HBVdb

Dataset for nucleotide sequence X of genotype B

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
     *     ** *   *                   **       *            * *         *  *    
ATGGCTG-CTAGGCTGTGCTGCCAACTGGATCCTGCGCGGGACGTCCTTTGTTTACGTCCCGTCGGCGCTGAATCCCGCG
             t   a             a  a              c  c        c  a           t   
                                                                                
                                                                                

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
       *       *                    *                 *     *         *         
GACGACCCCTCCCGGGGCCGCTTGGGGCTCTACCGCCCGCTTCTCCGcCTgttGTACCGACCGACCACGGGGCGCACCTC
           t     t     a     t  t  t     c     t  accc tt ag  at t        t     
           a                 g                    cg       t                    
                                                                                

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *                   *               **          * **                         * 
TCTTTACGCGGACTCCCCGTCTGTGCCTTCTCATCTGCCGGACCGTGTGCACTTCGCTTCACCTCTGCACGTCGCATGGA
           t                 t  gc ca    t                                      
           c                             g                                      
                                         c                                      

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                          *                                          *        * 
gACCACCGTGAACGCCCACcGGAACcTGCCCAAGGTCTTgCATAAGAGGACTCTTGGACTTTCAGCAATGTCAACGACCG
a            a   cta a ctt  a a c      at    a      a       c ttat        ta    
                  ag                                        g                   
                   t                                                            

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *            *      *             *                                           
ACCTTGAGGCATACTTCAAAGACTGTGTGTTTAcTGAGTGGGAGGAGTTGGGGGAGGAGgTtAGGTTAAaGgTC---TTT
                            a   gag  c       tacc         aacg  a    t a t    a 
                                  c                        c c                  
                                                           t                    

       410       420       430       440       450       460       470     
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:
                                              *                            
GTA-cTAGGAGGCTGTAGGCATAAATTGGTgTGTTCACCAGC--ACCATGCAACTTT---TTCACCTCTGCCTAA
    t g                       cc cc     t                               ---
                                  g                                       g
                                                                           
© 1998-2022Legal notice