJ023656_PreS2_P-C      atgcaatggaactccagcacattccaccaagctctactagatcccagagt
FJ023654_PreS2_P-C      atgcagtggaactccagcacattccaccaagctcttctagatcccagagt
DQ141666_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
DQ141664_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
MF925405_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
MF925394_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KC875267_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ801523_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JN827417_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KX765823_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
FJ349225_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ027333_PreS2_P-C      atacagtggaactccagcacattccaccaagctctgctaratcccagagt
JN604121_PreS2_P-C      atacagtggaactccagcacattccaccaagctctgctagatcccagagt
MF925398_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KX765843_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JN604153_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KF053187_PreS2_P-C      atgcagtggaactccactgcattccacccagctctgctagatcccagagt
KJ803780_PreS2_P-C      atgcagtggaactccactgcattccacccagctctgctagatcccagagt
KF214668_PreS2_P-C      atgcagtggaactccagcacattccatcaagctctgctagatcccagagt
KX765825_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ801482_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ801475_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KX765844_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
MG725248_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
MF925375_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KX774506_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KX765832_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KX765829_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KX765822_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KU051425_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctactagatcccagagt
KJ717802_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KJ803792_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KC875273_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KC875272_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KC875269_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ801522_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ801521_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ801505_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ801503_PreS2_P-C      atgcaatggaactccagcacattccaccaagctctgctagatcccagagt
JQ801501_PreS2_P-C      atgcaatggaactccagcacattccaccaagctctgctagatcccagagt
JQ801500_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ801486_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctcgatcccagagt
JN827416_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JN604151_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JF899336_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
GQ924629_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KX765851_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagattccagagt
JQ801496_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KT347089_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
GQ924609_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
GQ924614_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KX765827_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KX765836_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KC875264_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccacagt
KC875265_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
GQ358154_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KC875271_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
MF925410_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
MF925377_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
MF925367_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctactagatcccagagt
KX765839_PreS2_P-C      atgcaatggaactccagcacattccaccaagctctgctagatcccagagt
MF925369_PreS2_P-C      atgcaatggaactccagcacattccaccaagctctgctagatcccagagt
KX765831_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KT364718_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KJ717812_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KJ803800_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KJ717810_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KJ717811_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KJ803799_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KC875274_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ801518_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ801504_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ801502_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KX765818_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ801470_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
GQ924612_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
GQ924613_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
FJ023647_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctactagatcccagagt
KX765838_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctactagatcccagagt
EU306691_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
EU306690_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
EU306689_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
EU306688_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
EU306687_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
EU306694_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KC774228_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
AF068756_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
AB074756_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
DQ141668_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
FJ023641_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
FJ023642_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
FJ023657_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
FJ023658_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
GU563561_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ801511_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ801513_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ801520_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KT364721_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KT987424_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KU051423_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KX765820_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KX765833_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KX765840_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KX765846_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KX765853_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KX774503_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
MF925406_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
MF925408_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
GQ924649_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
MG571345_PreS2_P-C      atgcagtggaactccagaacattccaccaagctctgttagatcccagagt
KX276841_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
MG571359_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KJ410515_PreS2_P-C      atgaagtggaactccagcacattccaccaagctctgttagatcccaaagt
KJ410499_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgttagatcccagagt
KJ410494_PreS2_P-C      atgcagtggaactccagcacattccaccaagccctgttagatcccagagt
KJ410491_PreS2_P-C      atgcagtggaactccagcacattccaccaagccctgttagatcccagagt
KJ410492_PreS2_P-C      atgcagtggaactccagcacattccaccaagccctgttagatcccagagt
JQ341652_PreS2_P-C      atgcagtggaactccagcacattccaccnnnnnnnnnnnnnnnnnnnnnn
MF674390_PreS2_P-C      atgcagtggaattccagcacattccaccaagctctgctagatcccagagt
DQ089791_PreS2_P-C      atacagtggaactccarcacattccaccaagctctgccagatcccagagt
JQ281123_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagggt
JQ281125_PreS2_P-C      atgcagtggaaytccagcacattccaccaagctctgctagatcccagagt
DQ089780_PreS2_P-C      atgcagtggaactycagcacattccaccaagctctgctagatcccagagt
KJ717822_PreS2_P-C      acgcagtggaactccaccactttccaccaagctctgctagatcccagagt
KJ803810_PreS2_P-C      acgcagtggaactccaccactttccaccaagctctgctagatcccagagt
MF674489_PreS2_P-C      atgaagtggaactcccgcacattccaccaagctctgctagatcccagagt
KJ410511_PreS2_P-C      gtgcagtggaactcccgcacattccaccaagctctgctagatcccagagt
JQ341628_PreS2_P-C      rtgcagtggaactccascacattccaccaagctctgacagaycccagagt
KX276840_PreS2_P-C      atgcagtggaactccagcacattccaccaarctytgctagatcccagagt
JQ341650_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ341612_PreS2_P-C      atgcagtggaactccaacacattccaccaagcactgctagatcccagaat
JQ341626_PreS2_P-C      atgcagtggaattccagcacattccaccaagctctgctagatcccaaagt
JQ027320_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctactagatcccagagt
DQ089785_PreS2_P-C      gtgcggtggaactccagcacattccaccaagctctgctagatcccagagt
JX507211_PreS2_P-C      atgcagtggaattccaccacattccaccaagctctgttggatcccagagt
JQ341664_PreS2_P-C      atgcaatggaactccagcayattccaccaagctctgctagatcccagagt
JQ341653_PreS2_P-C      ctgcagtggnnnnnnggcacattccaccaagctctgctagatcccagagg
KJ173285_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KJ173286_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
DQ089767_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgatagatcccagagt
DQ089768_PreS2_P-C      acacagtggaactccagcacattccaccaagctctgatagatcccagagt
JQ027318_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ341631_PreS2_P-C      atgcagtgsaactccagcacattccaccaagctctgctagatcccagagt
JQ341620_PreS2_P-C      atgcagtggaactccagcacattccaccaaactctgctagatcccagagt
AB105174_PreS2_P-C      atacagtggaactccaccacattccaccaagctctgttagatcccaaagt
MF925376_PreS2_P-C      atgcagtggaattccagcacattccaccaagctctgctagaccccagagt
GQ924655_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagaccccagagt
KJ410518_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KJ410493_PreS2_P-C      atgcagtggaactccagcacattccaccaagcactgttagatcccagagt
GQ855393_PreS2_P-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
JQ341668_PreS2_P-C      atrcagtggaactccagcamattccaccaagttctgctagatcccagagt
JQ341790_PreS2_P-C      atrcagtggaactccagcamattccaccaagttctgctagatcccagagt
KR013935_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KR013820_PreS2_P-C      atgcaatggaactccggcacattccaccaagctctgctagatcccagagt
DQ089773_PreS2_P-C      atacagtggaactccaaaacattccaccaagctctgctagatcccagagt
KR013855_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KR013854_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KR013856_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KR013857_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KR013822_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KR013823_PreS2_P-C      atgaaatggaactccagcacattccaccaagctctgctagatcccagagt
KR013821_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KR013824_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ341655_PreS2_P-C      atrcagtggaactccagcacattccaccaarctctgctagatcccagagt
AB031262_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KR013905_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KR013770_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KR013900_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KR013902_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
DQ089790_PreS2_P-C      atgcagtggaactcaagcacattccaccaagctctgctagatcccagagt
MG571335_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
MF674425_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
MF674458_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KR013826_PreS2_P-C      atgcaatggaactccagcacattccaccaagctctgctagatcccagagt
KR013787_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KR013825_PreS2_P-C      atgcaatggaactccggcacattccaccaagctctgctagaccccagagt
JX507212_PreS2_P-C      gtgcagtggaactccagcacattccacctagctctgctagatcccagagt
DQ246215_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagaccccagagt
DQ089786_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ341669_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
DQ089766_PreS2_P-C      acgcagtggaactccagcacattccaccaagctctgctagatcccagagt
EF494379_PreS2_P-C      gtgcagtggaactccaacacattccaccaagctctgctagatcccagagt
DQ089761_PreS2_P-C      rtgcagtggaattccagcacattccaccaagctctgctagatcccagagt
DQ089776_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
DQ089777_PreS2_P-C      atgcaatggaactccagcacattccaccaagctctgctagatcccagagt
MF674444_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
MF674430_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KJ717809_PreS2_P-C      atgcagtggaactccagcacattccatcaagctctgctagatcccagagt
DQ089775_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
DQ089770_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ341633_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
DQ089792_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagattccagagt
DQ089788_PreS2_P-C      atgcaatggaactccagcacattccaccaagctctgctagatcccagagt
KM875424_PreS2_P-C      atgcaatggaactccagcacattccaccaagctctgctagatcccagagt
DQ089763_PreS2_P-C      acgcagtggaactccagcacattccaccaagctctgctagatcccagagt
AB205125_PreS2_P-C      acgcagtggaactccagcacattccaccaagctctgctagatcccagagt
MF674502_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
MG571332_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgttagatcccagagt
MF674417_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KR013903_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KM875425_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KF053185_PreS2_P-C      atgcagtggaactccagcacattccaccaggctctgctagatcccaaagt
KC774227_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ341611_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ281122_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ281113_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
DQ141663_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
DQ089783_PreS2_P-C      atgcaatggaactccagcacattccaccaagctctgctagatcccagagt
DQ089778_PreS2_P-C      atgcagtggaactccaacacattccaccaagctctgctagatcccagagt
DQ089762_PreS2_P-C      atgcagtggaactccagaacattccaccaagctctgctagatcccagagt
AF473543_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
GQ377536_PreS2_P-C      atgcagtggaattccagcactttccaccaagctctgctagatcccagagt
AB112065_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KM875429_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ801495_PreS2_P-C      tggaagtggaactccagcacattccaccaagctctactagatcccagagt
KR013899_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
HM011472_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctggatcccagagt
MK818227_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctggatcccagagt
MF674504_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
MF674408_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccaaagt
MF674399_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
MF488703_PreS2_P-C      atgcaatggaactccagcacattccaccaagctctgctagatcccagagt
KY470915_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KJ410504_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KJ173323_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ341654_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ341642_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ341639_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ341622_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JN604286_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
GQ924636_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
EF688062_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
DQ089784_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctactagatcccagagt
AF223960_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ281127_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ341618_PreS2_P-C      atgcaatggaactccagcacattccaccaagctctgctagatcccagagt
JN604144_PreS2_P-C      atgcagtggaactcaagcacattccaccaaamtctgctagatcccagagt
DQ141665_PreS2_P-C      atgcagtggaattccagcacattccaccaagctctgctagatcccagagt
MF674494_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
MF674486_PreS2_P-C      atgcagtggaactccagcacattccaccaaactctgctagatcccagagt
MF674467_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
MF674435_PreS2_P-C      atgcagtggaactccagcacattccaccaaactctgctagatcccagagt
MF674403_PreS2_P-C      atgcagtggaactcaagcacattccaccaagctctgctagatcccagagt
KX765845_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KM875428_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KM875406_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KJ173324_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ801490_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ341663_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ341659_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ341641_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ341617_PreS2_P-C      atgcartggaactccagcacattccaccaagctctgctagatcccagagt
JQ341616_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ281128_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctggatcccagagt
JQ281124_PreS2_P-C      atgcagtggaactccagcacattccaccaagccctgctagatcccagagt
JQ281121_PreS2_P-C      atgcagtggaattccagcacattccaccaagctctgctagatcccagagt
JQ281120_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ281118_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgttagatcccagagt
JQ040133_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
HM011497_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
FJ023650_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
DQ089789_PreS2_P-C      atgcaatggaactccagcacattccaccaagctctgctagatcccagagt
DQ089769_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
DQ089765_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
DQ089764_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
AF223958_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JX507214_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgttagatcccagagt
KJ410501_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KJ410513_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JN604118_PreS2_P-C      atgcaatggaactccagcacattccaccaagctctgctagatcccagagt
DQ089771_PreS2_P-C      atacagtggaactccagcacattccaccaagctctgctagatcccagagt
MF674484_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
MF674475_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
MF674474_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
MF674454_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KX765824_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KM875405_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KM875404_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KJ717803_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KJ803793_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ341644_PreS2_P-C      atgcagtggaactccagcacatttcaccaagctctgctagatcccagagt
JQ341615_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ281119_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
EU306685_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
DQ089779_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
AY862869_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
AF223957_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
AF223961_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
AP011097_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ341637_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
AF223955_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
AB105173_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
AF223956_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
AF223959_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
DQ089781_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
DQ089782_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
FJ023653_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ688403_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
MF674386_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
MF674388_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
MF674412_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
MF674418_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
MF674442_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
MF674468_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
MF674472_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
MF674501_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
AF223954_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgttagatcccagagt
MF674402_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgttagatcccagagt
JQ341660_PreS2_P-C      aygcagtggaactccagcamattccaccaagcactgctagatcccagagt
JQ341614_PreS2_P-C      atgcagtggaactccagcactttccaccaggctctgctagatcccagagt
HM011486_PreS2_P-C      gtgmagtggaactccagcacattccaccaagctctgctagatcccaragt
AB111946_PreS2_P-C      atgcagtggaactcaagcacattccaccaagctctgctagatcccaaagt
AB112063_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccaaagt
JQ341649_PreS2_P-C      rtgcagtggaacwccascacattccaccaagctctgctagatcycaaagt
KJ717844_PreS2_P-C      atgcagtggaattccagcacattccaccaagctctgctagatgcgagagt
KJ803826_PreS2_P-C      atgcagtggaattccagcacattccaccaagctctgctagatgcgagagt
DQ478901_PreS2_P-C      atgcagtggaactccagcactttccaccaggctctgctagatcccagagt
KF053177_PreS2_P-C      atgcagtggaactccagcacattccaccaggctctgctagatcccaaagt
KJ803770_PreS2_P-C      atgcagtggaactccagcacattccaccaggctctgctagatcccaaagt
DQ089758_PreS2_P-C      gtgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ341621_PreS2_P-C      atrcagtggaactccagcacattccaccaagctctgctagatcccaragt
KR014021_PreS2_P-C      atgcaatggaattccagcacattccaccaagctctgctagatcccagagt
KR013838_PreS2_P-C      atgcagtggaattccagcacattccaccaagctctgctagatcccagagt
KR013837_PreS2_P-C      atgcagtggaattccagcacattccaccaagctctgctagatcccagagt
KR013840_PreS2_P-C      atgcagtggaattccagcacattccaccaagctctgctagatcccagagt
KR013841_PreS2_P-C      atgcagtggaattccagcacattccaccaagctctgctagatcccagagt
KR013835_PreS2_P-C      atgcagtggaattccagcacattccaccaagctctgctagatcccagagt
KR013836_PreS2_P-C      atgcagtggaattccagcacattccaccaagctctgctagatcccagagt
KR013839_PreS2_P-C      atgcagtggaattccagcacattccaccaagctctgctagatcccagagt
JX504535_PreS2_P-C      atgcagtggaattccagcactttccaccaagctctgctagatcccagagt
JQ281470_PreS2_P-C      atgcartggaactccagcacattccaccaagctctgctagatcccagagt
AB246346_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ281126_PreS2_P-C      atgcagtggaactccagcacattccaccaagcactgctagatcccagagt
JQ027321_PreS2_P-C      atgcagtggaactccaacacattccaccaagcactgctagatcccagagt
DQ089757_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ341624_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KJ410514_PreS2_P-C      atacagtggaactccaatacattccaccaagctctgctagatcccagagt
JQ341630_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JX870000_PreS2_P-C      atgcagtggaactccagcactttccaccaggctctgctagatcccagagt
KX276853_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
AB112472_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
MF674514_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
MF674463_PreS2_P-C      atgcagtggaactccagcacattccaccaakctctgctagatcccagagt
KJ410519_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ281112_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
EU305541_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
DQ089772_PreS2_P-C      atgcagtggaactccagcacattccaccaaactctgctagatcccagagt
DQ089759_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgatagatcccagagt
KJ410489_PreS2_P-C      atgcagtggaattccagcactttccaccaagctctgctagatcccagagt
KJ410495_PreS2_P-C      atgcagtggaattccagcacattccaccaagctctgctagatcccagagt
JQ341651_PreS2_P-C      atacagtggaactccagcacattccaccaagctctgatagatcccagagt
KJ717790_PreS2_P-C      atgcagtggaactcccccacattccaccaagctctgctagatcccagagt
KJ803779_PreS2_P-C      atgcagtggaactcccccacattccaccaagctctgctagatcccagagt
KX276852_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KX276851_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KJ410498_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KJ410496_PreS2_P-C      atgcagtggaactccagcactttccaccaagctctgctagatcccagagt
EU305540_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
DQ089787_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
DQ089760_PreS2_P-C      atacagtggaactccagcacattccaccaagctctgctagatcccagagt
MF674428_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ281116_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ281114_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgttagatcccagagt
EU305542_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
MF674471_PreS2_P-C      acgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ341613_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JN604182_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JN604256_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
JQ281117_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
MF674398_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
MF674429_PreS2_P-C      atgcagtggaactccagcacattccaccaagttctgctagatcccagagt
AJ748098_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
MF674457_PreS2_P-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
                                                                          

KF873544_PreS2_P-C      raggggcctgtmttktcctgttggtggctccagttccggaacagtgaacc
KU679947_PreS2_P-C      aaagggtctgtattttcctgctggtggctccagttccgggacagtaagcc
KU679957_PreS2_P-C      aaggggtctgtattttcctgttggtggctccagttccgggacagtaagcc
KU679936_PreS2_P-C      aaggggtctgtattttcctgctggtggctccagtttcggggcagtaaacc
KF873520_PreS2_P-C      aaggggtctgtattttcctgctggtggctccagttccggggcagtaaacc
KF873514_PreS2_P-C      aaggggtctgtattttcctgctggtggctccagttccggggcagtaaacc
KF873516_PreS2_P-C      aaggggtc------ttcctgctggtggctccagttccggggcagtaaacc
KU679951_PreS2_P-C      aaggggtctgtattttcctgctggtggctccagttccggaacagtaagcc
KF873528_PreS2_P-C      aaggggtctgtattttcctgctggtggctccagttccggaacagtaagcc
KF873526_PreS2_P-C      aaggggtctgtattttcctgctggtggctccagttccggaacagtaagcc
KF873529_PreS2_P-C      aaggggtctgtattttcctgctggtggctccagttccggaacagtaagcc
KF873536_PreS2_P-C      aaggggcctgtattttcctgctggtggctccagttccggaacagtraacc
KU679960_PreS2_P-C      aaggggcctgtattttcctgctggtggctccagttccggaacagtaaccc
KU679937_PreS2_P-C      aaggggcctgtatcttcctgctggtggctccagttccggaacagtaaacc
KF873539_PreS2_P-C      aaggggcctgtattttcctgctggtggctccagttccggaacagtaaacc
KF873541_PreS2_P-C      aaggggcctgtattttcctgctggtggctccagttccggaacagtaaacc
JQ040167_PreS2_P-C      gagaggcctatactttcctgctggtggctccagttcmggaacagtaarcc
KX276846_PreS2_P-C      gaggggccwakactttcctgctggtggctccagttcmggaacagtaaacc
KX276855_PreS2_P-C      gaggggtctctattttcctgctggtggctccagttcaggaacagyaaacc
KX276982_PreS2_P-C      gaggggcctatgctttcctgctggtggctccagttccggaacagtaaacc
KX276992_PreS2_P-C      gaggggcctatgctttcctgctggtggctccagttccggaacagtaaacc
KX276988_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
KJ717799_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagcaaacc
KJ803790_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagcaaacc
GQ924620_PreS2_C-C      aaggggcctatacttccctgctggtggctccagttccggaacaacaaacc
KJ173335_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtgaacc
JN370955_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagcaaacc
JN827414_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagcaaacc
JN827415_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagcaaacc
AF241410_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagcaaacc
AF241411_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagcaaacc
GQ924622_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagcaaacc
AB241111_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagcaaacc
AP011101_PreS2_P-C      aaggggcctatattttcctgctggtggctccagttccggaacagcaaacc
AP011099_PreS2_P-C      aagaggcctatacttccctgctggtggctccagttccggaacagcaaacc
EU410079_PreS2_P-C      aaggggcctayactttcctgctggtggctccagttccggaacagcaaacc
AB241110_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagcaaacc
EU410081_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagcaaacc
JN604226_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagcaaacc
AP011100_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagcaaacc
EU410080_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagcaaacc
KR014082_PreS2_P-C      gaggggcctatacttccctgctggtggctccagttccggaacagcaaacc
KR013871_PreS2_P-C      gaggggcctatacttccctgctggtggctccagttccggaacagcaaacc
KR014083_PreS2_P-C      gaggggcctatacttccctgctggtggctccagttccggaacagcaaacc
KR014078_PreS2_P-C      gaggggcctatacttccctgctggtggctccagttccggaacagcaaacc
KR013870_PreS2_P-C      gaggggcctatacttccctgctggtggctccagttccggaacagcaaacc
KR014077_PreS2_P-C      gaggggcctatacttccctgctggtggctccagttccggaacagcaaacc
JQ341632_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagcaaacc
KJ717833_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagcaaacc
FJ562245_PreS2_P-C      gaggggcctatatcttcctgctggtggctccggttccggaacagtaaacc
DQ993690_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtatacc
JQ040132_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
FJ386626_PreS2_P-C      tgcgggtggatattttcctgctggaggatccagttctggaacagtaaacc
KC792868_PreS2_P-C      gaggg---------ttcctgctggtggctccagttccggaacagtaaacc
KY363258_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagcaaacc
KR014137_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
DQ141661_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY363260_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
AY220702_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB670259_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC792759_PreS2_P-C      gaggggcctatacyttcctgctggtggctccagttccggaacagtaaacc
JQ027322_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB670237_PreS2_P-C      gagaggcctatattttcctgctggtggctccagttccggaacagtaaacc
JX026877_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC792753_PreS2_P-C      gaggggcctatacttccctgctggtggctccagttccggaacagtaaacc
KC792710_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttcaggaacagtaaacc
EU939659_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
AB697502_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ899772_PreS2_P-C      gagaggcctatactttcctgctggtggctccagttccggaacagtaaacc
MG826122_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
EU939603_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ899773_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JQ040149_PreS2_P-C      gaggggcctatayyttcctgctggtggctccagttccggracagtaaacc
EU093902_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC792857_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU939646_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC793195_PreS2_P-C      gaggggcctatacttccctgctggtggctccagttcaggaacagtaaacc
FJ715360_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
KU964318_PreS2_P-C      gagaggcctatacaatcctgctggtggctccagttccggaacagtaaacc
KU964321_PreS2_P-C      gagaggcctatacagtcctgctggtggctccagttccggaacagtaaacc
KU964326_PreS2_P-C      gagaggcctatacagtcctgctggtggctccagttccggaacagtaaacc
KU964327_PreS2_P-C      gagaggcctatacagtcctgctggtggctccagttccggaacagtaaacc
KU964333_PreS2_P-C      gagaggcctatacagtcctgctggtggctccagttccggaacagtaaacc
KU964329_PreS2_P-C      gagaggcctatacagtcctgctggtggctccagttccggaacagtaaacc
KU964319_PreS2_P-C      gagaggcctatacagtcctgctggtggctccagttccggaacagtaaacc
KU964322_PreS2_P-C      gagaggcctatacagtcctgctggtggctccagttccggaacagtaaacc
KU964323_PreS2_P-C      gagaggcctatacagtcctgctggtggctccagttccggaacagtaaacc
KU964324_PreS2_P-C      gagaggcctatacagtcctgctggtggctccagttccggaacagtaaacc
KU964325_PreS2_P-C      gagaggcctatacagtcctgctggtggctccagttccggaacagtaaacc
KU964328_PreS2_P-C      gagaggcctatacagtcctgctggtggctccagttccggaacagtaaacc
KU964330_PreS2_P-C      gagaggcctatacagtcctgctggtggctccagttccggaacagtaaacc
KU964331_PreS2_P-C      gagaggcctatacagtcctgctggtggctccagttccggaacagtaaacc
KU964332_PreS2_P-C      gagaggcctatacagtcctgctggtggctccagttccggaacagtaaacc
KU964320_PreS2_P-C      gagaggcctatacagtcctgctggtggctccagttccggaacagtaaacc
FJ386592_PreS2_P-C      gaggggcctatacttacctgctggtggctccagttccggaacagtaaacc
AB670241_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
FJ715415_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
FJ715416_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
KJ173309_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ562228_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ562339_PreS2_P-C      gagggacctatacttccctgctggtggctccagttccggaacagtaaacc
AB014399_PreS2_P-C      aaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
FJ787455_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ787456_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ715418_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
FJ715391_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
FJ715351_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
FJ715390_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
D23681_PreS2_P-C        gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU939561_PreS2_P-C      gaggggcctatatcttcctgttggtggctccagttccggaacagtaaacc
FJ032336_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
FJ032338_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
FJ032339_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
FJ715359_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
AF533983_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AB670258_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC774290_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU939614_PreS2_P-C      gaggggcctttatcttcctgctggtggctccagttccggaacagtaaacc
AB367414_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ173334_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ715368_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
KY470977_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY470973_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaagcc
KY470971_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY470972_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY470966_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY470965_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY470969_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY470974_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY470976_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY470975_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY470968_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY470967_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY470970_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY470978_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY470979_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ386650_PreS2_P-C      gaggggtctataccttcctgctggtggctccagttccggaacagtaaacc
LC279274_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KM875423_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
GQ377631_PreS2_P-C      gaggggcctataytttcctgctggtggctccagttccggaacagtaaacc
FJ562279_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU939600_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
AY206384_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC774284_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
GQ377605_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY470894_PreS2_P-C      gaggggcctatactttccagctggtggctccagttccggaacagtaagcc
KY470901_PreS2_P-C      gaggggcctatactttccagctggtggctccagttccggaacagtaagcc
KY470902_PreS2_P-C      gaggggcctatactttccagctggtggctccagttccggaacagtaagcc
KJ173435_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ173436_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
GQ377530_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ715352_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
FJ715353_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
FJ562261_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ386591_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AB670307_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AB670269_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881736_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881737_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881738_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881739_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881742_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881743_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881744_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881748_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881749_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881750_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881751_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881754_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881755_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881758_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881762_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881763_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881764_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881765_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881766_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881767_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881768_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881769_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881770_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881771_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881772_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881773_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881774_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881775_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881776_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881777_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881972_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
GQ377524_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ562337_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AB300372_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU964185_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttcaggaacagtaaacc
KU964186_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttcaggaacagtaaacc
KU964187_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttcaggaacagtaaacc
KU964188_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttcaggaacagtaaacc
KU964191_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttcaggaacagtaaacc
KU964192_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttcaggaacagtaaacc
KU964194_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttcaggaacagtaaacc
KU964195_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttcaggaacagtaaacc
KU964196_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttcaggaacagtaaacc
KU964197_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttcaggaacagtaaacc
KU964198_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttcaggaacagtaaacc
KU964189_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttcaggaacagtaaacc
KU964190_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttcaggaacagtaaacc
KU964193_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttcaggaacagtaaacc
KU964199_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttcaggaacagtaaacc
JQ040162_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AF461357_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AF461363_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ173291_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ173292_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ173303_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
MG893560_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY470905_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY470895_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY470899_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY470903_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JX429904_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ899777_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
FJ715344_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ715343_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ562248_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccgaaacagtaaacc
FJ386609_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AY582136_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AB670282_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AB300359_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ173331_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ173332_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KT284759_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ377551_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KX276960_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ377584_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagaaaacc
JQ040172_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU963897_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ173301_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ173302_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ173289_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU963886_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU963887_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU963888_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU963889_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU963890_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU963891_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU963892_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU963893_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU963894_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU963895_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU963896_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU963898_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU963899_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ173337_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
GQ377583_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ173437_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ173438_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY470904_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY470900_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY470897_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY470896_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU963878_PreS2_P-C      gaggagcctatactttcctgctggtggctccagttccggaacagtaaacc
KU963880_PreS2_P-C      gaggagcctatactttcctgctggtggctccagttccggaacagtaaacc
KU963877_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU963876_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU963879_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU963881_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU963884_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU963872_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU963873_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU963871_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU963874_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU963875_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU963882_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU963885_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ173287_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC774357_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC774293_PreS2_P-C      gaggggtctatactttcctgctggtggctccagttccggaacagtaaacc
JX504546_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
GQ377578_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ715342_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC774361_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ562324_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ386619_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU939618_PreS2_P-C      gaagggcctatactttcctgctggtggctccagttccggaacagtaaacc
AB198077_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AB300365_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ562283_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC774248_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ173310_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU093900_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
FJ787470_PreS2_P-C      gaagggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ787471_PreS2_P-C      gaagggcctatattttcctgctggtggctccagttccggaacagtaaacc
KX276831_PreS2_P-C      gaggggcctatattgtcctgctggtggctccagttccgaaacagtacacc
AB367392_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
AB014372_PreS2_P-C      gaggggcctatatcttcctgctggtggctccaattccggaacagtaaacc
AB367434_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AB014380_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC792656_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC792700_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
D28880_PreS2_P-C        gaggggcctatacttccctgctggtggctccagttccggaacagtaaacc
S75184_PreS2_P-C        gaggggcctatacttccctgctggtggctccagttccggaacagtaaacc
KC774205_PreS2_P-C      gagaggcttgtatttccctgctggtggctccagttcaggaacagtaaacc
KC774217_PreS2_P-C      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FJ562241_PreS2_P-C      gagaggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
KC774219_PreS2_P-C      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC774352_PreS2_P-C      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB367416_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggtacagcaaacc
AB367803_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggtacagcaaacc
FJ386647_PreS2_P-C      gaggggcctatatsttcctgctggtggctccagttccggaacagcaaacc
AB697494_PreS2_P-C      aaagggcctatattttcctgctggtggctccagttccggaacagcaaacc
AB367395_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagcaaacc
AB367396_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagcaaacc
AB033553_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB033551_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB033552_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB033556_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB367424_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagcaaacc
KF485389_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagyaaacc
AB176642_PreS2_P-C      aaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB014378_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagaaaacc
JX125372_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
D23682_PreS2_P-C        gaggggcctatattttcctgctggtggctccagttcaggaacagtaaacc
D23683_PreS2_P-C        gaggggcctatattttcctgctggtggctccagttcaggaacagtaaacc
AB367402_PreS2_P-C      gaagggcctatacttccctgctggtggctccagttccggaacagtaaacc
JF828923_PreS2_P-C      gaggggtctatattttcctgctggtggctccagttccggaacagtaaacc
JF828931_PreS2_P-C      gaggggtctatattttcctgctggtggctccagttccggaacagtaaacc
JF828929_PreS2_P-C      gaggggtctatattttcctgctggtggctccagttccggaacagtaaacc
JF828924_PreS2_P-C      gaggggtctatattttcctgctggtggctccagttccggaacagtaaacc
JF828926_PreS2_P-C      gaggggtctatattttcctgctggtggctccagttccggaacagtaaacc
JF828930_PreS2_P-C      gaggggtctatattttcctgctggtggctccagttccggaacagtaaacc
JF828925_PreS2_P-C      gaggggtctatattttcctgctggtggctccagttccggaacagtaaacc
JF828921_PreS2_P-C      gaggggtctatattttcctgctggtggctccagttccggaacagtaaacc
JF828922_PreS2_P-C      gaggggtctatattttcctgctggtggctccagttccggaacagtaaacc
JF828928_PreS2_P-C      gaggggtctatattttcctgctggtggctccagttccggaacagtaaacc
AB670246_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
AB670248_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
GQ475355_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB367435_PreS2_P-C      gaggggccta------cctgctggtggctccagttccggaacagtaaacc
AB111114_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
JN604133_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB670238_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
JF828916_PreS2_P-C      aaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
JF828919_PreS2_P-C      aaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
KF214655_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AY641563_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AY641559_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB670260_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB367427_PreS2_P-C      gaggggcctgtattttcctgctggtggctccagttccggaacagtaaacc
JF828918_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
JF828920_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
JF828917_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
JF828913_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
JF828915_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
AB367411_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
JF828937_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB670275_PreS2_P-C      gagaggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB367432_PreS2_P-C      gaggggcctgtattttcctgctggtggctccagttccggaacagtaaacc
AB367804_PreS2_P-C      gaggggcctgtattttcctgctggtggctccagttccggaacagtaaacc
EF137802_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AY247031_PreS2_P-C      gaggggcctctattttcctgctggtggctccagttccggaacagtaaacc
AB697490_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB367403_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB195943_PreS2_P-C      gaggagcctatattttcctgctggtggctccagttcaggaacagtaaacc
AB195944_PreS2_P-C      gaggagcctatattttcctgctggtggctccagttcaggaacagtaaacc
KY363281_PreS2_P-C      gaggggcctatatttccctgctggtggctccagttccggaacagtaaacc
AB670242_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB367410_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
AB042285_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AY641562_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB195947_PreS2_P-C      gaggggcctatatttccctgctggtggctccagttcaggaacagtaaacc
AB195948_PreS2_P-C      gaggggcctatatttccctgctggtggctccagttcaggaacagtaaacc
AB670272_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB106895_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB111123_PreS2_P-C      gaagggcctatattttcctgctggtggctccagttccggaacaataaacc
AB111121_PreS2_P-C      gaagggcctatattttcctgctggtggctccagttccggaacaataaacc
AB111122_PreS2_P-C      gaagggcctatattttcctgctggtggctccagttccggaacaataaacc
KF779242_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
JN604254_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ562319_PreS2_P-C      gaggggcctatatttccctgctggtggctccagttccggaacagtgaacc
DQ536412_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB670291_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB367394_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KY363278_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtagacc
KY363279_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtagacc
AB367422_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
JX125374_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
JX125375_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KY363280_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ562230_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KY363264_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ475350_PreS2_P-C      gaggggcctctattttcctgctggtggctccagttccggaacagtaaacc
AB365451_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
GQ872211_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EF137803_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
D50520_PreS2_P-C        gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
D10055_PreS2_P-C        gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB900115_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttcaggaacagtaaacc
AB670301_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
AB670290_PreS2_P-C      gaggggcctatattatcctgctggtggctccagttccggaacagtaaacc
AB471851_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB471852_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB471853_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB367398_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB195945_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB042282_PreS2_P-C      gaaaggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB042283_PreS2_P-C      gaaaggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB014394_PreS2_P-C      gaagggcctatattttcctgctggtggctccagttccggaacagtaaacc
LC279253_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB182589_PreS2_P-C      gaggggcctgtattttcctgctggtggctccagttccggaacagtaaacc
DQ536410_PreS2_P-C      gaggggcctctattttcctgctggtggctccagttccggaacagtaaacc
KY363275_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KY363274_PreS2_P-C      gaggggcctatattttcctgctggtgactccagttccggaacagtaaacc
JN604215_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ475323_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttcaggaacagtaaacc
GQ377541_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
D50519_PreS2_P-C        gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
AY641560_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB670310_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB670278_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB670267_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB670266_PreS2_P-C      gaggggcctatatyttcctgctggtggctccagttccggaacagtaaacc
AB670262_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
AB195942_PreS2_P-C      gaggagcctatattttcctgctggtggctccagttccggaacagtaaacc
AB113879_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB014374_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttcaggaacagtaaacc
GQ475338_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB670263_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB642095_PreS2_P-C      gaggggcctatatttccctgctggtggctccagttccggaacagtaaacc
DQ683578_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB670306_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
JX125366_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
JN315779_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ475357_PreS2_P-C      gaggggcctatatttccctgctggtggctccagttccggaacagtaaacc
GQ475342_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ475317_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB670285_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB670305_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB670265_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB670300_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ475325_PreS2_P-C      gaggggccta------cctgctggtggctccagttccggaacagtaaacc
JX125370_PreS2_P-C      gaggggcctatattttcctgctggtggctccatttccggaacagtaaacc
GQ475354_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ475347_PreS2_P-C      gaggggcctatattttcctgctggtggctccacttccggaacagtaaacc
GQ475344_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ475332_PreS2_P-C      gaggggcctctattttcctgctggtggctccagttccggaacagtaaacc
GQ475322_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ475316_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
GQ475327_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
GQ475334_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
D50517_PreS2_P-C        gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
D50518_PreS2_P-C        gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB670292_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB670288_PreS2_P-C      gaggggcctatatttccctgctggtggctccagttccggaacagtaaacc
AB670252_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB222714_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB222715_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB026815_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttcaggaacagtaaacc
AB014376_PreS2_P-C      gaagggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB485808_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AF286594_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
JN604281_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ475313_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ475315_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
JQ341662_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ475312_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB697500_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB670256_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB640730_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttcaggaacagtaaacc
GQ475311_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ475320_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
JX125371_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
JX125373_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB670243_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
JN604246_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ475337_PreS2_P-C      gagaggcctatattttcctgctggtggctccagttccggaacagtaaacc
D12980_PreS2_P-C        gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB670247_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB670283_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
LC279251_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ475324_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ872210_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ475319_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB014377_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
JN604131_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ475339_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB300362_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ475305_PreS2_P-C      gaggggcctatatttccctgctggtggctccagttccggaacagtaaacc
GQ475329_PreS2_P-C      gaggggcctatatttccctgctggtggctccagttccggaacagtaaacc
GQ475346_PreS2_P-C      gaggggcctatatttccctgctggtggctccagttccggaacagtaaacc
AY206388_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KX276959_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JX661497_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
AB014369_PreS2_P-C      gcggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC792746_PreS2_P-C      gaggrgcctatactttcctgctggtggctccrgttccggaacagtaaacc
AY206386_PreS2_P-C      gaggggcctgtatcttcctgctggtggctccagttccggaacagtaaacc
KC792817_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881810_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881818_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881807_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881814_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881811_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881803_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881806_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ386673_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ173319_PreS2_P-C      gaggggcctatacttccctgctggtggctccagttccggaacagtaaacc
KJ173321_PreS2_P-C      gaggggcctatacttccctgctggtggctccagttccggaacagtaaacc
KR013975_PreS2_P-C      gaggggcctatactttcctgctggtgactccagttccggaacagtaaacc
KR013969_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KR013800_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KR013799_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KR013801_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccgggacagtaaacc
KR013974_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC792853_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaatagtaaacc
KR013827_PreS2_P-C      gaaaggcctatactttcctgctggtggctccagttccggaacagtaaacc
JF436920_PreS2_P-C      gaggggcctatacttccctgctggtggctccagttccggaacagtaaacc
KY881805_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU964341_PreS2_P-C      gaggggcctatacttccctgctggtggctccagttccggaacagtaaacc
AB014379_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AY220699_PreS2_P-C      gaggggcctatacattcctgctggtggctccagttccggaacagtaaacc
FJ562340_PreS2_P-C      gaggggcctatacttccctgctggtggctccagttccggaacagtaaacc
EU939545_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AY220700_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
FJ386653_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU919169_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AB014371_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagcaaacc
EU919168_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JX504534_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccgggacagtaaacc
FJ032345_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU554541_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU554542_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU963915_PreS2_P-C      gaggggcctatacttccctgctggtggctccaattccggaacagtaaacc
KU963916_PreS2_P-C      gaggggcctatacttccctgctggtggctccaattccggaacagtaaacc
KU963917_PreS2_P-C      gaggggcctatacttccctgctggtggctccaattccggaacagtaaacc
KU963918_PreS2_P-C      gaggggcctatacttccctgctggtggctccaattccggaacagtaaacc
KU963919_PreS2_P-C      gaggggcctatacttccctgctggtggctccaattccggaacagtaaacc
KU963921_PreS2_P-C      gaggggcctatacttccctgctggtggctccaattccggaacagtaaacc
KU963922_PreS2_P-C      gaggggcctatacttccctgctggtggctccaattccggaacagtaaacc
KU963923_PreS2_P-C      gaggggcctatacttccctgctggtggctccaattccggaacagtaaacc
KU963924_PreS2_P-C      gaggggcctatacttccctgctggtggctccaattccggaacagtaaacc
KU963925_PreS2_P-C      gaggggcctatacttccctgctggtggctccaattccggaacagtaaacc
KU963926_PreS2_P-C      gaggggcctatacttccctgctggtggctccaattccggaacagtaaacc
KU963927_PreS2_P-C      gaggggcctatacttccctgctggtggctccaattccggaacagtaaacc
KU963928_PreS2_P-C      gaggggcctatacttccctgctggtggctccaattccggaacagtaaacc
KU963929_PreS2_P-C      gaggggcctatacttccctgctggtggctccaattccggaacagtaaacc
KU963920_PreS2_P-C      gaggggcctatacttccctgctggtggctccaattccggaacagtaaacc
EU522068_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AF411412_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
AY167090_PreS2_P-C      gagggggctatacttccctgctggtggctccagctccggaacagtaaacc
KR013809_PreS2_P-C      gaggggcctttattttcctgctagtggctccagttccggaacagtaaacc
KR013810_PreS2_P-C      gaggggcctttatttccctgccggtggctccagttccggaacagtaaacc
KR013815_PreS2_P-C      gaggggcctttattttcctgctggtggctccagttccggaacagtaaacc
KR013811_PreS2_P-C      gaggggcctttattttcctgctggtggctccagttccggaacagtaaacc
KR013812_PreS2_P-C      gaggggcctttattttcctgctggtggctccagttccggaacagtaaacc
KR013814_PreS2_P-C      gaggggcctttattttcctgctggtggctccagttccggaacagtaaacc
KR013813_PreS2_P-C      gaggggcctttattttcctgctggtggctccagttccggaacagtaaacc
KC774301_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagcaaacc
JX429903_PreS2_P-C      gaggggactatactttcctgctggtggctccagttccggaacagtaaacc
EU439016_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU939655_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU939656_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AB205123_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KR013859_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
KR013862_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KR013860_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
KR013861_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
KR014048_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
GQ377636_PreS2_P-C      gaggggcctatacyttcctgctggtggctccagttccggaacagtaaacc
JQ040154_PreS2_P-C      gaggggcctatactttcctgctggtggctccrgttccggaacagtaaacc
KY881815_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ562335_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ562251_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ562235_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AY206392_PreS2_P-C      gagaggcctatactttcctgctggtggctccagttccggaacagtaaacc
AB670249_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KR014092_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacaataaacc
FJ562266_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AB198083_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccgggacagtaagcc
KU964355_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU964353_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU964350_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU964354_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU964359_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU964365_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU964352_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU964357_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU964360_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU964361_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU964356_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU964362_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU939556_PreS2_P-C      gagggg---------tcctgctggtggctccagttccggaacagtaaacc
EU872002_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU872000_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU872001_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU872003_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU872004_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ562272_PreS2_P-C      gaggggcctttattttcctgctggtggctccagttccggaacagtaaacc
JQ040131_PreS2_P-C      gaggggcctttattttcctgctggtggctccagttccggaacagtaaacc
KJ173281_PreS2_P-C      gaggggcctatacttccctgctggtggctccagttccggaacagtaaacc
KJ173282_PreS2_P-C      gaggggcctatacttccctgctggtggctccagttccggaacagtaaacc
KY881816_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881809_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
KU964364_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC774224_PreS2_P-C      gaggggcctatacttccctgctggtggctccagttccggaacagtaaacc
GQ377642_PreS2_P-C      gaggggcctatacttycctgctggtggctccagttcmggaacagtaaacc
FJ386651_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ386632_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ386595_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU554536_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AB299858_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AB426467_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AB288026_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccgaaacagtaaacc
KY881817_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881804_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598703_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
D23680_PreS2_P-C        gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC792706_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JX504539_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
GQ377552_PreS2_P-C      gaggggcctataytttcctgctggtggctccagttccggaacagtaaacc
EU939605_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
EU939613_PreS2_P-C      gaggggcctttattttcctgctggtggctccagttcaggaacagtaaacc
FJ787462_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881813_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881812_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881802_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ173305_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC793026_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC774218_PreS2_P-C      gaggggcctgtatttccctgctggtggctccagttccgggacagtaaacc
KC774210_PreS2_P-C      gaggggcctatacttccctgctggtggctccagttccggaacagtaaacc
JX429915_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JQ341648_PreS2_P-C      gaggggcctctactttcctgctggtggctccagttccggaacagtaaacc
FJ715389_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ562313_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ562308_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttcaggaacagtaaacc
FJ032361_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU939570_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU939555_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU439015_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
AF363961_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AB198080_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU939642_PreS2_P-C      gaggggcctatacactcttgctggtggctccagttccggaacagtaaacc
KC774231_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC774199_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ562281_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JX504536_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
FJ386659_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
LC279275_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacaataaacc
LC318702_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU939595_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ173295_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ173311_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ173312_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
LC318703_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KT284755_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598693_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ173396_PreS2_P-C      gaagggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ173318_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ173288_PreS2_P-C      gaggggcctatacttccctgctggtggctccagttccggaacagtaaacc
JX661493_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JX429918_PreS2_P-C      gaggggcctatactttcctgctggtggctccagtttcggaacagtaaacc
JX026884_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
GQ377597_PreS2_P-C      gagggggctatactttcctgctggtggctccagttccggaacagtaaacc
FJ715355_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ562327_PreS2_P-C      gaggggcctatacttccctgctggtggctccagttccggaacagtaaacc
FJ562242_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ386618_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ032360_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU554535_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AB050018_PreS2_P-C      gcggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ715357_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU939562_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC774320_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC774318_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaagcc
KC774226_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JX504545_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
HM750140_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ386574_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ032359_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AY596108_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC774315_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ386644_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JQ040163_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC774237_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC792803_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC792941_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ173391_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ173392_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ173395_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC774310_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
GQ377580_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ715376_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ715375_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ715374_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC774295_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC774326_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598690_PreS2_P-C      gaggggcctatactatcctgctggtggctccagttccggaacagtaaacc
KJ598688_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598691_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598695_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598696_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598697_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598701_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598694_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ173317_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ173306_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598689_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598698_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598699_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598702_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
LC373511_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
LC373512_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU939542_PreS2_P-C      cagaggcctatatcttcctgctggtggctccagttccggaacagtaaacc
FJ899767_PreS2_P-C      cagaggcctatatcttcctgctggtggctccagttccggaacagtaaacc
FJ562299_PreS2_P-C      gaggggtctatattttcctgctggtggctccacttccggaacagcaaaac
FJ386617_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
EU939657_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
X52939_PreS2_P-C        gaggggcctctatttccctgctggtggctccagttccggaacagtaaacc
FJ386589_PreS2_P-C      gaggggcctatatttccctgctggtggctccagttccggaacagtaaacc
AB670298_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB113878_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagcaaacc
AB195930_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagcaaacc
AB195931_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagcaaacc
AB195932_PreS2_P-C      aaggggcctatatcttcctgctggtggctccagttccggaacagcaaacc
AB670264_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB670274_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KR013868_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ386620_PreS2_P-C      gaggggcctctattttcctgctggtggctccagttccggaacagtaaacc
FJ386625_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ562307_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ386689_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU939552_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KU964219_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KU964214_PreS2_P-C      gaagggcctatattttcctgctggtggctccagttccggaacagtaaacc
HM750139_PreS2_P-C      gaggggcctatatttccctgctggtggctccagttccggaacagtaaacc
KU964227_PreS2_P-C      gaggggcctatatttccctgctggtggctccagttccggaacagtaaacc
KU964220_PreS2_P-C      gaggggcctatatttccctgctggtggctccagttccggaacagtaaacc
KU964215_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KU964223_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KU964226_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KU964217_PreS2_P-C      gaggggcctatatttccctgctggtggctccagttccggaacagtaaacc
KU964218_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KU964224_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KU964225_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KU964228_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KU964216_PreS2_P-C      gaggggcctatatttccctgctggtggctccagttccggaacagtaaacc
KU964222_PreS2_P-C      gaggggcctatatttccctgctggtggctccagttccggaacagtaaacc
KC774260_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774267_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
MH818373_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
JQ040161_PreS2_P-C      gaggggcctataytttcctgctggtggctccagttccggaacagtaaacc
FJ562301_PreS2_P-C      gaggggcctatatttccctgctggtggctccagttccggaacagtaaacc
FJ386613_PreS2_P-C      gaggggcctctattttcctgctggtggctccagttccggaacagtaaacc
KT284758_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
KT284757_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtgaacc
EU939612_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ386672_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ377554_PreS2_P-C      gaggggtctatattttcctgctggtggctccagttccggaacagtaaacc
GQ377570_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ377618_PreS2_P-C      gaggggcctctattttcctgctggtggctccagttccggaacagtaaacc
GQ377562_PreS2_P-C      gaggggtctatattttcctgctggtggctccagttccggaacagtaaacc
FJ715422_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU562218_PreS2_P-C      gaggggtctatatttccctgctggtggctccagttccggaacagtaaacc
FJ715395_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ715397_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ715392_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ715424_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ562225_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ032331_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ377545_PreS2_P-C      gaggggcctatatttccctgctggtggctccagttccggaacagtaaacc
EU939593_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB198076_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ377585_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774329_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ899783_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU939651_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU939539_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
FJ787466_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ787464_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ787465_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ787467_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
JX036326_PreS2_P-C      aaggggcctatattttcctgctggtggctccagctccggaacagtaaacc
JX036327_PreS2_P-C      aaggggcctatattttcctgctggtggctccagctccggaacagtaaacc
KC774191_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774213_PreS2_P-C      aaggggcctatattttcctgctggtggctccagttccgaaacagtaaacc
KC774214_PreS2_P-C      aaggggcctatattttcctgctggtggctccagttccgaaacagtaaacc
KC774335_PreS2_P-C      gaggggtctatattttcctgctggtggctccagttccggaacagtaaacc
KC774254_PreS2_P-C      aaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774189_PreS2_P-C      aaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774277_PreS2_P-C      aaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774211_PreS2_P-C      aaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
HM750136_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774256_PreS2_P-C      aaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EF536066_PreS2_P-C      gaggggcctgtactttcctgctggtggctccggttccggaacagtaaacc
EU547562_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
DQ089797_PreS2_P-C      gaggagcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ377620_PreS2_P-C      gaggggtctatatttccctgctggtggctccagttccggaacagtaaacc
AB697510_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaatagtaaacc
EU306724_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
DQ377165_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU439005_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU306729_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
DQ377164_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
DQ377160_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU306726_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU306728_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU306722_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU306721_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
DQ377161_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
DQ377162_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU306713_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU306725_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU306720_PreS2_P-C      gaggggcctatattttcctgctggtggctcccgttccggaacagtaaacc
EU306719_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU306714_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
DQ377163_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU306727_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU939607_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC792716_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU939594_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttcaggaacagtaaacc
KC774269_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KY470880_PreS2_P-C      gaggggcctgtattttcctgctggtggctccagttccggaacagtaaacc
KY470879_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KY470875_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KY470892_PreS2_P-C      gaggggcctatattttcctgctgggggctccagttccggaacagtaaacc
KY470885_PreS2_P-C      gaggggcctatattttcctgctggtggccccagttccggaacagtaaacc
KY470873_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KY470886_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KY470888_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KY470891_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KY470882_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KY470890_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KY470887_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KY470874_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KY470877_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KY470889_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KY470876_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KY470878_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KY470881_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KY470884_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KY470883_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ787468_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
