HBVdb

Dataset for nucleotide sequence X of genotype B

[Download (right click)] [Alignment] [Repertoires]

2553 sequence(s)

>gnl|hbvcds|AB010289_X_P-B Feature FT:CDS AB010289_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Yamagata-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagctgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AB010290_X_P-B Feature FT:CDS AB010290_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Yamagata-2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctataccgcccgcttctccgtctaccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagctgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AB010291_X_P-B Feature FT:CDS AB010291_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Yamagata-3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctataccgcccgcttctccgtctaccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagctgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AB010292_X_P-B Feature FT:CDS AB010292_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Yamagata-4). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctataccgcccgcttctccgtctcccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttacataagaggactcttggactttcagtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagctgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AB031266_X_P-B Feature FT:CDS AB031266_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV VietF-3). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgattggggctctaccgcccgctcctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacctgacaacggtcttacataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB031267_X_P-B Feature FT:CDS AB031267_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV VietF-6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcag
acgacccctcccggggccgcttggggctctaccgcccgctcctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttacataagaggactcttggactttcagcaatgttaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB033554_X_P-B Feature FT:CDS AB033554_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate RTB299). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB033555_X_P-B Feature FT:CDS AB033555_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate PAD744). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctctaccgccctcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB048705_X_P-B Feature FT:CDS AB048705_X_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccgtctcggggccgcttggggatctaccgtccccttctgcgtctaccgttccgaccatcgacggggcgcacctct
ctttacgcggactccccgtctgcgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccacatgatcttgcccaaggtcttgcataagaggactcttggactctcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggctaaaggtctttgtac
taggaggctgtaggcataaattggtctgttctccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB073821_X_P-B Feature FT:CDS AB073821_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi20). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcccgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtatcgaccawccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaktaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB073822_X_P-B Feature FT:CDS AB073822_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi32). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccaaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttttcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB073823_X_P-B Feature FT:CDS AB073823_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi35). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttgttccgaccgaccacggggcgaacctct
ctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccacagaaacctgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaagagttgggggaggaggttaggttaatgrtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB073824_X_P-B Feature FT:CDS AB073824_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagagtaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB073825_X_P-B Feature FT:CDS AB073825_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi51). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgttccgaccatccacggggcgcacctct
ctttacgaggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttgcataacaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB073826_X_P-B Feature FT:CDS AB073826_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi89). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgccttgtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB073827_X_P-B Feature FT:CDS AB073827_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-HK11). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccaaacacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB073828_X_P-B Feature FT:CDS AB073828_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-HK37). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccgggrccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB073829_X_P-B Feature FT:CDS AB073829_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-HK38). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB073830_X_P-B Feature FT:CDS AB073830_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-TH57). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
cttcacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccactggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcgacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB073831_X_P-B Feature FT:CDS AB073831_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-TH61). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtataccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgctcaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB073832_X_P-B Feature FT:CDS AB073832_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Th65). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggagtaccgaccaaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttttcatctgccggaccgtgtgcacttcgattcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccmtgcaactttttcacctctgcctaa
>gnl|hbvcds|AB073833_X_P-B Feature FT:CDS AB073833_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi59). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctga
>gnl|hbvcds|AB073834_X_P-B Feature FT:CDS AB073834_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Vi16). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB073835_X_P-B Feature FT:CDS AB073835_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Vi29). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgctcctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttacataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttacggagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB073836_X_P-B Feature FT:CDS AB073836_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Tw25). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttacataaaaggactcttggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttacggagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgcgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB073837_X_P-B Feature FT:CDS AB073837_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ku1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB073838_X_P-B Feature FT:CDS AB073838_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ho7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcgyctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagctgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AB073839_X_P-B Feature FT:CDS AB073839_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Tw174). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctcttccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagagaactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagttgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB073840_X_P-B Feature FT:CDS AB073840_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Tw36). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccaaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB073841_X_P-B Feature FT:CDS AB073841_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Tw30). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccaaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB073842_X_P-B Feature FT:CDS AB073842_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Iw11). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctccaggggccgcttgggcctctaccgcccgcttttccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttacataagaggactcttggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagctgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AB073843_X_P-B Feature FT:CDS AB073843_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Iw27). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgtttggggctctaccgcccgcttctccgcctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacctgcccaaggtcttgyataagaggactcttggacttttagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagctgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AB073844_X_P-B Feature FT:CDS AB073844_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-T11). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctctaccgcccgctactccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagctgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AB073845_X_P-B Feature FT:CDS AB073845_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ya16). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaattggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctccaggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgcccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagctgggggaggagatgaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AB073846_X_P-B Feature FT:CDS AB073846_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry565). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcag
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctctacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagctgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AB073847_X_P-B Feature FT:CDS AB073847_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Fu53). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagctgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AB073848_X_P-B Feature FT:CDS AB073848_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-HUS). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgtccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggacttgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagctgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AB073849_X_P-B Feature FT:CDS AB073849_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Na101). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggacttttagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagctgggggaggagactaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaacaccaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AB073850_X_P-B Feature FT:CDS AB073850_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Na102). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacctgcccaaggtcttgcatcagaggactcttggacttttagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagctgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccacgcaactttttcacctctgcctag
>gnl|hbvcds|AB073851_X_P-B Feature FT:CDS AB073851_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgccg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagctgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AB073852_X_P-B Feature FT:CDS AB073852_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry11). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagatgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AB073853_X_P-B Feature FT:CDS AB073853_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry24). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgatgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgacgacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcacctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactgtcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgtccaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AB073854_X_P-B Feature FT:CDS AB073854_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry30). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatactgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagctgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AB073855_X_P-B Feature FT:CDS AB073855_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry34). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatactgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccttctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcgtcaaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttatataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagctgggggaggagaataggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagctccatgcaactttttcacctctgcctag
>gnl|hbvcds|AB073856_X_P-B Feature FT:CDS AB073856_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry46). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctgtaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagctgggggaggagaggaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AB073857_X_P-B Feature FT:CDS AB073857_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry48). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgcaaactggatactgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagctgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AB073858_X_P-B Feature FT:CDS AB073858_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Shin). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttgtataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgaatgggaggagctgggggaggagattaggttaaagatttatgtat
taggaggctgtaggcataaattggtctgttcaccaacaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AB100695_X_P-B Feature FT:CDS AB100695_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-VH133). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgctcctccgtctgccgtatcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatgtgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggatcctgtccaaggacttacgtactatgactcttgaactttcaggactgtcgacgtccga
ccttgaggcatacttcaaagaccgtgtgtttactgagtgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtacgcatacattgctcttttcaccatcaccatgcaactttttgaattctgcctaa
>gnl|hbvcds|AB104890_X_P-B Feature FT:CDS AB104890_X_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcacctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgaccaccggaacctgtccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagctgggggaggagatgaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgtccaccagtaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AB104891_X_P-B Feature FT:CDS AB104891_X_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcacctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgaccaccggaacctgtccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagctgggggaggagatgaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgtccaccagtaccatgcaactttttcacctcagcctag
>gnl|hbvcds|AB106884_X_P-B Feature FT:CDS AB106884_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctccaggggccgcctggggctataccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttttcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcacatggag
accaccgtgaacgcccaccagaacctgcccaaggtcttgcataagaggactcttggactttcagcagtgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagctgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|AB115551_X_P-B Feature FT:CDS AB115551_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-CB15). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgctcctccgtctgccgtaccgaccgaccacggggcgcaccata
ctttacgcggactccccgtctgtctcttctctgctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttacataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttgaattctgcctag
>gnl|hbvcds|AB117759_X_P-B Feature FT:CDS AB117759_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-CB14). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgctcctccgtctgccgtaccgaccgaccacggggcgcacctct
ctctacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgacaacggtcttacataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB195933_X_P-B Feature FT:CDS AB195933_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaacgagtgggaggagtcgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB195934_X_P-B Feature FT:CDS AB195934_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaacgagtgggaggagtcgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB195935_X_P-B Feature FT:CDS AB195935_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaacgagtgggaggagtcgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB205119_X_P-B Feature FT:CDS AB205119_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-IF687-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgcgccttctcatcttccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB205120_X_P-B Feature FT:CDS AB205120_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-IF687-2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatcttccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB205121_X_P-B Feature FT:CDS AB205121_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-IF720-1). Complete genome. [Hepadnaviridae] (length=468 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacccggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagctgggggaggagattaggttaaaggtcttgtttg
tactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB205122_X_P-B Feature FT:CDS AB205122_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-VH69-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatcctgcgcgggacgtccttcgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgctcctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttacataagaggactcttggactttcagcaatgtcaacggccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB212625_X_P-B Feature FT:CDS AB212625_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate VT1026). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgaccgctcctccgtctaccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttttcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacctgcccaaggtcttacataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AB212626_X_P-B Feature FT:CDS AB212626_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate VT1022). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgctcctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaagatcttacataagaggactcttggactttcagtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AB219426_X_P-B Feature FT:CDS AB219426_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Patient #4014, PNN1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccctcggcgctgaatcctgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgngaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggacttttagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB219427_X_P-B Feature FT:CDS AB219427_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Patient #4075, PNN2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccctcagcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccaaccgaccacggggcgcacctct
ctctacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggacttttagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggcggaggctaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB219428_X_C-B Feature FT:CDS AB219428_X_C-B of [Viruses] Hepatitis B Virus genotype B (isolate Patient #4076, PNN3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctctcggggccgcttggggctttaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB219429_X_P-B Feature FT:CDS AB219429_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Patient #4101, PNN4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccctcggcgctgaatcctgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggacttttggcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB219430_X_P-B Feature FT:CDS AB219430_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Patient #4148, PNN5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttcgcgaggtcgcttgggactctttcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaatgcccatcagagcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaaatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB231909_X_P-B Feature FT:CDS AB231909_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate VH10). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgccgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctgcgg
acgacccctctcggggccgcttggggatctaccgtcctcttcttcgtctgccgtaccgaccgtccacggggcgcacctct
ctttacgcggtctccccgtttgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
gccaccgtgaacgcccacctgatcttgcccaaggtattgcataagcggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB241116_X_P-B Feature FT:CDS AB241116_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate PhHCC03). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccctcggcgctgaatcctgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgtccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggacttttagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagtcgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB241117_X_P-B Feature FT:CDS AB241117_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate PhHCC05). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccctcggcgctgaatcctgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgtccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggacttttagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagtcgggggaggagattaggttaatgatttttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB246339_X_P-B Feature FT:CDS AB246339_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctataccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataaaaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB246340_X_P-B Feature FT:CDS AB246340_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgccaaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
tgggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB246341_X_P-B Feature FT:CDS AB246341_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgtccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcatgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagctgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AB246342_X_P-B Feature FT:CDS AB246342_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtatcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcaccaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggaactgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AB246343_X_P-B Feature FT:CDS AB246343_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgctcctccgcctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcaccaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggaactgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggtataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AB287314_X_P-B Feature FT:CDS AB287314_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alaska433). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttacataagaggactcttggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AB287315_X_P-B Feature FT:CDS AB287315_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alaska419). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttacataagaggactcttggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AB287316_X_P-B Feature FT:CDS AB287316_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alaska427). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggagcctgcccaaggtcttacataagaggactcttggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AB287317_X_P-B Feature FT:CDS AB287317_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alaska416). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttatataagaggactcttggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttaaggagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AB287318_X_P-B Feature FT:CDS AB287318_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alaska2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttacataagaggactcttggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgcgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AB287319_X_P-B Feature FT:CDS AB287319_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate AlaskaG23). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcatctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttacataagaggactcttggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AB287320_X_P-B Feature FT:CDS AB287320_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Greenland-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgcccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcacctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccgaggtcttacataagaggactcttggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AB287321_X_P-B Feature FT:CDS AB287321_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Greenland-2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccacttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcacctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccgaggtcttacataagaggactcttggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AB287322_X_P-B Feature FT:CDS AB287322_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Greenland-3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccgtctgccgttccgaccgaccacggggcgtacctct
ctttacgcggactccccgtctgtgccttctcacctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggagcttgcccaaggtcttacataagaggactcttggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AB287323_X_P-B Feature FT:CDS AB287323_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Greenland-4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcacctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttacataaaaggactcttggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttactgactgggaggagttgggggaggagactaggttgaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AB287324_X_P-B Feature FT:CDS AB287324_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Greenland-5). Partial genome (Contains: HBc, HBx, MHBs, SHBs). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctccaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcacctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttacataagaggactcttggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggaattgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AB287325_X_P-B Feature FT:CDS AB287325_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Greenland-6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcacctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccgaggtcttacataagaggactcttggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagactaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AB287326_X_P-B Feature FT:CDS AB287326_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate JPN Bj A44). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagctgggggaggagattaggttaaaggtctttgtat
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AB287327_X_P-B Feature FT:CDS AB287327_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate JPN Bj A53). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaggagtgggaggagctgggggaggagattaggttaaagatttatgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AB287328_X_P-B Feature FT:CDS AB287328_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate JPN Ba 51). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctataccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataaaaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB287329_X_P-B Feature FT:CDS AB287329_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate JPN Ba A55). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccacgggaacctgcccaaggtcttacataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB300364_X_P-B Feature FT:CDS AB300364_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB300370_X_P-B Feature FT:CDS AB300370_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient12). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgcccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagctgggggaggagattaggttaaaggtttttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB302095_X_P-B Feature FT:CDS AB302095_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagcagggggaggagatgaggttaaaggtctttgtat
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AB302942_X_P-B Feature FT:CDS AB302942_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GRE3837NN). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctgtaccgcccgcttctccgcctgctgtaccgaccattcacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB302943_X_P-B Feature FT:CDS AB302943_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GRE3639NN). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctgtaccgcccgcttctccgcctgctgtaccgaccatccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB302944_X_P-B Feature FT:CDS AB302944_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GRE3641NN). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctgtaccgcccgcttctccgcctgctgtaccgaccattcacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB302945_X_P-B Feature FT:CDS AB302945_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GRE3643NN). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctataccgcccgcttctccgcctgctgtaccgaccatccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB362933_X_P-B Feature FT:CDS AB362933_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcgcgctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB365445_X_P-B Feature FT:CDS AB365445_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate BOL1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgtcgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccccaggaacctgcccaaggtcttgcataagaggactcttggactttcaacaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttgaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB368295_X_P-B Feature FT:CDS AB368295_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctatcgtccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacctgcccaaggtcttacataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB471854_X_P-B Feature FT:CDS AB471854_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F5M-F). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctatggtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB471855_X_P-B Feature FT:CDS AB471855_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F5M-C). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctatggtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB493827_X_P-B Feature FT:CDS AB493827_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 25UC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
caggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB493833_X_P-B Feature FT:CDS AB493833_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate P9). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttagggctctaccgcccgcttctccgtctgccgtaccgaccatccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB493835_X_P-B Feature FT:CDS AB493835_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate P30). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggcg
accaccgtgaacgcccatcggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB555498_X_P-B Feature FT:CDS AB555498_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-TA41). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatcttccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccaccaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB555499_X_P-B Feature FT:CDS AB555499_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-TA62). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctctggtaccgaccgaccacggggcgcacctct
cttttcgcggactccccgtctgtgccttctcatctgccggaccgtcagcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgccaggtcttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaatgagtgggaggagttggggaaggagtttaggttaatggcctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctga
>gnl|hbvcds|AB642093_X_P-B Feature FT:CDS AB642093_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate BFJT1999-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgyctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactgtcaacaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgctcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AB642094_X_P-B Feature FT:CDS AB642094_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate BFJT1999-2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcgacgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB642101_X_P-B Feature FT:CDS AB642101_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate BFJT2009-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtwccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagctgggggaggagaygaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AB675676_X_P-B Feature FT:CDS AB675676_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 10A37). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtatcgcccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcctcagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB713527_X_P-B Feature FT:CDS AB713527_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YOGHhbv30). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaacgtgtgcacttcgcttcacttctgcacgtcgcaaggag
aacaccgtgaacgcccaccggaacttgccccaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB713528_X_P-B Feature FT:CDS AB713528_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YOGHhbv44). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctccaggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB713529_X_P-B Feature FT:CDS AB713529_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YOGHhbv68). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcgggactcccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcaaggag
accaccgtgaacgcccattggaaactgccccaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB713530_X_P-B Feature FT:CDS AB713530_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YOGHhbv94). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcagggaa
accaccgtgaacgcccatcggaacctgcccaaggtcttgcataggaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaacttctccaccttagcctca
>gnl|hbvcds|AB713531_X_P-B Feature FT:CDS AB713531_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YOGHhbv98). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgcggtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB713532_X_P-B Feature FT:CDS AB713532_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YOGHhbv132). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggtgaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB828708_X_P-B Feature FT:CDS AB828708_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HB12-0626). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgaaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagctgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagtaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AB900095_X_P-B Feature FT:CDS AB900095_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgaatgggaggagctgggggaggagactaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AB900097_X_P-B Feature FT:CDS AB900097_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcgtttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctttaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgaccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagctgggggaggagatgaggttaaagrtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccttgcaactttttcacctctgcctaa
>gnl|hbvcds|AB900098_X_P-B Feature FT:CDS AB900098_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttaggggaggagactaggttaatgatctttgtam
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AB900102_X_P-B Feature FT:CDS AB900102_X_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttrtataagaggactcttggactttcagtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttgctgagtgggaggagctgggggaggagattaggttaawgrtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB900103_X_P-B Feature FT:CDS AB900103_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacctgcccaaggtcttatataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagctgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AB900104_X_P-B Feature FT:CDS AB900104_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggarctgggggaggagactaggttaatgatctttgtgt
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AB900105_X_P-B Feature FT:CDS AB900105_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagctgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AB900106_X_P-B Feature FT:CDS AB900106_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctataccgcccgcttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagctgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AB900107_X_P-B Feature FT:CDS AB900107_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtagcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactgtcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgccactttttcacctctgcctag
>gnl|hbvcds|AB900108_X_P-B Feature FT:CDS AB900108_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgtttggggctctaccgcccgcttctccgcctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggcctccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgaccaccggaacctgcccaaggtcttgcataagaggactcttggacttttagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagctgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AB900110_X_P-B Feature FT:CDS AB900110_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagggtaggttaatgatctttgtac
tgggaggctgtaggcataaattggtgcgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB900111_X_P-B Feature FT:CDS AB900111_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagctgggggaggagattaggttaawgrtctttgtac