FJ787469_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
KJ173313_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttcaggaacagtaaacc
KJ173314_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttcaggaacagtaaacc
KC774278_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774345_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774200_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
HM750141_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774196_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774336_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774187_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774348_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774342_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774337_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ377533_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774261_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774262_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774287_PreS2_P-C      gaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
GQ227692_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ227697_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ715372_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ715371_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ715398_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ715400_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774355_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ259588_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ227693_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ227694_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ227695_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ227696_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU916223_PreS2_P-C      gaggggcctatattttcctgctggtggatccagttcaggaacagtaagcc
EU916224_PreS2_P-C      gaggggcctatattttcctgctggtggatccagttcaggaacagtaagcc
JX560520_PreS2_P-C      gaggggcctatattttcctgctggtggatccagttcaggaacagtaagcc
FJ562306_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU916219_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaagcc
AB367423_PreS2_P-C      gaggggtctatattttcctgctggtggctccagttccggaacagtaaacc
KC774319_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC774242_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaagcc
FJ386602_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttcaggaacagtaaacc
JX504542_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EF536065_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU939550_PreS2_P-C      gaggggcctatatttycctgctggtggctccagttccggaacagtaaacc
FJ899765_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ899761_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ899764_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ899789_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaagcc
EU939647_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU939536_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
JQ040144_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaagcc
EU939597_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ562221_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ377518_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
JQ040155_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KU964043_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU964042_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU964034_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU964035_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU964036_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU964037_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU964038_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU964040_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU964041_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU964044_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU964045_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU964046_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU964047_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU964048_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU964039_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ562264_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ562243_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ715366_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ715365_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ715364_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ715367_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774354_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagcaaacc
EU916222_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaagcc
KC774209_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ899788_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaagcc
EU939615_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaagcc
FJ386678_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaagcc
KC792771_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC792658_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774206_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB195949_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttcaggaacagtaaacc
JX125365_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774190_PreS2_P-C      gagaggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ899763_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ899775_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU939540_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttcaggaacagtaaacc
KP027477_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttcaggaacagtaaacc
KT284756_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttcaggaacagtaaacc
JQ040165_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
GQ377517_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ386576_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU939538_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU939616_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ562318_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
HM011481_PreS2_P-C      gaggrgcctatatcttcctgctggtggctccagttccggaacagtaaacc
KX276839_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ032355_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ032356_PreS2_P-C      gaggggcctacactttcctgctggtggctccggttccggaacagtaaacc
KU964358_PreS2_P-C      nnnnnnnnnnnnnnnncctgctggtggctccagttccggaacagtaaacc
KU964349_PreS2_P-C      nnnnnnnnnnnnnnnncctgctggtggctccagttccggaacagtaaacc
KU964363_PreS2_P-C      nnnnnnnnnnnnnnnncctgctggtggctccagttccggaacagtaaacc
KU964184_PreS2_P-C      nnnnnnnnnnnnnnntcctgctggtggctccagttcaggaacagtaaacc
KU964182_PreS2_P-C      nnnnnnnnnnnnnnntcctgctggtggctccagttccggaacagtaaacc
KU964174_PreS2_P-C      nnnnnnnnnnnnnnntcctgctggtggctccagttccggaacagtaaacc
KU964176_PreS2_P-C      nnnnnnnnnnnnnnntcctgctggtggctccagttccggaacagtaaacc
KU964178_PreS2_P-C      nnnnnnnnnnnnnnntcctgctggtggctccagttccggaacagtaaacc
KU964181_PreS2_P-C      nnnnnnnnnnnnnnntcctgctggtggctccagttccggaacagtaaacc
KU964183_PreS2_P-C      nnnnnnnnnnnnnnntcctgctggtggctccagttccggaacagtaaacc
KU964179_PreS2_P-C      nnnnnnnnnnnnnnntcctgctggtggctccagttccggaacagtaaacc
HQ700517_PreS2_P-C      gaggggcctgtactttcctgctggtggctccagttccggaacagtaaacc
KC793107_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC793103_PreS2_P-C      gaggggcctatatttycctgctggtggctccagttccggaacagtaaacc
EU939644_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC774353_PreS2_P-C      gaggggcctgtatcttcctgctggtggctccagttccggaacagtaaacc
AF182802_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC793074_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
JQ341634_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ377608_PreS2_P-C      gagaggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU939596_PreS2_P-C      gagaggtctatactttcctgctggtggctccagttccggaacagcaaacc
KC793040_PreS2_P-C      gaagggcctatactttcctgctggtggctccagttccggaacagtaaacc
AB014367_PreS2_P-C      aaggggcctatatttccctgctggtggctccagttccggaacagtaaacc
KY363252_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttcaggaacagtaaacc
KY363253_PreS2_P-C      gaggggcctatattctcctgctggtggctccagttcaggaacagtaaacc
KR014008_PreS2_P-C      gaggggcctatagttccctgctggtggctccagttccggaacagtaaacc
EU939571_PreS2_P-C      gagaggcctatattttcctgctggtggctccagttccggaacagtaaacc
KR014016_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KR014017_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttcctgaacagtaaacc
KR014010_PreS2_P-C      gaggggcctatattttcatgctggtggctccagttccggaacagtaaacc
KR014011_PreS2_P-C      gaggggcctatattttcttgctggtggctccagttccggaacagtaaacc
KR014018_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KR014012_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KR014015_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ475351_PreS2_P-C      gaaaggcctatattttcctgctggtggctccagttccggaacagtacacc
AB670279_PreS2_P-C      gagaggcctatattttcctgctggtggctccagttccggaacagtaaacc
KY363284_PreS2_P-C      gagaggcctatatcttcctgctggtggctccagttccggaacagtaaacc
JN604258_PreS2_P-C      gaaaggcctatattttcctgctggtggctccagttcaggaacagtaaacc
AB300361_PreS2_P-C      gagaggcctatattttcctgctggtggctccagttccggaacagtacacc
GQ475328_PreS2_P-C      gagaggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB298720_PreS2_P-C      gaaaggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB298721_PreS2_P-C      gaaaggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ032351_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttcaggaacagtaaacc
FJ386605_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacartaaacc
KY881973_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtgaacc
KY882003_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacaggaaacc
KY881979_PreS2_P-C      gaggggcctatactttcctgctggtggctccagctccggaacaggaaacc
KY881884_PreS2_P-C      gaggggcctatactttcctgctggtggctccagctccggaacaggaaacc
KY881960_PreS2_P-C      gaggggcctatactttcctgctggtggctccagctccggaacaggaaacc
KY881883_PreS2_P-C      gaggggcctatacttccctgctggtggctccagttccggaacaggaaacc
KR013874_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KR013872_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KR013876_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KR013877_PreS2_P-C      gaggggcctgtactttcctgctggtggctccagttccggaacagtaaacc
KY881978_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacaggaaacc
KY881892_PreS2_P-C      gaggggcctatactttcctgctggtggctccagctccggaacaggaaacc
KY881885_PreS2_P-C      gaggggcctatactttcctgctggtggctccagctccggaacaggaaacc
KY882002_PreS2_P-C      gaggagcctatactttcctgctggtggctccagctccggaacaggaaacc
KY881876_PreS2_P-C      gaggagcctatactttcctgctggtggctccagttccggaacaggaaacc
KY881872_PreS2_P-C      gaggagcctatactttcctgctggtggctccagttccggaacaggaaacc
KY881888_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacaggaaacc
KY881874_PreS2_P-C      gaggggcctatacttccctgctggtggctccagttccgggacaggaaacc
KY881886_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacaggaaacc
KY881878_PreS2_P-C      gaggagcctatactttcctgctggtggctccagttccggaacaggaaacc
KY881997_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacaggaaacc
KY881882_PreS2_P-C      gaggggcctatacttccctgctggtggctccagttccggaacaggaaacc
KY881889_PreS2_P-C      gaggggcctatacttccctgctggtggctccagttccggaacaggaaacc
KY881991_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacaggaaacc
KY881890_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacaggaaacc
KY881887_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacaggaaacc
KY881881_PreS2_P-C      gaggagcctatactttcctgctggtggctccagttccggaacaggaaacc
KY881974_PreS2_P-C      gaggagcctatactttcctgctggtggctccagttccggaacaggaaacc
KY881875_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacaggaaacc
KY881989_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacaggaaacc
KY881873_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacaggaaacc
KY881871_PreS2_P-C      gaggggcctatactttcctgctggtggctccagctccggaacaggaaacc
KY881870_PreS2_P-C      gaggagcctatactttcctgctggtggctccagttccggaacaggaaacc
KY881987_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacaggaaacc
KY881891_PreS2_P-C      gaggagcctatactttcctgctggtggccccagttccggaacaggaaacc
KY881877_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacaggaaacc
KY881962_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacaggaaacc
KY881990_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacaggaaacc
KY881879_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacaggaaacc
KY881966_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacaggaaacc
KY881971_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacaggaaacc
KY881994_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacaggaaacc
KY881981_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacaggaaacc
KY881880_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacaggaaacc
KY881993_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacaggaaacc
KY882001_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacaggaaacc
KY881961_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacaggaaacc
KY881988_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacaggaaacc
KY881980_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacaggaaacc
EU570072_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
KR013769_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttcaggaacagtaaacc
KR013767_PreS2_P-C      gaggggcctatattttcctgctgatggctccagttcaggaacagtaaacc
KR013765_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttcaggaacagtaaacc
KR013764_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttcaggaacagtaaacc
KR013766_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttcaggaacagtaaacc
KR013761_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttcaggaacagtaaacc
KR013762_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttcaggaacagtaaacc
KR013768_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttcaggaacagtaaacc
KR013763_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttcaggaacagtaaacc
KC774340_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
JX429913_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU560438_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU560439_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
DQ478899_PreS2_P-C      gaggggcctgtattttcctgctggtggctccagttccggaacagtacacc
KR013796_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KR013795_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KR013794_PreS2_P-C      gaggggcctatattctcctgctggtggctccagttccggaacagtaaacc
KR013792_PreS2_P-C      gaggggcctatattttcctgctggtagctccagttccggaacagtaaacc
KR013793_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU093906_PreS2_P-C      gaggggccta------attgctggtggctccagttcaggaacagtaaacc
AY057947_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttcaggaacagtaaacc
GQ475356_PreS2_P-C      gaggggcctatatyttcctgctggtggctccagttccggaacagtaaacc
FJ562255_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU939592_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774356_PreS2_P-C      gaggggcctatattttcctgctggtggctccggttccggaacagtaaacc
GU357845_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC793187_PreS2_P-C      gaggggtctatattttcctgctggtggctccagttccggaacagtaaacc
GQ377593_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttcaggaacagtaaacc
EU093903_PreS2_P-C      gaagggcctatattttcctgctggtggctccagttcaggaacagtaaacc
JX026888_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ386603_PreS2_P-C      gaggggcctatattttgctgctggtggctccagttccggaacagtaaacc
GQ377538_PreS2_P-C      gaggggcctatattttcctgctggtggctccagtttcggaacagtacacc
EU717212_PreS2_P-C      gaggggcctatatttccctgctggtggctccagttccggaacagtgaacc
EU306673_PreS2_P-C      gcggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU306674_PreS2_P-C      gcagggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU306675_PreS2_P-C      gcagggcctatattttcctgctggtggctccagttccggaacagtaaacc
JQ040166_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
HM011465_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ377623_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774279_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ562280_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774232_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
MG893557_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KR013781_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttctggaacagtaaacc
KC774274_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC774252_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
JX661491_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
JX026880_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU916237_PreS2_P-C      gaggggcctatattttcctgctggtggctcctgttccggaacagtaaacc
EU570067_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KR013780_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
JX429905_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU939578_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KR013961_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KR013797_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KR013798_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KR013786_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KR013785_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774223_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774182_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774180_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
JX026878_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ377531_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU554537_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU916238_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KT284753_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KR013783_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KR013782_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KR013779_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KR013784_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KM213037_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC793039_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774313_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU570068_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
MH094411_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagcaaacc
KY022423_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774334_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774275_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
HM011489_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ377603_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU554538_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU554539_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU939541_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774257_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774259_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ377523_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ787452_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
EU717215_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KR013869_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KR013865_PreS2_P-C      gaggggcctattccttcctgctggtggctccagttccggaacagtaaacc
FJ386661_PreS2_P-C      caggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KR013863_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ562292_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KR013866_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
KX276981_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
KR013867_PreS2_P-C      gaggggcctatactttcctgctggtggctctagttccggaacagtaaacc
EU939584_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KX276986_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
KX276994_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
KR013864_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
GQ377571_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU086839_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacaataaacc
EU086837_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccgaaacagtaaacc
EU086838_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC793019_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
GQ377615_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JX661496_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ173432_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ173431_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
GQ377599_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AF384371_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU560441_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ787486_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ899776_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AF384372_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU871971_PreS2_P-C      gaggggcctatgctttcctgctggtggctccagttccggaacagtaaacc
AF182803_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AF182804_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU871974_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttcaggaacagtaaacc
EU871973_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU871970_PreS2_P-C      gaggggtctatactttcctgctggtggctccagttccggaacagtaaacc
EU871969_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU871972_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KF053170_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KJ803762_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
HM011479_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KX276837_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU939564_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
AY596107_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KJ598679_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KJ598686_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ787439_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
FJ787479_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
FJ787441_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
FJ899770_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
EU939563_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
FJ899771_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
FJ899769_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
KX276968_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU916233_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU916234_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KR013772_PreS2_P-C      gaggggcctatactttcctgctggtggctccagtaccggaacagtaaacc
KR013909_PreS2_P-C      gaggggcctatactttcctgctggtggctccagtaccggaacagtaaacc
KR013908_PreS2_P-C      gaggggcctatactttcctgctggtggctccagtaccggaacagtaaacc
KR013776_PreS2_P-C      gaggggcctatactttcctgctggtggctccagtaccggaacagtaaacc
KR013773_PreS2_P-C      gaggggcctatactttcctgctggtggctccagtaccggaacagtaaacc
KR013771_PreS2_P-C      gaggggcctatactttcctgctggtggctccagtaccggaacagtaaacc
KR013774_PreS2_P-C      gaggggcctatactttcctgctggtggctccagtaccggaacagtaaacc
GQ377526_PreS2_P-C      gaagggcctatactttcctgctggtggctccagttcaggaacagtaaacc
FJ386597_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacaataaacc
FJ562273_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ562265_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
KJ598687_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598715_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccgtaacagtaaacc
KJ598714_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598719_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598710_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598718_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598707_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598717_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598712_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598705_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598706_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598708_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598711_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598713_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598709_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccgaaacagtaaacc
KY881819_PreS2_P-C      gaggggcctatactttcctactggtggctccagttccggaacagtaaacc
KJ598716_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU093915_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598681_PreS2_P-C      gaagggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU939604_PreS2_P-C      gaggggcctatactttcctgatggtggctccagttccggaacagtaaacc
EU093881_PreS2_P-C      gaggggcctatactttcctgctggtggctccagctccggaacagtaaacc
EU093882_PreS2_P-C      gaggggcctatactttcctgctggtggctccagctccggaacagtaaacc
EU093908_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598680_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU093917_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU093911_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU093910_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU093883_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU075340_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU075339_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU075338_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU075337_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU093907_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU093909_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU093916_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU093914_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU093913_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU093912_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU075336_PreS2_P-C      gaagggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU075335_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU075334_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU075342_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU093918_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC774327_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC792740_PreS2_P-C      ggggcacccgtactttcctgctggtggctccagttccggaacagtaaacc
KY881976_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttcaggaacagtaaacc
KY881968_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881915_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881998_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881964_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881999_PreS2_P-C      aaggggcctatactttcctgctgatggctccagttccggaacagtaaacc
KY881970_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881965_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881996_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881995_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881992_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881983_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881925_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881916_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881917_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881919_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881921_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881923_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881924_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881926_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881927_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881928_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881929_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881930_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881931_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881932_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881933_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881934_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881935_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881936_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881938_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881963_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881969_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881977_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881982_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881986_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY882000_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881975_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881959_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881918_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881920_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881922_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881937_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881939_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881941_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881942_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881943_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881967_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881985_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881940_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC774358_PreS2_P-C      gaggggcctataccttcctgctggtggctccggttcaggaacagtaaacc
AB014391_PreS2_P-C      aaggggcctatacttccctgctggtggctccagttccggaacagtaaacc
AB014385_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC792680_PreS2_P-C      gagggggctatacttccctgctggtggctccagttccggaacagtaaacc
KU964014_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtcaacc
KU964012_PreS2_P-C      gaggggcctatacttccctgctggtggctccagttccggaacagtcaacc
KU964011_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtcaacc
KU964017_PreS2_P-C      gaggggcctatacttccctgctggtggctccagttccggaacagtcaacc
KU964018_PreS2_P-C      gaggggcctatacttccctgctggtggctccagttccggaacagtcaacc
KU964016_PreS2_P-C      gaggggcctatacttccctgctggtggctccagttccgaaacagtcaacc
KU964013_PreS2_P-C      gaggggcctatacttccctgctggtggctccagttccggaacagtcaacc
KU964019_PreS2_P-C      gaggggcctatacttccctgctggtggctccagttccggaacagtcaacc
KU964015_PreS2_P-C      gaggggcccatacttccctgctggtggctccagttccggaacagtcaacc
KC875261_PreS2_P-C      gaggggcctatactttcctgctggtggctcaacttccggaacagtaaacc
FJ386612_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
KC793024_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC792902_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
JQ040145_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttcaggaacagtaaacc
GQ377628_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ032334_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
DQ089796_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB014389_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KR013844_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
KR013842_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
KR013845_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
KR013848_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
KR013847_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
KR013849_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
FJ562276_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AB014384_PreS2_P-C      aaggggcctatacttccctgctggtggctccagttccggaacagtaaacc
FJ032340_PreS2_P-C      gaagggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ032341_PreS2_P-C      gaagggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ787453_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ787454_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
MG826143_PreS2_P-C      gaggggcctagaccttcctgctggtggctccagttccggaacagtaaacc
AY206389_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB367417_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
DQ975274_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AB014393_PreS2_P-C      aaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
AB014382_PreS2_P-C      aaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
DQ089795_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ787448_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ032350_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AB111120_PreS2_P-C      aaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
AB014392_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AB014364_PreS2_P-C      aaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
KC875263_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggcacagtaaacc
KC793202_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JQ341643_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU939568_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU570073_PreS2_P-C      gaggggcctatactttcctgttggtggctccagttccggaacagtaaacc
EU570074_PreS2_P-C      gaggggcctatactttcctgttggtggctccagttccggaacagtaaacc
KR013791_PreS2_P-C      gaagggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC793097_PreS2_P-C      gaggggcctatattttcctgctggtggctcmagttccggaacagtaaacc
EU579443_PreS2_P-C      gagaggcctatactttcctgctggtggctccagttccggaacagtaaacc
AF458665_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU560440_PreS2_P-C      aaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
EU579442_PreS2_P-C      aaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
AB670302_PreS2_P-C      aaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
KU964169_PreS2_P-C      aaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KU964177_PreS2_P-C      aaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KU964170_PreS2_P-C      aaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KU964173_PreS2_P-C      aaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
KU964175_PreS2_P-C      aaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
KU964171_PreS2_P-C      aaggagcctatatcgtcctgctggtggctccagttccggaacagtaaacc
KU964172_PreS2_P-C      aaggagcctatatcttcctgctggtggctccagttccggaacagtaaacc
DQ141658_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
DQ141659_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC793142_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
FJ787447_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU881996_PreS2_P-C      gaggggcctatatttccctgctggtggctccagttccggaacagtaaacc
AB900099_PreS2_P-C      gaagggcctatactttcctgctggtggctccagttccggaacagtaaacc
AB014383_PreS2_P-C      aaggggcctctaccttcctgctggtggctccagttccggaacagtaaacc
KR014049_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KF053175_PreS2_P-C      gaggggcctatattatcctgctggtggctccagttccggaacagtaaacc
KJ803769_PreS2_P-C      gaggggcctatattatcctgctggtggctccagttccggaacagtaaacc
KC875262_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KC774281_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JQ040152_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ715404_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagcaaacc
EU939567_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
EU919164_PreS2_P-C      gaggggcccatattttcctgctggtggctccagttccggaacagtaaacc
EU589336_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AB367397_PreS2_P-C      gcggggcctataccttcctgctggtggctccagttccggaacagtaaacc
AB111118_PreS2_P-C      aaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
KX276838_PreS2_P-C      gaggggcctatatttccctgctggtggctccagttccggaacagtaaacc
KR013846_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaagcc
KJ410521_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU916204_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JQ040139_PreS2_P-C      gaggggcc------ttcctgctggtggctccagttccggaacagtaaacc
KU964004_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtcaacc
KC793093_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
JQ341610_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AY066028_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AF411408_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AF411411_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU796070_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU796072_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KR013943_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
KC792862_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB300360_PreS2_P-C      gaggggtctatattttcctgctggtggctccagttccggaacagtaaacc
AB014381_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ410510_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC792834_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ386630_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
EU939582_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
KC793119_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagcaaacc
KC793108_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
KC792691_PreS2_P-C      aaggggcctatacyttcctgctggtggctccagttccggaacagtaaacc
KC774197_PreS2_P-C      gaggggcctttattttcctgctggtggctccagttccggaacagtaaacc
GQ377609_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU939546_PreS2_P-C      gagaggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU939543_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU796069_PreS2_P-C      gaggggcccatactttcctgctggtggctccagttccggaacagtaaacc
DQ478900_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacaataaacc
D00630_PreS2_P-C        gaggggcctatatcttcctgctggtggctccagttccggaacagtgaacc
AY306136_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AB014362_PreS2_P-C      gaggggcctatactttcctgctggtggccccagttccggaacagtaaacc
FJ715405_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ715406_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU093895_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU093898_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC793035_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttcaggaacagtaaacc
KC774311_PreS2_P-C      gaggggcctctattttcctgctggtggctccagttccggaacagtaaacc
FJ386614_PreS2_P-C      gaggggcctctactttcctgctggtggctccagttccggaacagtaaacc
AB670289_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ386604_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ787437_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
MG826124_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KR013875_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KR013858_PreS2_P-C      gaggggcctatactctcctgctggtggctccagttccggaacagtaaacc
FJ386579_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
EU939658_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU939586_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
DQ089799_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AB971714_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB971715_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KR014043_PreS2_P-C      gaggggcctatacgttcctgctggtggctccagttccggaacagtaaacc
FJ032346_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
DQ975272_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
D23684_PreS2_P-C        aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AB670277_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB014396_PreS2_P-C      aaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
EU871980_PreS2_P-C      gaggggcctatacttccatgctggtggctccagttccggaacagtaaacc
EU871998_PreS2_P-C      gaggggcctatacttccatgctggtggctccagttccggaacagtaaacc
KC774289_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ562238_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ386685_PreS2_P-C      gaagggtctatattttcctgctggtggctccagttccggaacagtaaacc
EU939640_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccgggacagtaaacc
JX504541_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ562325_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU916229_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KJ598740_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598749_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598743_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598752_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598746_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598741_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598742_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598744_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598745_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598747_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598748_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598750_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598754_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598751_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598753_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KR013984_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ173316_PreS2_P-C      gaggggcctctattttcctgctggtggctccagttccggaacagtaaacc
KF779300_PreS2_P-C      agggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC792923_PreS2_P-C      gaggggcctatacttccctgctggtggctccagttccggaacagtaaacc
KC792790_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774271_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JX429917_PreS2_P-C      gaggggcttatacttccctgctggtggctccagttccggaacagtaaacc
JX504544_PreS2_P-C      gaggggcttatacttccctgctggtggctccagttccggaacagtaaacc
JQ040141_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
HM011500_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ377546_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ715381_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ715421_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ562269_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagcaaacc
FJ518813_PreS2_P-C      gaggggcctatacttccctgctggtggctccagttccggaacagtaaacc
FJ386663_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU939619_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
DQ478885_PreS2_P-C      gaggggcctatattttcctgctggtggctccggttccggaacagtcaacc
AY206382_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AY206381_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AB670254_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
EU871975_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU871977_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KR013804_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC774283_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
JN604140_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU075315_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
DQ986375_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC792799_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC792682_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU939585_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
JQ040168_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
FJ386662_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ386596_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
FJ386687_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
EU872012_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU871976_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC793100_PreS2_P-C      gaggggcctatatyttcctgctggtggctccagttccggaacagtaaacc
EU939611_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU872008_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU964201_PreS2_P-C      gaggggcctatacttccctgctggtggctccagttccggaacagtaaacc
KU964204_PreS2_P-C      gaggggcctatacttccctgctggtggctccagttccggaacagtaaacc
KU964206_PreS2_P-C      gaggggcctatacttccctgctggtggctccagttccggaacagtaaacc
KU964207_PreS2_P-C      gaggggcctatacttccctgctggtggctccagttccggaacagtaaacc
KU964208_PreS2_P-C      gaggggcctatacttccctgctggtggctccagttccggaacagtaaacc
KU964209_PreS2_P-C      gaggggcctatacttccctgctggtggctccagttccggaacagtaaacc
KU964210_PreS2_P-C      gaggggcctatacttccctgctggtggctccagttccggaacagtaaacc
KU964211_PreS2_P-C      gaggggcctatacttccctgctggtggctccagttccggaacagtaaacc
KU964212_PreS2_P-C      gaggggcctatacttccctgctggtggctccagttccggaacagtaaacc
KU964213_PreS2_P-C      gaggggcctatacttccctgctggtggctccagttccggaacagtaaacc
KU964202_PreS2_P-C      gaggggcctatacttccctgctggtggctccagttccggaacagtaaacc
KU964203_PreS2_P-C      gaggggcctatacttccctgctggtggctccagttccggaacagtaaacc
KU964205_PreS2_P-C      gaggggcctatacttccctgctggtggctccagttccggaacagtaaacc
FJ386628_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
FJ787445_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MG893553_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY470927_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KR013805_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC793050_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
KC792965_PreS2_P-C      gaggggcctctattttcctgctggtggctccagttccggaacagtaaacc
KC792679_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
JX429916_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
HM750131_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ377624_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ562315_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ562293_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ562285_PreS2_P-C      gaggggcctatattttcctgctggtggctccggttccggaacagtaaacc
FJ562284_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ386657_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ386627_PreS2_P-C      gaggggcctatattttcctgctggtggctccaattccggaacagtaaacc
FJ386577_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ032332_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU939610_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU939609_PreS2_P-C      gaggggcctatacttccctgctggtggctccagttccggaacagtaaacc
EU916210_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU086842_PreS2_P-C      gaggagcctatattttcctgctggtggctccagttccggaacagtaaacc
AB246345_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
EU871978_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
AB195953_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
AB195954_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
KY881984_PreS2_P-C      gaggggcctatactttcctgttggtggctccagttccggaacaggaaacc
KT284754_PreS2_P-C      gaggggtctatactttcctgctggtggctccagttccggaacagtaaacc
EU939544_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
LC279276_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU086840_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
EU086847_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU086845_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU086841_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU086843_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU086844_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU086846_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KR013803_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ715379_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagcaaacc
FJ562239_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
LC279250_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC774333_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KR013808_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AF461358_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AF461359_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AB026811_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AB026813_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AB026814_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AB026812_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
LC279259_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
LC279252_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY470930_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KY470929_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KY470925_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KX276964_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU964200_PreS2_P-C      gaggggcctatacttccctgctggtggctccagttccggaacagtaaacc
KR013834_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KR013832_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KR013802_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ173446_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ173443_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ173444_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ173304_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ173307_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ173308_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC793201_PreS2_P-C      gaggggcctatattttcctgttggtggctccagttccggaacagtaaacc
KC792968_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC774359_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC774292_PreS2_P-C      gaggggcctatacttccctgctggtggctccagttccggaacagtaaacc
KC774286_PreS2_P-C      gaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
KC774264_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774203_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
GQ377600_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ377575_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
GQ377543_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ715378_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagcaaacc
FJ715377_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagcaaacc
FJ715358_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ562249_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ562233_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU939554_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU086852_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagcaaacc
DQ980547_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
DQ975273_PreS2_P-C      gaggggcctatacttccctgctggtggctccagttccggaacagtaaacc
DQ922649_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AY167096_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AF458664_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtcaacc
AB670311_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AB195952_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ715402_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774339_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774331_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774240_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ377527_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ715409_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtgaacc
FJ562332_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU939652_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ386587_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ715382_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ715383_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ715403_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ715407_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB111124_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB111125_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB246344_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KF485390_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KM359441_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ386670_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
DQ922651_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
DQ922650_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ173393_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KJ173394_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KF053172_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KJ803765_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ386639_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
DQ993691_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
DQ993692_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
V00867_PreS2_P-C        gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KJ173441_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KJ173442_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KJ173327_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KJ173328_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC792961_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC792940_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC792792_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC792708_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC792704_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774316_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774229_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
JQ341665_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
JQ341636_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU082435_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU082432_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
DQ993693_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU082428_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU082429_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU082430_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU082431_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ924633_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC792655_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC792690_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC792695_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC792776_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC792921_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC792962_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KJ790199_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KX276835_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC792999_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KJ173433_PreS2_P-C      gaggggcctttattttcctgctggtggctccagttccggaacagtaaacc
KJ173434_PreS2_P-C      gaggggcctttattttcctgctggtggctccagttccggaacagtaaacc
FJ562252_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AB642099_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY470933_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
JX429909_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
HM750132_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ562218_PreS2_P-C      gaggggcctttattttcctgctggtggctccagttccggaacagtaaacc
AB675677_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
JQ688404_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KJ173426_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KY470926_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KY470934_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774338_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
HM750134_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
HM750135_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
LC279247_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
LC279248_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
LC279249_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774268_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774276_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ377619_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KP784761_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AB670261_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
LC279258_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
MG893558_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
LC279261_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
LC279260_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
LC279262_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
LC279246_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
LC279245_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
LC090200_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU964002_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KR013873_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KR013833_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KR013831_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KR013830_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KR013829_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KR013828_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KR013807_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ173430_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccgggacagtaaacc
KJ173429_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccgggacagtaaacc
KJ173315_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ173293_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC774347_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC774249_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JX661492_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JX429912_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JQ341658_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
GU434374_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
GQ377637_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
GQ377621_PreS2_P-C      gaggggcctatactttcctgttggtggctccagttccggaacagtaaacc
GQ377574_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
GQ377515_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ715380_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagcaaacc
KC774360_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagcaaacc
FJ562274_PreS2_P-C      gaggggtctatactttcctgctggtggctccagttccggaacagtaaacc
FJ562258_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ562244_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ386598_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU871982_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU871979_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccagaacagtaaacc
DQ141656_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AB198079_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AB471848_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AB471849_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AB471850_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AB670276_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU872010_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ386637_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ562275_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ562329_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
GQ377521_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
GQ377579_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
GQ377617_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
GQ377640_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JX429906_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JX661495_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC774241_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC774312_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC774314_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ173294_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ173427_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ173428_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU963992_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU963996_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU963997_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KX276991_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KX276989_PreS2_P-C      gaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
KX276980_PreS2_P-C      gaggggcctttactttcctgctggtggctccagttccggaacagtgaacc
KX276993_PreS2_P-C      gaggggcctatgctttcctgctggtggctccagttccggaacagtaaacc
AB675674_PreS2_P-C      aaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
AB675675_PreS2_P-C      aaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
AY206376_PreS2_P-C      gaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
AY206379_PreS2_P-C      gaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
KX276985_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ562250_PreS2_P-C      aaggggcctttactttcctgctggtggctccagttccggaacagcaaacc
FJ562256_PreS2_P-C      aaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
KX276983_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
FJ386623_PreS2_P-C      gaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
KC774306_PreS2_P-C      gaggggcctttaccttcctgctggtggctccagttccggaacagtaaacc
FJ787451_PreS2_P-C      gaggggcctttaccttcctgctggtggctccagttccggaacagtaaacc
FJ787450_PreS2_P-C      gaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
KX276963_PreS2_P-C      gaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
KC774207_PreS2_P-C      gaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
KX276984_PreS2_P-C      gaggggcctatgctttcctgctggtggctccagttccggaacagtaaacc
KR013882_PreS2_P-C      gaggggcctttactttcctgctggtggctccagttccggaacagtgaacc
KX276965_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KX276961_PreS2_P-C      gaggggcctatgctttcctgctggtggctccagttccggaacagtaaacc
KX276966_PreS2_P-C      gaggggcctatgctttcctgctggtggctccagttccggaacagtaaacc
KX276973_PreS2_P-C      gaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
KC774221_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KX276976_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774238_PreS2_P-C      gaggggcctctactttcctgctggtggctccagttccggaacagtaaacc
KC774202_PreS2_P-C      gaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
FJ386664_PreS2_P-C      gaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
KC774253_PreS2_P-C      gaggggcctttacttccctgctggtggctccagttccggaacagtaaacc
KC774304_PreS2_P-C      gaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
EU939625_PreS2_P-C      gaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
KR013890_PreS2_P-C      gaggggcctttactttcctgctggtggctccagttccggaacagtgaacc
FJ715341_PreS2_P-C      gaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
EU939626_PreS2_P-C      gaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
KR013993_PreS2_P-C      gaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
KR013818_PreS2_P-C      gaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
KC774302_PreS2_P-C      gaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
KR013817_PreS2_P-C      gaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
KC774308_PreS2_P-C      gaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
KR013819_PreS2_P-C      gaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
KC774303_PreS2_P-C      gaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
KC774179_PreS2_P-C      gaggggcctgtactttcctgctggtggctccagttccggaacagtaaacc
KC774297_PreS2_P-C      gaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
KT364751_PreS2_P-C      gaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
KC774300_PreS2_P-C      gagggggctttactttcctgctggtggctccagttccggaacagtaaacc
KC774296_PreS2_P-C      gaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
KC774325_PreS2_P-C      gaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
KC774351_PreS2_P-C      gaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
KC774321_PreS2_P-C      gaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
KC774288_PreS2_P-C      gaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
GQ377591_PreS2_P-C      gaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
KC774204_PreS2_P-C      gaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
GQ377529_PreS2_P-C      gaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
KC774330_PreS2_P-C      gaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
KT364752_PreS2_P-C      gaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
KC774285_PreS2_P-C      gaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
KX276979_PreS2_P-C      gaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
KC774280_PreS2_P-C      gaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
FJ562323_PreS2_P-C      gaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
KC774282_PreS2_P-C      gaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
KC774298_PreS2_P-C      gaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
AB493839_PreS2_P-C      gaggggcctttattttcctgctggtggctccagttccggaacagtaaacc
AB493844_PreS2_P-C      gaggggcctttattttcctgctggtggctccagttccggaacagtaaacc
MG826139_PreS2_P-C      gaggggcctctatcttcctgctggtggctccgcttccgggacagtaaacc
MG826140_PreS2_P-C      gaggggcctagaccttcctgctggtggctccagttccggaacagtaaacc
MG826136_PreS2_P-C      gaggggcctctattttcctgctggtggctccagttccggaatagtaaacc
MG826137_PreS2_P-C      gaggggtctctattttcctgctggtggctccagttcaggaacagtaaacc
MG826128_PreS2_P-C      gaggggcctttattttcctgctggtggctccagttccggaacagtaaacc
MG826138_PreS2_P-C      gaggggcctctattttcctgctggtggctccagttccgggacagtaaacc
MG826132_PreS2_P-C      gaggggcctctattttcctgctggtggctccagttccggaacagtaaacc
MG826134_PreS2_P-C      aaggggcctctattttcctgctggtggctccagttccggaacagtaaacc
MG826129_PreS2_P-C      gagaggtctttatgttcctgctggtggctccagttccggaacagtaaacc
DQ141657_PreS2_P-C      gaggggcctctattttcctgctggtggctccagttccggaacagtaaacc
AP011107_PreS2_P-C      gaggggcctctattttcctgctggtggctccagttccggaacagtaaacc
MG826135_PreS2_P-C      gaggggcctctattttcctgctggtggctccagttccggaacagtaaacc
MG826131_PreS2_P-C      gaggggcctctatcttcctgctggtggctccagttccggaacagtaaacc
AP011106_PreS2_P-C      caggggcctctattttcctgctggtggctccagttccggaacagtaaacc
DQ141660_PreS2_P-C      gaggggcctctattttcctgctggtggctccagttccggaacagtaaacc
MG826133_PreS2_P-C      gaggggcctctattttcctgctggtggctccagttccggaacagtaaacc
EU306671_PreS2_P-C      aaggggcctctattttcctgctggtggctccagttccggaacagtaaacc
EU306672_PreS2_P-C      aaggggcctctattttcctgctggtggctccagttccggaacagtaaacc
X75665_PreS2_P-C        cagggtcctttattttcctgctggtggctccagttccggaacagtaaacc
HQ700562_PreS2_P-C      gaggggcctttattatcctrctggtggctccagttccggaacagtaaacc
HQ700570_PreS2_P-C      gaggggcctttattatcctgctggtggctccagttccggaacagtacacc
HQ700504_PreS2_P-C      gaggggcctttattatcctgctggtggctccagttccggaacagtaaacc
HQ700568_PreS2_P-C      gaggggcctttattatcctgctggtggctccagttccggaacagtaaacc
HQ700563_PreS2_P-C      gaggggcctttattatcctgctggtggctccagttccggaacagtaaacc
JN604222_PreS2_P-C      gaggggcctttattatcctgctggtggctccagttccggaacagtaaacc
HQ700574_PreS2_P-C      gaggggcctttattatcctgctggtggctccagttccggaacagtaaacc
HQ700556_PreS2_P-C      gaggggcctttattatcctgctggtggctccagttccggaacagtaaacc
HQ700564_PreS2_P-C      gaggggcctttattatcctgctggtggctccagttccggaacagtaaacc
HQ700573_PreS2_P-C      gaggggcctttattatcctgctggtggctccagttccggaacagtaaacc
HQ700502_PreS2_P-C      gaggggcctttattatcctgctggtggctccagttccggaacagtaaacc
HQ700565_PreS2_P-C      gaggggcctttattatcctgctggtggctccagttccggaacagtaaacc
HQ700545_PreS2_P-C      gaggggcctttattatcctgctggtggctccagttccggaacagtaaacc
HQ700529_PreS2_P-C      gaggggcctttattttcctgctggtggctccaattccggaacagtaaacc
GQ358158_PreS2_C-C      aaggggcctttattttcctgctggtggctccagttccggaacagtaaacc
GQ358157_PreS2_P-C      aaggggtctttactttcctgctggtggctccagttccggaacagtaagcc
HQ700522_PreS2_P-C      gaggggcctttattttcctgctggtggctccagttccgggacagtaaacc
HQ700543_PreS2_P-C      gaggggcctttattttcctgctggtggctccagttccgggacagtaaacc
HQ700516_PreS2_P-C      gaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
HQ700576_PreS2_P-C      aargggcctttattttcctgctggtggctccagttccggaacagtaaacc
HQ700506_PreS2_P-C      aaggggcctttattttcctgctggtggctccagttccgggacagtaaacc
KF779327_PreS2_P-C      aagggacctttattttcctgctggtggctccagttccggaacagtaaacc
HQ700457_PreS2_P-C      aaggggcctgtattttcctgctggtggctccagttccggaacagtaaacc
HQ700490_PreS2_P-C      aaggggcctgtattttcctgctggtggctccagttccggaacagtaaacc
HQ700567_PreS2_P-C      aatgggcctttattttcctgctggtggctccagttccggaacagtaaacc
HQ700495_PreS2_P-C      aaggggcctttattttcctgctggtggctccagttccgggacagtaaacc
HQ700496_PreS2_P-C      aaggggcctttattttcctgctggtggctccagttccgggacagtaaacc
HQ700569_PreS2_P-C      aaggggcctttattttcctgctggtggctccagttccggaacagtaaacc
HQ700577_PreS2_P-C      aaggggcctttattttcctgctggtggctccagttccggaacagtaaacc
HQ700476_PreS2_P-C      aargggcctttattttcctgctggtggctccagttccggaacagtaaacc
HQ700456_PreS2_P-C      aaggggcctttattttcctgctggtggctccagttccggaacagtaaacc
HQ700475_PreS2_P-C      aaggggcctttattttcctgctggtggctccagttccggaacagtaaacc
HQ700578_PreS2_P-C      gaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
HQ700571_PreS2_P-C      aaggggcctttattttcctgctggtggctccagttccggaacagtaaacc
HQ700575_PreS2_P-C      raggggcctttactttcctgctggtggctccagttccggaacagtaaacc
HQ700566_PreS2_P-C      aagggscctttactttcctgctggtggctccagttccggaacagtaaacc
HQ700555_PreS2_P-C      aaggggcctttactttcctgctggtgrctccagttccggaacagtaaacc
HQ700572_PreS2_P-C      aaggggccttyactttcctgctggtggctccagttccggaacagtaaacc
HQ700544_PreS2_P-C      aaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
HQ700558_PreS2_P-C      aaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
HQ700561_PreS2_P-C      aaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
HQ700559_PreS2_P-C      aaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
AB115417_PreS2_P-C      gaggggcctgtactttcctgctggtggctccagttccggaacagtaaacc
EU093896_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC793046_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttcaggaacagtaaacc
KY363261_PreS2_P-C      gaggggcctacattttcctgctggtggctccagttccggaacagtaaacc
KC792818_PreS2_P-C      gaggggcctgtattttcctgctggtggctccagttccggaacagtaaacc
AB713890_PreS2_P-C      gaggggtctatattttcctgctggtggctccagttccggaacagtaaacc
KC792995_PreS2_P-C      gaagagcctatattatcctgctggtggctccagttccggaacagtaaacc
KC792911_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KJ598726_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU964236_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598720_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacggtaaacc
KU964238_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacggtaaacc
KU964243_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacggtaaacc
KC774235_PreS2_P-C      gagaggcctatacttccctgctggtggctccagttccggaacagtaaacc
KY470987_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY470985_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY470980_PreS2_P-C      gaggggcctatactttcctgctggcggctccagttccggaacagtaaacc
KY470981_PreS2_P-C      gaggggcctatactttcctgctggcggctccagttccggaacagtaaacc
KY470982_PreS2_P-C      gaggggcctatactttcctgctggcggctccagttccggaacagtaaacc
KY470984_PreS2_P-C      gaggggcctatactttcctgctggcggctccagttccggaacagtaaacc
KY470988_PreS2_P-C      gaggggcctatactttcctgctggcggctccagttccggaacagtaaacc
KY470983_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY470986_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY470990_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY470991_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
GQ377555_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598670_PreS2_P-C      gaggggcctatacctccctgctggtggctccagttccggaacagtaaacc
KJ598678_PreS2_P-C      gaggggcctatacctccctgctggtggctccagttccggaacagtaaacc
KJ598674_PreS2_P-C      gaggggcctatacctccctgctggtggctccagttccggaacagtaaacc
KJ598669_PreS2_P-C      gaggggcctatacctccctgctggtggctccagttccggaacagtaaacc
KJ598665_PreS2_P-C      gaggggcctatacctccctgctggtggctccagttccggaacagtaaacc
KJ598663_PreS2_P-C      gaggggcctatacctccctgctggtggctccagttccggaacagtaaacc
KJ598666_PreS2_P-C      gaggggcctatacctccctgctggtggctccagttccggaacagtaaacc
KJ598667_PreS2_P-C      gaggggcctatacctccctgctggtggctccagttccggaacagtaaacc
KJ598668_PreS2_P-C      gaggggcctatacctccctgctggtggctccagttccggaacagtaaacc
KJ598671_PreS2_P-C      gaggggcctatacctccctgctggtggctccagttccggaacagtaaacc
KJ598672_PreS2_P-C      gaggggcctatacctccctgctggtggctccagttccggaacagtaaacc
KJ598673_PreS2_P-C      gaggggcctatacctccctgctggtggctccagttccggaacagtaaacc
KJ598676_PreS2_P-C      gaggggcctatacctccctgctggtggctccagttccggaacagtaaacc
KJ598677_PreS2_P-C      gaggggcctatacctccctgctggtggctccagttccggaacagtaaacc
KJ598664_PreS2_P-C      gaggggcctatacctccctgctggtggctccagttccggaacagtaaacc
JX504537_PreS2_P-C      gcggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598737_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598739_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU964242_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU964237_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU964235_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU964230_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598733_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598732_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598730_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598727_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598736_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598721_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598725_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598735_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU964239_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU964231_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU964232_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU964233_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU964240_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU964229_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598734_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598731_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598723_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598729_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598724_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU964241_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU964234_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598738_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598722_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ598728_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU963911_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KU963900_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KU963901_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KU963902_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KU963903_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KU963905_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KU963906_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KU963907_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KU963908_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KU963909_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KU963910_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KU963912_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KU963913_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KU963914_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KU963904_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KF495606_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY670782_PreS2_P-C      gaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
MG826127_PreS2_P-C      gaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
KJ598662_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
HM011493_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JQ412089_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY629631_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttcaggaacagtaaacc
MG826126_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY629637_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ562300_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ173333_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ717821_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KJ803809_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB670253_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KR819180_PreS2_P-C      gaggggcctctattttcctgctggtggctccagttccggaacagtaaacc
AB367420_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU939588_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttcaggaacagtaaacc
FJ899778_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttcaggaacagtaaacc
FJ386631_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacaataaacc
FJ787449_PreS2_P-C      gaggggcctctattctcctgctggtggctccagttccggaacaataaacc
KR013789_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KR013942_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KR013788_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KR013790_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB713885_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC793123_PreS2_P-C      gaggggcctatatyttcctgctggtggctccagttccggaacartaaacc
FJ787442_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ787443_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU939617_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccgggacagtaaacc
FJ787457_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtgaacc
FJ787458_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtgaacc
AB670270_PreS2_P-C      gaggggcctatatgttcctgctggtggctccagttccggaacagtaaacc
EU939653_PreS2_P-C      gaagggcctatattttcctgctggtggctccagttccggaacaataaacc
AB195937_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB195938_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB670273_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
KY363286_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KY363287_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC792669_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
KC793051_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacactaaacc
KC774225_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacaataaacc
DQ370439_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacaataaacc
DQ370438_PreS2_P-C      gaggggcctatatttacctgctggtggctccagttccggaacaataaacc
JX429914_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacaataaacc
FJ386652_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacaataaacc
GQ377577_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacaataaacc
GQ377601_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacaataaacc
AB198082_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacaataaacc
KM229703_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacaataaacc
FJ562304_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttcaggaacagtaaacc
AB670239_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB670240_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KJ598641_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KJ598660_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KJ598642_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KJ598644_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KJ598637_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KJ598655_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KJ598653_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KJ598640_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KJ598645_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KJ598648_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KJ598650_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KJ598654_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KJ598657_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KJ598659_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KJ598652_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KJ598651_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KJ598646_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KJ598635_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KJ598636_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KJ598639_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KJ598647_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KJ598649_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KJ598656_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KJ598658_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KJ598661_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KJ598638_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774245_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
AB367404_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU939573_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ475309_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
MH891502_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KJ173296_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB195936_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU916225_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ562282_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ377572_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
JX560519_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccgaaacagtaaacc
EU939569_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
MH887433_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccgggacagtaaacc
KC774272_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB670281_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB642100_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB900116_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
HQ622095_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774243_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774346_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ377528_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ386588_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB198081_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ562232_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB900109_PreS2_P-C      gaggggcctgtattttcctgctggtggctccagttccggaacagtaaacc
KX276836_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccgggacagtaaacc
AB900113_PreS2_P-C      gaggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
FJ562320_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
DQ089802_PreS2_P-C      gaggggcctgtatkttcctgctggtggctccagttccggagcagtaaacc
EU522071_PreS2_P-C      gaggggcctatactttcctgctggtggctccaattccggaacagtaaacc
FJ386624_PreS2_P-C      gcggggcctatattttcctgctggtggctccagttccggaacagtaagcc
GQ372968_PreS2_P-C      gcggggcctatattttcctgctggtggctccagttccggaacagtaagcc
KC792926_PreS2_P-C      gaggggcctgtattttcctgctggtggctccagttccggaacagtgaacc
KC792880_PreS2_P-C      gaggggcctgtatcttcctgctggtggctccagttccggaacagtaaacc
KJ598761_PreS2_P-C      gaggggcctatattatcctgctggtggctccagttccggaacagtaaacc
KJ598756_PreS2_P-C      gaggggcctatattatcctgctggtggctccagttccggaacagtaaacc
KJ598757_PreS2_P-C      gaggggcctatattatcctgctggtggctccagttccggaacagtaaacc
KJ598765_PreS2_P-C      gaggggcctatattatcctgctggtggctccagttccggaacagtaaacc
KJ598767_PreS2_P-C      gaggggcctatattatcctgctggtggctccagttccggaacagtaaacc
KJ598773_PreS2_P-C      gaggggcctatattatcctgctggtggctccagttccggaacagtaaacc
KJ598777_PreS2_P-C      gaggggcctatagtatcctgctggtggctccagttccggaacagtaaacc
KJ598768_PreS2_P-C      gaggggcctatattatcctgctggtggctccagttccggaacagtaaacc
KJ598769_PreS2_P-C      gaggggcctatattatcctgctggtggctccagttccggaacagtaaacc
KJ598775_PreS2_P-C      gaggggcctatattatcctgctggtggctccagttccggaacagtaaacc
KJ598770_PreS2_P-C      gaggggcctatattatcctgctggtggctccagttccggaacagtaaacc
KJ598772_PreS2_P-C      gaggggcctatattatcctgctggtggctccagttccggaacagtaaacc
KJ598766_PreS2_P-C      gaggggcctatattatcctgctggtggctccagttccggaacagtaaacc
KJ598771_PreS2_P-C      gaggggcctatattatcctgctggtggctccagttccggaacagtaaacc
KJ598780_PreS2_P-C      gaggggcctatattatcctgctggtggctccagttccggaacagtaaacc
KJ598779_PreS2_P-C      gaggggcctatattatcctgctggtggctccagttccggaacagtaaacc
KJ598776_PreS2_P-C      gaggggcctatattatcctgctggtggctccagttccggaacagtaaacc
KJ598774_PreS2_P-C      gaggggcctatattatcctgctggtggctccagttccggaacagtaaacc
KJ598778_PreS2_P-C      gaggggcctatattatcctgctggtggctccagttccggaacagtaaacc
KC792775_PreS2_P-C      gaggggcctgtattttcctgctggtggctccagttccggaacagtaaacc
KC793003_PreS2_P-C      gaggggcctgtattttcctgctggtggctccagttccggaacagtaaacc
KC792672_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccgggacagtaaacc
GQ377632_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB368297_PreS2_P-C      gaggggcctgtattttcctgctggtggctccagttccggaacagtacacc
AB931170_PreS2_P-C      gaggggcctgtattttcctgctggtggctccagttccggaacagtaaacc
AB931171_PreS2_P-C      gaggggcctgtattttcctgctggtggctccagttccggaacagtaaacc
KC793129_PreS2_P-C      gaggggcctgtatcttcctgctggtggctccagttccggaacagtaaacc
AB367431_PreS2_P-C      gaggggcctgtattttcctgctggtggctccagttccggaacagtaaacc
MK321266_PreS2_P-C      gaggggcctatattttcctgctggtggntccagttccggaacagtaaacc
MK720629_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
MK720630_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC792873_PreS2_P-C      gaggggcctgtattttcctgctggtggctccagttccggaacagtaaacc
EU882005_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccgggacagtaaacc
KC792762_PreS2_P-C      gaggggcctgtatcttcctgctggtggctccagttccggaacagtaaacc
KU964032_PreS2_P-C      gaggagcctgtattttcctgctggtggctccagttccggaacagtaaacc
KU964020_PreS2_P-C      gaggagcctgtattttcctgctggtggctccagttccggaacagtaaacc
KU964021_PreS2_P-C      gaggagcctgtattttcctgctggtggctccagttccggaacagtaaacc
KU964022_PreS2_P-C      gaggagcctgtattttcctgctggtggctccagttccggaacagtaaacc
KU964023_PreS2_P-C      gaggagcctgtattttcctgctggtggctccagttccggaacagtaaacc
KU964024_PreS2_P-C      gaggagcctgtattttcctgctggtggctccagttccggaacagtaaacc
KU964025_PreS2_P-C      gaggagcctgtattttcctgctggtggctccagttccggaacagtaaacc
KU964026_PreS2_P-C      gaggagcctgtattttcctgctggtggctccagttccggaacagtaaacc
KU964027_PreS2_P-C      gaggagcctgtattttcctgctggtggctccagttccggaacagtaaacc
KU964028_PreS2_P-C      gaggagcctgtattttcctgctggtggctccagttccggaacagtaaacc
KU964029_PreS2_P-C      gaggagcctgtattttcctgctggtggctccagttccggaacagtaaacc
KU964030_PreS2_P-C      gaggagcctgtattttcctgctggtggctccagttccggaacagtaaacc
KU964031_PreS2_P-C      gaggagcctgtattttcctgctggtggctccagttccggaacagtaaacc
KU964033_PreS2_P-C      gaggagcctgtattttcctgctggtggctccagttccggaacagtaaacc
DQ089801_PreS2_P-C      gaggggcctgtattttcctgctggtggctccagttccggaacagtaagcc
FJ562298_PreS2_P-C      gaggggcctgtattttcctgctggtggctccagttccggaacagtaaacc
KU964049_PreS2_P-C      gaggggcctgtattttcctgctggtggctcaagttccggaacagtaaacc
KU964050_PreS2_P-C      gaggggcctgtattttcctgctggtggctcaagttccggaacagtaaacc
KU964051_PreS2_P-C      gaggggcctgtattttcctgctggtggctcaagttccggaacagtaaacc
KU964052_PreS2_P-C      gaggggcctgtattttcctgctggtggctcaagttccggaacagtaaacc
KU964053_PreS2_P-C      gaggggcctgtattttcctgctggtggctcaagttccggaacagtaaacc
KU964054_PreS2_P-C      gaggggcctgtattttcctgctggtggctcaagttccggaacagtaaacc
KU964055_PreS2_P-C      gaggggcctgtattttcctgctggtggctcaagttccggaacagtaaacc
KU964056_PreS2_P-C      gaggggcctgtattttcctgctggtggctcaagttccggaacagtaaacc
KU964057_PreS2_P-C      gaggggcctgtattttcctgctggtggctcaagttccggaacagtaaacc
KU964058_PreS2_P-C      gaggggcctgtattttcctgctggtggctcaagttccggaacagtaaacc
KU964059_PreS2_P-C      gaggggcctgtattttcctgctggtggctcaagttccggaacagtaaacc
KU964060_PreS2_P-C      gaggggcctgtattttcctgctggtggctcaagttccggaacagtaaacc
KU964061_PreS2_P-C      gaggggcctgtattttcctgctggtggctcaagttccggaacagtaaacc
KU964062_PreS2_P-C      gaggggcctgtattttcctgctggtggctcaagttccggaacagtaaacc
KU964063_PreS2_P-C      gaggggcctgtattttcctgctggtggctcaagttccggaacagtaaacc
KJ410508_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
MG826125_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AY167091_PreS2_P-C      gaggggtctgtattttcctgctggtggctccagttccggaacagtaaacc
KC792793_PreS2_P-C      gaggggcctgtattttcctgctggtggctccagttccggaacagtaaacc
DQ141662_PreS2_P-C      gaggggcctgtattttcctgctggtggctccagttccggaacagtaaacc
KC792713_PreS2_P-C      gaggggcctgtattttcctgctggtggctccagttccggaacagtaaacc
KC792739_PreS2_P-C      gaggggcctgtattttcctgctggtggctccagttccggaacagtaaacc
DQ890381_PreS2_P-C      gaggggcctatatcttcctgttggtggctccagttccggaacagtaaacc
EU670263_PreS2_P-C      gagaggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC792831_PreS2_P-C      gaggggcctatatcttcctgctggtggctccggttccggaacagtaaacc
AB014365_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttcaggaacagtaaacc
AB367421_PreS2_P-C      gaggggcctgtattatcctgctggtggctccagttccggaacagtaaacc
KR013919_PreS2_P-C      gaggggcctatatcttcctgctagtggctccagttccggaacagtaaacc
FJ386638_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KR013915_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ386601_PreS2_P-C      gaggggcttatattttcctgctggtggctccttctccggaacagtaaacc
AB367406_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccgggacagtaaacc
AB367401_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
AB049610_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
FJ562310_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ386611_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ377557_PreS2_P-C      aaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ386607_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
AB014363_PreS2_P-C      gaggggcctttacctgcctgctggtggctccagttccggaacagtaaacc
GU721029_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB014360_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ562295_PreS2_P-C      ggggggcctatattttcctgcaggtggctccagttccggaacagtaaacc
EU939579_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccgggacagtaaacc
FJ899774_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccgggacagtaaacc
DQ993181_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ562334_PreS2_P-C      gaggggcttatattttcctgctggtggctccagttccggaacagtaaacc
KC793110_PreS2_P-C      gaggggcctatatttycctgctggtggctccagttccggaacagtaaacc
KU964064_PreS2_P-C      gaggggcctgtactttcctgctggtggctccagtttcggaacagtaaacc
KU964065_PreS2_P-C      gaggggcctgtactttcctgctggtggctccagtttcggaacagtaaacc
KU964066_PreS2_P-C      gaggggcctgtactttcctgctggtggctccagtttcggaacagtaaacc
KU964067_PreS2_P-C      gaggggcctgtactttcctgctggtggctccagtttcggaacagtaaacc
KU964068_PreS2_P-C      gaggggcctgtactttcctgctggtggctccagtttcggaacagtaaacc
KU964069_PreS2_P-C      gaggggcctgtactttcctgctggtggctccagtttcggaacagtaaacc
KU964070_PreS2_P-C      gaggggcctgtactttcctgctggtggctccagtttcggaacagtaaacc
KU964071_PreS2_P-C      gaggggcctgtactttcctgctggtggctccagtttcggaacagtaaacc
KU964072_PreS2_P-C      gaggggcctgtactttcctgctggtggctccagtttcggaacagtaaacc
KU964073_PreS2_P-C      gaggggcctgtactttcctgctggtggctccagtttcggaacagtaaacc
KU964074_PreS2_P-C      gaggggcctgtactttcctgctggtggctccagtttcggaacagtaaacc
KU964075_PreS2_P-C      gaggggcctgtactttcctgctggtggctccagtttcggaacagtaaacc
KU964077_PreS2_P-C      gaggggcctgtactttcctgctggtggctccagtttcggaacagtaaacc
KU964078_PreS2_P-C      gaggggcctgtactttcctgctggtggctccagtttcggaacagtaaacc
KU964334_PreS2_P-C      gaggggcctgtactttcctgctggtggctccagtttcggaacagtaaacc
KU964336_PreS2_P-C      gaggggcctgtactttcctgctggtggctccagtttcggaacagtaaacc
KU964337_PreS2_P-C      gaggggcctgtactttcctgctggtggctccagtttcggaacagtaaacc
KU964338_PreS2_P-C      gaggggcctgtactttcctgctggtggctccagtttcggaacagtaaacc
KU964339_PreS2_P-C      gaggggcctgtactttcctgctggtggctccagtttcggaacagtaaacc
KU964340_PreS2_P-C      gaggggcctgtactttcctgctggtggctccagtttcggaacagtaaacc
KU964342_PreS2_P-C      gaggggcctgtactttcctgctggtggctccagtttcggaacagtaaacc
KU964343_PreS2_P-C      gaggggcctgtactttcctgctggtggctccagtttcggaacagtaaacc
KU964344_PreS2_P-C      gaggggcctgtactttcctgctggtggctccagtttcggaacagtaaacc
KU964345_PreS2_P-C      gaggggcctgtactttcctgctggtggctccagtttcggaacagtaaacc
KU964346_PreS2_P-C      gaggggcctgtactttcctgctggtggctccagtttcggaacagtaaacc
KU964347_PreS2_P-C      gaggggcctgtactttcctgctggtggctccagtttcggaacagtaaacc
KU964348_PreS2_P-C      gaggggcctgtactttcctgctggtggctccagtttcggaacagtaaacc
KU964076_PreS2_P-C      gaggggcctgtactttcctgctggtggctccagtttcggaacagtaaacc
EU939649_PreS2_P-C      aaggggcctatattttcctgctggtggctccagttccggaatagtaaacc
EU939599_PreS2_P-C      gaggggcctgtattttcctgctggtggctccagttccggaactgtaaacc
KC774265_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB367412_PreS2_P-C      gaggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB642097_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB367418_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KR013853_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KR013923_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KR013778_PreS2_P-C      gaggggtctatattttcctgctggtggctccagttccggaacagtaaacc
KR013777_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ787474_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB670309_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
AB670295_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774343_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
JN604231_PreS2_P-C      gaggggcctatatattcctgctggtggctccagttccggaacagtaaacc
AY220701_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KY363254_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
EU554540_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaagcc
GQ475353_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB113875_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttcaggaacagtaaacc
AB113876_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttcaggaacagtaaacc
AB111119_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttcaggaacagtaaacc
KC774194_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaagcc
JX661489_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
JQ027323_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
HM750137_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaatagtaaacc
EU939601_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU939572_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU562216_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB367399_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
AB362932_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttcaggaacagtaaacc
FJ032333_PreS2_P-C      gaggggcctatatttccctgctggtggctccagttccggaacagtaagcc
FJ386665_PreS2_P-C      gaggggcctatatttccctgctggtggctccagttccggaacagtaagcc
GQ377559_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
LC279256_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AB042284_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
LC279254_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
LC279257_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
LC279255_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KF214652_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB300368_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ562268_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KR013852_PreS2_P-C      gaggggcctatatcctcctgctggtggctccagttccggaacagtaaacc
KY363282_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttcaggaacagcaaacc
KY363283_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttcaggaacagcaaacc
KC792927_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774215_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774216_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
JX429907_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
HM750138_PreS2_P-C      gaggggcctctattttcctgctggtggctccagttccggaacagtaaacc
GQ377586_PreS2_P-C      gaggggcctatatttccctgctggtggctccagttccggaacagtaaacc
FJ562333_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU939549_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AY641561_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaagcc
AY641558_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
JN400087_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
JN400088_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
JN400089_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AY247032_PreS2_P-C      gaggggcctatattttcctgctggtggctccaattccggaacagtaaacc
AB367407_PreS2_P-C      gaggggcctatactttcctgttggtggctccagttccggaacagtaaacc
AB485810_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB033550_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ377535_PreS2_P-C      gaggggcctatatttccctgttggtggctccagttccggaacagtaaacc
GQ377553_PreS2_P-C      gaggggcctatatttccctgttggtggctccagttccggaacagtaaacc
FJ715350_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttcaggaacagtaaacc
FJ715370_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttcaggaacagtaaacc
FJ562330_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ386679_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
EU939654_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
AB670294_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KY363268_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KR013851_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KR013850_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774309_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774270_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774266_PreS2_P-C      gaggggcctatatttccctgctggtggctccagttccggaacagtaaacc
KC774247_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttcaggaacagtaaacc
KC774208_PreS2_P-C      gaggggcctatattttcctgctggtggctccagtttcggaacagtaaacc
JQ341670_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ475336_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ475331_PreS2_P-C      aaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ377540_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ562291_PreS2_P-C      gaggggcctctattttcctgctggtggctccagttccggaacagtaaacc
FJ562288_PreS2_P-C      gaggggcttatattttcctgctggtggctccagttccggaacagtaaacc
FJ386671_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaagcc
EU939587_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
EU939566_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU939648_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ475318_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ475306_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ475308_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ475310_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
JN604148_PreS2_P-C      gaggggcctctattttcctgctggtggctccagttccggaacagtaaacc
JQ040151_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
X04615_PreS2_P-C        gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KJ173439_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KJ173440_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774299_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
KC774239_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC774195_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774192_PreS2_P-C      gaggggcctatatttccctgctggtggctccagttccggaacagtaaacc
KC774185_PreS2_P-C      gaggggcctgtattttcctgctggtggctccagttccggaacagtaaacc
JX661490_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ475330_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ475321_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttcaggaacagtaaacc
EU939590_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU939591_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU939548_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU562215_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB670297_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB670287_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB670251_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB202071_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ386575_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774184_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ475341_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU562217_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774255_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagcaaacc
KC774244_PreS2_P-C      gaggggcctatattttcctgttggtggctccagttccggaacagtaaacc
KC774233_PreS2_P-C      gaggggcctatatttccctgctggtggctccagttccggaacagtaaacc
KC774220_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ475349_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ475345_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttcaggaacagtaaacc
GQ475307_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttcaggaacagtaaacc
GQ377616_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ377563_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ377598_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
JX661488_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KJ173283_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KJ173284_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ377514_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AP011098_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB205124_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB198078_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttcaggaacagtaaacc
GQ475348_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttcaggaacagtaaacc
MG893556_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttcaggaacagtaaacc
DQ089793_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ475314_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774181_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774250_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774251_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ377576_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
JQ341635_PreS2_P-C      nnggggcccataccttcttgctggtggctccagttccgaaacagtaaacc
KX276850_PreS2_P-C      gaggggyctataytttcctgctggtggctcaagttccggaacagtaaacc
EU498227_PreS2_P-C      gaggggcccatactttcctgctggtggctccagttccggaacagtaaacc
HM011488_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AB074047_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
JQ027324_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KF053181_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ803774_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
HM011495_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ717804_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KJ803794_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
GQ924642_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KF053168_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KJ803760_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KY470908_PreS2_P-C      gaggggcctatactgtcctgctggtggctcaagttccggaacagtaaacc
KY470911_PreS2_P-C      gaggggcctatactgtcctgctggtggctcaagttccggaacagtaaacc
KF053173_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacaggaaacc
KJ803766_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacaggaaacc
MK286461_PreS2_P-C      gaggrkcctatattttcctgctggtggctcaagttcygraacagtaaacc
JN604135_PreS2_P-C      gagggacctatgctttcctgctggtggctcaagttccggaacagtaaacc
KF214673_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KF053161_PreS2_P-C      gaggggcctatatttccctgctggtggctcaagttccggaacagtaaacc
KJ803754_PreS2_P-C      gaggggcctatatttccctgctggtggctcaagttccggaacagtaaacc
JQ341657_PreS2_P-C      nnnnnnnnnnnnnnnnnctgctggtggctcaagttccggaacagtaaacc
KF214671_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
MF925403_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KJ717839_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KJ803823_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
FJ023639_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
JQ027317_PreS2_P-C      gaggggcctatatwytcctgctggtggctcmagttccggaacagtaaacc
KX276848_PreS2_P-C      gaggggtctatattttcctgctggtggctcaagttccggaacagtaaacc
AB112471_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KX276844_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KR013927_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EF384206_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
GQ924658_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
JN827423_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KJ717826_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KJ803813_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KJ717823_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KJ717828_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KJ803811_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KJ803815_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KJ717827_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KJ803814_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KX276847_PreS2_P-C      gaggggcctatatttycctgctggtggctcaagttccggaacagtaaacc
KP148526_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148512_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
JQ801497_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148561_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148559_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148521_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148524_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148493_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148487_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148481_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148476_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148474_PreS2_P-C      gaggggcctatattttcctactggtggctcaagttccggaacagtaaacc
KP148470_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KX765830_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148568_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148567_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148543_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148534_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148519_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148530_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148514_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148513_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacaataaacc
KP148492_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148473_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148472_PreS2_P-C      gaggggcatatattttcctgctggtggctcaagttccggaacagtaaacc
KP148477_PreS2_P-C      gaggggcatatattttcctgctggtggctcaagttccggaacagtaaacc
FJ023649_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
FJ023643_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ023644_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
MF925387_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaaccgtaaacc
AB300363_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
JQ801519_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KX765826_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KX765837_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KX765848_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KX765850_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
EF384200_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
GQ924604_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
AB074755_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KF053167_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KF053169_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KJ803759_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KJ803761_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
GQ924615_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148563_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148546_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148560_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148520_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148529_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148465_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148564_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148575_PreS2_P-C      gaggggcctatgttttcctgctggtggctcaagttccggaacagtaaacc
KP148570_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148566_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148555_PreS2_P-C      gaggggcctatattttccagctggtggctcaagttccggaacagtaaacc
KP148551_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148548_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148545_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148537_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148535_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148532_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148525_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148489_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148557_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148483_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148491_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148482_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148554_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148475_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148469_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148466_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148463_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148315_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148464_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148462_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148468_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148471_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148479_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148480_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148488_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148517_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148523_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148528_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148531_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148538_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148540_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148547_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148549_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148552_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148558_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148562_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148571_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148572_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148573_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KP148574_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
GQ358153_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KF053164_PreS2_P-C      gaggggcctaaactttcctgctggtggctcaggttccggaacagtaaacc
KJ803757_PreS2_P-C      gaggggcctaaactttcctgctggtggctcaggttccggaacagtaaacc
JQ801491_PreS2_P-C      gaggggcctagactttcctgctggtggctcaagttccggaacagtaaacc
DQ089804_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
JQ341656_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
JQ341778_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KC315399_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KF053184_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ803777_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ717791_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
JN604129_PreS2_P-C      gaggggcctatacttccctgctggtggctcaagttccggaacagtaaacc
HM011468_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttcaggaacagtaaacc
HM011491_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccgaaacagtaaacc
KX276854_PreS2_P-C      gagaggcctatactttcctgctggtggctccagttccggaacaghaaacc
GQ855376_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttcaggaacagtaaacc
AY167099_PreS2_P-C      gaggggcctctattttcctgctggtggctccagttccggaacagtaaacc
KJ717825_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KJ803812_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KF214670_PreS2_P-C      gaggggcctataccttcctgctggtggctcaagttccggaacagtaaacc
MF925409_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KF214675_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttcaggaacagtaaacc
AB112066_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KF053183_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccgggacagtaaacc
KJ803776_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccgggacagtaaacc
JQ801472_PreS2_P-C      gaggggcctataccttcctgctggtggctcaagttccggaacagtaaacc
GQ222203_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccgggacagtaaacc
DQ089803_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
JN604243_PreS2_P-C      gaggggcctataccttcctgctggtggctcaagttccggaacagtaaacc
DQ315781_PreS2_P-C      gaagggcctatactttcctgctggtggctcaagttccggaacagtaaacc
DQ315783_PreS2_P-C      gaagggcctatactttcctgctggtggctcaagttccggaacagtaaacc
GQ924643_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JN827418_PreS2_P-C      gagaggcctatactatcctgctggtggctcaagttccggaacagtaaacc
JN827421_PreS2_P-C      gagaggcctatactttcctgctggtggctcaagttccggaacagtaaacc
AB112408_PreS2_P-C      gagggg---------tcctgctggtggctcaagttccggaacagtaaacc
JQ801493_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
JQ801481_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccgaaacagtaaacc
KX765828_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccgggacagtaaacc
JQ801515_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
MF488701_PreS2_P-C      gaggggcctataccttcttgctggtggctcaagttccggaacagtaaacc
JN827420_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
AB112348_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JN827424_PreS2_P-C      gagaggcctatactttcctgctggtggctcaagttccggaacagtaaacc
JN827425_PreS2_P-C      gagaggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KU051424_PreS2_P-C      gaggggcctttactttcctgctggtggctcaagttccggaacagtaaacc
FJ023648_PreS2_P-C      gaggggcctatacattcctgctggtggctcaagttccggaacagtaaacc
KX765855_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
JN604232_PreS2_P-C      gaggggcctataytttcctgctggtggctcaagttccggaacagtaaacc
FJ023646_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ023645_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacattaaacc
KC875268_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KX765819_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KX765847_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KY470912_PreS2_P-C      gaggggcctatactttcctgctggcggctcaagttccggaacagtaaacc
KX774504_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KF214667_PreS2_P-C      gaggggcctataccttcctgctggtggctcaagttccggaacagtaaacc
JQ801473_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttcaggaacagtaaacc
JQ341661_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY470914_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KF053176_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttcaggaacagtaaacc
KT366464_PreS2_P-C      gaggggcctata------tgctggtggctcaagttccggaacagtaaacc
KF053193_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
MH220971_PreS2_P-C      gaggggcctataccttcctgctggtggctcaagttccggaacagtaaacc
MF925395_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
MF925359_PreS2_P-C      gaggggcctctacttacctgctggtggctcaagttccggaactgtaaacc
MF925374_PreS2_P-C      gaggggcctctacttacctgctggtggctcaagttccggaactgtaaacc
KX765849_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KX765842_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KX765834_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccgggacagtaaacc
JQ429078_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaagcc
JN827422_PreS2_P-C      aaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
JN604147_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtraacc
GQ924650_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccgaaacagtaaacc
KY470913_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KY470910_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KY470918_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KY470906_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KY470920_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KY470909_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KY470907_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KY470917_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KT987425_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KT987426_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KT307718_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KT307719_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KU051427_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KU051426_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
JQ801498_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
GQ924616_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KJ410505_PreS2_P-C      g------ctaga---tcctgctggtggctccagttccggaacagtaaacc
GQ184326_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccgggacagtaaacc
DQ141667_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KJ717834_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KJ803818_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
MG826123_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AB247916_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaactgtaaacc
AB117758_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
MK628732_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaaccgtaaacc
MF925365_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KY470936_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KY470937_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KY470916_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KX765852_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttcaggaacagtaaacc
KX765821_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KT987423_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccgggacagtaaacc
KT366463_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KF214676_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KC875270_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC774236_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccgggacagtaaacc
JQ801509_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
JQ801488_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttcaggaacagtaaacc
FJ023656_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
FJ023654_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccgggacagtaaacc
DQ141666_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
DQ141664_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
MF925405_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
MF925394_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KC875267_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JQ801523_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttcaggaatagtaaacc
JN827417_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KX765823_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ349225_PreS2_P-C      gagaggcctatactttcctgctggtggctccagttccggaacagtaaacc
JQ027333_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
JN604121_PreS2_P-C      gaggggcctatacgttcctgctggtggctcaagttccggaacagtaaacc
MF925398_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KX765843_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccgggacagtaaacc
JN604153_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KF053187_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KJ803780_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KF214668_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KX765825_PreS2_P-C      gagaggcctatactttcctgctggtggctcaagttccggaacagtaaacc
JQ801482_PreS2_P-C      gagaggcctatactttcctgctggtggctcaagttccggaacagtaaacc
JQ801475_PreS2_P-C      gagaggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KX765844_PreS2_P-C      gagaggcctatactttcctgctggtggctcaagttccggaacagtaaacc
MG725248_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
MF925375_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KX774506_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KX765832_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtgaacc
KX765829_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KX765822_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KU051425_PreS2_P-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KJ717802_PreS2_P-C      gagaggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KJ803792_PreS2_P-C      gagaggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KC875273_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaagc
KC875272_PreS2_P-C      gaggggcctatactttcctgctggtggctccacttccggaacagtaaacc
KC875269_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagcaaacc
JQ801522_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttcaggaacagtaaacc
JQ801521_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
JQ801505_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
JQ801503_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccgggacagtaaacc
JQ801501_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
JQ801500_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
JQ801486_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
JN827416_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
JN604151_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
JF899336_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
GQ924629_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KX765851_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccgggacagtaaacc
JQ801496_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccgggacagtaaacc
KT347089_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccgggacagtaaacc
GQ924609_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
GQ924614_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KX765827_PreS2_P-C      gaggggcctttactttcctgctggtggctcaagttccggaacagtaaacc
KX765836_PreS2_P-C      gaggggcctttactttcctgctggtggctcaagttccggaacagtaaacc