taggaggctgtaggcataaattggtctgttcaccagtaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AB900112_X_P-B Feature FT:CDS AB900112_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcayctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcgtggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagctgggggaggagaytaggttaawggtytttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccacgcaactttttcacctctgcctag
>gnl|hbvcds|AB931168_X_P-B Feature FT:CDS AB931168_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1P_HB11-1417). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttagggctctaccgcccgcttctccgcctgccgttccgacctaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaggagtgggaggagatgggggaggagactaggttaatgatttttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AB931169_X_P-B Feature FT:CDS AB931169_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1S_HB11-1418). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttagggctctaccgcccgcttctccgcctgccgttccgacctaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaggagtgggaggagatgggggaggagactaggttaatgatttttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AB976562_X_P-B Feature FT:CDS AB976562_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate AK8). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtatcgacctaccacggggcgaacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcactgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttacggagtgggaggagttgggggaggagattagtgaaaaggttgcatggc
gctggtgcagtaagcatattttgctctgttcaccagaatcctgcaactttttaacctatgcctta
>gnl|hbvcds|AF100308_X_P-B Feature FT:CDS AF100308_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgtccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF100309_X_P-B Feature FT:CDS AF100309_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttggggctctaccgcccgcttctccgcctgttctaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF121243_X_P-B Feature FT:CDS AF121243_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/14611). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctataccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggar
accaccgtgaacgcccccgggaacctgcccaaggtcttgcataagaggactcttggactttcagtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgtccaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF121244_X_P-B Feature FT:CDS AF121244_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/15122). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctataccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggar
accaccgtgaacgcccccgggaacctgcccaaggtcttgcataagaggactcttggactttcagtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgtccaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF121245_X_P-B Feature FT:CDS AF121245_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/16091). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctataccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggar
accaccgtgaacgcccccgggaacctgcccaaggtcttgcataagaggactcttggactttcagtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgtccaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF121246_X_P-B Feature FT:CDS AF121246_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/IK29902). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctgtaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggar
accaccgtgaacgcccccgggaacctgcccaaggtcttgcataagaggactcttggactttcagtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgtccaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF121247_X_P-B Feature FT:CDS AF121247_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/719). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccccaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF121248_X_P-B Feature FT:CDS AF121248_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/139-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagkttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF121249_X_P-B Feature FT:CDS AF121249_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/4014). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF121250_X_P-B Feature FT:CDS AF121250_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/6395). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF121251_X_P-B Feature FT:CDS AF121251_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/9873). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagtttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF282917_X_P-B Feature FT:CDS AF282917_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-B1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttcccggggccgcttggggctctaccgcccgcttctccgcctcttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggccttgcataagaggactcttggactttccgcaacgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtttaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcacccgtaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF282918_X_P-B Feature FT:CDS AF282918_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-B2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagacagtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF461360_X_P-B Feature FT:CDS AF461360_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate FH14-2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgtcgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgaatgggaggagttgggggaggagaataggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF479684_X_P-B Feature FT:CDS AF479684_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 3c). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctataccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
tagggggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AJ627225_X_P-B Feature FT:CDS AJ627225_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 19749). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccggccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagagaactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AP011084_X_P-B Feature FT:CDS AP011084_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgattggggctctaccgcccacttctccgcctggtgtaccaaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AP011085_X_P-B Feature FT:CDS AP011085_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AP011086_X_P-B Feature FT:CDS AP011086_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagctatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AP011087_X_P-B Feature FT:CDS AP011087_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagctgtgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagrttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AP011088_X_P-B Feature FT:CDS AP011088_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttatctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttaggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AP011089_X_P-B Feature FT:CDS AP011089_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccatccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcacctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AP011090_X_P-B Feature FT:CDS AP011090_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AP011091_X_P-B Feature FT:CDS AP011091_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagctgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AP011092_X_P-B Feature FT:CDS AP011092_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacatcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AP011093_X_P-B Feature FT:CDS AP011093_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctatcgcccgcttctccgcctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttgcataagaggactcttggactttcagcactgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttacagaatgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AP011094_X_P-B Feature FT:CDS AP011094_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctatcgcccgcttctccgcctgccataccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttacggagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AP011095_X_P-B Feature FT:CDS AP011095_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctatcgcccgcttctccgcctgccataccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcgcctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacyggaacctgcccaaggtcttgcataaaaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttacggagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AP011096_X_P-B Feature FT:CDS AP011096_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY033072_X_P-B Feature FT:CDS AY033072_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccggccgcttctccgtctcccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttacaggagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttgctgagtgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY033073_X_P-B Feature FT:CDS AY033073_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccggccgcttctccgtctcccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttacaggagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttgctgagtgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY163869_X_P-B Feature FT:CDS AY163869_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate FMClx-1). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggtctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaagagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY163870_X_P-B Feature FT:CDS AY163870_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate FMU001). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggtctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaagagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY167089_X_P-B Feature FT:CDS AY167089_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ia). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY167093_X_P-B Feature FT:CDS AY167093_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate IIa). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggtctctaccgcccgcttctccgcctcttgtaccgaccgtcaacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttgcataaaaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatactttaaagactgtgtgtttactgagtgggaggagttgggggcggagggtaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY167094_X_P-B Feature FT:CDS AY167094_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate IIb). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgacaacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcgtctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
gccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaggagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY167097_X_P-B Feature FT:CDS AY167097_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate IIIb). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY167098_X_P-B Feature FT:CDS AY167098_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate IVa). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagagaactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY167100_X_P-B Feature FT:CDS AY167100_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Va). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagagaactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaagagttgggggaggaggttaagttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY167101_X_P-B Feature FT:CDS AY167101_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Vb). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY167102_X_P-B Feature FT:CDS AY167102_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Vc). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgctactccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccctccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgcgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY206373_X_P-B Feature FT:CDS AY206373_X_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgtgaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtat
taggaggctgtaggcataaattggtgcgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY206375_X_P-B Feature FT:CDS AY206375_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggaattgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY206383_X_P-B Feature FT:CDS AY206383_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcttgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggaattgggggaggaggttaggttaatgatctatgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY206387_X_P-B Feature FT:CDS AY206387_X_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgccttttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcttacttcaaagactgtgtgtttactgagtgggaggaggtggggaatgagggtaggttaatggtttatgtat
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY206390_X_P-B Feature FT:CDS AY206390_X_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcacggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgaccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY206391_X_P-B Feature FT:CDS AY206391_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY217355_X_P-B Feature FT:CDS AY217355_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A6-2). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaaccccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY217356_X_P-B Feature FT:CDS AY217356_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A9-2). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY217357_X_P-B Feature FT:CDS AY217357_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1r-4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggctaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY217358_X_P-B Feature FT:CDS AY217358_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B8r-4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggctaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY217359_X_P-B Feature FT:CDS AY217359_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Q6-5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacaaccga
ccttgagcaatacttcaaagactgtgtgtttactgagtgggaggagctgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY217360_X_P-B Feature FT:CDS AY217360_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 6-4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacaaccga
ccttgagcaatacttcaaagactgtgtgtttactgagtgggaggagctgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY217361_X_P-B Feature FT:CDS AY217361_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 582-2). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttgggctttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagtttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttgaactctgcctaa
>gnl|hbvcds|AY217362_X_P-B Feature FT:CDS AY217362_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 582-4). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgtccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttgacctctgcctaa
>gnl|hbvcds|AY217364_X_P-B Feature FT:CDS AY217364_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 586). Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctccaggggccgcttagggctgtaccgcccgcttctccgcctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactattggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgcgttcaccagcaccatgcaactttttgaactctgcctaa
>gnl|hbvcds|AY217368_X_P-B Feature FT:CDS AY217368_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 21949). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctttaccgcccgcttctccgcctgttctaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY220697_X_P-B Feature FT:CDS AY220697_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccactggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgttcaatgagtgggaggagttgggggaggagtttaagttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY220698_X_P-B Feature FT:CDS AY220698_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY220703_X_P-B Feature FT:CDS AY220703_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttgaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY220704_X_P-B Feature FT:CDS AY220704_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY238972_X_P-B Feature FT:CDS AY238972_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate FMU023). Partial genome (Contains: HBx, LHBs, MHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcacggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY283777_X_P-B Feature FT:CDS AY283777_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate spliced variant D-9). Partial genome (Contains: HBc, HBx). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactgaatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattgatgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY293309_X_P-B Feature FT:CDS AY293309_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgtccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY310322_X_P-B Feature FT:CDS AY310322_X_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttttcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY518556_X_P-B Feature FT:CDS AY518556_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 57-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagtaatgtcagcgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY596102_X_P-B Feature FT:CDS AY596102_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ia-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaatgatctttgtac
tcggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY596103_X_P-B Feature FT:CDS AY596103_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ia-2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccccgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgcgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY596104_X_P-B Feature FT:CDS AY596104_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ia-4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgacaacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcgtctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
gccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaggagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY596105_X_P-B Feature FT:CDS AY596105_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ia-5). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagagaactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY596106_X_P-B Feature FT:CDS AY596106_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ia-6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatcttccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaacgagtgggaggagctgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY596109_X_P-B Feature FT:CDS AY596109_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate II-1). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY596110_X_P-B Feature FT:CDS AY596110_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate II-2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgacctaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaagcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
tgggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY596111_X_P-B Feature FT:CDS AY596111_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ia-3). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggcctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY596112_X_P-B Feature FT:CDS AY596112_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ia-7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgacctaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcgatgtcaacgaccga
ccttgaagcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
tgggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY766463_X_P-B Feature FT:CDS AY766463_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccaaccgaccacggggcgcacctct
ccttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcacaagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgcgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY800389_X_P-B Feature FT:CDS AY800389_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate ZY041024). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggacgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY800391_X_P-B Feature FT:CDS AY800391_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate ZY041026). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggtctctaccgaccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggacttttagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgttcaatgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY800392_X_P-B Feature FT:CDS AY800392_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate ZY041027). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggtctctaccgaccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggacttttagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgttcaatgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|D00329_X_P-B Feature FT:CDS D00329_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagctgggggaggagattaggttaaaggtctttgtac
tcggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|D00330_X_P-B Feature FT:CDS D00330_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|D00331_X_C-B Feature FT:CDS D00331_X_C-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcacacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|D23678_X_P-B Feature FT:CDS D23678_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-HBVYS2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatactgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttagggctctaccgcccgcttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagctgggggaggagattaggttaaaggtctttgtat
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|D23679_X_P-B Feature FT:CDS D23679_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A3-HBVMS2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacggccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagctgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|D50521_X_P-B Feature FT:CDS D50521_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctctacgcggactccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagctgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|D50522_X_P-B Feature FT:CDS D50522_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctctacgcggactccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagctgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|DQ361535_X_P-B Feature FT:CDS DQ361535_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CRP-228). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacatcccgtcagcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccacttctccgtctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaccctgcccaaggtcttacataagaggactattggactttcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagaccaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ377158_X_P-B Feature FT:CDS DQ377158_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WJT31). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccaaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ448619_X_P-B Feature FT:CDS DQ448619_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-DYH). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ448620_X_P-B Feature FT:CDS DQ448620_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-DYF). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatcttccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ448621_X_P-B Feature FT:CDS DQ448621_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-HQY). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggacttttagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaagttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ448622_X_P-B Feature FT:CDS DQ448622_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-JSM). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ448623_X_P-B Feature FT:CDS DQ448623_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-LMX). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ448624_X_P-B Feature FT:CDS DQ448624_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-QSA). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ448625_X_P-B Feature FT:CDS DQ448625_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-TXB). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttatttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccggccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcacctttttcacctctgcctaa
>gnl|hbvcds|DQ448626_X_P-B Feature FT:CDS DQ448626_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-XLB). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ448627_X_P-B Feature FT:CDS DQ448627_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-ZFL). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttatttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ448628_X_P-B Feature FT:CDS DQ448628_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-ZX). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccacttctccgccttgtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ463787_X_P-B Feature FT:CDS DQ463787_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 928-9_1979). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccgcctgccgttccgaccgaccacggggcgtacctct
ctttacgcggcctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttatataagaggactcttggactttcatcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ463788_X_P-B Feature FT:CDS DQ463788_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 739-11_1979). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccgcctgccgtaccgaccgaccacggggcgtacctct
ctttacgcggcctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttacataagaggactcttggactttcatcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|DQ463789_X_P-B Feature FT:CDS DQ463789_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 650-15_1979). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccgtctgccgtatcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttacataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttactgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ463790_X_P-B Feature FT:CDS DQ463790_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 621-14_1979). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcgaagctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccgcctgccgttccgaccgaccacggggcgtacctct
ctttacgcggcctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttacataagaggactcttggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ463791_X_P-B Feature FT:CDS DQ463791_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 539-16_1979). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcgccgctgaatcccgcgg
acgacccctctcggggacgcttggggctgtaccgcccgcttctccgcctgccgtaccgaccgaccacggggcgtacctct
ctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttatataagaggactcttggactttcaacaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ463792_X_P-B Feature FT:CDS DQ463792_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 524-3_1979). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcgccgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccgcctgccgtaccgaccgaccacggggcgtacctct
ctttacgcggcctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttacataagaggactcttggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagactaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ463793_X_P-B Feature FT:CDS DQ463793_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 462-4_1979). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccgcctgccgttccggccgaccacggggcgtacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttatataagaggactcttggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|DQ463794_X_P-B Feature FT:CDS DQ463794_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 234-6_1979). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccgcctgccgtaccgaccgaccacggggcgtacctct
ctttacgcggcctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttacataagaggactcttggactttcatcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ463795_X_P-B Feature FT:CDS DQ463795_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 928-9_2004). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccggcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttggggctctaccgcccgcttctccgcctgccgttccgaccgaccacggggcgtacctct
ctttacgcggcctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttatataagaggactcttggactttcatcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagactaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|DQ463796_X_P-B Feature FT:CDS DQ463796_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 739-11_2004). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcgaagctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccgcctgccgttccgaccgaccacggggcgtacctct
ctttacgcggcctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttacataagaggactcttggactttcatcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttaaggagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|DQ463797_X_P-B Feature FT:CDS DQ463797_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 650-15_2004). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccgtctgccgtatcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttacataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttactgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|DQ463798_X_P-B Feature FT:CDS DQ463798_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 621-14_2004). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggatgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgattctccgccagccgttccgaccgaccacggggcgtacctct
ctttacgcggcctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttacataagaggactcttggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|DQ463799_X_P-B Feature FT:CDS DQ463799_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 539-16_2004). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcgccgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccgcctgccgtaccgaccgaccacggggcgtacctct
ctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttacataagaggactcttggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagactaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|DQ463800_X_P-B Feature FT:CDS DQ463800_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 524-3_2004). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccgcctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttatataagaggactcttggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagtctaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|DQ463801_X_P-B Feature FT:CDS DQ463801_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 462-4_2004). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccgcctgccgttccggccgaccacggggcgtacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttatataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagactaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|DQ463802_X_P-B Feature FT:CDS DQ463802_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 234-6_2004). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccgcctgccgtaccgaccgaccacggggcgtacctct
ctttacgcggcctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttacataagaggactcttggactttcatcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|DQ904357_X_P-B Feature FT:CDS DQ904357_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
tgggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ975271_X_P-B Feature FT:CDS DQ975271_X_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgcaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ993680_X_P-B Feature FT:CDS DQ993680_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 268). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttacataagaggactcttggactttcagtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ993681_X_P-B Feature FT:CDS DQ993681_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 290). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccctcccggggccgcttggggctctaccgccctctcctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgaccaaggtcttacataagaggactcttggactttcggcaatgtcaacgaccga
ccttgagacatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaratwaggttwaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ993682_X_P-B Feature FT:CDS DQ993682_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 479). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgctcctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggar
accaccgtgaacgcccaccggaacctgmccaaggtcttacataagaggactcttggactttcagtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ993683_X_P-B Feature FT:CDS DQ993683_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 82). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgtccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgsccactggaacctgcccaaggtcttacataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagawtaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ993684_X_P-B Feature FT:CDS DQ993684_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 336). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgctcctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgacaacggtcttacataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatwaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ993685_X_P-B Feature FT:CDS DQ993685_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 554). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgctcctccgtctgccgtaccggccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgaccaaggtcttacataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagtkgggggaggagatwaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ993686_X_P-B Feature FT:CDS DQ993686_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 342). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgctcctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgacaacggtcttacataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttyaaagactgtgtgtttactgagtgggaggagttgggggaggagattargttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ993687_X_P-B Feature FT:CDS DQ993687_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 700). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctttaccgcccgcttctccgcctaccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttacataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttgctgagtgggargagttggggraggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ993694_X_P-B Feature FT:CDS DQ993694_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 234). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggacgcttggggctttaccgcccgcttctccgcctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttacataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatrcttcaaagactgtgtgtttgctgagtgggaggagttaggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ993696_X_P-B Feature FT:CDS DQ993696_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 452b1). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttaacctctgcctaa
>gnl|hbvcds|DQ993697_X_P-B Feature FT:CDS DQ993697_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 940b1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagargactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttaacctctgcctaa
>gnl|hbvcds|DQ993698_X_P-B Feature FT:CDS DQ993698_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 6144-0327-ETCvs3TC-Naive). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttgcataagaggactcttggactttcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaagagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttgaactctgcctaa
>gnl|hbvcds|DQ993699_X_P-B Feature FT:CDS DQ993699_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 6144-0226-ETCvs3TC-Break). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttgcataagaggactcttggactttcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaagagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttgaactctgcctaa
>gnl|hbvcds|DQ993700_X_P-B Feature FT:CDS DQ993700_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate JMY-0725-ETC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgacaacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ993701_X_P-B Feature FT:CDS DQ993701_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate JMY-0210-ETCvs3TC-Brack). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgacaacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ993702_X_P-B Feature FT:CDS DQ993702_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate JMY-0919-ETCvs3TC-Naive). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccatcggcgctgaatcccccgt
actacccctcccggggctccttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ993703_X_P-B Feature FT:CDS DQ993703_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 236-0526-Nature1.2-Sero). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttacaggagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttgctgagtgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ993704_X_P-B Feature FT:CDS DQ993704_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 239-1127-Nature3.1-unSero). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcgacgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttacaggagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttgctgagtgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ993705_X_P-B Feature FT:CDS DQ993705_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 239-0625-Nature3.4-unSero). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttacaggagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttgctgagtgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ993706_X_P-B Feature FT:CDS DQ993706_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 239-0402-Nature3.3-unSero). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttacaggagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttgctgagtgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ993707_X_P-B Feature FT:CDS DQ993707_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 239-O218-Nature3.2-unSero). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttacaggagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttgctgagtgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ993708_X_P-B Feature FT:CDS DQ993708_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 6136-1228-Naive). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccaaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ993709_X_P-B Feature FT:CDS DQ993709_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 6136-0127-ETCvs3TC-Break). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ993710_X_P-B Feature FT:CDS DQ993710_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 6144-0718-ETC). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccactggaacctgcccaaggtcttgcataagaggactcttggactttcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaagagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttgaactctgcctaa
>gnl|hbvcds|DQ993711_X_P-B Feature FT:CDS DQ993711_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 221-1120-Nature1.1-unSero). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccacttctccgcctgatgtaccaaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
gccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaggagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ995801_X_P-B Feature FT:CDS DQ995801_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H60-6). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacgggacgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgtttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatatttcaaagactgtgtgtttactgagtgagaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgcgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ995802_X_P-B Feature FT:CDS DQ995802_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H293-16). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctccaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccccgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ995803_X_P-B Feature FT:CDS DQ995803_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C265-15). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccgcctgttgtgccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagagaactcttggactttcatccatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggtggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgcgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ995804_X_P-B Feature FT:CDS DQ995804_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1691-11). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttctaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggaattgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ995805_X_P-B Feature FT:CDS DQ995805_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H60-2.5KB). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcatgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatatttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgcgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF134945_X_P-B Feature FT:CDS EF134945_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G247-B3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttatttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF134946_X_P-B Feature FT:CDS EF134946_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G247-B5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacatcctttatttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF473971_X_P-B Feature FT:CDS EF473971_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2059Java). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccggctgccgtaccgaccgaccacggggcgcacctct
ctttacgaggactccccggctgtgccttctcatctgccggaccgggtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatcatgttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF473972_X_P-B Feature FT:CDS EF473972_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1839Java). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF473973_X_P-B Feature FT:CDS EF473973_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EIH45AChinese). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF473974_X_P-B Feature FT:CDS EF473974_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EIH21AChinese). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgagtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgggtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattgttgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF473975_X_P-B Feature FT:CDS EF473975_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2061Chinese). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF473976_X_P-B Feature FT:CDS EF473976_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alr049East). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF473977_X_P-B Feature FT:CDS EF473977_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate KD048East). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcacggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggaattgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF494380_X_P-B Feature FT:CDS EF494380_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate TW836). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF494381_X_P-B Feature FT:CDS EF494381_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate TW936). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggccttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcacccgcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF494382_X_P-B Feature FT:CDS EF494382_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate TWD347). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttccccgcctgatgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgccccccggactctgcccaaggtcttgcatgagaggactattggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU043342_X_P-B Feature FT:CDS EU043342_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate XX259-2). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcacccgcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU043343_X_P-B Feature FT:CDS EU043343_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate XX259-5). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattagattaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcacccgcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU043344_X_P-B Feature FT:CDS EU043344_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate XX259-14). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaaggctgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU043345_X_P-B Feature FT:CDS EU043345_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate XX259-20). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaaggctgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU139543_X_P-B Feature FT:CDS EU139543_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgtttggggctctaccgcccgcttctccgcctgttgtaccatccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU158262_X_P-B Feature FT:CDS EU158262_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G116). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtytacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgyccgcttctccgcctgccgtwccggccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccrccrrrwcttgcccaaggtcttrcataagaggactcttggactytcagyaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttamwgastgggaggagytgggggaggagaykaggttaatgatctttgtac
trggaggctgtaggcataaattggtstgttcaccagcaccatgcaactttttsamctctgcctga
>gnl|hbvcds|EU158263_X_P-B Feature FT:CDS EU158263_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G108). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccacttctccgcctgttgtaccgaccgtccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacctgcccaaggtcttgtataagaggactcttggactttcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
tgggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU305547_X_P-B Feature FT:CDS EU305547_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M118-481). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtctcgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU305548_X_P-B Feature FT:CDS EU305548_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M118-673). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcgtaagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU306677_X_P-B Feature FT:CDS EU306677_X_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU306678_X_P-B Feature FT:CDS EU306678_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU306679_X_P-B Feature FT:CDS EU306679_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU306680_X_P-B Feature FT:CDS EU306680_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU306681_X_P-B Feature FT:CDS EU306681_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU306695_X_P-B Feature FT:CDS EU306695_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccaaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU306696_X_P-B Feature FT:CDS EU306696_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccaaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU306697_X_P-B Feature FT:CDS EU306697_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccaaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU306698_X_P-B Feature FT:CDS EU306698_X_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccaaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU306699_X_P-B Feature FT:CDS EU306699_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacttgcccaaggtctggcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatactttaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU306700_X_P-B Feature FT:CDS EU306700_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaatctgcctacggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgtttaccagctccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU306701_X_P-B Feature FT:CDS EU306701_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaatctgcctacggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU306702_X_P-B Feature FT:CDS EU306702_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaatctgcctacggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU306703_X_P-B Feature FT:CDS EU306703_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaatctgcctacggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgcgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU306704_X_P-B Feature FT:CDS EU306704_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaatctgcctacggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU306705_X_P-B Feature FT:CDS EU306705_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaatctgcctacggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU306706_X_P-B Feature FT:CDS EU306706_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaatctgcctacggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU306707_X_P-B Feature FT:CDS EU306707_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaatctgcctacggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtgc
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU306708_X_P-B Feature FT:CDS EU306708_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttggttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaatctgcctacggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU306709_X_P-B Feature FT:CDS EU306709_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaatctgcctacggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU306710_X_P-B Feature FT:CDS EU306710_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaatctgcctacggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU306711_X_P-B Feature FT:CDS EU306711_X_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaatctgcctacggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU306712_X_P-B Feature FT:CDS EU306712_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgtccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaatctgcctacggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggctaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU330989_X_P-B Feature FT:CDS EU330989_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M84-74). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgactggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggactctgcccaaggtcttacataagaggactattggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU330990_X_P-B Feature FT:CDS EU330990_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M84-146). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgactggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggactctgcccaaggtcttacataagaggactattggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU330992_X_P-B Feature FT:CDS EU330992_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-6). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgactggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggactctgcccaaggtcttacataagaggactactggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU330994_X_P-B Feature FT:CDS EU330994_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-10). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgactggggctctaccgcccgcttccccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgcctcctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggactctgcccaaggtcttacataagaggactattggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggtgaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU330995_X_P-B Feature FT:CDS EU330995_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-80). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgactggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggactctgcccaaggtcttacataagaggactattggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU330996_X_P-B Feature FT:CDS EU330996_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-81). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgactggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtacacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggactctgcccaaggtcttacataagaggactattggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU330997_X_P-B Feature FT:CDS EU330997_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-216). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgactggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctccgcacgtcgcatggag
accaccgtgaacgcccaccggactctgcccaaggtcttacataagaggactattggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU330998_X_P-B Feature FT:CDS EU330998_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-1043). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgactggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggactctgcccaaggtcttacataagaggactactggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU330999_X_P-B Feature FT:CDS EU330999_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-1044). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgactggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggactctgcccaaggtcttacataagaggactactggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU331000_X_P-B Feature FT:CDS EU331000_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-1045). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgactggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggactctgcccaaggtcttacataagaggactactggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU331001_X_P-B Feature FT:CDS EU331001_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-1046). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgactggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggactctgcccaaggtcttacataagaggactactggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU350409_X_P-B Feature FT:CDS EU350409_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate BTO5856). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaacgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcagcatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU439018_X_P-B Feature FT:CDS EU439018_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagagggctcctggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU439020_X_P-B Feature FT:CDS EU439020_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU439021_X_P-B Feature FT:CDS EU439021_X_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
gccaccgtgaacgcccactggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctrmctaa
>gnl|hbvcds|EU439022_X_P-B Feature FT:CDS EU439022_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctatgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU439023_X_P-B Feature FT:CDS EU439023_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtctacgaccga
ccttgaggcatacttcaaggactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagaaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU487256_X_P-B Feature FT:CDS EU487256_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient12). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctccaggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU487257_X_P-B Feature FT:CDS EU487257_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient14). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacctgcccaaggtcttatataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccttgcaactttttcacctctgcctaa
>gnl|hbvcds|EU522066_X_P-B Feature FT:CDS EU522066_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 4N). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggaattgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU522067_X_P-B Feature FT:CDS EU522067_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 4T). Non-functional genomic sequence. [Hepadnaviridae] (length=468 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtcttgtttg
tattaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU522072_X_P-B Feature FT:CDS EU522072_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 8N). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccactggaacctgcccaaggtcttgcataaacgaactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
tgggaggctgtaggcataaattggtgcgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU522073_X_P-B Feature FT:CDS EU522073_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 8T). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccactggaacctgcccaaggtcttgcataaacgaactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
tgggaggctgtaggcataaattggtgcgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU522074_X_P-B Feature FT:CDS EU522074_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 8T). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgggtcttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
tgggaggctgtaggcataaattggtgcgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU522075_X_P-B Feature FT:CDS EU522075_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 8T). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccactggaacctgcccaaggtcttgcataaacgaactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
tgggaggctgtaggcataaattggtgcgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU547563_X_P-B Feature FT:CDS EU547563_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MC06). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcacaagagaactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttgaaggtctttgtac
taggaggctgtaggcataaattggtgcgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU564822_X_P-B Feature FT:CDS EU564822_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-10TA). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaagggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccctgcaactttttcacctctgcctaa
>gnl|hbvcds|EU564823_X_P-B Feature FT:CDS EU564823_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-10TB). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccaaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaagggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccctgcaactttttcacctctgcctaa
>gnl|hbvcds|EU564824_X_P-B Feature FT:CDS EU564824_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-10N). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccaaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaagggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccctgcaactttttcacctctgcctaa
>gnl|hbvcds|EU564826_X_P-B Feature FT:CDS EU564826_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-11N). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgatgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcactgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgcgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU570069_X_P-B Feature FT:CDS EU570069_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1-B24). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgtatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgacctcggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgtccacgggaatctgcccaaggtcttgcataagaggactcttggactttcagcaatgccaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU570070_X_P-B Feature FT:CDS EU570070_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2-B24). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgttaacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgacctcggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgtccacgggaatctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU570071_X_P-B Feature FT:CDS EU570071_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 4-B24). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgacctcggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgtccacgggaatctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU570075_X_P-B Feature FT:CDS EU570075_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 11-S142). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacccct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaatctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggtgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU579441_X_P-B Feature FT:CDS EU579441_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 12). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagtctaggttgaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU589335_X_P-B Feature FT:CDS EU589335_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S142-5). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggctaggttgaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU595031_X_P-B Feature FT:CDS EU595031_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccagctggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcgtaagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU660224_X_P-B Feature FT:CDS EU660224_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-12N). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctccaggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcgtctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU660230_X_P-B Feature FT:CDS EU660230_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-16T-del1). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcaacaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU660231_X_P-B Feature FT:CDS EU660231_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-16T-del2). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcaacaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU660232_X_P-B Feature FT:CDS EU660232_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-16N-del1). Partial genome (Contains: HBc, HBx, MHBs, SHBs). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU660233_X_P-B Feature FT:CDS EU660233_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-16N-del2). Partial genome (Contains: HBc, HBx, MHBs, SHBs). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU796066_X_P-B Feature FT:CDS EU796066_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgccgcatggaa
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagcggactcttggactttcagcgatgtcaacgaccga
ccttgaggcatacttcaaaaactgtgtgtttactgagtgggaggagttgggggaggagaataggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU796067_X_P-B Feature FT:CDS EU796067_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactgggtcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagcggactcttggactttcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU796068_X_P-B Feature FT:CDS EU796068_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
gcgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU796071_X_P-B Feature FT:CDS EU796071_X_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atagctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacttgcccaaggtcttgcacaagcggactcttggactttcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU881997_X_P-B Feature FT:CDS EU881997_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient18). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgcccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttacggagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU881998_X_P-B Feature FT:CDS EU881998_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient18). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgcccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttacggagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaacttttttacctctgcctaa
>gnl|hbvcds|EU882002_X_P-B Feature FT:CDS EU882002_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient20). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctatgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU882003_X_P-B Feature FT:CDS EU882003_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient21). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcggcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagagtaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU882004_X_P-B Feature FT:CDS EU882004_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient21). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcggcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagaataggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU919171_X_P-B Feature FT:CDS EU919171_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient29). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttaggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtgcgtccaccggcaccttgcaattttttcacctctgcctaa
>gnl|hbvcds|EU919172_X_P-B Feature FT:CDS EU919172_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient30). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU919173_X_P-B Feature FT:CDS EU919173_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient30). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU919175_X_P-B Feature FT:CDS EU919175_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient34). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgacccctggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgaatgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU919176_X_P-B Feature FT:CDS EU919176_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient34). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgacccctggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgaatgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939559_X_P-B Feature FT:CDS EU939559_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C67). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggtggagggtaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgtccaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939633_X_P-B Feature FT:CDS EU939633_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C181). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgtttggggctctaccgcccgcttctccgcttgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaatctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatcaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctga
>gnl|hbvcds|EU939634_X_P-B Feature FT:CDS EU939634_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C19). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgtttggggctctaccgcccgcttctccgcttgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaatctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatcagggcaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctga
>gnl|hbvcds|EU939636_X_P-B Feature FT:CDS EU939636_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C11). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccacaggaacctgcccaaggtcttgtataagaggactcttggactgtcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939637_X_P-B Feature FT:CDS EU939637_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C13). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggttggtaggctgtacttccaactcgatcctgctcgggacgtcctttttttacgtcccgtcggcgatgaatcccgcgg
acgacccttcccggggccgcttggggatctaccgtccgcttctccgcctgttgtactgactgaccacggggcgcacctct
ctttacgcggattccccgtctgtgccttgtcatctgccggaccgtgtgcacttcgcttcccctctgcacgtcgcatggaa
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttcaggcatacttccaagactgtgtgtttactgagtgggaggagctgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939638_X_P-B Feature FT:CDS EU939638_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C17). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggacgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939639_X_P-B Feature FT:CDS EU939639_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C28). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgtcgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagctatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaatgagtgggaggaattgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939660_X_P-B Feature FT:CDS EU939660_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C34). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttctaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggar
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcgacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgacggggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939661_X_P-B Feature FT:CDS EU939661_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C40). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctggtaggttgtgctgccaactggatactgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggcctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939663_X_P-B Feature FT:CDS EU939663_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C74). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttatggagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939664_X_P-B Feature FT:CDS EU939664_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C85). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactgtcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggaattgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgcgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939665_X_P-B Feature FT:CDS EU939665_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C129). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggstgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacsggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939666_X_P-B Feature FT:CDS EU939666_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C150). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgtccgcttctccgcctrttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccmcaggaacctgcccaaggtcttgcataagaggactcttggactttcagtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagctgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939667_X_P-B Feature FT:CDS EU939667_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C171). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgtcgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccctgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939669_X_P-B Feature FT:CDS EU939669_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C185). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgccttgtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccacaggaacttgcccaaggtcttgyataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgcgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939670_X_P-B Feature FT:CDS EU939670_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C189). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcaacaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgcgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939671_X_P-B Feature FT:CDS EU939671_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C201). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939672_X_P-B Feature FT:CDS EU939672_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C215). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgtccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagctgggggaggaggtcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939673_X_P-B Feature FT:CDS EU939673_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C219). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactgtcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939674_X_P-B Feature FT:CDS EU939674_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C232). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcgtttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacttgcccaaggtcttgtataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaagatttatgtat
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939675_X_P-B Feature FT:CDS EU939675_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C235). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgtataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagatgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939676_X_P-B Feature FT:CDS EU939676_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D54). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaatgatctttgtgt
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939677_X_P-B Feature FT:CDS EU939677_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D95). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgagcacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgccaaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatggaactttttcacctctgcctaa
>gnl|hbvcds|EU939678_X_P-B Feature FT:CDS EU939678_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D106). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccactggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU939679_X_P-B Feature FT:CDS EU939679_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D134). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ023631_X_P-B Feature FT:CDS FJ023631_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2_C04-1213). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccatcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggcctgtaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaagcatacttcaaagactgtgtgtttaatgagtgggaggtgttgggggaggagcttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ023632_X_P-B Feature FT:CDS FJ023632_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B4_C04-0254). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttatgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctgtaccgcccgcttctccgcctgccgtaccaaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttacataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ023633_X_P-B Feature FT:CDS FJ023633_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B4_C04-0583). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctttaccgcccgcttctccgcctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgcctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttgctgagtgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ023634_X_P-B Feature FT:CDS FJ023634_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B4_C04-1358). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttggggctctaccgcccgctcctccgtctaccgtaccggccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttacataagaggactcttggactttcagtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ023635_X_P-B Feature FT:CDS FJ023635_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B4_M04-0467). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtatcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
acccccgtgaacgcccaccggaacctgcccaaggtcttacataagaggactcttggactgtcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ023636_X_P-B Feature FT:CDS FJ023636_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B4_M04-0876). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctttaccgcccgcttctccgcctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcctaaggtcttacataagaggactcttggactttcagcagtgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ023637_X_P-B Feature FT:CDS FJ023637_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B5_M04-0013). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaccctgcccaaggtcttacataagaggactattggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatcaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ023638_X_P-B Feature FT:CDS FJ023638_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B5_M04-0465). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgctactccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaccctgcccaaggtcttacataagaggactattggactttcaccaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatcaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ032342_X_P-B Feature FT:CDS FJ032342_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S659-2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgatcgcccaccggaacttgcccaaggtcttgcatcagaggactcttggactttctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggttaaaggtctttgtat
taggaggctgtaggcataaattggtgtgctcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ032344_X_P-B Feature FT:CDS FJ032344_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S659-5). Complete genome. [Hepadnaviridae] (length=465 residues).
ctggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgatcgcccaccggaacttgcccaaggtcttgcatcagaggactcttggactttctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggttaaaggtctttgtat
taggaggctgtaggcataaattggtgtgctcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ032349_X_P-B Feature FT:CDS FJ032349_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S734-1). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ032352_X_P-B Feature FT:CDS FJ032352_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1026-3). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcactgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtctcgcataagaggactcttggactgtcaacaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtaggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ032353_X_P-B Feature FT:CDS FJ032353_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1026-4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactgtcaacaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctcttcctaa
>gnl|hbvcds|FJ032354_X_P-B Feature FT:CDS FJ032354_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1026-7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactgtcaacactgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ032357_X_P-B Feature FT:CDS FJ032357_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1607-8). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttcttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ032358_X_P-B Feature FT:CDS FJ032358_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1607-10). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttcttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggccgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ349236_X_P-B Feature FT:CDS FJ349236_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C15). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctccaggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttacataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386582_X_P-B Feature FT:CDS FJ386582_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1765). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgtcgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactgtcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386583_X_P-B Feature FT:CDS FJ386583_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1780). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggcatctatcgcccgcttctccgccttgtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaaagaccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagtcgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386584_X_P-B Feature FT:CDS FJ386584_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1798). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgaccgcttctccgcctcttgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaacgagtgggaggagctgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386600_X_P-B Feature FT:CDS FJ386600_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1893). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctactgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttgcataagaggactcttggactttcagtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggagggtgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386608_X_P-B Feature FT:CDS FJ386608_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1998). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgtcgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcacctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcgacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386610_X_P-B Feature FT:CDS FJ386610_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2000). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttgtaccgaccgacgacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386615_X_P-B Feature FT:CDS FJ386615_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2061). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtat
taggagggtgtaggcataaattggtgcgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386634_X_P-B Feature FT:CDS FJ386634_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2392). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattgggctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386636_X_P-B Feature FT:CDS FJ386636_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1813). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386642_X_P-B Feature FT:CDS FJ386642_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1829). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattagattaaaggtctttgtac
tcggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386648_X_P-B Feature FT:CDS FJ386648_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2419). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcycggggccgcttgggrctctaccgcccgcttctccryctgytgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccacmrgrwcttgcccaaggtcttgcataagaggactcttggactytcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgactgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtagcaataaattggtgcgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386654_X_P-B Feature FT:CDS FJ386654_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S51). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactgtcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386655_X_P-B Feature FT:CDS FJ386655_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S121). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccctcccggggccgcttggggctctatcgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386656_X_P-B Feature FT:CDS FJ386656_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S142). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttgaaggtctttgtac
taggaggctgtagcaataaattggtgtgttcacctgcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386658_X_P-B Feature FT:CDS FJ386658_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S185). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaatgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagctgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386660_X_P-B Feature FT:CDS FJ386660_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S221). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgctcctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttgcataagaggactcttggactttcagtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattgggctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386666_X_P-B Feature FT:CDS FJ386666_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S367). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccaaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactgtcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386668_X_P-B Feature FT:CDS FJ386668_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S395). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgttccaaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcactgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggatgaggttaggttaaggaactatgtac
taggaggctgtagggataaattggtgtgttcaccagccccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386669_X_P-B Feature FT:CDS FJ386669_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S411). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386675_X_P-B Feature FT:CDS FJ386675_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S734). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggar
accaccgtgaacgcccactggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386676_X_P-B Feature FT:CDS FJ386676_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1055). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386680_X_P-B Feature FT:CDS FJ386680_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1244). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcgtacatcaaagactgtgtgtttactgagtgggaggaattgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtgcgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386681_X_P-B Feature FT:CDS FJ386681_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1336). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386682_X_P-B Feature FT:CDS FJ386682_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1416). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacagraacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386683_X_P-B Feature FT:CDS FJ386683_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1450). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcggcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtcc
tcggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386684_X_P-B Feature FT:CDS FJ386684_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1554). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggaattgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ386688_X_P-B Feature FT:CDS FJ386688_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1632). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggagcttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgaatgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ518811_X_P-B Feature FT:CDS FJ518811_X_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtatcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgagcaatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ518812_X_P-B Feature FT:CDS FJ518812_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttctaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggagcttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562219_X_P-B Feature FT:CDS FJ562219_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttctaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctga
>gnl|hbvcds|FJ562222_X_P-B Feature FT:CDS FJ562222_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I14). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562224_X_P-B Feature FT:CDS FJ562224_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I16). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccacctcttctaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcarcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562231_X_P-B Feature FT:CDS FJ562231_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I44). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
tgggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562234_X_P-B Feature FT:CDS FJ562234_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I49). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggtctctaccgcccgcttctccgcctgttgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562236_X_P-B Feature FT:CDS FJ562236_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I51). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcctggggctctaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggcggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562237_X_P-B Feature FT:CDS FJ562237_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I53). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggar
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562240_X_P-B Feature FT:CDS FJ562240_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I65). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
tgggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562246_X_P-B Feature FT:CDS FJ562246_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I74). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562253_X_P-B Feature FT:CDS FJ562253_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I86). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562254_X_P-B Feature FT:CDS FJ562254_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I87). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562257_X_P-B Feature FT:CDS FJ562257_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I96). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggactctatcgcccgcttctccgccttgtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgaccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagtcgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562259_X_P-B Feature FT:CDS FJ562259_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I106). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcaacaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggtgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgcgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562260_X_P-B Feature FT:CDS FJ562260_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I107). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggaattgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgcgttcaccagcaccttgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562262_X_P-B Feature FT:CDS FJ562262_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I111). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacacccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagctgggggaggagtttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgcgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562289_X_P-B Feature FT:CDS FJ562289_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I160). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggtctctaccgcccgcttctccgccttgtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgaccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagtcgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562296_X_P-B Feature FT:CDS FJ562296_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I171). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagrytaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562303_X_P-B Feature FT:CDS FJ562303_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I189). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccttgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562311_X_P-B Feature FT:CDS FJ562311_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I202). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgtacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttgctgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgcgttcaccggcaccttgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562312_X_P-B Feature FT:CDS FJ562312_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I203). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgtataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggaattaggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtgcgttcaccagcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562316_X_P-B Feature FT:CDS FJ562316_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I208). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcggcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562321_X_P-B Feature FT:CDS FJ562321_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I214). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ562322_X_P-B Feature FT:CDS FJ562322_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I216). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccggccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagctgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ751769_X_P-B Feature FT:CDS FJ751769_X_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcaacaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ755833_X_P-B Feature FT:CDS FJ755833_X_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
ggactatcaaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcaacaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgcttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ787444_X_P-B Feature FT:CDS FJ787444_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S208-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ787475_X_P-B Feature FT:CDS FJ787475_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CX-2). Complete genome. [Hepadnaviridae] (length=468 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgtcgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtcttgtttg
tactaggaggctgtaggcataaattggtgcgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ787476_X_P-B Feature FT:CDS FJ787476_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CX-3). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttcccggggccgcttggagctctaccgcccgcttctccgcctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggaattgggggaggagattaggttaatgatctttgtac
taagaggctgtaggcataaattggtgcgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ787477_X_P-B Feature FT:CDS FJ787477_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate LWM-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggacttccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ899779_X_P-B Feature FT:CDS FJ899779_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C185-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgccttgtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgcgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ899784_X_P-B Feature FT:CDS FJ899784_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C215-3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgtccgcgtctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagtaatgtcaacgaccga
cctcgaggcatacttcaaagactgtgtgtttaatgagtgggaggagctgggggaggaggtcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ899785_X_P-B Feature FT:CDS FJ899785_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C215-5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgtccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgctccacctctgcacgtcgcatggaa
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagctgggggaggaggtcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ899786_X_P-B Feature FT:CDS FJ899786_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C215-7). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgtccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagctgggggaggaggtcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ899787_X_P-B Feature FT:CDS FJ899787_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C215-9). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggcctctaccgtccgcttctccgcctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgctttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagctgggggaggaggtcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ899790_X_P-B Feature FT:CDS FJ899790_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C232-2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcgtttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacttgcccaaggtcttgtataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaagatttatgtat
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ899791_X_P-B Feature FT:CDS FJ899791_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C232-6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcgtttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacttgcccaaggtcttgtataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaagatttatgtat
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ358136_X_P-B Feature FT:CDS GQ358136_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EIHB134). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctgtgcacgtcgcatggag
accaccgtgaacgcccatcggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggacatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ358137_X_P-B Feature FT:CDS GQ358137_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate LBY001). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttgctgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcccctctgcctaa
>gnl|hbvcds|GQ358138_X_P-B Feature FT:CDS GQ358138_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate LBY041). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctaccgcccgcttctccgcctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ358139_X_P-B Feature FT:CDS GQ358139_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate FLT032). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccccccgcttctccgcctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgagtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ358140_X_P-B Feature FT:CDS GQ358140_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate FLT020). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ358141_X_P-B Feature FT:CDS GQ358141_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate LBY009). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ358142_X_P-B Feature FT:CDS GQ358142_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate LAR070). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgccaactggatcctgcgcgggacctcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataactaggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ358143_X_P-B Feature FT:CDS GQ358143_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CBL027). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagactaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ358144_X_P-B Feature FT:CDS GQ358144_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate KDI15). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcttgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctgtaccgcccgcttctccgtctgccgttccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaagggctttgtac
taggaggctgtaggcataaattggtttggtcaccagcaccatgcaactttttcccctctgcctaa
>gnl|hbvcds|GQ358145_X_P-B Feature FT:CDS GQ358145_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate KDI04). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcttgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgcttggggctgtaccgcccgcttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaccgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ358146_X_P-B Feature FT:CDS GQ358146_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate KDI35). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcttgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcccgggcccccttggggctctaccgcccgcttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtttgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgctcaccggaacctgcccaaggtcttgcataagaggactcttggacttccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ358147_X_P-B Feature FT:CDS GQ358147_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate KDI43). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcttgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggacttccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
tcggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ358148_X_P-B Feature FT:CDS GQ358148_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate ALO36). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccgcctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcctcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ358149_X_P-B Feature FT:CDS GQ358149_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate PAN001). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccgcctgccgtaccgcccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ358150_X_P-B Feature FT:CDS GQ358150_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate PAN009). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctaccgcccgcttctccgcctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgtacaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ358151_X_P-B Feature FT:CDS GQ358151_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate PAN011). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccgcctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgaaacctgcccaaggtcttgcacaagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ358152_X_P-B Feature FT:CDS GQ358152_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate PAN037). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccgcctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttactgagtgggaggagttgggggaggagattaggttaaaggtctttgttc
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377519_X_P-B Feature FT:CDS GQ377519_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J16). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgtccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
tatgaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377525_X_P-B Feature FT:CDS GQ377525_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J24). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccactggaacctgcccaaggtcttgcataagaggactcttggactttcagcactgtcaacgaccga
tcttgaggcatacttcaaagactgtgtgtatactgagtgggacgagttgggggaggaggttaggttaatgatctatgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377537_X_P-B Feature FT:CDS GQ377537_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J48). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggctaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377542_X_P-B Feature FT:CDS GQ377542_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J61). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttctaccgaccgaccacggggcgtacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggatgagattaggttaatgatctttgtac
tgggaggctgtaagcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377547_X_P-B Feature FT:CDS GQ377547_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J78). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagtttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377550_X_P-B Feature FT:CDS GQ377550_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J81). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgtcgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagagaactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaagatctttgtac
tgggaggctgtagggataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377558_X_P-B Feature FT:CDS GQ377558_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J89). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377561_X_P-B Feature FT:CDS GQ377561_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J96). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttgcataagaggactcttggactgttagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377566_X_P-B Feature FT:CDS GQ377566_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J101). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccggccgcttctccgcctattgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagctgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377567_X_P-B Feature FT:CDS GQ377567_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J102). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggactctaccgcccgcttctccgccttatgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgaccaccggaacctgcccaaggtcttgcataagaggactcttggactctcaccagtgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaatgactgggaggagtcgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377568_X_P-B Feature FT:CDS GQ377568_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J103). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtgtgtgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377569_X_P-B Feature FT:CDS GQ377569_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J105). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcacggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377582_X_P-B Feature FT:CDS GQ377582_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J131). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccacaggaacctgcccaaggtcttgcaaaaaaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtgtgtccaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377587_X_P-B Feature FT:CDS GQ377587_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J138). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagtttaggttaatgatctttgtac
tgggaggctgtaagcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377588_X_P-B Feature FT:CDS GQ377588_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J141). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctga
>gnl|hbvcds|GQ377606_X_P-B Feature FT:CDS GQ377606_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J171). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattagattaatgatctttgtac
tgggaggctgtaagcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377610_X_P-B Feature FT:CDS GQ377610_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J177). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagtttggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtgtgtccaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377612_X_P-B Feature FT:CDS GQ377612_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J180). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377622_X_P-B Feature FT:CDS GQ377622_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J207). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctrtcgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccacaggaacttgcccaaggtcttacataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttagtttaatgatctttgtac
tgggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377625_X_P-B Feature FT:CDS GQ377625_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J222). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
tgggaggctgtaggcataaattggtaggttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377629_X_P-B Feature FT:CDS GQ377629_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J234). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgtggtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaatgatctttgtac
tggggggctgtaagcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377638_X_P-B Feature FT:CDS GQ377638_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J250). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttagggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttctgtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaagttaatgatctttgtac
tgggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377639_X_P-B Feature FT:CDS GQ377639_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J251). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
tgggaggctgttagcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377641_X_P-B Feature FT:CDS GQ377641_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J254). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggcctttaccgcccgcttctccgccttgtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgaccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagtcgggggaggaggttaggttaatgatctttgtac
tgggaggctgtaggcataaattggtgcgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377643_X_P-B Feature FT:CDS GQ377643_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J258). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgcgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaatgatctttgtac
tgggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ377644_X_P-B Feature FT:CDS GQ377644_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J294). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctatcgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactctcggactgtcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggcggagggtaggttaatgagctttgtac
tggtaagctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ475340_X_P-B Feature FT:CDS GQ475340_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate KOR36HCC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccataggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagtcgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ855522_X_P-B Feature FT:CDS GQ855522_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate migrant 23). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaagcatacttcaaagactgtatgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgtacaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ855526_X_P-B Feature FT:CDS GQ855526_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate migrant 103). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgctcctccgtctcccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgaccacggtcttacataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ855529_X_P-B Feature FT:CDS GQ855529_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate migrant 198). Partial genome (Contains: HBe, HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacctgcccaaggtcttgcatcagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ855689_X_P-B Feature FT:CDS GQ855689_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate migrant 3469). Partial genome (Contains: HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgctcctccgtctaccgtaccgaccgaccacggggcgcacctct
ctttacccggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgcgaacgcccaccagaacctgaccaaggccttacacaacaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgactgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ924603_X_P-B Feature FT:CDS GQ924603_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaattggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ924605_X_P-B Feature FT:CDS GQ924605_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M11). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctgtaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ924606_X_P-B Feature FT:CDS GQ924606_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M12). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggcctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaatctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ924607_X_P-B Feature FT:CDS GQ924607_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M13). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgctcaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ924608_X_P-B Feature FT:CDS GQ924608_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M15). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcacggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ924610_X_P-B Feature FT:CDS GQ924610_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M19). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ924611_X_P-B Feature FT:CDS GQ924611_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M28). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ924617_X_P-B Feature FT:CDS GQ924617_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M34). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgttcaatgagtgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ924621_X_P-B Feature FT:CDS GQ924621_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M39). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccacttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgccaaaggtcttgcataagaggactcttggactctcagcactgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttactgagtgggaggagttgggggaggagatcaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ924624_X_P-B Feature FT:CDS GQ924624_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M42). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggacgcttgggactctaccgcccgcttctccgcctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccgaaacctgcccaaggtcttgcataagaggactcttggacttttagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ924625_X_P-B Feature FT:CDS GQ924625_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M43). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggacttttagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ924626_X_P-B Feature FT:CDS GQ924626_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M47). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctttaccgcccgcttctccgtctgccgtatcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttacataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ924627_X_P-B Feature FT:CDS GQ924627_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M48). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ924628_X_P-B Feature FT:CDS GQ924628_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M50). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccggccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagactaagttaatgatctttgtac
taggaggctgtaagcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ924630_X_P-B Feature FT:CDS GQ924630_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M52). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ924631_X_P-B Feature FT:CDS GQ924631_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M53). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagctgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ924632_X_P-B Feature FT:CDS GQ924632_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M54). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ924634_X_P-B Feature FT:CDS GQ924634_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M57). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagagaactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ924635_X_P-B Feature FT:CDS GQ924635_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M67). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgaatgggaggagctgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccaacaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ924637_X_P-B Feature FT:CDS GQ924637_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M69). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgcggtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaccttgcccaaggtcttacataagaggactcttggactttcagcaatgtcaacgatcga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ924638_X_P-B Feature FT:CDS GQ924638_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M70). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggtctctaccgcccgcttctccgtctgcagtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ924639_X_P-B Feature FT:CDS GQ924639_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M71). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggtctctaccgcccgcttctccgtctgcggtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ924640_X_P-B Feature FT:CDS GQ924640_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M72). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcgatgaccga
ccttgaggcatacttcaaagactgtgtgtttactgaatgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ924641_X_P-B Feature FT:CDS GQ924641_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M76). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgtccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcaacaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ924644_X_P-B Feature FT:CDS GQ924644_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M79). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgctcaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
tagggggctgtaggcataaattggtgtgatcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ924645_X_P-B Feature FT:CDS GQ924645_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M82). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccctcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcacaagaggactcttggacttttagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ924646_X_P-B Feature FT:CDS GQ924646_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M83). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ924647_X_P-B Feature FT:CDS GQ924647_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M84). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtatcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ924648_X_P-B Feature FT:CDS GQ924648_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ924651_X_P-B Feature FT:CDS GQ924651_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M88). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgaccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ924653_X_P-B Feature FT:CDS GQ924653_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M90). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacatcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ924654_X_P-B Feature FT:CDS GQ924654_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M91). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgaccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ924656_X_P-B Feature FT:CDS GQ924656_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M93). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacttgcccaaggtcttgcacacgaggactcttggactttcagtcatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagtcgggggaggagagtaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU357842_X_P-B Feature FT:CDS GU357842_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C4371). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgtgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU434372_X_P-B Feature FT:CDS GU434372_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 011-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctccaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgtccaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU434373_X_P-B Feature FT:CDS GU434373_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 209-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgtccaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU451682_X_P-B Feature FT:CDS GU451682_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate pLL-EGFP). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815548_X_P-B Feature FT:CDS GU815548_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgtgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815549_X_P-B Feature FT:CDS GU815549_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815550_X_P-B Feature FT:CDS GU815550_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815551_X_P-B Feature FT:CDS GU815551_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815552_X_P-B Feature FT:CDS GU815552_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815553_X_P-B Feature FT:CDS GU815553_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815554_X_P-B Feature FT:CDS GU815554_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815555_X_P-B Feature FT:CDS GU815555_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-8). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815556_X_P-B Feature FT:CDS GU815556_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-9). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815557_X_P-B Feature FT:CDS GU815557_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-10). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815558_X_P-B Feature FT:CDS GU815558_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-11). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815559_X_P-B Feature FT:CDS GU815559_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-12). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815560_X_P-B Feature FT:CDS GU815560_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctaaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815561_X_P-B Feature FT:CDS GU815561_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815562_X_P-B Feature FT:CDS GU815562_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815563_X_P-B Feature FT:CDS GU815563_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815564_X_P-B Feature FT:CDS GU815564_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815565_X_P-B Feature FT:CDS GU815565_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815566_X_P-B Feature FT:CDS GU815566_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815567_X_P-B Feature FT:CDS GU815567_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-8). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815568_X_P-B Feature FT:CDS GU815568_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-9). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815569_X_P-B Feature FT:CDS GU815569_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-10). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815570_X_P-B Feature FT:CDS GU815570_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-11). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815571_X_P-B Feature FT:CDS GU815571_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-12). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815572_X_P-B Feature FT:CDS GU815572_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A3-1). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttataccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtccacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttccgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaataggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815573_X_P-B Feature FT:CDS GU815573_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A3-2). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815574_X_P-B Feature FT:CDS GU815574_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A3-3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcctcacctctgcacgtcgcatggag
accaccgtgaacacccccgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815575_X_P-B Feature FT:CDS GU815575_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A3-4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815576_X_P-B Feature FT:CDS GU815576_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A3-5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815577_X_P-B Feature FT:CDS GU815577_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A3-6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcctcacctctgcacgtcgcatggag
accaccgtgaacacccccgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815578_X_P-B Feature FT:CDS GU815578_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A3-7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccccgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815579_X_P-B Feature FT:CDS GU815579_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1-10). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggggttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815581_X_P-B Feature FT:CDS GU815581_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1-12). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815583_X_P-B Feature FT:CDS GU815583_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1-2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815584_X_P-B Feature FT:CDS GU815584_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1-3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815585_X_P-B Feature FT:CDS GU815585_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1-4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815586_X_P-B Feature FT:CDS GU815586_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1-5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815587_X_P-B Feature FT:CDS GU815587_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1-6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815588_X_P-B Feature FT:CDS GU815588_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1-7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815589_X_P-B Feature FT:CDS GU815589_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1-8). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815590_X_P-B Feature FT:CDS GU815590_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1-9). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctacacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815591_X_P-B Feature FT:CDS GU815591_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2-10). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815593_X_P-B Feature FT:CDS GU815593_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2-12). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815594_X_P-B Feature FT:CDS GU815594_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcacttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815595_X_P-B Feature FT:CDS GU815595_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2-2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815596_X_P-B Feature FT:CDS GU815596_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2-3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815597_X_P-B Feature FT:CDS GU815597_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2-4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815598_X_P-B Feature FT:CDS GU815598_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2-5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815599_X_P-B Feature FT:CDS GU815599_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2-6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815600_X_P-B Feature FT:CDS GU815600_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2-7). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815601_X_P-B Feature FT:CDS GU815601_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2-8). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcgaactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815602_X_P-B Feature FT:CDS GU815602_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2-9). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctcc
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815603_X_P-B Feature FT:CDS GU815603_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-10). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815604_X_P-B Feature FT:CDS GU815604_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-11). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815605_X_P-B Feature FT:CDS GU815605_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-12). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacttct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815606_X_P-B Feature FT:CDS GU815606_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815607_X_P-B Feature FT:CDS GU815607_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815608_X_P-B Feature FT:CDS GU815608_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctccgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815609_X_P-B Feature FT:CDS GU815609_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815610_X_P-B Feature FT:CDS GU815610_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaaccccttcacctctgcctaa
>gnl|hbvcds|GU815611_X_P-B Feature FT:CDS GU815611_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-6). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815612_X_P-B Feature FT:CDS GU815612_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggttgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815613_X_P-B Feature FT:CDS GU815613_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-8). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815614_X_P-B Feature FT:CDS GU815614_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-9). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815616_X_P-B Feature FT:CDS GU815616_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1-11). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acggcccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815617_X_P-B Feature FT:CDS GU815617_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1-12). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagctgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815618_X_P-B Feature FT:CDS GU815618_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815619_X_P-B Feature FT:CDS GU815619_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1-2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815620_X_P-B Feature FT:CDS GU815620_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1-3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815621_X_P-B Feature FT:CDS GU815621_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1-4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815622_X_P-B Feature FT:CDS GU815622_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1-5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagctgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815623_X_P-B Feature FT:CDS GU815623_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1-6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagtttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815624_X_P-B Feature FT:CDS GU815624_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1-7). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815625_X_P-B Feature FT:CDS GU815625_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1-8). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815626_X_P-B Feature FT:CDS GU815626_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1-9). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815627_X_P-B Feature FT:CDS GU815627_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C2-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815628_X_P-B Feature FT:CDS GU815628_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C2-2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815629_X_P-B Feature FT:CDS GU815629_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C2-3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815630_X_P-B Feature FT:CDS GU815630_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C2-4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815631_X_P-B Feature FT:CDS GU815631_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C2-5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatatttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815632_X_P-B Feature FT:CDS GU815632_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C2-6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815633_X_P-B Feature FT:CDS GU815633_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C2-7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815634_X_P-B Feature FT:CDS GU815634_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-10). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggaccctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815635_X_P-B Feature FT:CDS GU815635_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-11). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815636_X_P-B Feature FT:CDS GU815636_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-12). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815637_X_P-B Feature FT:CDS GU815637_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgcgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815638_X_P-B Feature FT:CDS GU815638_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815639_X_P-B Feature FT:CDS GU815639_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815640_X_P-B Feature FT:CDS GU815640_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctaaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815641_X_P-B Feature FT:CDS GU815641_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815642_X_P-B Feature FT:CDS GU815642_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
tagggggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815643_X_P-B Feature FT:CDS GU815643_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcctggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815644_X_P-B Feature FT:CDS GU815644_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-8). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815645_X_P-B Feature FT:CDS GU815645_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-9). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815646_X_P-B Feature FT:CDS GU815646_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1.D1.5-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815647_X_P-B Feature FT:CDS GU815647_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2.D1.5-2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815648_X_P-B Feature FT:CDS GU815648_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 3.D1.5-3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815649_X_P-B Feature FT:CDS GU815649_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 4.D1.5-4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815650_X_P-B Feature FT:CDS GU815650_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 5.D1.5-5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggtgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815651_X_P-B Feature FT:CDS GU815651_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 6.D1.5-6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815652_X_P-B Feature FT:CDS GU815652_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 7.D1.5-7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815653_X_P-B Feature FT:CDS GU815653_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 8.D1.5-8). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgtccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815654_X_P-B Feature FT:CDS GU815654_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 9.D1.5-9). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815656_X_P-B Feature FT:CDS GU815656_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 11.D1.5-11). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaagctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815657_X_P-B Feature FT:CDS GU815657_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 12.D1.5-12). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815658_X_P-B Feature FT:CDS GU815658_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815659_X_P-B Feature FT:CDS GU815659_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2-2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815660_X_P-B Feature FT:CDS GU815660_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2-3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815661_X_P-B Feature FT:CDS GU815661_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2-4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctccgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815662_X_P-B Feature FT:CDS GU815662_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2-5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815663_X_P-B Feature FT:CDS GU815663_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2-6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815664_X_P-B Feature FT:CDS GU815664_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2-7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815665_X_P-B Feature FT:CDS GU815665_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2-8). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815666_X_P-B Feature FT:CDS GU815666_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2-9). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815667_X_P-B Feature FT:CDS GU815667_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3-10). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgctcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815668_X_P-B Feature FT:CDS GU815668_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3-11). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815669_X_P-B Feature FT:CDS GU815669_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3-12). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815670_X_P-B Feature FT:CDS GU815670_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttccccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccctctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccaa
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815672_X_P-B Feature FT:CDS GU815672_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3-3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815673_X_P-B Feature FT:CDS GU815673_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3-4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815674_X_P-B Feature FT:CDS GU815674_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3-5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815675_X_P-B Feature FT:CDS GU815675_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3-6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815676_X_P-B Feature FT:CDS GU815676_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3-7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815677_X_P-B Feature FT:CDS GU815677_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3-8). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815678_X_P-B Feature FT:CDS GU815678_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3-9). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815679_X_P-B Feature FT:CDS GU815679_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E1-10). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctcccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815680_X_P-B Feature FT:CDS GU815680_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E1-11). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815681_X_P-B Feature FT:CDS GU815681_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E1-12). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815683_X_P-B Feature FT:CDS GU815683_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E1-2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815684_X_P-B Feature FT:CDS GU815684_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E1-3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815685_X_P-B Feature FT:CDS GU815685_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E1-4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcttgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815686_X_P-B Feature FT:CDS GU815686_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E1-5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815687_X_P-B Feature FT:CDS GU815687_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E1-6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815688_X_P-B Feature FT:CDS GU815688_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E1-7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaaccttttcacctctgcctaa
>gnl|hbvcds|GU815689_X_P-B Feature FT:CDS GU815689_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E1-8). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815691_X_P-B Feature FT:CDS GU815691_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E2-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815692_X_P-B Feature FT:CDS GU815692_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E2-2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccacttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815693_X_P-B Feature FT:CDS GU815693_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E2-3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815695_X_P-B Feature FT:CDS GU815695_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E2-5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815696_X_P-B Feature FT:CDS GU815696_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E2-6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815697_X_P-B Feature FT:CDS GU815697_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E2-7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815698_X_P-B Feature FT:CDS GU815698_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E2-8). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815699_X_P-B Feature FT:CDS GU815699_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-10). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815700_X_P-B Feature FT:CDS GU815700_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-11). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815701_X_P-B Feature FT:CDS GU815701_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-12). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815702_X_P-B Feature FT:CDS GU815702_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815703_X_P-B Feature FT:CDS GU815703_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815704_X_P-B Feature FT:CDS GU815704_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagataaggtcaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815705_X_P-B Feature FT:CDS GU815705_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815706_X_P-B Feature FT:CDS GU815706_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815707_X_P-B Feature FT:CDS GU815707_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaaccccttcacctctgcctaa
>gnl|hbvcds|GU815708_X_P-B Feature FT:CDS GU815708_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815709_X_P-B Feature FT:CDS GU815709_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-8). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815710_X_P-B Feature FT:CDS GU815710_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-9). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815711_X_P-B Feature FT:CDS GU815711_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-10). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcgtccaccggaccgtgtgcacttcgcttcacctccgcacgtcgcatggag
accaccgtgaacgcccaccgaaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815712_X_P-B Feature FT:CDS GU815712_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-11). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgaaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815713_X_P-B Feature FT:CDS GU815713_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-12). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgaaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815715_X_P-B Feature FT:CDS GU815715_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgaaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815716_X_P-B Feature FT:CDS GU815716_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgaaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815717_X_P-B Feature FT:CDS GU815717_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgaaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815718_X_P-B Feature FT:CDS GU815718_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgaaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815719_X_P-B Feature FT:CDS GU815719_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgaaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815720_X_P-B Feature FT:CDS GU815720_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccaccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccgaaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815721_X_P-B Feature FT:CDS GU815721_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-8). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgaaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggttaaaggtctttgtat
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815722_X_P-B Feature FT:CDS GU815722_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-9). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ccttacgcggtctccccgtctgtgccttctcatccaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccgaaacctgcccaaggtcttgcatcagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815723_X_P-B Feature FT:CDS GU815723_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-10). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccgaaacctgcccaaggtcttgcatcagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggttaaaggtctttgtat
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815724_X_P-B Feature FT:CDS GU815724_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-11). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccgaaacctgcccaaggtcttgcatcagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815725_X_P-B Feature FT:CDS GU815725_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-12). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccaccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccgaaacctgcccaaggtcttgcatcagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815726_X_P-B Feature FT:CDS GU815726_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttggttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccgaaacctgcccaaggtcttgcatcagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815727_X_P-B Feature FT:CDS GU815727_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccgcggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgaaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815728_X_P-B Feature FT:CDS GU815728_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccgaaacctgcccaaggtcttgcatcagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815729_X_P-B Feature FT:CDS GU815729_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgaaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggttaaaggtctttgtat
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815730_X_P-B Feature FT:CDS GU815730_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccgaaacctgcccaaggtcttgcatcagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815731_X_P-B Feature FT:CDS GU815731_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccgaaacctgcccaaggtcttgcatcagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815732_X_P-B Feature FT:CDS GU815732_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttagggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccgaaacctgcccaaggtcttgcatcagaggactcttggactttcagcaatgccaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttagaggtctttgtat
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815733_X_P-B Feature FT:CDS GU815733_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-8). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcaaccgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgaaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggttaaaggtctttgtat
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815734_X_P-B Feature FT:CDS GU815734_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-9). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccgaaacctgcccaaggtcttgcatcagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815735_X_P-B Feature FT:CDS GU815735_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-10). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccgaaacctgcccaaggtcttgcatcagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815736_X_P-B Feature FT:CDS GU815736_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-11). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccgaaacctgcccaaggtcttgcatcagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815737_X_P-B Feature FT:CDS GU815737_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-12). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccgaaacctgcccaaggtcttgcatcagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815738_X_P-B Feature FT:CDS GU815738_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccgaaacctgcccaaggtcttgcatcagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815739_X_P-B Feature FT:CDS GU815739_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccgaaacctgcccaaggtcttgcatcagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815740_X_P-B Feature FT:CDS GU815740_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccgaaacctgcccaaggttttgcatcagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815741_X_P-B Feature FT:CDS GU815741_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-4). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccgaaacctgcccaaggtcttgcatcagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815742_X_P-B Feature FT:CDS GU815742_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccgaaacctgcccaaggtcttgcatcagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815743_X_P-B Feature FT:CDS GU815743_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccgaaacctgcccaaggtcttgcatcagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815744_X_P-B Feature FT:CDS GU815744_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccgaaacctgcccaaggtcttgcatcagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815745_X_P-B Feature FT:CDS GU815745_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-8). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccgaaacctgcccaaggtcttgcatcagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815746_X_P-B Feature FT:CDS GU815746_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-9). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccgaaacctgcccaaggtcttgcatcagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815747_X_P-B Feature FT:CDS GU815747_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-10). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaacggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815748_X_P-B Feature FT:CDS GU815748_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-11). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaacggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815749_X_P-B Feature FT:CDS GU815749_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-12). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaacggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815750_X_P-B Feature FT:CDS GU815750_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-14). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaacggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815751_X_P-B Feature FT:CDS GU815751_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaacggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815752_X_P-B Feature FT:CDS GU815752_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaacggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815753_X_P-B Feature FT:CDS GU815753_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaacggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815754_X_P-B Feature FT:CDS GU815754_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaacggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815755_X_P-B Feature FT:CDS GU815755_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaacggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815756_X_P-B Feature FT:CDS GU815756_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaacggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815757_X_P-B Feature FT:CDS GU815757_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaacggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815759_X_P-B Feature FT:CDS GU815759_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-9). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaacggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815760_X_P-B Feature FT:CDS GU815760_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-10). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaacggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815761_X_P-B Feature FT:CDS GU815761_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-11). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaacggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815762_X_P-B Feature FT:CDS GU815762_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-12). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaacggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815764_X_P-B Feature FT:CDS GU815764_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaacggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815765_X_P-B Feature FT:CDS GU815765_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaacggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815766_X_P-B Feature FT:CDS GU815766_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaacggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815767_X_P-B Feature FT:CDS GU815767_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaacggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815768_X_P-B Feature FT:CDS GU815768_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaacggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815769_X_P-B Feature FT:CDS GU815769_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaacggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815770_X_P-B Feature FT:CDS GU815770_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-8). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaacggaacctgcccagggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815771_X_P-B Feature FT:CDS GU815771_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-9). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaacggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815772_X_P-B Feature FT:CDS GU815772_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-10). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaacggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815773_X_P-B Feature FT:CDS GU815773_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-11). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaacggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815774_X_P-B Feature FT:CDS GU815774_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-12). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaacggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815775_X_P-B Feature FT:CDS GU815775_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaacggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815776_X_P-B Feature FT:CDS GU815776_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-21). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaacggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815777_X_P-B Feature FT:CDS GU815777_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaacggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815778_X_P-B Feature FT:CDS GU815778_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaacggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815779_X_P-B Feature FT:CDS GU815779_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaacggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815780_X_P-B Feature FT:CDS GU815780_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgcgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaacggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815781_X_P-B Feature FT:CDS GU815781_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaacggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815782_X_P-B Feature FT:CDS GU815782_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-8). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaacggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU815783_X_P-B Feature FT:CDS GU815783_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-9). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaacggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaaccccttcacctctgcctaa
>gnl|hbvcds|HM011466_X_P-B Feature FT:CDS HM011466_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctgtaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggyctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagaykaggttaatgstctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|HM011467_X_P-B Feature FT:CDS HM011467_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcacggggccgcttggggctctaccgcccgcttctccgtctgcmgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttgctgagtgggaggagttgggggaggagatkaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM011469_X_P-B Feature FT:CDS HM011469_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggcctctaccgcccgcttctccgcctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgaaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM011470_X_P-B Feature FT:CDS HM011470_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggctaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM011471_X_P-B Feature FT:CDS HM011471_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcayctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactgtcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM011473_X_P-B Feature FT:CDS HM011473_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcycggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctyccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgtccaccagcaccaygcractttttcacctctgcctaa
>gnl|hbvcds|HM011474_X_P-B Feature FT:CDS HM011474_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttagggctctaccgcccgcttctccgcttgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggactctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttacggagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgcgttcaccagcaccctgcaactttttcacctctgcctaa
>gnl|hbvcds|HM011475_X_P-B Feature FT:CDS HM011475_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccgcctgttgtwccaaccgaccacggggcgcacctct
ctttacgcggtctccccrtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccccgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgwaggcataaattggtgcgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM011476_X_P-B Feature FT:CDS HM011476_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctttgccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttacataagaggactcttggactttcaacaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM011477_X_P-B Feature FT:CDS HM011477_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcttgatgtwccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttacataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgcgttcaccagcaccacgcaactttttcacctctgcctaa
>gnl|hbvcds|HM011478_X_P-B Feature FT:CDS HM011478_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacrcccvcgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagrttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM011480_X_P-B Feature FT:CDS HM011480_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccmcgggaacctgcccaaggtcttgcacaagagaactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaacgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM011482_X_P-B Feature FT:CDS HM011482_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgccaactggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatactttaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgcgttcaccagcaccaygcaactttttcacctctgcctra
>gnl|hbvcds|HM011483_X_P-B Feature FT:CDS HM011483_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttacggagtgggaggagttgggggaggaggktaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM011484_X_P-B Feature FT:CDS HM011484_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgctgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccagaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM011487_X_P-B Feature FT:CDS HM011487_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctgtaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttgctgagtgggaggagttggggaaggagaataggttaatgatttatgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctga
>gnl|hbvcds|HM011490_X_P-B Feature FT:CDS HM011490_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgyctgccgtatcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcggaacctgcccaaggtcttgcataagaggactcttggactgtcaacaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggtgaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM011492_X_P-B Feature FT:CDS HM011492_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgyttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM011494_X_P-B Feature FT:CDS HM011494_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgcgttcaccrgcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM011496_X_P-B Feature FT:CDS HM011496_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcacatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttacataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagaataggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgyaactttttcacctctgcctaa
>gnl|hbvcds|HM011499_X_P-B Feature FT:CDS HM011499_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccgcctgccgtaccggccgaccacgggkcgcacctct
ctttacgcggmctccccgtctgtgccttctcatctgccggrccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccmtgcaactttttcacctctgcctaa
>gnl|hbvcds|HM011503_X_P-B Feature FT:CDS HM011503_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccccgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcacccgcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM011504_X_P-B Feature FT:CDS HM011504_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcgtttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggmccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacctgcccaaggtcttgtataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM153811_X_P-B Feature FT:CDS HM153811_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 712005001256). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700546_X_P-B Feature FT:CDS HQ700546_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate BC_NC_AM263). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggcctttaccgcccgcttctccgcctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttacataagaggactcttggccttttagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700548_X_P-B Feature FT:CDS HQ700548_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I_WA1031A). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctcacggggccgcttggggctgtaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HQ700549_X_P-B Feature FT:CDS HQ700549_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I_WA1098A). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctgtaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaagcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF412801_X_P-B Feature FT:CDS JF412801_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBVJSTZ3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggctgtgctgccaactggatcttgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF436921_X_P-B Feature FT:CDS JF436921_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SZ7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggaccctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggagtaccgaccgaccacggggcgcacctct
ctttacgcgaactccccgtctgtgccttttcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JF899335_X_P-B Feature FT:CDS JF899335_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 10B1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN406371_X_P-B Feature FT:CDS JN406371_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WHUB1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccgaggtcttgcataagaggactcttggactttcagtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN792893_X_P-B Feature FT:CDS JN792893_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MN2004). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccgcctgccgttccggccgaccacggggcgtacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttatataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagactaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|JN792894_X_P-B Feature FT:CDS JN792894_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MN2009). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccacttctccgcctgccgttccgaccgaccacggggcgtacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttacataagaggactcttggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagactaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|JN792895_X_P-B Feature FT:CDS JN792895_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate KM2004). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccgtctgccgtatcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttacataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttactgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|JN792896_X_P-B Feature FT:CDS JN792896_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate KM2009). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccgtctgccgtatcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttacataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttactgagtgggaggagttgggggaggagatgaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|JN792897_X_P-B Feature FT:CDS JN792897_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate IT2009). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccgcctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttatataagaggactcttggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagtctaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|JN792898_X_P-B Feature FT:CDS JN792898_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate IT2004). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccgcctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttatataagaggactcttggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagtctaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|JN792899_X_P-B Feature FT:CDS JN792899_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate AT2004). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggatgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgattctccgccagccgttccgaccgaccacggggcgtacctct
ctttacgcggcctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttacataagaggactcttggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|JN792900_X_P-B Feature FT:CDS JN792900_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate AT2009). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccgcctgccgttccgaccgaccacggggcgtacctct
ctttacgcggcctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttacataagaggactcttggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|JN792901_X_P-B Feature FT:CDS JN792901_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate AD2009). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccccttctccgtctgccgtaccgcccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgaaacctgcccaaggtcttacataagaggactcttggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtatttactgagtgggaggagttgggggaggagatgaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN792902_X_P-B Feature FT:CDS JN792902_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate AD2004). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccccttctccgtctgccgtaccgcccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgaaacctgcccaaggtcttacataagaggactcttggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtatttactgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|JN827419_X_P-B Feature FT:CDS JN827419_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2539). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagtaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ027311_X_P-B Feature FT:CDS JQ027311_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggcctctaccgcccgcttctccgcctgccgtaccggccgaccacggggcgcatctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttgcataagaggactcttggactttcagtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatacaactttttcacctctgcctaa
>gnl|hbvcds|JQ027313_X_P-B Feature FT:CDS JQ027313_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttgtataagaggactcttggactttcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggctaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ027315_X_P-B Feature FT:CDS JQ027315_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagttgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgcgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ027316_X_P-B Feature FT:CDS JQ027316_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctrccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttatataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ027325_X_P-B Feature FT:CDS JQ027325_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgtggttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccccgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ027329_X_P-B Feature FT:CDS JQ027329_X_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtrctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccccgggaacctgcccaaggtcttatataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccaggcaactttttcacctctgcctaa
>gnl|hbvcds|JQ027330_X_P-B Feature FT:CDS JQ027330_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccrgaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagtctgtgtgtttattgagtgggaggagctgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ027331_X_P-B Feature FT:CDS JQ027331_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccrgaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagtctgtgtgtttattgagtgggaggagctgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ027334_X_P-B Feature FT:CDS JQ027334_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgyctgccgtwccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaatctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ040125_X_P-B Feature FT:CDS JQ040125_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 8). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ040128_X_P-B Feature FT:CDS JQ040128_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 69). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccggccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaacgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ040138_X_P-B Feature FT:CDS JQ040138_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 240). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacargrwcttgcccaaggtcttgcataagaggactcttggactgtcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ040147_X_P-B Feature FT:CDS JQ040147_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 280). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgccccctggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ040157_X_P-B Feature FT:CDS JQ040157_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G187). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ040169_X_P-B Feature FT:CDS JQ040169_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G237). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgaccgcttctccgcctattgtaccgaccgaccacggggcgaacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacraccga
ccttgaggcatacttcaaagactgtgtgtttaccgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgcgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ040170_X_P-B Feature FT:CDS JQ040170_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G238). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctctcgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactkwcaccaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagtwgggggaggaggttaggtwaaaggtcttkgtrc
taggaggctgtatgcatawattggtgtgtwcaccascaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ040171_X_P-B Feature FT:CDS JQ040171_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G239). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaaatttttcacctctgcctaa
>gnl|hbvcds|JQ040173_X_P-B Feature FT:CDS JQ040173_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G244). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgaccgcttctccgcctcttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaaatttttcacctctgcctaa
>gnl|hbvcds|JQ341793_X_P-B Feature FT:CDS JQ341793_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno01). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=462 residues).
atggctgctaggctgtgctgccaactggatcttacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcacggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgccaaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcc
>gnl|hbvcds|JQ341794_X_P-B Feature FT:CDS JQ341794_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno02). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=462 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcc
>gnl|hbvcds|JQ341795_X_P-B Feature FT:CDS JQ341795_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno03). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=462 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttamtgagtgggaggagttgggggaggagrttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgygttcaccagcaccatgcaactttttcacctctgcc
>gnl|hbvcds|JQ341796_X_P-B Feature FT:CDS JQ341796_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno04). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=462 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcc
>gnl|hbvcds|JQ341797_X_P-B Feature FT:CDS JQ341797_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno05). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=462 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacwggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcc
>gnl|hbvcds|JQ341798_X_P-B Feature FT:CDS JQ341798_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno06). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=462 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctgtaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccgrrccgtgtgcacttcgcttcacctctgcacgtcgcatggar
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgkgggaggagattaggtyaaaggtctttgtrc
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcc
>gnl|hbvcds|JQ341799_X_P-B Feature FT:CDS JQ341799_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno07). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=462 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcgtttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcc
>gnl|hbvcds|JQ341800_X_P-B Feature FT:CDS JQ341800_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno08). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=462 residues).
atggctgctaggctgtrctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggctaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcc
>gnl|hbvcds|JQ341802_X_P-B Feature FT:CDS JQ341802_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno10). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=462 residues).
atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttamtgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcc
>gnl|hbvcds|JQ341803_X_P-B Feature FT:CDS JQ341803_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno11). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=462 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggactctaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggar
accaccgtgaacgcccactggaacctgcccaaggtcttrcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttamtgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcc
>gnl|hbvcds|JQ341804_X_P-B Feature FT:CDS JQ341804_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno12). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=462 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccacggaaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaacgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgcgttcaccagcaccatgcaactttttcacctctgcc
>gnl|hbvcds|JQ341807_X_P-B Feature FT:CDS JQ341807_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno15). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=462 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcmtacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcc
>gnl|hbvcds|JQ341808_X_P-B Feature FT:CDS JQ341808_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno16). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=462 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttrgggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgtaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgtncaccagcaccatgcaactttttcacctctgcc
>gnl|hbvcds|JQ341809_X_P-B Feature FT:CDS JQ341809_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno17). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=462 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttgtaccggccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
tcggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcc
>gnl|hbvcds|JQ341810_X_P-B Feature FT:CDS JQ341810_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno18). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=462 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcc
>gnl|hbvcds|JQ341811_X_P-B Feature FT:CDS JQ341811_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno19). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=462 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgswstaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggar
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttrctgagtgggaggagttgggggaggagatkaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgygttcaccagcaccatgcaactttttcacctctgcc
>gnl|hbvcds|JQ341812_X_P-B Feature FT:CDS JQ341812_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno20). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=462 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgtttggggctctaccgcccgcttctccgcctcttataccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcc
>gnl|hbvcds|JQ341813_X_P-B Feature FT:CDS JQ341813_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno21). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=462 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggacgcttggggcyctaccgcccgcttctccgcctgttataccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccccagggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtay
taggaggctgtaggcataaattggtgcgtccaccagcaccatgcaactttttcacctctgcc
>gnl|hbvcds|JQ341814_X_P-B Feature FT:CDS JQ341814_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno22). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=462 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttatttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcc
>gnl|hbvcds|JQ341815_X_P-B Feature FT:CDS JQ341815_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno23). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=462 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctgtaccgcccgcttctccgcctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacyggaacytgcccaaggtcttacataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagaytaggttaatggtttttgtat
taggaggctgtaggcataaattggtctgtgcaccagcaccatgcaactttttcacctctgcc
>gnl|hbvcds|JQ341816_X_P-B Feature FT:CDS JQ341816_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno24). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=462 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaacgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcc
>gnl|hbvcds|JQ341817_X_P-B Feature FT:CDS JQ341817_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno25). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=462 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttgctgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgcgttcaccagcaccatgcaactttttcacctctgcc
>gnl|hbvcds|JQ341818_X_P-B Feature FT:CDS JQ341818_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno26). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=462 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcc
>gnl|hbvcds|JQ341819_X_P-B Feature FT:CDS JQ341819_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno27). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=462 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttagggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcggcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcc
>gnl|hbvcds|JQ341821_X_P-B Feature FT:CDS JQ341821_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno29). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=462 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccacttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggamcctgcccaaggtcttgcataaaaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgygttcaccagcaccatgcaactttttcacctctgcc
>gnl|hbvcds|JQ341822_X_P-B Feature FT:CDS JQ341822_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno30). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=462 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgctgtaccgaccaaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaacgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcc
>gnl|hbvcds|JQ341823_X_P-B Feature FT:CDS JQ341823_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno31). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=462 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccggccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcc
>gnl|hbvcds|JQ341824_X_P-B Feature FT:CDS JQ341824_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno32). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=462 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctataccgcccgctcctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgccaacggtcttacataagaggactcttggactttcagtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcc
>gnl|hbvcds|JQ341825_X_P-B Feature FT:CDS JQ341825_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno33). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=462 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagaaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggktaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcc
>gnl|hbvcds|JQ341826_X_P-B Feature FT:CDS JQ341826_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno34). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=462 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgctgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcc
>gnl|hbvcds|JQ341827_X_P-B Feature FT:CDS JQ341827_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno35). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=462 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctrttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggar
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttamtgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcc
>gnl|hbvcds|JQ341828_X_P-B Feature FT:CDS JQ341828_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno36). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=462 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaacgagtgggaggagctgggggaagaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcc
>gnl|hbvcds|JQ341830_X_P-B Feature FT:CDS JQ341830_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno38). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=462 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttctaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttamtgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcc
>gnl|hbvcds|JQ341831_X_P-B Feature FT:CDS JQ341831_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno39). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=462 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcmcggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggtggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcc
>gnl|hbvcds|JQ341833_X_P-B Feature FT:CDS JQ341833_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno41). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=462 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcacatggag
accaccgtgaacgcccaccgcaacctgcccaaggtcttacataagaggactcttggactttcggcaatgtcaacgaccga
ccttgaggcatacttcaaagaccgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcc
>gnl|hbvcds|JQ341835_X_P-B Feature FT:CDS JQ341835_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno43). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=462 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctatcgcccgcttctccgcctgttataccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgctcgcyggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcc
>gnl|hbvcds|JQ341836_X_P-B Feature FT:CDS JQ341836_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno44). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=462 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcwtggggctctaccgcccgcttctccgcctgttstaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccmcgggaacctgcccaaggtcttgcataagaggactcttggactytcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaagctaggttaatgatctttgtac
taggaggctgtaggcataaattggtgcgttcaccagcaccatgcaactttttcacctctgcc
>gnl|hbvcds|JQ341837_X_P-B Feature FT:CDS JQ341837_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno45). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=462 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcc
>gnl|hbvcds|JQ341838_X_P-B Feature FT:CDS JQ341838_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno46). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=462 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgtygttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgccctcgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgaggacactgagtgggaggagttgggggaggagattaggttgaaggtctttgtrc
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcc
>gnl|hbvcds|JQ341839_X_P-B Feature FT:CDS JQ341839_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno47). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=462 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtgcgttcaccagcaccatgcaactttttcacctctgcc
>gnl|hbvcds|JQ341840_X_P-B Feature FT:CDS JQ341840_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno48). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=462 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcrgcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgctcctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcrtggag
accaccgtgaacgcccaccggaacctgccaacggtcttacataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatkaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcc
>gnl|hbvcds|JQ341842_X_P-B Feature FT:CDS JQ341842_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno50). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=462 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggwgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcc
>gnl|hbvcds|JQ341843_X_P-B Feature FT:CDS JQ341843_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno51). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=462 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttamtgagtgggaggagttgggtgaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcc
>gnl|hbvcds|JQ341844_X_P-B Feature FT:CDS JQ341844_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno52). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=462 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccactggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcc
>gnl|hbvcds|JQ341845_X_P-B Feature FT:CDS JQ341845_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno53). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=462 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgccaaaggtcttacataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggyataaattggtctgttcaccagcaccatgcaactttttcacctctgcc
>gnl|hbvcds|JQ341848_X_P-B Feature FT:CDS JQ341848_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno56). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=462 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgctcctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacyggaacctgmccaaggtcttacataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcc
>gnl|hbvcds|JQ341850_X_P-B Feature FT:CDS JQ341850_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno58). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=462 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttstaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccmcaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttgytgagtgggaggagttgggggcggaggctaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgtccaccagcaccatgcaactttttcacctctgcc
>gnl|hbvcds|JQ341853_X_P-B Feature FT:CDS JQ341853_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno61). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=462 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgctcaccggaacctgcccaaggtcttgcataagaggacccttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaacgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcc
>gnl|hbvcds|JQ429079_X_P-B Feature FT:CDS JQ429079_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 08.10.002). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatcaaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccattggaacctgcccaaggtcttrcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ429080_X_P-B Feature FT:CDS JQ429080_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 09.40.033). Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcggggcgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccatcggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ429081_X_P-B Feature FT:CDS JQ429081_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 09.80.055). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttagggctctaccgcccgcttctccgcctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggtgaggagatcaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ429082_X_P-B Feature FT:CDS JQ429082_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 09.41.591). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccatcggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagaccaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ688405_X_P-B Feature FT:CDS JQ688405_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBVB2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707734_X_P-B Feature FT:CDS JQ707734_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtatcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttacataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttgctgagtgggaggagttgggggaggagattaggttaaaggtttatgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707735_X_P-B Feature FT:CDS JQ707735_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_10). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtatcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccactggaacctgcccaaggtcttacataaaaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttgctgagtgggaggagttgggggaggagattaggttaaaggtttatgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707736_X_P-B Feature FT:CDS JQ707736_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_11). Partial genome (Contains: HBx). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtatcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccattggaacctgcccaaggtcttatataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaatggtttatgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707737_X_P-B Feature FT:CDS JQ707737_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_12). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtatcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttacataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtttatgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707738_X_P-B Feature FT:CDS JQ707738_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_14). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtatcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttacataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtttatgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707739_X_P-B Feature FT:CDS JQ707739_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_17). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtatcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttacataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtttatgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707740_X_P-B Feature FT:CDS JQ707740_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_18). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgccgtatcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccactggaacctgcccaaggtcttacataaaaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtttatgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707741_X_P-B Feature FT:CDS JQ707741_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_19). Partial genome (Contains: HBx). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtatcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccattggaacctgcccaaggtcttatataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtttatgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707742_X_P-B Feature FT:CDS JQ707742_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtatcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttacataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtttatgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707743_X_P-B Feature FT:CDS JQ707743_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_20-3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtatcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttacataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtttatgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707744_X_P-B Feature FT:CDS JQ707744_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_22). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctacagcccgcttctccgtctgccgtatcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttacataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtttatgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707745_X_P-B Feature FT:CDS JQ707745_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_23). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgccgtatcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccactggaacctgcccaaggtcttacataaaaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtttatgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707746_X_P-B Feature FT:CDS JQ707746_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_24-6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgccgtatcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccactggaacctgcccaaggtcttacataaaaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtttatgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707747_X_P-B Feature FT:CDS JQ707747_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_25). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtatcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttacataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtttatgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707748_X_P-B Feature FT:CDS JQ707748_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_26). Partial genome (Contains: HBx). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtatcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccattggaacctgcccaaggtcttatataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaatggtttatgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707749_X_P-B Feature FT:CDS JQ707749_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_27). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtatcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttacataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtttatgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707750_X_P-B Feature FT:CDS JQ707750_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_28). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtatcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttacataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtttatgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707751_X_P-B Feature FT:CDS JQ707751_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_30). Partial genome (Contains: HBx). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtatcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccattggaacctgcccaaggtcttatataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggaattgggggaggagattaggttaatggtttatgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707752_X_P-B Feature FT:CDS JQ707752_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_31). Partial genome (Contains: HBx). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtatcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccattggaacctgcccaaggtcttatataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaatggtttatgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707753_X_P-B Feature FT:CDS JQ707753_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_32). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgccgtatcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccactggaacctgcccaaggtcttacataaaaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtttatgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707754_X_P-B Feature FT:CDS JQ707754_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_33). Partial genome (Contains: HBx). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtatcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccattggaacctgcccaaggtcttatataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaatggtttatgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707755_X_P-B Feature FT:CDS JQ707755_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_38). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtatcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttacataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtttatgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707756_X_P-B Feature FT:CDS JQ707756_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_39). Partial genome (Contains: HBx). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtatcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccattggaacctgcccaaggtcttatataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaatggtttatgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707757_X_P-B Feature FT:CDS JQ707757_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_40). Partial genome (Contains: HBx). [Hepadnaviridae] (length=465 residues).
atggttgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtatcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccattggaacctgcccaaggtcttatataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaatggtttatgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707758_X_P-B Feature FT:CDS JQ707758_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_41). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtatcgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttacataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtttatgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707759_X_P-B Feature FT:CDS JQ707759_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_43). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtatcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttacataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtttatgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707760_X_P-B Feature FT:CDS JQ707760_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_44). Partial genome (Contains: HBx). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtatcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccattggaacctgcccaaggtcttatataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaatggtttatgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707761_X_P-B Feature FT:CDS JQ707761_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_45). Partial genome (Contains: HBx). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtatcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccattggaacctgcccaaggtcttatataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaatggtttatgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707762_X_P-B Feature FT:CDS JQ707762_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_46). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgagcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgccgtatcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccactggaacctgcccaaggtcttacataaaaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtttatgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707763_X_P-B Feature FT:CDS JQ707763_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_47). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtatcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttacataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtttatgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707764_X_P-B Feature FT:CDS JQ707764_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_48). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtatcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttacataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtttatgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707765_X_P-B Feature FT:CDS JQ707765_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtatcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggttttacataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtttatgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707766_X_P-B Feature FT:CDS JQ707766_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_8). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgccgtatcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccactggaacctgcccaaggtcttacataaaaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtttatgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707767_X_P-B Feature FT:CDS JQ707767_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_9). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtatcgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttacataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtttatgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ801471_X_P-B Feature FT:CDS JQ801471_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate AIDS7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ801474_X_P-B Feature FT:CDS JQ801474_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate AIDS16). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggacttgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ801479_X_P-B Feature FT:CDS JQ801479_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate AIDS22). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ801485_X_P-B Feature FT:CDS JQ801485_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate AIDS32). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctgtaccgcccgcttctccgcctcttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggacttgcagcactgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgcgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ801494_X_P-B Feature FT:CDS JQ801494_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CONTROL1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ801506_X_P-B Feature FT:CDS JQ801506_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CONTROL13). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggacgcttggggctctaccgcccgcttctccgcctagtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttttcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgtccaccggaacctgcccaaggtcttgcacaagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttgctgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccancaccatgccactttttcacctctgcctaa
>gnl|hbvcds|JQ801507_X_P-B Feature FT:CDS JQ801507_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CONTROL15). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccagcgggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ801512_X_P-B Feature FT:CDS JQ801512_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CONTROL20). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctatggtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggacttccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcactagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ801514_X_P-B Feature FT:CDS JQ801514_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CONTROL22). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ801516_X_P-B Feature FT:CDS JQ801516_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CONTROL24). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagctgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ801524_X_P-B Feature FT:CDS JQ801524_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CONTROL32). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JX026879_X_P-B Feature FT:CDS JX026879_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WY-NJ-17). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggagctgaatcccgcgg
acgacccctcccggggccgcttagggctctaccgcccgcttctccgccttttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggacttgcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgtgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JX026883_X_P-B Feature FT:CDS JX026883_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WY-NJ-50). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgtccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttgcatgagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctatgcac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JX026886_X_P-B Feature FT:CDS JX026886_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WY-NJ-73). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaaccggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggacgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaatttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttgaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JX429897_X_P-B Feature FT:CDS JX429897_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WY-HZ-12). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttctttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttgtaccgaccgaccacggggcgcacctct
ctttacgcggcctccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgtgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JX429899_X_P-B Feature FT:CDS JX429899_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WY-HZ-20). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagagaactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JX429900_X_P-B Feature FT:CDS JX429900_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WY-HZ-24). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JX429901_X_P-B Feature FT:CDS JX429901_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WY-HZ-33). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgagcaatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JX429902_X_P-B Feature FT:CDS JX429902_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WY-HZ-34). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcttgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggacgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JX429908_X_P-B Feature FT:CDS JX429908_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WY-HZ-58). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JX429910_X_P-B Feature FT:CDS JX429910_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WY-HZ-67). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JX429911_X_P-B Feature FT:CDS JX429911_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WY-NJ-45). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggcctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcactttgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaataggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JX504531_X_P-B Feature FT:CDS JX504531_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WY-HZ-1). Non-functional genomic sequence. [Hepadnaviridae] (length=462 residues).
atggctgctaggctgtgctgccaactggatcttgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggtg
ctggtgaacacccactggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccgacct
tgaggcatacttcaaagactgtgtgtttaatgagtgggaggatttgggggaggaggttaggttaatgatctttgtactag
gaggctgtaggcataaattggtgtgtgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JX504532_X_P-B Feature FT:CDS JX504532_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WY-HZ-5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctgttctaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggcggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JX504533_X_P-B Feature FT:CDS JX504533_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WY-HZ-16). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatgggg
accaccgtgaacgtccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacaaccga
ccttgagcaatacttcaaagactgtgtgtttaatgagtgggaggagttgggggcggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JX504538_X_P-B Feature FT:CDS JX504538_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WY-HZ-65). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagagcactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JX504543_X_P-B Feature FT:CDS JX504543_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WY-NNJ-19). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgccttgcgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JX507210_X_P-B Feature FT:CDS JX507210_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 16). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccacttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgagaacctgcccaaggtcttgcataagaggactcttggactttcagtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JX507213_X_P-B Feature FT:CDS JX507213_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 82). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggar
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactmttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaawggtctttgtac
taggaggctgtaggcataaattggtgygttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JX507215_X_P-B Feature FT:CDS JX507215_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 310). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttcggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JX661470_X_P-B Feature FT:CDS JX661470_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SH1221-B12). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgtccaactacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcacctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgccaacggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgagacatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|JX661471_X_P-B Feature FT:CDS JX661471_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SH1202-B1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
acccccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|JX661472_X_P-B Feature FT:CDS JX661472_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SH1224-B13). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|JX661473_X_P-B Feature FT:CDS JX661473_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SH1220-B11). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcctggggctctaccgcccgcttctccgcatcttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|JX661474_X_P-B Feature FT:CDS JX661474_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SH1229-B15). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|JX661475_X_P-B Feature FT:CDS JX661475_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SH1216-B9). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|JX661476_X_P-B Feature FT:CDS JX661476_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SH1227-B14). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|JX661477_X_P-B Feature FT:CDS JX661477_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SH1209-B5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtagcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagagaactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggatgaggttaggttaaaggtcttgtatc
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|JX661478_X_P-B Feature FT:CDS JX661478_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SH1211-B7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|JX661479_X_P-B Feature FT:CDS JX661479_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SH1219-B10). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcctggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgtccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgttcaatgagtgggaggagttgggggcggaggttaggttaatgatctttgtac
taggaggccttaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|JX661480_X_P-B Feature FT:CDS JX661480_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SH1210-B6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|JX661481_X_P-B Feature FT:CDS JX661481_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SH1214-B8). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgtttttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtcttgtacc
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|JX661482_X_P-B Feature FT:CDS JX661482_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SH1204-B2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctgtgtac
taggaggctgctgctatgaacgggtctgttcaccagcaccatgcaactttttcacgttagcctaa
>gnl|hbvcds|JX661483_X_P-B Feature FT:CDS JX661483_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SH1205-B3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccacttctccgcctgttgtaccgaccgactacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagatgaggttaaaggtctgtgtac
taggaggctgctgctatgaacgggtctgttcaccagcaccatgcaactttttcacgttagcctaa
>gnl|hbvcds|JX661484_X_P-B Feature FT:CDS JX661484_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SH1206-B4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgtacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggcg
accaccgtgaacgcccaccgaaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagcttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagctccatgcaactttttcacctctgcctag
>gnl|hbvcds|JX869998_X_P-B Feature FT:CDS JX869998_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 317). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JX869999_X_P-B Feature FT:CDS JX869999_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 14). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccacttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaccctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JX870001_X_P-B Feature FT:CDS JX870001_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 90). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctataccgcccgcttctccgcctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgcgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JX978431_X_P-B Feature FT:CDS JX978431_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate X02). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctctcctaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC163805_X_P-B Feature FT:CDS KC163805_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 3009). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcgcgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcaacaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggttaacggtctttgtac
taggaggctgtaggcataaattggtgtgtccaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC163809_X_P-B Feature FT:CDS KC163809_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 3043). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgaggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggagaagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgtccaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC163810_X_P-B Feature FT:CDS KC163810_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 3004). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggacccttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgtccaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC163811_X_P-B Feature FT:CDS KC163811_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 3010). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatgggg
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgtccaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC163812_X_P-B Feature FT:CDS KC163812_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 3024). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgtccaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC163813_X_P-B Feature FT:CDS KC163813_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 3029). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgtttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgtccaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC163814_X_P-B Feature FT:CDS KC163814_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 3046). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccgactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgtccaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC163815_X_P-B Feature FT:CDS KC163815_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 3048). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggattcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgtccaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC163816_X_P-B Feature FT:CDS KC163816_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 3002). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgtccaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC163817_X_P-B Feature FT:CDS KC163817_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 3003). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgtccaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC163818_X_P-B Feature FT:CDS KC163818_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 3013). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgtccaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC163819_X_P-B Feature FT:CDS KC163819_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 3014). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgtccaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC163820_X_P-B Feature FT:CDS KC163820_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 3016). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgtccaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC163821_X_P-B Feature FT:CDS KC163821_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 3018). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgtccaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC163822_X_P-B Feature FT:CDS KC163822_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 3025). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgtccaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC163823_X_P-B Feature FT:CDS KC163823_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 3026). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgtccaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC163824_X_P-B Feature FT:CDS KC163824_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 3027). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgtccaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC163825_X_P-B Feature FT:CDS KC163825_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 3031). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgtccaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC163826_X_P-B Feature FT:CDS KC163826_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 3033). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgtccaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC163827_X_P-B Feature FT:CDS KC163827_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 3036). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgtccaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC163828_X_P-B Feature FT:CDS KC163828_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 3035). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgtccaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC163829_X_P-B Feature FT:CDS KC163829_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 3040). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtatgcataaattggtgtgtccaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC163830_X_P-B Feature FT:CDS KC163830_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 3021). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccgggaccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtatgcataaattggtgtgtccaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC163831_X_P-B Feature FT:CDS KC163831_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 3044). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtatgcataaattggtgtgtccaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC163833_X_P-B Feature FT:CDS KC163833_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 3017). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgtccaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC315393_X_P-B Feature FT:CDS KC315393_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M0912). Partial genome (Contains: HBc, HBx, Pol). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC492739_X_P-B Feature FT:CDS KC492739_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MT). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcacatggaa
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC492740_X_P-B Feature FT:CDS KC492740_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Del). Partial genome (Contains: HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcacatggaa
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC510641_X_P-B Feature FT:CDS KC510641_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcacctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgccaacggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaaacatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcggctttttcacctctgcctaa
>gnl|hbvcds|KC510642_X_P-B Feature FT:CDS KC510642_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttagggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgcgttcacgaggaccccgcggctttttcacctctgcctaa
>gnl|hbvcds|KC510643_X_P-B Feature FT:CDS KC510643_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcgactttttcacctctgcctaa
>gnl|hbvcds|KC510644_X_P-B Feature FT:CDS KC510644_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtctgcgctgaatcccgcgg
acgacccctcccggggccgcttagggctctaccgcccgcttctccgccttttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaaccctcacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattgatgcgttcacgatgtccccgtgactttttcacctctgcctaa
>gnl|hbvcds|KC510646_X_P-B Feature FT:CDS KC510646_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgccttgtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcacccaccga
ccttgaggcatacttcaaagactgtgtgtttaaggagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgcgttcacgaggtccccgtggatttttcacctctgcctaa
>gnl|hbvcds|KC510647_X_P-B Feature FT:CDS KC510647_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcgactttttcacctctgcctaa
>gnl|hbvcds|KC510648_X_P-B Feature FT:CDS KC510648_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgccttgtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaaccctcacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattgatgcgttcacgatgtccatgcggctttttcacctctgcctaa
>gnl|hbvcds|KC510649_X_P-B Feature FT:CDS KC510649_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcacctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgccaacggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaaacatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcggctttttcacctctgcctaa
>gnl|hbvcds|KC510650_X_P-B Feature FT:CDS KC510650_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcgactttttcacctctgcctaa
>gnl|hbvcds|KC510651_X_P-B Feature FT:CDS KC510651_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcacctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgcgttcacgaggaccatgcgactttttcacctctgcctaa
>gnl|hbvcds|KC510652_X_P-B Feature FT:CDS KC510652_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttagggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgcgttcacgaggaccatgcgactttttcacctctgcctaa
>gnl|hbvcds|KC510653_X_P-B Feature FT:CDS KC510653_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtctgcgctgaatcccgcgg
acgacccctcccggggccgcttagggctctaccgcccgcttctccgccttttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcacccaccga
ccttgaggcatacttcaaagactgtgtgtttaaggagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgcgttcacgaggtccatgcggctttttcacctctgcctaa
>gnl|hbvcds|KC510654_X_P-B Feature FT:CDS KC510654_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttataccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactgtcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcgactttttcacctctgcctaa
>gnl|hbvcds|KC510655_X_P-B Feature FT:CDS KC510655_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttagggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgcgttcacgaggaccatgcgactttttcacctctgcctaa
>gnl|hbvcds|KC510656_X_P-B Feature FT:CDS KC510656_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttataccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactgtcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtgcgttcacggggtccatgcggctttttcacctctgcctaa
>gnl|hbvcds|KC510657_X_P-B Feature FT:CDS KC510657_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttataccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactgtcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagactaggttaatgatctttgtac
taggaggctgtaggcataaattggtgcgttcacggggtccatgcgactttttcacctctgcctaa
>gnl|hbvcds|KC510658_X_P-B Feature FT:CDS KC510658_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcacctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgccaacggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaaacatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcggctttttcacctctgcctaa
>gnl|hbvcds|KC510659_X_P-B Feature FT:CDS KC510659_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgccttgtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcacccaccga
ccttgaggcatacttcaaagactgtgtgtttaaggagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgcgttcacgaggtccatgcgactttttcacctctgcctaa
>gnl|hbvcds|KC510660_X_P-B Feature FT:CDS KC510660_X_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcgactttttcacctctgcctaa
>gnl|hbvcds|KC774362_X_P-B Feature FT:CDS KC774362_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate blz1107). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgtcgttccgaccgaccccggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtagcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttgtactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|KC774363_X_P-B Feature FT:CDS KC774363_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate blz2022). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgtcgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC774365_X_P-B Feature FT:CDS KC774365_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate blz2113). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC774366_X_P-B Feature FT:CDS KC774366_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate blz2116). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggactctaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC774367_X_P-B Feature FT:CDS KC774367_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate blz2147). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcctaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgttcaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC774368_X_P-B Feature FT:CDS KC774368_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bur1012). Complete genome. [Hepadnaviridae] (length=465 residues).
atgggtggtaggctgtgctgccaaatggatcctgcgcgggacgtcctttgtttacgtcccgttggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctttaccccccgcttttccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtttgtgccttttcatttgccgggccgtgtgcactttgctttacctttgcacgttgcaaggag
acccccgtgaacgcccacaggaacctgcccaaggttttgcataagaggactcttggactttcagcaaagtcaacgaccga
ccttgaggcatacttcaaagacagtttgtttactgaatgggaggagttgggggaggaggttaagttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|KC774369_X_P-B Feature FT:CDS KC774369_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bur1013). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaaatggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgaccccccccggggccgcttggggctctaccgcccgcttctccgtttgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttttcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggag
acccccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggaattttggacttttagcaatgtcaacgaccga
ccctgaggcatactttaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC774370_X_P-B Feature FT:CDS KC774370_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bur1014). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgaccgcttttccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggag
acccccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC774371_X_P-B Feature FT:CDS KC774371_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bur1036). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC774372_X_P-B Feature FT:CDS KC774372_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bur1040). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttctaccaaccgaccccggggggcccctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcactttgtttcccctctgcccgtcgaatggag
acccccgtaaacgccccccggaatttcccaaaggttttgcaaaagaggatttttgtcctttcagaaatgtcaacgaccga
ccttgaggcatacttcaaaaactgtgtgtttaatgagtgggaggagttgggggaggacattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC774373_X_P-B Feature FT:CDS KC774373_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bur1044). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC774374_X_P-B Feature FT:CDS KC774374_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bur1053). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagtcgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|KC774375_X_P-B Feature FT:CDS KC774375_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bur1055). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctggtaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggatctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctatgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtat
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC774376_X_P-B Feature FT:CDS KC774376_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bur1056). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgctcctccgcctgttctaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC774377_X_P-B Feature FT:CDS KC774377_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bur1064). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttacataagaggactcttggactttcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC774378_X_P-B Feature FT:CDS KC774378_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bww1015). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgtcgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC774379_X_P-B Feature FT:CDS KC774379_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bww1023). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC774380_X_P-B Feature FT:CDS KC774380_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bww1033). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcgacgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgtcgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|KC774381_X_P-B Feature FT:CDS KC774381_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bww1062). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggactttaccgcccgcttctccgcctgtcgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC774382_X_P-B Feature FT:CDS KC774382_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bww1063). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctggtagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgtcgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggaatcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtag
tagcaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC774383_X_P-B Feature FT:CDS KC774383_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bww1081). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgtcgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacacccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC774384_X_P-B Feature FT:CDS KC774384_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bww1091). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC774385_X_P-B Feature FT:CDS KC774385_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bww1099). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgtcgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC774386_X_P-B Feature FT:CDS KC774386_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bww1101). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggtctctaccgcccactcctccgcctgtcgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|KC774387_X_P-B Feature FT:CDS KC774387_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bww1104). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgtcgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC774388_X_P-B Feature FT:CDS KC774388_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bww1116). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgtcgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC774389_X_P-B Feature FT:CDS KC774389_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bww1121). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgtcgttccgaccaaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC774390_X_P-B Feature FT:CDS KC774390_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bww2158). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctataccgcccgcttctccgcctgtcgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC774391_X_P-B Feature FT:CDS KC774391_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bww2163). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgtcgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC774392_X_P-B Feature FT:CDS KC774392_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bww2169). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgtcgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|KC774393_X_P-B Feature FT:CDS KC774393_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bxa1068). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccctcacggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgtccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaactcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC774394_X_P-B Feature FT:CDS KC774394_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bxa1070). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC774395_X_P-B Feature FT:CDS KC774395_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bxa1073). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttacggagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC774396_X_P-B Feature FT:CDS KC774396_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bxa1182). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC774397_X_P-B Feature FT:CDS KC774397_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bxa1185). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcagagactgtgtgtttactgagtgggaggagttgggggaggaagttaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC774398_X_P-B Feature FT:CDS KC774398_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bxa1202). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagtaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC774399_X_P-B Feature FT:CDS KC774399_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bxa1556). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaacgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC774400_X_P-B Feature FT:CDS KC774400_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bxa1585). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcacctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagtactgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC774401_X_P-B Feature FT:CDS KC774401_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bxa1663). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC774402_X_P-B Feature FT:CDS KC774402_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bxa1670). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggggtctaccgcccgcttctccgcctgttgtaccgaccatccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC774403_X_P-B Feature FT:CDS KC774403_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bxa2001). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC774404_X_P-B Feature FT:CDS KC774404_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bxa2004). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgctcctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC774405_X_P-B Feature FT:CDS KC774405_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bxa2005). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgcttagggctctaccgcccgcttctccgcctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcgtacatcaaagactgtgtgttcaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC774406_X_P-B Feature FT:CDS KC774406_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bxa2009). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcatttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgccttgtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC774407_X_P-B Feature FT:CDS KC774407_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bxa2011). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcatcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC774408_X_P-B Feature FT:CDS KC774408_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bxa2012). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagctgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC774409_X_P-B Feature FT:CDS KC774409_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bxa2013). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttaggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC774410_X_P-B Feature FT:CDS KC774410_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bxa2018). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC774411_X_P-B Feature FT:CDS KC774411_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bxa2025). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttctaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC774412_X_P-B Feature FT:CDS KC774412_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bxa2034). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcggaacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC774413_X_P-B Feature FT:CDS KC774413_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bxa2037). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgttccaaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC774415_X_P-B Feature FT:CDS KC774415_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bxa2064). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttgtaccgaccaaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC774416_X_P-B Feature FT:CDS KC774416_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bxn1016). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttatttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttctaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC774417_X_P-B Feature FT:CDS KC774417_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bxn1028). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC774418_X_P-B Feature FT:CDS KC774418_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bxn1055). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggactctaccgaccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggacttttagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgttcaatgagtgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC774419_X_P-B Feature FT:CDS KC774419_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bxn1083). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC814873_X_P-B Feature FT:CDS KC814873_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M0209422C). Partial genome (Contains: HBx). [Hepadnaviridae] (length=462 residues).
atggctgctagggtgtgctgccaactgactaacgcgcgggaagtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgtccgcttcttcgcctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccactggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttccccatcaccatgtaactttttcacctctgcc
>gnl|hbvcds|KC814875_X_P-B Feature FT:CDS KC814875_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M0209424C). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=462 residues).
tttgctgctagggtgtgctgtcaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccccttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaatgttgctgtctgctagcaccatgcaactttttcacctctgcc
>gnl|hbvcds|KC814883_X_P-B Feature FT:CDS KC814883_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M0209432C). Partial genome (Contains: HBe, HBx). [Hepadnaviridae] (length=462 residues).
atggctgctagggtgtgctgccaactgacaaacaggcgggaagtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccccttctccacctgccgttccggccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccgggacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttggac
tgagaggcggtaggcatagattgatctgttcaccaccaccatgcaactttttcacctctgcc
>gnl|hbvcds|KC814890_X_P-B Feature FT:CDS KC814890_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M020944P). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=462 residues).
aaggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgcgttcactaataccatgcaactttttcacctcatcc
>gnl|hbvcds|KC814917_X_P-B Feature FT:CDS KC814917_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M0209431P). Partial genome (Contains: HBe, HBx, Pol). [Hepadnaviridae] (length=462 residues).
aaggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgcgttcactgatagcatgcaactttttcacctctgcc
>gnl|hbvcds|KC814918_X_P-B Feature FT:CDS KC814918_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M0209432P). Partial genome (Contains: HBe, HBx). [Hepadnaviridae] (length=462 residues).