KC875264_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC875265_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
GQ358154_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC875271_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
MF925410_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
MF925377_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
MF925367_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KX765839_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
MF925369_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KX765831_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KT364718_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KJ717812_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KJ803800_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KJ717810_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KJ717811_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KJ803799_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KC875274_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JQ801518_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
JQ801504_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagtaccggaacagtaaacc
JQ801502_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KX765818_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
JQ801470_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
GQ924612_PreS2_P-C      gaggggcctataccttcctgctggtggctcaagttccggaacagtaaacc
GQ924613_PreS2_P-C      gaggggcctataccttcctgctggtggctcaagttccggaacagtaaacc
FJ023647_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KX765838_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
EU306691_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
EU306690_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
EU306689_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
EU306688_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
EU306687_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
EU306694_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KC774228_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
AF068756_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
AB074756_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
DQ141668_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
FJ023641_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
FJ023642_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
FJ023657_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
FJ023658_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
GU563561_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
JQ801511_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
JQ801513_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
JQ801520_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KT364721_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KT987424_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KU051423_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KX765820_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KX765833_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KX765840_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KX765846_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KX765853_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KX774503_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
MF925406_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
MF925408_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
GQ924649_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
MG571345_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KX276841_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
MG571359_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ410515_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ410499_PreS2_P-C      gaggggactatacttccctgctggtggctccagttccggaacagtaaacc
KJ410494_PreS2_P-C      gaggggactatactttcctgctggtggctccagttccggaacagtaaacc
KJ410491_PreS2_P-C      gaggggactatactttcctgctggtggctccagttccggaacagtaaacc
KJ410492_PreS2_P-C      gaggggactatactttcctgctggtggctccagttccggaacagtaaacc
JQ341652_PreS2_P-C      nnnnnnnnnnnnnnttcctgctggtggctccagttccggaacagtaaacc
MF674390_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
DQ089791_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
JQ281123_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
JQ281125_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
DQ089780_PreS2_P-C      gaggggcckttaccttcctgctggtggctccagttccggaacagtaaacc
KJ717822_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttcaggaacagtaaacc
KJ803810_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttcaggaacagtaaacc
MF674489_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttcaggaacagtaagcc
KJ410511_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
JQ341628_PreS2_P-C      gagrggcctatactttcctgctggtggctccagttccggaacagtaaacc
KX276840_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JQ341650_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JQ341612_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttcaggaacagtaaacc
JQ341626_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
JQ027320_PreS2_P-C      gaggggcctatactttcctgctggtggctccggttccggaacagtaaacc
DQ089785_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JX507211_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JQ341664_PreS2_P-C      gagaggcctatactttcctgctggtggctccagttccggaacagtaaacc
JQ341653_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccagaacagtaaacc
KJ173285_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaaccgtaaacc
KJ173286_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaaccgtaaacc
DQ089767_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
DQ089768_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JQ027318_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JQ341631_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JQ341620_PreS2_P-C      gaagggcctatactttcctgctggtggctccagttccgraacagtaaacc
AB105174_PreS2_P-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
MF925376_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
GQ924655_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccgggacagtaaacc
KJ410518_PreS2_P-C      gaggggcctatacttccctgctggtggctccagttccggaacagtaaacc
KJ410493_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
GQ855393_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JQ341668_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JQ341790_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KR013935_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KR013820_PreS2_P-C      gaggggcctatacttccctgctggtggctccagttccggaacagtaaacc
DQ089773_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
KR013855_PreS2_P-C      gaggggcctatacttccctgctggtggctccagttcaggaacagtaaacc
KR013854_PreS2_P-C      gaggggcctatacttccctgctggtggctccagttcaggaacagtaaacc
KR013856_PreS2_P-C      gaggggcctatacttccctgctggtggctccagttcaggaacagtaaacc
KR013857_PreS2_P-C      gaggggcctatacttccctgctggtggctccagttcaggaacagtaaacc
KR013822_PreS2_P-C      gaagggcctatacttccctgctggtggctccagttccggaactgtaaacc
KR013823_PreS2_P-C      aaggggcctatacttccctgctggtggctccagttccggaacagtaaacc
KR013821_PreS2_P-C      gaagggcctatacttccctgctggtggctccagttccggaacagtaaacc
KR013824_PreS2_P-C      gaagggcctatacttccctgctggtggctccagttccggaacagtaaacc
JQ341655_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AB031262_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KR013905_PreS2_P-C      gaggggcctatactttcctgctggcggctccagttccggaacagtaaacc
KR013770_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KR013900_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KR013902_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
DQ089790_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
MG571335_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
MF674425_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
MF674458_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KR013826_PreS2_P-C      gaggggcctatacctccctgctggtggctccagttccggaacagtaaacc
KR013787_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KR013825_PreS2_P-C      gaggggcctatacttccctgctggtggctccagttccggaacagtaaacc
JX507212_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccgggacastaaacc
DQ246215_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
DQ089786_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JQ341669_PreS2_P-C      gaggggcctatacwtycctgctggtggctccagttccggaacagtaaacc
DQ089766_PreS2_P-C      gaagggcctatactttcctgctggtggctccagttccggaacagtaaacc
EF494379_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
DQ089761_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
DQ089776_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
DQ089777_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
MF674444_PreS2_P-C      gaggggcctctactttcctgctggtggctccagttcaggaacagtaaacc
MF674430_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ717809_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
DQ089775_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
DQ089770_PreS2_P-C      gaggggcctatactttcctgctggtggttccagttccggaacagtaaacc
JQ341633_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
DQ089792_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
DQ089788_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
KM875424_PreS2_P-C      gaagggcctatactttcctgctggtggctccagttccggaacagtaaacc
DQ089763_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AB205125_PreS2_P-C      gcggggcctctaccttcctgctggtggctccagttccggaacagtaaacc
MF674502_PreS2_P-C      gcggggcctctactttcctgctggtggctccagttccggaacagtaaacc
MG571332_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
MF674417_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KR013903_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KM875425_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KF053185_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC774227_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JQ341611_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccgaaacagtaaacc
JQ281122_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttcaggaacagtaaacc
JQ281113_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttcaggaacagtaaacc
DQ141663_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
DQ089783_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
DQ089778_PreS2_P-C      gaggggcctatactttcctgctggtggctccggttccggaacagtaaacc
DQ089762_PreS2_P-C      gaagggcctatactttcctgctggtggctccagttccggaacagtaaacc
AF473543_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ377536_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AB112065_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagaaaacc
KM875429_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JQ801495_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
KR013899_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
HM011472_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
MK818227_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
MF674504_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
MF674408_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
MF674399_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
MF488703_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY470915_PreS2_P-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KJ410504_PreS2_P-C      gaggggcctatactttcctgctggtggctccaattccggaacagtaaacc
KJ173323_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JQ341654_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JQ341642_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JQ341639_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JQ341622_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacaataaacc
JN604286_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
GQ924636_PreS2_P-C      gagaggcctatactttcctgctggtggctccagttcaggaacagtaaacc
EF688062_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
DQ089784_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AF223960_PreS2_P-C      gaggggcctatacgttcctgctggtggctccagttccggaacagtaaacc
JQ281127_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JQ341618_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JN604144_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
DQ141665_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacaataaacc
MF674494_PreS2_P-C      gaggggcctatactttcctgctggtggctccggttccggaacagtaaacc
MF674486_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
MF674467_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
MF674435_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
MF674403_PreS2_P-C      gagaggcctatactttcctgctggtggctccagttccggaacagtaaacc
KX765845_PreS2_P-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KM875428_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KM875406_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ173324_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JQ801490_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JQ341663_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JQ341659_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttcaggaacagtaaacc
JQ341641_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JQ341617_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JQ341616_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JQ281128_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JQ281124_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccgggacagtaaacc
JQ281121_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagcaaacc
JQ281120_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagcaaacc
JQ281118_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JQ040133_PreS2_P-C      gaggggcctctactttcmtgctggtggctccagttccggaacagtaaacc
HM011497_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ023650_PreS2_P-C      gaggggcttatactttcctgctggtggctccagttccggaacagtaaacc
DQ089789_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttcmggaacagtaaacc
DQ089769_PreS2_P-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
DQ089765_PreS2_P-C      gaggggcctatacttccctgctggtggctccagttccggaacagtaaacc
DQ089764_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
AF223958_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JX507214_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ410501_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ410513_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JN604118_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
DQ089771_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
MF674484_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
MF674475_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
MF674474_PreS2_P-C      gaggggcctctactttcctgctggtggctccagttccggaacagtaaacc
MF674454_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KX765824_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KM875405_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KM875404_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ717803_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ803793_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JQ341644_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JQ341615_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JQ281119_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU306685_PreS2_P-C      gaggggcctatactttcctgctggtggctcgagttccggaacagtaaacc
DQ089779_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AY862869_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AF223957_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AF223961_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AP011097_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JQ341637_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AF223955_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AB105173_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AF223956_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AF223959_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
DQ089781_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
DQ089782_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ023653_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JQ688403_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
MF674386_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
MF674388_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
MF674412_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
MF674418_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
MF674442_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
MF674468_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
MF674472_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
MF674501_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AF223954_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
MF674402_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JQ341660_PreS2_P-C      gaggggcctatacgttcctgctggtggctccagttccggaacagtaaacc
JQ341614_PreS2_P-C      aaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
HM011486_PreS2_P-C      gaggggcctatacttccctgctggtggctccagttccggaacagtaaacc
AB111946_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
AB112063_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
JQ341649_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ717844_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaaccgtaaacc
KJ803826_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaaccgtaaacc
DQ478901_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KF053177_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
KJ803770_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
DQ089758_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JQ341621_PreS2_P-C      gaggggcctatacsttcctgctggtggctccagttccggaacagtaaacc
KR014021_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KR013838_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KR013837_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KR013840_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KR013841_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KR013835_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KR013836_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KR013839_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JX504535_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JQ281470_PreS2_P-C      gagaggcctatactttcctgctggtggctccagttccggaacagtaaacc
AB246346_PreS2_P-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
JQ281126_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JQ027321_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
DQ089757_PreS2_P-C      gaagggcctatactttcctgctggtggctccagttccggaacagtaaacc
JQ341624_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ410514_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JQ341630_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JX870000_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KX276853_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AB112472_PreS2_P-C      gaggggactgtactttcctgctggtggctccagttccggaacagtaaacc
MF674514_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttcaggaacagtaaacc
MF674463_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ410519_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JQ281112_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttcaggaacagtaaacc
EU305541_PreS2_P-C      gaggggcctatacgttcctgctggtggctccagttccggaacagtaaacc
DQ089772_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
DQ089759_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ410489_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ410495_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JQ341651_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ717790_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ803779_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KX276852_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KX276851_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ410498_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ410496_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU305540_PreS2_P-C      gaggggcctatactttcctgcaggtggctccagttccggaacagtaaacc
DQ089787_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
DQ089760_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
MF674428_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JQ281116_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JQ281114_PreS2_P-C      gaggggcctatacyttcctgctggtggctccagttccggaacagtaaacc
EU305542_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
MF674471_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JQ341613_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JN604182_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JN604256_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JQ281117_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
MF674398_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
MF674429_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AJ748098_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
MF674457_PreS2_P-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
                                                     *                   *

KF873544_PreS2_P-C      ctgttccgaatactgtctctcacatctcatcaaccttcacgaagactggg
KU679947_PreS2_P-C      ctgttccgactactgtctctcacatctcatcaatcttcacgaagactggg
KU679957_PreS2_P-C      ctgttccgactactgtctctcacatctcatcaatcttcacgaagactggg
KU679936_PreS2_P-C      ctgttccgaatactgtctctcccatctcatcaatcttcacgaagactggg
KF873520_PreS2_P-C      ctgttccgaatactgtctctcccatctcatcaatcttcacgaagactggg
KF873514_PreS2_P-C      ctgttccgaatactgtctctcccatatcatcaatcttcacgaagactggg
KF873516_PreS2_P-C      ctgttccgaatactgtctctcccatatcatcaatcttcgcgaagactggg
KU679951_PreS2_P-C      ctgttccgaatactgtctctcacatctcatcaatcttcacgaagactggg
KF873528_PreS2_P-C      ctgttcagaatactgtctctcacatctcatcaatcttcacgaagactggg
KF873526_PreS2_P-C      ctgttcagaatactgtctctcacatctcatcaatcttcacgaagactggg
KF873529_PreS2_P-C      ctgttcagaatactgtctctcacatctcatcaatcttcacgaagactggg
KF873536_PreS2_P-C      ctgttccgaatactgtctctcacatatcatcaaycttcrcgacgactggg
KU679960_PreS2_P-C      ctgttccgamtactgtctctcacatatcatcaakcttcrcgacgactggg
KU679937_PreS2_P-C      ctgttccgaatactgtctctcacatctcatcaatcttcacgacgactggg
KF873539_PreS2_P-C      ctgttccgaatactgtctctcacatctcatcaatcttcacgacgactggg
KF873541_PreS2_P-C      ctgttccgaatactgtctctcacatctcatcaatcttcacgacgactggg
JQ040167_PreS2_P-C      ctgytcmgamtactgyctctsccatatcgtcaatcttmtcgargactggg
KX276846_PreS2_P-C      ctgttccgactactgyctctcccatatcgtcaatcttctcgaggactggg
KX276855_PreS2_P-C      ctgttccgacttctgcctctcccatatcgtcaatcttctcgaggactggg
KX276982_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KX276992_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KX276988_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ717799_PreS2_P-C      ctgttccgacttctgcctctcccatatcgtcaatcttctcgaggactggg
KJ803790_PreS2_P-C      ctgttccgacttctgcctctcccatatcgtcaatcttctcgaggactggg
GQ924620_PreS2_C-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KJ173335_PreS2_P-C      ctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggg
JN370955_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
JN827414_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
JN827415_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
AF241410_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
AF241411_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
GQ924622_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
AB241111_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
AP011101_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
AP011099_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
EU410079_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
AB241110_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
EU410081_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
JN604226_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttcttgaggactggg
AP011100_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
EU410080_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KR014082_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcgatcttctcgaggactggg
KR013871_PreS2_P-C      ctgttccgactactgcatctcccatatcgtcaatcttctcgaggactggg
KR014083_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgagggctggg
KR014078_PreS2_P-C      ccgttccgactactgcatctcccatatcgtcaatcttctcgaggactggg
KR013870_PreS2_P-C      ctgttccgactactgcatctcccatatcgtcaatcttctcgaggactggg
KR014077_PreS2_P-C      ctgttccgactactgcatctcccatatcgtcaatcttctcgaggactggg
JQ341632_PreS2_P-C      ctgttccaactactgcctctcccatatcatcaatcttctcgaggactggg
KJ717833_PreS2_P-C      ctgttccaactactgcctctcccatatcatcaatcttctcgaggactggg
FJ562245_PreS2_P-C      ctgttccgactactgcctctcccatatcgttaatcttctcgaggactggg
DQ993690_PreS2_P-C      ctgttccgactactgcctctcccctatcgtcaatcttctcgaggactggg
JQ040132_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactssg
FJ386626_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC792868_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KY363258_PreS2_P-C      ctgttccgactactgccttacccatatcgtcaatcttctcgaggactggg
KR014137_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttcccgaggactggg
DQ141661_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttcttgaggactggg
KY363260_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AY220702_PreS2_P-C      ctgttccgaccactgcctcacccatatcgtcaatcttctcgaggactggg
AB670259_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC792759_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
JQ027322_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
AB670237_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JX026877_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC792753_PreS2_P-C      ctgttccgactactgcctcacccatatagtcaatcttctcgaggactggg
KC792710_PreS2_P-C      ctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggg
EU939659_PreS2_P-C      ctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggg
AB697502_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
FJ899772_PreS2_P-C      ctgttccgactactgccttgcccatatcgtcaatcttctcgaggactggg
MG826122_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
EU939603_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
FJ899773_PreS2_P-C      ctgttccgactactgccttacccatattgtcaatcttctcgaggactggg
JQ040149_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU093902_PreS2_P-C      ctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggg
KC792857_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU939646_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KC793195_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
FJ715360_PreS2_P-C      ctgttccgactaccgcctcacccatatcgtcaatcttctcgaggactggg
KU964318_PreS2_P-C      ctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggg
KU964321_PreS2_P-C      ctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggg
KU964326_PreS2_P-C      ctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggg
KU964327_PreS2_P-C      ctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggg
KU964333_PreS2_P-C      ctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggg
KU964329_PreS2_P-C      ctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggg
KU964319_PreS2_P-C      ctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggg
KU964322_PreS2_P-C      ctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggg
KU964323_PreS2_P-C      ctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggg
KU964324_PreS2_P-C      ctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggg
KU964325_PreS2_P-C      ctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggg
KU964328_PreS2_P-C      ctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggg
KU964330_PreS2_P-C      ctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggg
KU964331_PreS2_P-C      ctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggg
KU964332_PreS2_P-C      ctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggg
KU964320_PreS2_P-C      ctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggg
FJ386592_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB670241_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ715415_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ715416_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ173309_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ562228_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ562339_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB014399_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ787455_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ787456_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ715418_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ715391_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ715351_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ715390_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
D23681_PreS2_P-C        ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU939561_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ032336_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ032338_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ032339_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ715359_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AF533983_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB670258_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774290_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU939614_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB367414_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ173334_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ715368_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY470977_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY470973_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY470971_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY470972_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY470966_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY470965_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY470969_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY470974_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY470976_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY470975_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggacaggg
KY470968_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY470967_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY470970_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY470978_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY470979_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ386650_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
LC279274_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KM875423_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaagactggg
GQ377631_PreS2_P-C      ctgttccgactactgcctcwcccatatcgtcaatcttctcgaggactggg
FJ562279_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU939600_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AY206384_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774284_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ377605_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KY470894_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY470901_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY470902_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ173435_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ173436_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ377530_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ715352_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ715353_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ562261_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ386591_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB670307_PreS2_P-C      ctgttccgactactgtctcacccacatcgtcaatcttctcgaggactggg
AB670269_PreS2_P-C      ctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggg
KY881736_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881737_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881738_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881739_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881742_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881743_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881744_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881748_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881749_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881750_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881751_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881754_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881755_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881758_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881762_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881763_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881764_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881765_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881766_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881767_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881768_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881769_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881770_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881771_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881772_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881773_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881774_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881775_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881776_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881777_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881972_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ377524_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ562337_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB300372_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964185_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964186_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964187_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964188_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964191_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964192_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964194_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964195_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964196_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964197_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964198_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964189_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KU964190_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KU964193_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KU964199_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
JQ040162_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AF461357_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AF461363_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ173291_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ173292_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ173303_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MG893560_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY470905_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY470895_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY470899_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY470903_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JX429904_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
FJ899777_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ715344_PreS2_P-C      ctgttccgactactgcctcacccatatcgccaatcttctcgaggactggg
FJ715343_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ562248_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ386609_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AY582136_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB670282_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB300359_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ173331_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ173332_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KT284759_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ377551_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KX276960_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ377584_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JQ040172_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU963897_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ173301_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ173302_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ173289_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU963886_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU963887_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU963888_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU963889_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU963890_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU963891_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU963892_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU963893_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU963894_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU963895_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU963896_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU963898_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU963899_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ173337_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ377583_PreS2_P-C      ctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggg
KJ173437_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ173438_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY470904_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY470900_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY470897_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaaccttctcgaggactggg
KY470896_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU963878_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU963880_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU963877_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU963876_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU963879_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU963881_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU963884_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU963872_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU963873_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU963871_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU963874_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU963875_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU963882_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU963885_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ173287_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774357_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774293_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JX504546_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ377578_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ715342_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774361_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ562324_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ386619_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU939618_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB198077_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB300365_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ562283_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774248_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ173310_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU093900_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ787470_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgatgactggg
FJ787471_PreS2_P-C      ccgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KX276831_PreS2_P-C      ctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggg
AB367392_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB014372_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB367434_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