atggctgctagggtgtgctgccaactgaaactcgcgcgggacagtctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgcgttcactaccatcatgcaactttttcacctcagcc
>gnl|hbvcds|KJ173297_X_P-B Feature FT:CDS KJ173297_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate FH008C(e46n)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaattggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccatccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccactggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173298_X_P-B Feature FT:CDS KJ173298_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate FH008M(e47)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaattggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccatccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggaattgggggaggagattaggttaatggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173339_X_P-B Feature FT:CDS KJ173339_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CX001C(e201)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcgtttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttgtaccggccgactacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggatgttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173340_X_P-B Feature FT:CDS KJ173340_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CX001M(e202)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcgtttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttgtaccggccgactacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggatgttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173341_X_P-B Feature FT:CDS KJ173341_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CX003C(e204)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcttgttgtaccgaccgactacggggcgcacctct
ctctacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173342_X_P-B Feature FT:CDS KJ173342_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CX003M(e205)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcttgttgtaccgaccgactacggggcgcacctct
ctctacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173343_X_P-B Feature FT:CDS KJ173343_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CX007C(e211)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccacctcttgttccgaccgaccacggggcgaacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaacgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgctcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173345_X_P-B Feature FT:CDS KJ173345_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CX008C(e214)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccacctcttgttccgaccgaccacggggcgaacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaacgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgctcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173347_X_P-B Feature FT:CDS KJ173347_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CX012C(e220)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgttccgaccgtccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatactttaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccggcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173348_X_P-B Feature FT:CDS KJ173348_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CX012M(e221)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgttccgaccgtccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatactttaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccggcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173351_X_P-B Feature FT:CDS KJ173351_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CX025C(e234)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccacctacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggaattgggggaggagattcggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173352_X_P-B Feature FT:CDS KJ173352_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CX025M(e235n)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcttgttgtaccgaccgactacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173353_X_P-B Feature FT:CDS KJ173353_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CX027C(e237)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccaactacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattcggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173354_X_P-B Feature FT:CDS KJ173354_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CX027M(e235n)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcttgttgtaccgaccgactacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173355_X_P-B Feature FT:CDS KJ173355_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CX032C(e247n)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcttgttgtaccgaccgactacggggcgcacctct
ctctacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173356_X_P-B Feature FT:CDS KJ173356_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CX032M(e248n)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcttgttgtaccgaccgactacggggcgcacctct
ctctacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173357_X_P-B Feature FT:CDS KJ173357_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CX065C(e313)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttagggctgtaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggtgttgggggcggagattaggttaaaggtctttgtac
ttggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173359_X_P-B Feature FT:CDS KJ173359_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate NB161C(m162)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgagcaatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173360_X_P-B Feature FT:CDS KJ173360_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate NB161M(m161)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccgctggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgagcaatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173361_X_P-B Feature FT:CDS KJ173361_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate NB041C(m42)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcatttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173362_X_P-B Feature FT:CDS KJ173362_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate NB041M(m41)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcatttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173363_X_P-B Feature FT:CDS KJ173363_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate P002-C(006)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttataccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctga
>gnl|hbvcds|KJ173364_X_P-B Feature FT:CDS KJ173364_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate P002-M(007)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttataccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctga
>gnl|hbvcds|KJ173365_X_P-B Feature FT:CDS KJ173365_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate P003-C(009)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173366_X_P-B Feature FT:CDS KJ173366_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate P003-M(011)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173367_X_P-B Feature FT:CDS KJ173367_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate P006-C(B1)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173368_X_P-B Feature FT:CDS KJ173368_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate P006-M(B3)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173369_X_P-B Feature FT:CDS KJ173369_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate P008-C(B37)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173370_X_P-B Feature FT:CDS KJ173370_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate P008-M(B39)). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173371_X_P-B Feature FT:CDS KJ173371_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate P009-C(B135)). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173372_X_P-B Feature FT:CDS KJ173372_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate P009-M2(B137)). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173373_X_P-B Feature FT:CDS KJ173373_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate P010-C1(147a)). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcctaccggaacctgcccaacgtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgttcaatgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173374_X_P-B Feature FT:CDS KJ173374_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate P010-M(B149)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcctaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgttcaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173375_X_P-B Feature FT:CDS KJ173375_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YY004C(e107)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccatccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173376_X_P-B Feature FT:CDS KJ173376_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YY004M(e108)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccatccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173377_X_P-B Feature FT:CDS KJ173377_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YY014C(e115)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacaaccga
ccttgagcaatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgcgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173378_X_P-B Feature FT:CDS KJ173378_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YY014M(e116)). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacaaccga
ccttgagcaatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgcgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173379_X_P-B Feature FT:CDS KJ173379_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YY019C(e121)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggacttttagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173380_X_P-B Feature FT:CDS KJ173380_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YY019M(e122)). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataacaggactcttggacttttagcaatgtcaactaccga
ccttgaggcatacttcaaagactgtgtgtttactgaatgtgaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173381_X_P-B Feature FT:CDS KJ173381_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N16-C(FY137Cn).fas). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgttccaaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173382_X_P-B Feature FT:CDS KJ173382_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N16_M(FY137An).fas). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgttccaaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173383_X_P-B Feature FT:CDS KJ173383_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YZ009C(e30)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccttccacggggcgcacctct
ctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggacttttagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173384_X_P-B Feature FT:CDS KJ173384_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YZ009M(e31)). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173385_X_P-B Feature FT:CDS KJ173385_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Vac02-M(m603)). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccatccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcctcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173386_X_P-B Feature FT:CDS KJ173386_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Vac02-C(m604)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccatccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgagtgcacttcgcctcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173387_X_P-B Feature FT:CDS KJ173387_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Vac03-M(m607)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcggaacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
acccccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173388_X_P-B Feature FT:CDS KJ173388_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Vac03-C(m608)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcggaacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
acccccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173389_X_P-B Feature FT:CDS KJ173389_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Vac05-M(m617)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccttccacggggcgcacctct
ctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggacttttagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173390_X_P-B Feature FT:CDS KJ173390_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Vac05-C(m618)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccttccacggggcgcacctct
ctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggacttttagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173397_X_P-B Feature FT:CDS KJ173397_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N03-M(134A)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttctaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173398_X_P-B Feature FT:CDS KJ173398_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N03-C(134B)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttctaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173399_X_P-B Feature FT:CDS KJ173399_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N07-M(4161A)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173400_X_P-B Feature FT:CDS KJ173400_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N07-C(4230B)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173401_X_P-B Feature FT:CDS KJ173401_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N09-M(6720A)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcag
acgatccctcccggggccgcttggggctctaccgaccgcttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccgcggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173402_X_P-B Feature FT:CDS KJ173402_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N09-C(3733B)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcag
acgatccctcccggggccgcttggggctctaccgaccgcttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccgcggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173403_X_P-B Feature FT:CDS KJ173403_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N10-M(6641M)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgtccaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173404_X_P-B Feature FT:CDS KJ173404_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N10-C(3953B)). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgtccaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173405_X_P-B Feature FT:CDS KJ173405_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N11-M(6642A)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173406_X_P-B Feature FT:CDS KJ173406_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N11-C(3965B)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173407_X_P-B Feature FT:CDS KJ173407_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N13-M(6650A)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcacctgcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173408_X_P-B Feature FT:CDS KJ173408_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N13-C(4198B)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcacctgcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173409_X_P-B Feature FT:CDS KJ173409_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N14-M(6692A)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccggccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173410_X_P-B Feature FT:CDS KJ173410_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N14-C(4171B)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccggccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173411_X_P-B Feature FT:CDS KJ173411_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N15-M(6579A)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgccttttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttgctgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173412_X_P-B Feature FT:CDS KJ173412_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N15-C(4159b)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgccttttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttgctgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173413_X_P-B Feature FT:CDS KJ173413_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N16_M(FY137A)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgttccaaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173414_X_P-B Feature FT:CDS KJ173414_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N16_C(FY137B)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgttccaaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173415_X_P-B Feature FT:CDS KJ173415_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N16-V(FY137C)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgttccaaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173416_X_P-B Feature FT:CDS KJ173416_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N201M(e401)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatccggcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgtccaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173417_X_P-B Feature FT:CDS KJ173417_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N201C(e402)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatccggcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgtccaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173418_X_P-B Feature FT:CDS KJ173418_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N202M(e403)). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttagttaatcattctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173419_X_P-B Feature FT:CDS KJ173419_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N202C(e404)). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttagttaatcattctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173420_X_P-B Feature FT:CDS KJ173420_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N203M(e405)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgactacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagctgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173421_X_P-B Feature FT:CDS KJ173421_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N203C(e406)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgactacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagctgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173422_X_P-B Feature FT:CDS KJ173422_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N204M(e407)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgcccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcatcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaacgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173423_X_P-B Feature FT:CDS KJ173423_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N204C(e408)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgcccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcatcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaacgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173424_X_P-B Feature FT:CDS KJ173424_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N205M(e409)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ173425_X_P-B Feature FT:CDS KJ173425_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N205C(e410)). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ410490_X_P-B Feature FT:CDS KJ410490_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HK_1329). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaacgagtgggaggagttgggggaggaggttaggttaatggtttttgtac
taggaggctgtaggcataaattggtctgttcaccagttccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ410500_X_P-B Feature FT:CDS KJ410500_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Occult_HK321). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttctcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatatttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgtccaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ410502_X_P-B Feature FT:CDS KJ410502_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Occult_HK318). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacctgcccaaggtcttgcatgagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagttgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ410507_X_P-B Feature FT:CDS KJ410507_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Occult_HK6840). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggactctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ410516_X_P-B Feature FT:CDS KJ410516_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Occult_HK4777). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggactctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ410517_X_P-B Feature FT:CDS KJ410517_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Occult_HK4901). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggactctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ790200_X_P-B Feature FT:CDS KJ790200_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H44). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtgcgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ803752_X_P-B Feature FT:CDS KJ803752_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY155693). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttgcacaagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ803755_X_P-B Feature FT:CDS KJ803755_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY247131). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcggaacctgcccaaggtcttacataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ803756_X_P-B Feature FT:CDS KJ803756_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY727495). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggcggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ803758_X_P-B Feature FT:CDS KJ803758_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY484998). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcggaacctgcccaaggtcttacataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgtttaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ803763_X_P-B Feature FT:CDS KJ803763_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY790800). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacggaaacctgcccaaggtcttgcataagaggactcttggactgtcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtatgcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ803764_X_P-B Feature FT:CDS KJ803764_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY043147). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggagtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatttgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ803768_X_P-B Feature FT:CDS KJ803768_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY495063). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctataccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaagtggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ803773_X_P-B Feature FT:CDS KJ803773_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY727093). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgaccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccacgtgaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgcgtgtttaccgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ803775_X_P-B Feature FT:CDS KJ803775_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY741196). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgaccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccacgtgaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgcgtgtttaccgagtgggaggagttgggggagagggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcaccttctcctaa
>gnl|hbvcds|KJ803781_X_P-B Feature FT:CDS KJ803781_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY799421). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttagggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ803783_X_P-B Feature FT:CDS KJ803783_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY266289). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttagggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaacattttcacctctgcctaa
>gnl|hbvcds|KJ803784_X_P-B Feature FT:CDS KJ803784_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY781114). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcggaacctgcccaaggtcttgcataagaggactcttggactttcagcgatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagaccaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ803786_X_P-B Feature FT:CDS KJ803786_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY846440). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccattggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagttcaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ803787_X_P-B Feature FT:CDS KJ803787_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY853571). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccatcggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ803789_X_P-B Feature FT:CDS KJ803789_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY303852). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaacttttcactctctgcctaa
>gnl|hbvcds|KJ803795_X_P-B Feature FT:CDS KJ803795_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY789421). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttagggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggtttactgattggggagttgggggatgttc
taaggggatggaaggctaaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ803796_X_P-B Feature FT:CDS KJ803796_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY711763). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgtcttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattggggagttgggggatgttc
taaggggatggaaggctaaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ803797_X_P-B Feature FT:CDS KJ803797_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY775775). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttagggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ803801_X_P-B Feature FT:CDS KJ803801_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY035746). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctataccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ803805_X_P-B Feature FT:CDS KJ803805_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY491666). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggagggggatgagttaatgatctttgtac
taggaggctgtaggcataaagtggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ803808_X_P-B Feature FT:CDS KJ803808_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY571290). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ803816_X_P-B Feature FT:CDS KJ803816_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY540630). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctgtaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggaattgggggaggagattaggttaaagatctttgtac
taggaggctgtaggcataaagtggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ803817_X_P-B Feature FT:CDS KJ803817_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY241913). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttggctacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ803819_X_P-B Feature FT:CDS KJ803819_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY131767). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgaccgttggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ803820_X_P-B Feature FT:CDS KJ803820_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY081397). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatactgcgcggaacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctgctgtaccgaccgaccacggggcgtacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccactggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ803821_X_P-B Feature FT:CDS KJ803821_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY500621). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggaattgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaatgtatctgttaaacagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ803824_X_P-B Feature FT:CDS KJ803824_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY502457). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatcaggttaaaggtctttgtac
taggaggctgtaggcataaatgggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ803825_X_P-B Feature FT:CDS KJ803825_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY381508). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggatctaccgcccgcttctccgcatcttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcctacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgttc
tgggaggctggagggataagttggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843165_X_P-B Feature FT:CDS KJ843165_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ag03). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaatgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KM213032_X_P-B Feature FT:CDS KM213032_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate LRF-k1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttctaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacaagaacctgcccaaggtcttgcataaaaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggtggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KM213034_X_P-B Feature FT:CDS KM213034_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate LYG-k1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KM213035_X_P-B Feature FT:CDS KM213035_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MRG-k1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KM213036_X_P-B Feature FT:CDS KM213036_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CSW-k1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgcgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KM359440_X_P-B Feature FT:CDS KM359440_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate FF3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttagggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcccctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KM392072_X_P-B Feature FT:CDS KM392072_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate V3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaacgagtgggaggagttgggggaagaggtcaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttgacctctgcctaa
>gnl|hbvcds|KM392083_X_P-B Feature FT:CDS KM392083_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate V41). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|KM392084_X_P-B Feature FT:CDS KM392084_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate V42). Non-functional genomic sequence. [Hepadnaviridae] (length=462 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccacggggcgcacctct
ctttacgcggcctccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtagcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgatctcgctcgcccaaatttttcacctctgcctaa
>gnl|hbvcds|KM875416_X_P-B Feature FT:CDS KM875416_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate pt9N). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgtccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KM875417_X_P-B Feature FT:CDS KM875417_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate pt9T). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgtccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KM875418_X_P-B Feature FT:CDS KM875418_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate pt10N). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccacgggaacctgcccaaggtcttgtataagaggactcttggactgtccgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtgcgttcaccggcaccttgcaactttttcacctctgcctaa
>gnl|hbvcds|KM875420_X_P-B Feature FT:CDS KM875420_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate pt11N). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccaccagaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaacgagtgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtgcgttcaccagcaccttgcaactttttcacctctgcctaa
>gnl|hbvcds|KM875426_X_P-B Feature FT:CDS KM875426_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate pt14N). Non-functional genomic sequence. [Hepadnaviridae] (length=468 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccaaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttttcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcttcacctctgcctaa
>gnl|hbvcds|KM875427_X_P-B Feature FT:CDS KM875427_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate pt14T). Non-functional genomic sequence. [Hepadnaviridae] (length=468 residues).
atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgtcgtaccgaccaaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttttcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccacgggaacttgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatttttgtat
taggaggctgtaggcataaattggtgtgttcaccagcaccatggaactttttcttcacctctgcctaa
>gnl|hbvcds|KP036970_X_P-B Feature FT:CDS KP036970_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-YA). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148314_X_P-B Feature FT:CDS KP148314_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D243-3-18). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggactgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccatcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148317_X_P-B Feature FT:CDS KP148317_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D243-8). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaacgtcaacgaccga
ccttgaggcatacttcaaagactgtttgcttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccatcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148318_X_P-B Feature FT:CDS KP148318_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D243-19). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccatcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148319_X_P-B Feature FT:CDS KP148319_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D243-3-2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccatcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148320_X_P-B Feature FT:CDS KP148320_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D243-3-4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccatcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148321_X_P-B Feature FT:CDS KP148321_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D243-3-5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgccaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ccttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccatcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148322_X_P-B Feature FT:CDS KP148322_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D243-3-11). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagagaactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccatcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148323_X_P-B Feature FT:CDS KP148323_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D243-3-12). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccatcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148324_X_P-B Feature FT:CDS KP148324_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D243-3-20). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactgggtcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccatcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148325_X_P-B Feature FT:CDS KP148325_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D243-3-25). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccatcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148326_X_P-B Feature FT:CDS KP148326_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D243-3-27). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccatcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148327_X_P-B Feature FT:CDS KP148327_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D243-3-41). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcggcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccatcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148328_X_P-B Feature FT:CDS KP148328_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D243-3-94). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccatcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148329_X_P-B Feature FT:CDS KP148329_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D243-3-99). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctatcgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcccatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccatcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148330_X_P-B Feature FT:CDS KP148330_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D243-3-104). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtctgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaagctgtaggcataaattggtgtgttcaccatcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148331_X_P-B Feature FT:CDS KP148331_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D243-3-109). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccatcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148332_X_P-B Feature FT:CDS KP148332_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D243-3-122). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgccaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccatcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148333_X_P-B Feature FT:CDS KP148333_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D243-3-124). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtctgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccctcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148334_X_P-B Feature FT:CDS KP148334_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D243-3-126). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
cgttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccatcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148335_X_P-B Feature FT:CDS KP148335_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D243-3-130). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtctgtttaatgagtgggaggagttgggggaggaggttaggttacaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccatcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148336_X_P-B Feature FT:CDS KP148336_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D282-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgactacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148338_X_P-B Feature FT:CDS KP148338_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D282-3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgactacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggcctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148339_X_P-B Feature FT:CDS KP148339_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D282-5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgactacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148340_X_P-B Feature FT:CDS KP148340_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D282-6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgactacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148341_X_P-B Feature FT:CDS KP148341_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D282-7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgactacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcgcttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148342_X_P-B Feature FT:CDS KP148342_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D282-9). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgctgtaccgaccgactacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148343_X_P-B Feature FT:CDS KP148343_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D282-10). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccggccgactacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagactaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148344_X_P-B Feature FT:CDS KP148344_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D282-14). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgcgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgtccgcttctccgcctgttgtaccgaccgactacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148345_X_P-B Feature FT:CDS KP148345_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D282-20). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgactacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccactggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148346_X_P-B Feature FT:CDS KP148346_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D282-22). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgactacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtcggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148347_X_P-B Feature FT:CDS KP148347_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D282-24). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgactacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148348_X_P-B Feature FT:CDS KP148348_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D282-25). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgactacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctccgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148349_X_P-B Feature FT:CDS KP148349_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D282-26). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgactacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148356_X_P-B Feature FT:CDS KP148356_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D93-3-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtatgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccatcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148357_X_P-B Feature FT:CDS KP148357_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D93-3-2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtctgtttaatgagtgggaggagttgggggaagaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccatcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148359_X_P-B Feature FT:CDS KP148359_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D93-3-30). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtctgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccatcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148360_X_P-B Feature FT:CDS KP148360_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D93-3-36). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtatgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccatcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148361_X_P-B Feature FT:CDS KP148361_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D93-3-42). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtctgtttaatgagtgggaggagttgggggaggaggttgggttaaaggtctttgtac
taggaggctgtgggcataaattggtgtgttcaccatcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148362_X_P-B Feature FT:CDS KP148362_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D93-3-73). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtctgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccatcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148363_X_P-B Feature FT:CDS KP148363_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D93-3-86). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcgcctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtctgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccatcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148364_X_P-B Feature FT:CDS KP148364_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D93-3-101). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtctgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccatcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148365_X_P-B Feature FT:CDS KP148365_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D93-3-106). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccatcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148366_X_P-B Feature FT:CDS KP148366_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D93-3-110). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtctgtttaatgagtgggaggagttgggggaggaggttaggttaaaggtctttgtac
taggaggctgtaggcataaattggtgtgttcaccatcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148367_X_P-B Feature FT:CDS KP148367_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctggatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148368_X_P-B Feature FT:CDS KP148368_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtccgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148369_X_P-B Feature FT:CDS KP148369_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgactacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148370_X_P-B Feature FT:CDS KP148370_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148371_X_P-B Feature FT:CDS KP148371_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgttttctgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148372_X_P-B Feature FT:CDS KP148372_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-9). Complete genome. [Hepadnaviridae] (length=465 residues).
ctggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148373_X_P-B Feature FT:CDS KP148373_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-11). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148374_X_P-B Feature FT:CDS KP148374_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-20). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcgcctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148375_X_P-B Feature FT:CDS KP148375_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148376_X_P-B Feature FT:CDS KP148376_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148377_X_P-B Feature FT:CDS KP148377_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-12). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttcaccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148378_X_P-B Feature FT:CDS KP148378_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-17). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148379_X_P-B Feature FT:CDS KP148379_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-19). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgtccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148380_X_P-B Feature FT:CDS KP148380_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-20). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148382_X_P-B Feature FT:CDS KP148382_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-25). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148383_X_P-B Feature FT:CDS KP148383_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-26). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggaacctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggcctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148384_X_P-B Feature FT:CDS KP148384_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-28). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggcactaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148385_X_P-B Feature FT:CDS KP148385_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-30). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148386_X_P-B Feature FT:CDS KP148386_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-32). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148387_X_P-B Feature FT:CDS KP148387_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-34). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148388_X_P-B Feature FT:CDS KP148388_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-35). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148389_X_P-B Feature FT:CDS KP148389_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-44). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148390_X_P-B Feature FT:CDS KP148390_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-45). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148391_X_P-B Feature FT:CDS KP148391_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-46). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148392_X_P-B Feature FT:CDS KP148392_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-47). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148394_X_P-B Feature FT:CDS KP148394_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-50). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcggtacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acaacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148395_X_P-B Feature FT:CDS KP148395_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-51). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148396_X_P-B Feature FT:CDS KP148396_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-58). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148397_X_P-B Feature FT:CDS KP148397_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-59). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148398_X_P-B Feature FT:CDS KP148398_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-60). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148399_X_P-B Feature FT:CDS KP148399_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-61). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgccaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148400_X_P-B Feature FT:CDS KP148400_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-65). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148401_X_P-B Feature FT:CDS KP148401_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-67). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148402_X_P-B Feature FT:CDS KP148402_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-70). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148403_X_P-B Feature FT:CDS KP148403_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-71). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148405_X_P-B Feature FT:CDS KP148405_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H54-2-2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148406_X_P-B Feature FT:CDS KP148406_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H54-2-3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148407_X_P-B Feature FT:CDS KP148407_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H54-2-4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148409_X_P-B Feature FT:CDS KP148409_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H54-2-6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgtccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148410_X_P-B Feature FT:CDS KP148410_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H54-2-29). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148411_X_P-B Feature FT:CDS KP148411_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H54-2-31). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctacctaa
>gnl|hbvcds|KP148413_X_P-B Feature FT:CDS KP148413_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H54-2-38). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148414_X_P-B Feature FT:CDS KP148414_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H54-2-42). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccgcggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148415_X_P-B Feature FT:CDS KP148415_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H54-2-48). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148416_X_P-B Feature FT:CDS KP148416_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H54-2-54). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148418_X_P-B Feature FT:CDS KP148418_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H54-2-58). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgaccccccccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148419_X_P-B Feature FT:CDS KP148419_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H54-2-65). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgactcctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148420_X_P-B Feature FT:CDS KP148420_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H54-2-66). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgagggtaaaggtctttgtac
taggaggctgtaggcataaattggtctggccaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148421_X_P-B Feature FT:CDS KP148421_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H54-2-72). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148423_X_P-B Feature FT:CDS KP148423_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H54-2-86). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148424_X_P-B Feature FT:CDS KP148424_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H54-2-89). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148425_X_P-B Feature FT:CDS KP148425_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H54-2-90). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148426_X_P-B Feature FT:CDS KP148426_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H54-2-92). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgcgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccggaacttgcccgaggtcttgcataagaggactcttggactttctgcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148427_X_P-B Feature FT:CDS KP148427_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H54-2-94). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgactcctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148429_X_P-B Feature FT:CDS KP148429_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H54-2-104). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148430_X_P-B Feature FT:CDS KP148430_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H54-2-105). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactctccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggacttttggactttctgcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtagacataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148433_X_P-B Feature FT:CDS KP148433_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H75-4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148435_X_P-B Feature FT:CDS KP148435_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H75-14). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148437_X_P-B Feature FT:CDS KP148437_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H75-18). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148438_X_P-B Feature FT:CDS KP148438_X_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H75-20). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP148439_X_P-B Feature FT:CDS KP148439_X_P-B of [Viruses] Hepatitis B Viru