AB014380_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KC792656_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KC792700_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
D28880_PreS2_P-C        ctgttccgactactgcctcacccatatcgtcaatctcctcgaggactggg
S75184_PreS2_P-C        ctgttccgactactgcctcacccatatcgtcaatctcctcgaggactggg
KC774205_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KC774217_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
FJ562241_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaaccttcttgaggactggg
KC774219_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KC774352_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
AB367416_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaaccttctcgaggattggg
AB367803_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaaccttctcgaggattggg
FJ386647_PreS2_P-C      ctgttccgactactgcctcacccacatcgtcaatcttctcgaggattggg
AB697494_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaaccttctcgaggattggg
AB367395_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaaccttctcgaggattggg
AB367396_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaaccttctcgaggattggg
AB033553_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB033551_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaaccttctcgaggactggg
AB033552_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaaccttctcgaggactggg
AB033556_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaaccttctcgaggactggg
AB367424_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaaccttctcgaggattggg
KF485389_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaaccttctcgaggattggg
AB176642_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB014378_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JX125372_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
D23682_PreS2_P-C        ctgttccgactattgcctcacccatatcgtcaatcttctcgaggactggg
D23683_PreS2_P-C        ctgttccgactattgcctcacccatatcgtcaatcttctcgaggactggg
AB367402_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JF828923_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JF828931_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JF828929_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JF828924_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JF828926_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JF828930_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JF828925_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JF828921_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JF828922_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JF828928_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
AB670246_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB670248_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ475355_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB367435_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB111114_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JN604133_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB670238_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JF828916_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JF828919_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KF214655_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaagactggg
AY641563_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AY641559_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB670260_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB367427_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JF828918_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JF828920_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JF828917_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JF828913_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JF828915_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB367411_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JF828937_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB670275_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB367432_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB367804_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EF137802_PreS2_P-C      ctgtttcgactactgcctcacccatatcgtcaatcttctcgaggactggg
AY247031_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaagactggg
AB697490_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
AB367403_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB195943_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB195944_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY363281_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB670242_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB367410_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggattggg
AB042285_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AY641562_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB195947_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB195948_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB670272_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB106895_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB111123_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB111121_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB111122_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KF779242_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JN604254_PreS2_P-C      ctgttccgactactgccttacccatatcgtcaatcttctcgaggactggg
FJ562319_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
DQ536412_PreS2_P-C      ctgttcggactactgcctcacccatatcgtcaatcttctcgaggactggg
AB670291_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB367394_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY363278_PreS2_P-C      ctgttccgactactgcctcacacatatcgtcaatcttctcgaggactggg
KY363279_PreS2_P-C      ctgttccgactactgcctcacacatatcgtcaatcttctcgaggactggg
AB367422_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JX125374_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JX125375_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY363280_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ562230_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY363264_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ475350_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB365451_PreS2_P-C      ctgttccgactactgccttacccatatcgtcaatcttctcgaggactggg
GQ872211_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EF137803_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
D50520_PreS2_P-C        ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
D10055_PreS2_P-C        ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB900115_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB670301_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB670290_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB471851_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB471852_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB471853_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB367398_PreS2_P-C      ctgttccgattactgcctcacccatatcgtcaatcttctcgaggactggg
AB195945_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB042282_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB042283_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB014394_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
LC279253_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB182589_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
DQ536410_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY363275_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY363274_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JN604215_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
GQ475323_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ377541_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
D50519_PreS2_P-C        ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AY641560_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB670310_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB670278_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB670267_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB670266_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB670262_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB195942_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB113879_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB014374_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ475338_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB670263_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB642095_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
DQ683578_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB670306_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JX125366_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JN315779_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ475357_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ475342_PreS2_P-C      ctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggg
GQ475317_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB670285_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB670305_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB670265_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB670300_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ475325_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JX125370_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ475354_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ475347_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ475344_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ475332_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ475322_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaaccttctcgaggactggg
GQ475316_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ475327_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ475334_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
D50517_PreS2_P-C        ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
D50518_PreS2_P-C        ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB670292_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB670288_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB670252_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB222714_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB222715_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB026815_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB014376_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB485808_PreS2_P-C      ctgttccgactactgcctcacccatctcgtcaatcttctcgaggactggg
AF286594_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JN604281_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ475313_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ475315_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JQ341662_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ475312_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB697500_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB670256_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB640730_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ475311_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ475320_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JX125371_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JX125373_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB670243_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JN604246_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ475337_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
D12980_PreS2_P-C        ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB670247_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB670283_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
LC279251_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ475324_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ872210_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ475319_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB014377_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JN604131_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ475339_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB300362_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ475305_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ475329_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ475346_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AY206388_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KX276959_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JX661497_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB014369_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC792746_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AY206386_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KC792817_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881810_PreS2_P-C      ctgttccgactactgcctcacccatatagtcaatcttctcgaggactggg
KY881818_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881807_PreS2_P-C      ctgttccgactactgcctcacccatatagtcaatcttctcgaggactggg
KY881814_PreS2_P-C      ctgttccgactactgcctcacccatatagtcaatcttctcgaggactggg
KY881811_PreS2_P-C      ctgttccgactactgcctcacccatatagtcaatcttctcgaggactggg
KY881803_PreS2_P-C      ctgttccgactactgcctcacccatatagtcaatcttctcgaggactggg
KY881806_PreS2_P-C      ctgttccgactactgcctcacccatatagtcaatcttctcgaggactggg
FJ386673_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcartcttctcgaggactggg
KJ173319_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KJ173321_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KR013975_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KR013969_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KR013800_PreS2_P-C      ctgttccgactactgcctctcccatatcctcaatcttctcgaggactggg
KR013799_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KR013801_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KR013974_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KC792853_PreS2_P-C      ctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggg
KR013827_PreS2_P-C      ctgttcagactactgcctctcccatatcgtcaatcttctcgaggactggg
JF436920_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KY881805_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964341_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB014379_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AY220699_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
FJ562340_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU939545_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AY220700_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ386653_PreS2_P-C      ctgttccgactactgtctcacccatatcgtcaaccttctcgaggactggg
EU919169_PreS2_P-C      ctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggg
AB014371_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU919168_PreS2_P-C      ctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggg
JX504534_PreS2_P-C      ctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggg
FJ032345_PreS2_P-C      ctgttccgactactgcctcacccatatcgccaatcttctcgaggactggg
EU554541_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU554542_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU963915_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KU963916_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KU963917_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KU963918_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KU963919_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KU963921_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KU963922_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KU963923_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KU963924_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KU963925_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KU963926_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KU963927_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KU963928_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KU963929_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KU963920_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
EU522068_PreS2_P-C      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggactggg
AF411412_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AY167090_PreS2_P-C      ctgttccgactattgtctcacccatatcgtcaatcttctcgaggactggg
KR013809_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KR013810_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KR013815_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KR013811_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KR013812_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KR013814_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KR013813_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774301_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JX429903_PreS2_P-C      ctgttccgactactgccttacccatatcgtcaatcttctcgaggactggg
EU439016_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU939655_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU939656_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB205123_PreS2_P-C      ctgttccgactactgccccacccatatcgtcaatcttctcgaggactggg
KR013859_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KR013862_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KR013860_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KR013861_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KR014048_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ377636_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JQ040154_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881815_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ562335_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
FJ562251_PreS2_P-C      ctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggg
FJ562235_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AY206392_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
AB670249_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KR014092_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ562266_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatctcctcgaggactggg
AB198083_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964355_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964353_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964350_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964354_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964359_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964365_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964352_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964357_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964360_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964361_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964356_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964362_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU939556_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU872002_PreS2_P-C      ctgttccgactactgtctcacccatatcgtcaatctcctcgaggactggg
EU872000_PreS2_P-C      ctgttccgactactgtctcacccatatcgtcaatctcctcgaggactggg
EU872001_PreS2_P-C      ctgttccgactactgtctcacccatatcgtcaatctcctcgaggactggg
EU872003_PreS2_P-C      ctgttccgactactgtctcacccatatcgtcaatctcctcgaggactggg
EU872004_PreS2_P-C      ctgttccgactactgtctcacccatatcgtcaatctcctcgaggactggg
FJ562272_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JQ040131_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ173281_PreS2_P-C      ctgttccgacyactgcctcacccatatcgtcaatcttctcgaggactggg
KJ173282_PreS2_P-C      ctgttccgaccactgcctcacccatatcgtcaatcttctcgaggactggg
KY881816_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881809_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964364_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774224_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ377642_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ386651_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ386632_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
FJ386595_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
EU554536_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB299858_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB426467_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB288026_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881817_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881804_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ598703_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
D23680_PreS2_P-C        ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC792706_PreS2_P-C      ctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggg
JX504539_PreS2_P-C      ctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggg
GQ377552_PreS2_P-C      ctgttccgactactgcctcwcccatatcgtcaatcttctcgaggactggg
EU939605_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU939613_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ787462_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881813_PreS2_P-C      ctgttccgactaccgcctcacccatatcgtcaatcttctcgaggactggg
KY881812_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881802_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ173305_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC793026_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774218_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774210_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JX429915_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
JQ341648_PreS2_P-C      ctgttccgactactgcctcacccatatcatcaatcttctcgaggactggg
FJ715389_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ562313_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ562308_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ032361_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU939570_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU939555_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU439015_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AF363961_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
AB198080_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU939642_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KC774231_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774199_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ562281_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JX504536_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ386659_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
LC279275_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
LC318702_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU939595_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ173295_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ173311_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ173312_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
LC318703_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KT284755_PreS2_P-C      ctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggg
KJ598693_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ173396_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcgatcttcttgaggactggg
KJ173318_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ173288_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JX661493_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JX429918_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JX026884_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ377597_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ715355_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttcttgaggactggg
FJ562327_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ562242_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ386618_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ032360_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU554535_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB050018_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ715357_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttcttgaggactggg
EU939562_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KC774320_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774318_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774226_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JX504545_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
HM750140_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ386574_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
FJ032359_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AY596108_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774315_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ386644_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JQ040163_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774237_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC792803_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC792941_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ173391_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ173392_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ173395_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttcttgaggactggg
KC774310_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ377580_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ715376_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ715375_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ715374_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774295_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774326_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ598690_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ598688_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ598691_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ598695_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ598696_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ598697_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ598701_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ598694_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ173317_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ173306_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ598689_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ598698_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ598699_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ598702_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
LC373511_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
LC373512_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU939542_PreS2_P-C      ctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggg
FJ899767_PreS2_P-C      ctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggg
FJ562299_PreS2_P-C      ctgctcccactactgccacagccatatcggcaatcttctcgaggactggg
FJ386617_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU939657_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
X52939_PreS2_P-C        ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ386589_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB670298_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB113878_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB195930_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB195931_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB195932_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB670264_PreS2_P-C      ctgttccgactattgcctcacccatatcgtcaatcttctcgaggactggg
AB670274_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KR013868_PreS2_P-C      ctgttccgaccactgcctcacccatatcgtcaatcttctcgaggactggg
FJ386620_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ386625_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttcgcgaggactggg
FJ562307_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ386689_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU939552_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964219_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964214_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
HM750139_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KU964227_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgagaactggg
KU964220_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964215_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964223_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964226_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964217_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964218_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964224_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964225_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964228_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964216_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964222_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774260_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774267_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatctactcgaggactggg
MH818373_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JQ040161_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ562301_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ386613_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KT284758_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcactcttctcgaggattggg
KT284757_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU939612_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
FJ386672_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ377554_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
GQ377570_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
GQ377618_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttcgcgaggactggg
GQ377562_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ715422_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttcgcgaggactggg
EU562218_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ715395_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ715397_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ715392_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttcgcgaggactggg
FJ715424_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttcgcgaggactggg
FJ562225_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ032331_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ377545_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU939593_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB198076_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ377585_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774329_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ899783_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU939651_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
EU939539_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
FJ787466_PreS2_P-C      ctgttccgactactgccttacccacatcgtcaatcttctcgaggactggg
FJ787464_PreS2_P-C      ctgttccgactactgccttacccacatcgtcaatcttctcgaggactggg
FJ787465_PreS2_P-C      ctgttccgactactgccttacccacatcgtcaatcttctcgaggactggg
FJ787467_PreS2_P-C      ctgttccgactactgccttacccacatcgtcaatcttctcgaggactggg
JX036326_PreS2_P-C      ctgttccgactactgccttacccacatcgtcaatcttctcgaggactggg
JX036327_PreS2_P-C      ctgttccgactactgccttacccacatcgtcaatcttctcgaggactggg
KC774191_PreS2_P-C      ctgttccgactactgccttacccacatcgtcaatcttctcgaggactggg
KC774213_PreS2_P-C      ctgttccgactactgccttacccacatcgtcaatcttctcgaggactggg
KC774214_PreS2_P-C      gggttccgactactgccttacccacatcgtcaatcttctcgaggactggg
KC774335_PreS2_P-C      ctgttccgactactgccttacccacatcgtcaatcttctcgaggactggg
KC774254_PreS2_P-C      ctgttccgactactgccttacccacatcgtcaatcttctcgaggactggg
KC774189_PreS2_P-C      ctgttccgactactgccttacccacatcgtcaatcttctcgaggactggg
KC774277_PreS2_P-C      ctgttccgactactgtcttacccacatcgtcaatcttctcgaggactggg
KC774211_PreS2_P-C      ctgttccgactactgccttacccacatcgtcaatcttctcgaggactggg
HM750136_PreS2_P-C      ctgttccgactactgccttacccacatcgtcaatcttctcgaggactggg
KC774256_PreS2_P-C      ctgttccgactactgccttacccacatcgtcaatcttctcgaggactggg
EF536066_PreS2_P-C      ctgttccgactactgcctctcccatatcgccaatcttctcgaggactggg
EU547562_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
DQ089797_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaaacttctcgaggactggg
GQ377620_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB697510_PreS2_P-C      ctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggg
EU306724_PreS2_P-C      ctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggg
DQ377165_PreS2_P-C      ctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggg
EU439005_PreS2_P-C      ctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggg
EU306729_PreS2_P-C      ctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggg
DQ377164_PreS2_P-C      ctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggg
DQ377160_PreS2_P-C      ctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggg
EU306726_PreS2_P-C      ctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggg
EU306728_PreS2_P-C      ctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggg
EU306722_PreS2_P-C      ctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggg
EU306721_PreS2_P-C      ctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggg
DQ377161_PreS2_P-C      ctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggg
DQ377162_PreS2_P-C      ctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggg
EU306713_PreS2_P-C      ctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggg
EU306725_PreS2_P-C      ctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggg
EU306720_PreS2_P-C      ctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggg
EU306719_PreS2_P-C      ctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggg
EU306714_PreS2_P-C      ctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggg
DQ377163_PreS2_P-C      ctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggg
EU306727_PreS2_P-C      ctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggg
EU939607_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC792716_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU939594_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774269_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY470880_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY470879_PreS2_P-C      ctggtccgactactgcctcacccctatcgtcaatcttctcgaggactggg
KY470875_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcatctcgaggactggg
KY470892_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY470885_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcctctcgaggactggg
KY470873_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY470886_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcagtcttctcgaggactggg
KY470888_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcagtcttctcgaggactggg
KY470891_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY470882_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY470890_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY470887_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY470874_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY470877_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY470889_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY470876_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY470878_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY470881_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY470884_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY470883_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ787468_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ787469_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ173313_PreS2_P-C      ctgttccgactactgcctcacacatatcatcaatcttctcgaggattggg
KJ173314_PreS2_P-C      ctgttccgactactgcctcacacatatcatcaatcttctcgaggattggg
KC774278_PreS2_P-C      ctgttccgactactgcctcgcccacatcgtcaatcttctcgaggactggg
KC774345_PreS2_P-C      ctgttccgactactgcctcgcccacatcgtcaatcttctcgaggactggg
KC774200_PreS2_P-C      ctgttccgactactgcctcgcccacatcgtcaatcttctcgaggactggg
HM750141_PreS2_P-C      ctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggg
KC774196_PreS2_P-C      ctgttccgactactgcctcactcacatcgtcaatcttctcgaggactggg
KC774336_PreS2_P-C      ctgttccgactactgcctcactcacatcgtcaatcttctcgaggactggg
KC774187_PreS2_P-C      ctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggg
KC774348_PreS2_P-C      ctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggg
KC774342_PreS2_P-C      ctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggg
KC774337_PreS2_P-C      ctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggg
GQ377533_PreS2_P-C      ctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggg
KC774261_PreS2_P-C      ctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggg
KC774262_PreS2_P-C      ctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggg
KC774287_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
GQ227692_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ227697_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ715372_PreS2_P-C      ctgttccgactactgcctctcccataccgtcaatcttctcgaggactggg
FJ715371_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ715398_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ715400_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774355_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ259588_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ227693_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ227694_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ227695_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ227696_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU916223_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU916224_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JX560520_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ562306_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU916219_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB367423_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774319_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KC774242_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
FJ386602_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JX504542_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EF536065_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
EU939550_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ899765_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ899761_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ899764_PreS2_P-C      ctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggg
FJ899789_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU939647_PreS2_P-C      ctgttccgactactgccttacccatatcgtcaatcttctcgaggattggg
EU939536_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JQ040144_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU939597_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ562221_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ377518_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JQ040155_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964043_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KU964042_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KU964034_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KU964035_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KU964036_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KU964037_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KU964038_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KU964040_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KU964041_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KU964044_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KU964045_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KU964046_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KU964047_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KU964048_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KU964039_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
FJ562264_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ562243_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ715366_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ715365_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ715364_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ715367_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774354_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU916222_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgagggctggg
KC774209_PreS2_P-C      ctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggg
FJ899788_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU939615_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ386678_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC792771_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC792658_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774206_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
AB195949_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JX125365_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774190_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ899763_PreS2_P-C      ctgttccgactactgcctcacccatatcatcaatcttctcgaggactggg
FJ899775_PreS2_P-C      ctgttccgactactgcctcacccatatcatcaatcttctcgaggactggg
EU939540_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KP027477_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KT284756_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JQ040165_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ377517_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ386576_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU939538_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU939616_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ562318_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
HM011481_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttcttgaggactggg
KX276839_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttcttgaggactggg
FJ032355_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
FJ032356_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KU964358_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964349_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964363_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964184_PreS2_P-C      ctgttccgactactgcctcacccatattgtcaatcttctcgaggactggg
KU964182_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964174_PreS2_P-C      ctgttccgactactgcctcacccatattgtcaatcttctcgaggactggg
KU964176_PreS2_P-C      ctgttccgactactgcctcacccatattgtcaatcttctcgaggactggg
KU964178_PreS2_P-C      ctgttccgactactgcctcacccatattgtcaatcttctcgaggactggg
KU964181_PreS2_P-C      ctgttccgactactgcctcacccatattgtcaatcttctcgaggactggg
KU964183_PreS2_P-C      ctgttccgactactgcctcacccatattgtcaatcttctcgaggactggg
KU964179_PreS2_P-C      ctgttccgactactgcctcacccatattgtcaatcttctcgaggactggg
HQ700517_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KC793107_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC793103_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU939644_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774353_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
AF182802_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC793074_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JQ341634_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
GQ377608_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaagcttctcgaggactggg
EU939596_PreS2_P-C      ctgttccgactattgcctcacccatatcgtcaatcttctcgaggactggg
KC793040_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB014367_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY363252_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KY363253_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KR014008_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU939571_PreS2_P-C      ctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggg
KR014016_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KR014017_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KR014010_PreS2_P-C      ctgttccgactattgcctcacccatatcgtcaatcttctcgaggactggg
KR014011_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KR014018_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatctcctcgaggactggg
KR014012_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KR014015_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ475351_PreS2_P-C      ctgttccgactactgccttacccatatcgtcaatcttctcgaggactggg
AB670279_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY363284_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JN604258_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB300361_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ475328_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB298720_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB298721_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ032351_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggattggg
FJ386605_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KY881973_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY882003_PreS2_P-C      ctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggg
KY881979_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881884_PreS2_P-C      ctgttccgactattgcctcacccatatcgtcaatcttctcgaggactggg
KY881960_PreS2_P-C      ctgttccgactattgcctcacccatatcgtcaatcttctcgaggactggg
KY881883_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttatcgaggactggg
KR013874_PreS2_P-C      ctgttccgactactgccttacccatatcgtcaatcttctcgaggactggg
KR013872_PreS2_P-C      ctgttccgactactgccttacccatatcgtcaatcttctcgaggactggg
KR013876_PreS2_P-C      ctgttccgactactgccttacccatatcgtcaatcttctcgaggactggg
KR013877_PreS2_P-C      ctgttccgactactgccttacccatatcgtcaatcttctcgaggactggg
KY881978_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881892_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881885_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY882002_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881876_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881872_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881888_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881874_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881886_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttatcgaggactggg
KY881878_PreS2_P-C      ctgtcccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881997_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881882_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881889_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881991_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881890_PreS2_P-C      ctgttccgactactgcctcacccatattgtcaatcttctcgaggactggg
KY881887_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881881_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881974_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881875_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881989_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881873_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881871_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881870_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881987_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttatcgaggactggg
KY881891_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881877_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881962_PreS2_P-C      ctgttccgactactgcctcacccatgtcgtcaatcttctcgaggactggg
KY881990_PreS2_P-C      ctgttccgactactgcctcacccatgtcgtcaatcttctcgaggactggg
KY881879_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881966_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881971_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881994_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881981_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881880_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881993_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY882001_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881961_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881988_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881980_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU570072_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KR013769_PreS2_P-C      ctgttccgactaccgcctcacccatatcgtcaatcttctcgaggactggg
KR013767_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KR013765_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaagactggg
KR013764_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KR013766_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KR013761_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KR013762_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KR013768_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KR013763_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774340_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttatcgaggactggg
JX429913_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaagactggg
EU560438_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU560439_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
DQ478899_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KR013796_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KR013795_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KR013794_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KR013792_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KR013793_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
EU093906_PreS2_P-C      ctgttccgactattgcctcacccatatcgtcaatcttctcgaggactggg
AY057947_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ475356_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
FJ562255_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU939592_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774356_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
GU357845_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC793187_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ377593_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU093903_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JX026888_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ386603_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ377538_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU717212_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU306673_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU306674_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU306675_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JQ040166_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
HM011465_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ377623_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774279_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ562280_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774232_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MG893557_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KR013781_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774274_PreS2_P-C      ctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggg
KC774252_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JX661491_PreS2_P-C      ctgttccgactattgcctcacccatatcgtcaatcttctcgaggactggg
JX026880_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
EU916237_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU570067_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KR013780_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JX429905_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU939578_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KR013961_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KR013797_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KR013798_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KR013786_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KR013785_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774223_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774182_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774180_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JX026878_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ377531_PreS2_P-C      ctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggg
EU554537_PreS2_P-C      ctgttccgactactgccttacccatatcgtcaatcttctcgaggactggg
EU916238_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KT284753_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KR013783_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KR013782_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KR013779_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KR013784_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KM213037_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC793039_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774313_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU570068_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MH094411_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY022423_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774334_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774275_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
HM011489_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ377603_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU554538_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU554539_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU939541_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774257_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774259_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ377523_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ787452_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU717215_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KR013869_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KR013865_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ386661_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KR013863_PreS2_P-C      ctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggg
FJ562292_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KR013866_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KX276981_PreS2_P-C      ctgttccgactattgtctcacccatatcgtcaatcttctcgaggactggg
KR013867_PreS2_P-C      ctgttccgactactgcctcatccatatcgtcaatcttctcgaggactggg
EU939584_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttcttgaggactggg
KX276986_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KX276994_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KR013864_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ377571_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttatcgaggactggg
EU086839_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU086837_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU086838_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC793019_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
GQ377615_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
JX661496_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ173432_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ173431_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ377599_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AF384371_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU560441_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ787486_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ899776_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AF384372_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU871971_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AF182803_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AF182804_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU871974_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU871973_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU871970_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU871969_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU871972_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaagactggg
KF053170_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcagtcttctcgaggactggg
KJ803762_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcagtcttctcgaggactggg
HM011479_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KX276837_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
EU939564_PreS2_P-C      ctgttccgactcctgcctcgcccatatcgtcaatcttctcgaggactggg
AY596107_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ598679_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ598686_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ787439_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ787479_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ787441_PreS2_P-C      ctgttccgactactgcctcacccataccgtcaatcttctcgaggactggg
FJ899770_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU939563_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ899771_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ899769_PreS2_P-C      ctgttccgacaactgcctcacccatatcgtcaatcttctcgaggactggg
KX276968_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU916233_PreS2_P-C      ctgttccgaccactgcctcacccatatcgtcaatcttctcgaggactggg
EU916234_PreS2_P-C      ctgttccgaccgctgcctcacccatatcgtcaatcttctcgaggactggg
KR013772_PreS2_P-C      ctgttccgaccactgcctcacccatatcgtcaatcttctcgaggactggg
KR013909_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KR013908_PreS2_P-C      ctgttccgaccactgcctcacccatatcgtcaatcttctcgaggactggg
KR013776_PreS2_P-C      ctgttccgaccactgcctcacccatatcgtcaatcttctcgaggactggg
KR013773_PreS2_P-C      ctgttccgaccactgcctcacccatatcgtcaatcttctcgaggactggg
KR013771_PreS2_P-C      ctgttccgaccactgcctcacccatatcgtcaatcttctcgaggactggg
KR013774_PreS2_P-C      ctgttccgaccactgcctcacccatatcgtcaatcttctcgaggactggg
GQ377526_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ386597_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ562273_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ562265_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ598687_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ598715_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ598714_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ598719_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ598710_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ598718_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ598707_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ598717_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ598712_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ598705_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ598706_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ598708_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ598711_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ598713_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ598709_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881819_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KJ598716_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU093915_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ598681_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU939604_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU093881_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU093882_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU093908_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ598680_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttcttgaggactggg
EU093917_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU093911_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU093910_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU093883_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU075340_PreS2_P-C      ctgttccgattactgcctcacccatatcgtcaatcttctcgaggactggg
EU075339_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
EU075338_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
EU075337_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU093907_PreS2_P-C      ccgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU093909_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU093916_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU093914_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU093913_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU093912_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU075336_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU075335_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
EU075334_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU075342_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU093918_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774327_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC792740_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KY881976_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881968_PreS2_P-C      ctgttccggctactgcctcacccatatcgtcaatcttctcgaggactggg
KY881915_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881998_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881964_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881999_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881970_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881965_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881996_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881995_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881992_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881983_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881925_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881916_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881917_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881919_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881921_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881923_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881924_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881926_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881927_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881928_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881929_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881930_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881931_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881932_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881933_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881934_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881935_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881936_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881938_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881963_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881969_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881977_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881982_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881986_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY882000_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881975_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881959_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881918_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881920_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881922_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881937_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881939_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881941_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881942_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881943_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881967_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881985_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881940_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774358_PreS2_P-C      ctgttccgaccactgcctcacccatatcgtcaatcttctcgaggactggg
AB014391_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB014385_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC792680_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964014_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964012_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964011_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964017_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964018_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964016_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964013_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964019_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964015_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC875261_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
FJ386612_PreS2_P-C      ctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggg
KC793024_PreS2_P-C      ctgttccgactactgcctcwcccatatcgtcaatcttctcgaggactggg
KC792902_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JQ040145_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcsaggactggg
GQ377628_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttcwcgaggactggg
FJ032334_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
DQ089796_PreS2_P-C      ctgttccgactactgcctcgcccatatcgtcaatcttctcgaggactggg
AB014389_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KR013844_PreS2_P-C      ctgttccgaccactgcctcacccatatcgtcaatcttctcgaggactggg
KR013842_PreS2_P-C      ctgttccgaccactgcctcacccatatcgtcaatcttctcgaggactggg
KR013845_PreS2_P-C      ctgttccgaccactgcctcacccatatcgtcaatcttctcgaggactggg
KR013848_PreS2_P-C      ctgttccgaccactgcctcacccatatcgtcaatcttctcgaggactggg
KR013847_PreS2_P-C      ctgttccgaccactgcctcacccatatcgtcaatcttctcgaggactggg
KR013849_PreS2_P-C      ctgttccgaccactgcctcacccatatcgtcaatcttctcgaggactggg
FJ562276_PreS2_P-C      ctgttccgactactgcctcwcccayatcgtcaatcttctcgaggactggg
AB014384_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ032340_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ032341_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ787453_PreS2_P-C      ctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggg
FJ787454_PreS2_P-C      ctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggg
MG826143_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgagaactggg
AY206389_PreS2_P-C      ctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggg
AB367417_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
DQ975274_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB014393_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB014382_PreS2_P-C      ctgttccgactactgcctcacccatattgtcaatcttctcgaggactggg
DQ089795_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaagcttctcgaggactggg
FJ787448_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ032350_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB111120_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB014392_PreS2_P-C      ctgttccgactactgcctcgcccatatcgtcaatcttctcgaggactggg
AB014364_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC875263_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KC793202_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JQ341643_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU939568_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
EU570073_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU570074_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KR013791_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC793097_PreS2_P-C      ctgttccgactactgcctcacccatatcgttaatcttctcgaggactggg
EU579443_PreS2_P-C      ctgttccgactattgcctcacccatatcgtcaatcttctcgaggactggg
AF458665_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
EU560440_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
EU579442_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
AB670302_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964169_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KU964177_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964170_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964173_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964175_PreS2_P-C      ctgttccgactattgcctcacccatatcgtcaatcttctcgaggactggg
KU964171_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964172_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
DQ141658_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttcttgaggactggg
DQ141659_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttcttgaggactggg
KC793142_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ787447_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU881996_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB900099_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB014383_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KR014049_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KF053175_PreS2_P-C      ctgttccgactattgcctcacccatatcgtcaatcttctcgaggactggg
KJ803769_PreS2_P-C      ctgttccgactattgcctcacccatatcgtcaatcttctcgaggactggg
KC875262_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KC774281_PreS2_P-C      ctgttccgattactgcctcacccatatcgtcaatcttctcgaggactggg
JQ040152_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ715404_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU939567_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU919164_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU589336_PreS2_P-C      ctgttccgactattgcctcacccatatcgtcaatcttctcgaggactggg
AB367397_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB111118_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KX276838_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttcacgaggactggg
KR013846_PreS2_P-C      ctgttccgaccactgcctcacccatatcgtcaatcttctcgaggactggg
KJ410521_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
EU916204_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JQ040139_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964004_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC793093_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggattggg
JQ341610_PreS2_P-C      ctgttccgactactgcctcacccayatcgtcaatcttctcgaggactggg
AY066028_PreS2_P-C      ctgttccgactactgcctcacccacgtcgtcaatcttctcgaggactggg
AF411408_PreS2_P-C      ctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggg
AF411411_PreS2_P-C      ctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggg
EU796070_PreS2_P-C      ctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggg
EU796072_PreS2_P-C      ctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggg
KR013943_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC792862_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaakcttctcgaggactggg
AB300360_PreS2_P-C      ctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggg
AB014381_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KJ410510_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC792834_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ386630_PreS2_P-C      ctgttccgactactgyctcacccatatcgtcaatcttctcgaggactggg
EU939582_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC793119_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaagactggg
KC793108_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttcttgaggactggg
KC792691_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774197_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ377609_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU939546_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
EU939543_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU796069_PreS2_P-C      ctgttccgactactgcttcacccatatcgtcaatcttctcgaggactggg
DQ478900_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
D00630_PreS2_P-C        ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AY306136_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttcccgaggactggg
AB014362_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ715405_PreS2_P-C      ctgttctgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ715406_PreS2_P-C      ctgttctgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU093895_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU093898_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC793035_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774311_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ386614_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
AB670289_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ386604_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ787437_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MG826124_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KR013875_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KR013858_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaattttctcgaggactggg
FJ386579_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU939658_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU939586_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
DQ089799_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB971714_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB971715_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KR014043_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ032346_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
DQ975272_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
D23684_PreS2_P-C        ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB670277_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB014396_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
EU871980_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU871998_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774289_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ562238_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ386685_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatctcctcgaggactggg
EU939640_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JX504541_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ562325_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU916229_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ598740_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ598749_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ598743_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ598752_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ598746_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ598741_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ598742_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ598744_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ598745_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ598747_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ598748_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ598750_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ598754_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ598751_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ598753_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KR013984_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KJ173316_PreS2_P-C      ctgttccgactactgcctcacccatatcatcaatcttctcgaggattggg
KF779300_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC792923_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC792790_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774271_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JX429917_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JX504544_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JQ040141_PreS2_P-C      ctgttccgaccactgcctcacccatatcgtcaatcttctcgaggactggg
HM011500_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
GQ377546_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ715381_PreS2_P-C      ctgttctgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ715421_PreS2_P-C      ctgttctgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ562269_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ518813_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ386663_PreS2_P-C      ctgttccgamtactgcctcacccatatcgtcaatcttctcgaggactggg
EU939619_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
DQ478885_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AY206382_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AY206381_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB670254_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU871975_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU871977_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KR013804_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774283_PreS2_P-C      ctgttccgactactgccttacccacatcgtcaatcttctcgaggactggg
JN604140_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU075315_PreS2_P-C      ctgttccgactactgcctcacccacatcgtcaagcttctcgaggactggg
DQ986375_PreS2_P-C      ctgttccgactacagcctctcccatatcgtcaatcttctcgaggactggg
KC792799_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC792682_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU939585_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JQ040168_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ386662_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ386596_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ386687_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU872012_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU871976_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC793100_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU939611_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU872008_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KU964201_PreS2_P-C      ctgttccgactactgtctcacccatatcgtcagtcttctcgaggactggg
KU964204_PreS2_P-C      ctgttccgactactgtctcacccatatcgtcagtcttctcgaggactggg
KU964206_PreS2_P-C      ctgttccgactactgtctcacccatatcgtcagtcttctcgaggactggg
KU964207_PreS2_P-C      ctgttccgactactgtctcacccatatcgtcagtcttctcgaggactggg
KU964208_PreS2_P-C      ctgttccgactactgtctcacccatatcgtcagtcttctcgaggactggg
KU964209_PreS2_P-C      ctgttccgactactgtctcacccatatcgtcagtcttctcgaggactggg
KU964210_PreS2_P-C      ctgttccgactactgtctcacccatatcgtcagtcttctcgaggactggg
KU964211_PreS2_P-C      ctgttccgactactgtctcacccatatcgtcagtcttctcgaggactggg
KU964212_PreS2_P-C      ctgttccgactactgtctcacccatatcgtcagtcttctcgaggactggg
KU964213_PreS2_P-C      ctgttccgactactgtctcacccatatcgtcagtcttctcgaggactggg
KU964202_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcagtcttctcgaggactggg
KU964203_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcagtcttctcgaggactggg
KU964205_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcagtcttctcgaggactggg
FJ386628_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ787445_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MG893553_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY470927_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KR013805_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC793050_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC792965_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KC792679_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaagcttctcgaggactggg
JX429916_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
HM750131_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ377624_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ562315_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttcttgaggactggg
FJ562293_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
FJ562285_PreS2_P-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
FJ562284_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ386657_PreS2_P-C      ctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggg
FJ386627_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ386577_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ032332_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU939610_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU939609_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU916210_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU086842_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB246345_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU871978_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB195953_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggattggg
AB195954_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggattggg
KY881984_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KT284754_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU939544_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
LC279276_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU086840_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU086847_PreS2_P-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactgg<