HBVdb

Dataset for nucleotide sequence X of genotype B

[Download (right click)] [Edit] [Sequences] [Repertoires]

2553 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


KC774372_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC774368_X_P-B      atgggtg-gtaggctgtgctgccaaatggatcctgcgcgggacgtcctttgtttacgtcc
AB219430_X_P-B      atggctg-ctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcc
KC814883_X_P-B      atggctg-ctagggtgtgctgccaactgacaaacaggcgggaagtcctttgtctacgtcc
MH488818_X_P-B      atggctg-ctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
EU939637_X_P-B      atggttg-gtaggctgtacttccaactcgatcctgctcgggacgtcctttttttacgtcc
AB231909_X_P-B      atggctg-ctaggctgtgccgccaactggatcctgcgcgggacgtcctttgtctacgtcc
AB048705_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcc
KU679959_X_P-B      atggctg-ctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
AB976562_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB100695_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MH488840_X_P-B      atggctg-ctaggctatgctgccaactggatcctgcgcgggacgtcctttatttacgtcc
MH488825_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU158262_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtytacgtcc
KC814873_X_P-B      atggctg-ctagggtgtgctgccaactgactaacgcgcgggaagtcctttgtctacgtcc
MH488860_X_P-B      atggctg-ccagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
MK171606_X_P-B      atggctg-ctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KY881821_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171413_X_P-B      atggctg-ctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
FJ386648_X_P-B      atggctg-ctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MH488855_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KX276812_X_P-B      atggctg-ctcggttgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MH488830_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtggacgtcc
MH488856_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171285_X_P-B      atggctg-ctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AY206387_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB073823_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881792_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtcc
KJ803773_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ803775_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB073836_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881784_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctccgtttacgtcc
KY881800_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtcc
KY881797_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtcc
KY881781_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtcc
KY881801_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtcc
KY881795_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtcc
KY881793_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtcc
KY881787_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtcc
KY881783_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtcc
KY881780_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtcc
KY881782_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtcc
KY881786_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtcc
KY881788_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtcc
KY881789_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtcc
KY881790_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtcc
KY881791_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtcc
KY881794_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtcc
KY881796_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtcc
KY881798_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtcc
KY881799_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtcc
KY881808_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtcc
KY881850_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtcc
KY881785_X_P-B      atgcctg-ctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtcc
HM011475_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AY217364_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ341813_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ787476_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ040169_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ377525_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EF494382_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171525_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MH488845_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttatttacgtcc
DQ995803_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AY283777_X_P-B      atggctg-ctaggctgtgctgccaactgaatcctacgcgggacgtcctttgtttacgtcc
AY206390_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
AY238972_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
JQ341836_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KM875418_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ377622_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU939633_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU939634_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
DQ993710_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
DQ993698_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
DQ993699_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ027329_X_P-B      atggctg-ctaggctgtrctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU939660_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MG571331_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KX276789_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JX504532_X_P-B      atggctg-ctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ803821_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171589_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ377582_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ562312_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171579_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ801485_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
DQ995802_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ040147_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtcc
EU487256_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU660224_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171476_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MH488853_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KJ410500_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY470834_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY470837_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY470841_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY470838_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY470835_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY470830_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY470832_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY470833_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY470836_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY470839_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY470840_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KT749820_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ341803_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964272_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964284_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964283_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964273_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964274_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964275_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964276_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964277_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964278_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964279_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964280_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964282_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964285_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964286_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964281_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtactttgtttacgtcc
FJ787475_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU939669_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ899779_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MH488834_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
DQ995801_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AY206373_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171545_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
HM011482_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU564823_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU564824_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU564822_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171475_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC774397_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU522072_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU522075_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU522073_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171377_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MG372436_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ562262_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AY167102_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB195933_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB195934_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB195935_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ040128_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ341816_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
JQ027315_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ562224_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171507_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AY220697_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MH488820_X_P-B      atggctg-cttggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881864_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ562260_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU939671_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU939636_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
DQ995805_X_P-B      atggctg-ctaggctgtgctgccaactggatcatgcgcgggacgtcctttgtttacgtcc
AF121247_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC492739_X_P-B      atggctg-ctaggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
KC492740_X_P-B      atggctg-ctaggttgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
KY881845_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ518812_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AY596103_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MH663473_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JX870001_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171516_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ341797_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881865_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881853_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881849_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KX276811_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC774408_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
HM011494_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU939670_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171603_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AY217355_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AY217356_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ386636_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ386676_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ562254_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171497_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171601_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ341817_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KM213036_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674422_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059711_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP036970_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JX429900_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AY220698_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
DQ993700_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU939678_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ562222_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ386675_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ341844_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
DQ361535_X_P-B      atggctg-ctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacatcc
GQ855689_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB106884_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB900097_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcgtttgtttacgtcc
AB073858_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674492_X_P-B      atggctg-ctaggttgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
HM011487_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB931168_X_P-B      atggctg-ctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB931169_X_P-B      atggctg-ctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB900112_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
HM011499_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KX276858_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JX661484_X_P-B      atggctg-ctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB073853_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB073850_X_P-B      atggctg-ctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MG826152_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP659249_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB219427_X_P-B      atggctg-ctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB104890_X_P-B      atggctg-ctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB104891_X_P-B      atggctg-ctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB115551_X_P-B      atggctg-ctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
DQ993681_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674448_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttatttacgtcc
MF674385_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB212625_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ341840_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674436_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU234318_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674483_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ023634_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
DQ993685_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674499_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674495_X_P-B      atggctg-ctaggctgtgctgccaactggatcttgcgcgggacgtcctttgtttacgtcc
DQ993682_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674420_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674432_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674508_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674415_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674476_X_P-B      atggctg-ctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674456_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
MF674500_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
AB031267_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674434_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ341824_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674515_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674462_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674409_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674396_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674395_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674394_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KX765841_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674383_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ855526_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674479_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB212626_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674507_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674459_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674392_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674413_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674404_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ341848_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674511_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674466_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674445_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674441_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674440_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674433_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674401_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674400_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674393_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
DQ993686_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB073835_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674419_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674482_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674452_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674451_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674510_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674513_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674423_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674387_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674461_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674389_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674469_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB031266_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674455_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674505_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674493_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674491_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674478_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674447_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674498_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674443_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674437_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674477_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674405_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
DQ993684_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB117759_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674414_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ924635_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
GQ358144_X_P-B      atggctg-ctaggctgtgctgccaactggatcttgcgcgggacgtcctttgtttacgtcc
AB900102_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ358145_X_P-B      atggctg-ctaggctgtgctgccaactggatcttgcgcgggacgtcctttgtttacgtcc
GQ358146_X_P-B      atggctg-ctaggctgtgctgccaactggatcttgcgcgggacgtcctttgtttacgtcc
GQ358147_X_P-B      atggctg-ctaggctgtgctgccaactggatcttgcgcgggacgtcctttgtttacgtcc
AB300370_X_P-B      atggctg-ctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB900107_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB828708_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB713527_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB246343_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB219428_X_C-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB073846_X_P-B      atggctg-ctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB073845_X_P-B      atggctg-ctaggctgtgctgccaattggatcctgcgcgggacgtcctttgtttacgtcc
AB073842_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB246342_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MH932712_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB900103_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB287327_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB205121_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
D23678_X_P-B        atggctg-ctaggctgtgctgccaactggatactgcgcgggacgtcctttgtttacgtcc
AB010289_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
D00329_X_P-B        atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB073848_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
LC279268_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
LC279269_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
LC279270_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
LC279271_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
LC279272_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
LC279273_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY629636_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ358151_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ358150_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ358149_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ358152_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ358148_X_P-B      atggctg-ctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
LC349871_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KX276824_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB900106_X_P-B      atggctg-ctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB010290_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB010291_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB010292_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB302095_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB073856_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB073844_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB900111_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB246341_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB073857_X_P-B      atggctg-ctaggctgtgctgcaaactggatactgcgcgggacgtcctttgtttacgtcc
AB073851_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB073838_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB493827_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB073847_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
D23679_X_P-B        atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
D50521_X_P-B        atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
D50522_X_P-B        atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB642101_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB073854_X_P-B      atggctg-ctaggctgtgctgccaactggatactgcgcgggacgtcctttgtttacgtcc
AB900105_X_P-B      atggctg-ctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB241116_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB241117_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ429082_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ924641_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB900104_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148420_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148430_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148426_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148394_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcggtacgtcctttgtttacgtcc
KP148383_X_P-B      atggctg-ctaggctgtgctgccaactggaacctgcgcgggacgtcctttgtttacgtcc
KP148374_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148414_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148411_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148405_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148425_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148410_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148416_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148421_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148429_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148433_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148418_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148423_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148419_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148427_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148409_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148415_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148399_X_P-B      atggctg-ccaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148389_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148384_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148379_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148377_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148371_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148369_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148451_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148368_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148367_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148370_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148373_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148375_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148376_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148378_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148380_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148382_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148385_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148386_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148387_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148388_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148390_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148391_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148392_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148395_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148396_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148397_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148398_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148400_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148401_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148402_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148403_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148437_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148372_X_P-B      ctggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148440_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148439_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148406_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148407_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148413_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148424_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148435_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148438_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB219426_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB219429_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ924645_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ924638_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AP011088_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttatctacgtcc
GQ358142_X_P-B      atggctg-ctaggttgtgctgccaactggatcctgcgcgggacctcctttgtttacgtcc
GQ358143_X_P-B      atggctg-ctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB713528_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB713532_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ924625_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KX276819_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
HQ700549_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
GQ358140_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
GQ358139_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
GQ358138_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
AB287326_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AP011091_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
AP011092_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacatcctttgtttacgtcc
GQ358137_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
AP011090_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
EF473976_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
GQ358141_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
GQ924639_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
HM011467_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KX276820_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KX429628_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EF473977_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
LC349877_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KX429622_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB205122_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtccttcgtttacgtcc
GQ924640_X_P-B      atggctg-ctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB900095_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AP011086_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AP011087_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173401_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173402_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KX276823_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KJ803786_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
JQ429079_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KX429630_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KY629635_X_P-B      atggctg-ctaggctgcgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB900098_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
LC349878_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB073852_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674439_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU660230_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU660231_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU660232_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU660233_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MH488817_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ023637_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
FJ023638_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KP148452_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KP148453_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KP148461_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KP148458_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctgcgtcc
KP148457_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KP148459_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KP148455_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KP148460_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KP148456_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
EU330994_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
EU330997_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
EU330996_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
EU330989_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
EU330990_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
EU330995_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
EU330992_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
EU330998_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
EU330999_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
EU331000_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
EU331001_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KP659255_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP659220_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
DQ463798_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggatgtcctttgtttacgtcc
JN792899_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggatgtcctttgtttacgtcc
DQ463791_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
DQ463800_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JN792898_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JN792897_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
DQ463796_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
DQ463795_X_P-B      atggctg-ctaggctgtgctgccaactggatccggcgcgggacgtcctttgtttacgtcc
DQ463792_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
DQ463799_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JN792894_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JN792900_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
DQ463790_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
DQ463793_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
DQ463801_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JN792893_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
DQ463787_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
DQ463802_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
DQ463788_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
DQ463794_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB287324_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB287323_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP659250_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacttcctttgtttacgtcc
AB287321_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB287320_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB287325_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP659221_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KP659251_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JN792901_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JN792902_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP659245_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB287322_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP659253_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JN792896_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
DQ463789_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
DQ463797_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JN792895_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP659223_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
AB287319_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KP659224_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KP659248_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB287317_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KP659234_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB287318_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KP659219_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KP659254_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP659252_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP659246_X_P-B      atggctg-ctaggstgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB287314_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB287315_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB287316_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP659235_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP659237_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP659247_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KX276821_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KJ803796_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KX276830_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
AB713529_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
HM011490_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtctacgtcc
AB713530_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
EF473971_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KX429623_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KX429620_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
AB033555_X_P-B      atggctg-ctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ429081_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ341843_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KX276828_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KX429631_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
M54923_X_P-B        atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgttc
LC349879_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KX429651_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KX276829_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KJ803784_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
GQ358136_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
LC349872_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KJ803819_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
AB493833_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
LC349870_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
AB033554_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
D00331_X_C-B        atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
LC349874_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
LC349869_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KX276814_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KJ803824_X_P-B      atggctg-ctaggctgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcc
JQ429080_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcggggcgtcctttgtttacgtcc
HQ700548_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
HM011492_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EF473972_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
GQ924617_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
AB493835_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KX429616_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KX429627_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
LC349873_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
LC349875_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KX429648_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KX429624_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KX276825_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KJ803787_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KJ803758_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
AP011085_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KX429621_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KX429626_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KJ803755_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
JQ341815_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KX276817_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcggracgtcctttgtttacgtcc
GQ924656_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
JQ341833_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ924621_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
DQ993694_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ924637_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674464_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF621878_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ707751_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ707741_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ707736_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ707748_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ707752_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ707754_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ707756_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ707760_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ707761_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ707757_X_P-B      atggttg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ707740_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ707745_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ707746_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ707753_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ707766_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ707762_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgagcgggacgtcctttgtttacgtcc
JQ707735_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ707765_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ707758_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ707744_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ707734_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ707737_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ707738_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ707739_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ707742_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ707743_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ707747_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ707749_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ707750_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ707755_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ707759_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ707763_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ707764_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ707767_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674410_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtcc
MF674407_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
HQ700546_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AY033072_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AY033073_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
DQ993704_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
DQ993703_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
DQ993705_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
DQ993706_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
DQ993707_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
DQ993687_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674453_X_P-B      atggctg-ctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ023632_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttatgtcc
AB368295_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
MF674487_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674446_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MG571348_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674473_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674470_X_P-B      atggctg-ctaggctgtgctgccaactggaacctgcgcgggacgtcctttgtttacgtcc
FJ023636_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
DQ993683_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ023633_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674488_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674490_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674497_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674481_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
DQ993680_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674509_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674397_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ023635_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674416_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674421_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674424_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ341845_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674406_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ924626_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674460_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674438_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674382_X_P-B      atggctg-ctaggctgtgctgccaactggatcttgcgcgggacgtcctttgtttacgtcc
FJ349236_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674384_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674496_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ040170_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MH488843_X_P-B      atggctg-ctgggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171636_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB555499_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059694_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcggaacgtcctttgtttacgtcc
MF059700_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcggaacgtcctttgtttacgtcc
JX661482_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JX661483_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC510644_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC510648_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC510653_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC510646_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC510659_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AY167093_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ386668_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP406170_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MH488814_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgcttacgtcc
MH488812_X_P-B      atggctg-ctaggctgtgctgccaactggaccctgcgcgggacgtcctttgtttacgtcc
KC510656_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC510657_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AF282917_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JX504531_X_P-B      atggctg-ctaggctgtgctgccaactggatcttgcgcgggacgtcctttgtttacgtcc
KX276779_X_P-B      atggctg-ctmggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MH488816_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JX026879_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AY766463_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173347_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173348_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173343_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173345_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815572_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB073821_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcccgggacgtcctttgtttacgtcc
KC163805_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MG571340_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MH488851_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MH488813_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059418_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KJ173339_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcgtttgtttacgtcc
KJ173340_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcgtttgtttacgtcc
KC774393_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB246340_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
KJ803805_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU570075_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059554_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU306712_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU306700_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU306708_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttggttacgtcc
EU306707_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU306701_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU306702_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU306704_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU306705_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU306706_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU306709_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU306710_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU306711_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU306703_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059563_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MH488832_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ386656_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964264_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
KU964261_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
KU964257_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
KU964258_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
KU964259_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
KU964262_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
KU964263_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
KU964265_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
KU964266_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
KU964267_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
KU964268_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
KU964269_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
KU964271_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
KU964260_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
KU964270_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
KU964105_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964093_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964094_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964095_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964097_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964099_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964100_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964103_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964104_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964106_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964096_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964098_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964101_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964102_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964107_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171273_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KM213032_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ341800_X_P-B      atggctg-ctaggctgtrctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MH488835_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059620_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
JX429911_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ475340_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtcc
FJ562303_X_P-B      atggctg-ctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ386666_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU306699_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
DQ448625_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttatttacgtcc
DQ448621_X_P-B      atggctg-ctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AY206383_X_P-B      atggctg-ctaggctgtgctgccaactggatcttgcgcgggacgtcctttgtttacgtcc
KC510654_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ801512_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AF479684_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059466_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059495_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815670_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963828_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963829_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963830_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963831_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963832_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963833_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963834_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963835_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963836_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963837_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963838_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963839_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963840_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963841_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963855_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171304_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674391_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MG571347_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ562234_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
HM011483_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU939663_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173387_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcggaacgtcctttgtttacgtcc
KJ173388_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcggaacgtcctttgtttacgtcc
EU579441_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU589335_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815574_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815577_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815578_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171638_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171536_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171552_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171466_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171460_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171334_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171280_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ341825_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ386684_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MG571371_X_P-B      atggctg-ctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MG571364_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MG571358_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KU964115_X_P-B      atggctg-ctaggctgtgctgccaactggatcttgcgcgggacgtcctttgtttacgtcc
KU964117_X_P-B      atggctg-ctaggctgtgctgccaactggatcttgcgcgggacgtcctttgtttacgtcc
KU963962_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963963_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173416_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173417_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173411_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173412_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC774399_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC774366_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC163809_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JX429899_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ801516_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ040173_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ027325_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JN406371_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
HM011470_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815573_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ386655_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ386582_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU939675_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU595031_X_P-B      atggctg-ctaggctgtgctgccagctggatcctgcgcgggacgtcctttgtttacgtcc
AY518556_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AF282918_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
X97851_X_P-B        atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AF121251_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AF100309_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AF100308_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
KC163830_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC163829_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC163831_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963989_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173403_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173404_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC163833_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC163815_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC163814_X_P-B      atggctg-ctaggctgtgctgccgactggatcctgcgcgggacgtcctttgtttacgtcc
KC163813_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC163811_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC163810_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU434373_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963976_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963977_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963978_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963979_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963981_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963982_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963983_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963984_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963985_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963986_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU434372_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC163812_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC163816_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC163817_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC163818_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC163819_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC163820_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC163821_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC163822_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC163823_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC163824_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC163825_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC163826_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC163827_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC163828_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963980_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963987_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963988_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ562253_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ801471_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ377537_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171558_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ341818_X_P-B      atggctg-ctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MG571369_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MG571322_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
MF674426_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173369_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173370_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ924608_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ377547_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB471854_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB471855_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173365_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173366_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MG571328_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171598_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ801507_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ801479_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB073840_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB073841_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AF121248_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AF121249_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AF121250_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MG571344_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ924648_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ924605_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ924627_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ924646_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
HM153811_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ801494_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173405_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173406_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171523_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JX978431_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
GU815654_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173409_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173410_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059609_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171419_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059737_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059733_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059523_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059438_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964255_X_P-B      atggctg-ctaggctgtgctgccaattggatcctgcgcgggacgtcctttgtttacgtcc
KU964256_X_P-B      atggctg-ctaggctgtgctgccaattggatcctgcgcgggacgtcctttgtttacgtcc
KU964251_X_P-B      atggctg-ctaggctgtgctgccaattggatcctgcgcgggacgtcctttgtctacgtcc
KU964249_X_P-B      atggctg-ctaggctgtgctgccaattggatcctgcgcgggacgtcctttgtttacgtcc
KU964394_X_P-B      atggctg-ctaggctgtgctgccaattggatcctgcgcgggacgtcctttgtttacgtcc
KU964245_X_P-B      atggctg-ctaggctgtgctgccaattggatcctgcgcgggacgtcctttgtttacgtcc
KU964244_X_P-B      atggctg-ctaggctgtgctgccaattggatcctgcgcgggacgtcctttgtttacgtcc
KU964246_X_P-B      atggctg-ctaggctgtgctgccaattggatcctgcgcgggacgtcctttgtttacgtcc
KU964247_X_P-B      atggctg-ctaggctgtgctgccaattggatcctgcgcgggacgtcctttgtttacgtcc
KU964248_X_P-B      atggctg-ctaggctgtgctgccaattggatcctgcgcgggacgtcctttgtttacgtcc
KU964250_X_P-B      atggctg-ctaggctgtgctgccaattggatcctgcgcgggacgtcctttgtttacgtcc
KU964252_X_P-B      atggctg-ctaggctgtgctgccaattggatcctgcgcgggacgtcctttgtttacgtcc
KU964253_X_P-B      atggctg-ctaggctgtgctgccaattggatcctgcgcgggacgtcctttgtttacgtcc
KU964254_X_P-B      atggctg-ctaggctgtgctgccaattggatcctgcgcgggacgtcctttgtttacgtcc
EU306681_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
DQ975271_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AY310322_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AY293309_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB300364_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU306677_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU306678_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU306679_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU306680_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
DQ448626_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815672_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JF899335_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059357_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059358_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059359_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059360_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059361_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059362_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059363_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059364_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059365_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059366_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059367_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059368_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059369_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059370_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059371_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059372_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059373_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059374_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059375_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059376_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059377_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059378_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059379_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059380_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059381_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059382_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059383_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059384_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059385_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059386_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059387_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059388_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059389_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059390_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059391_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059392_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059393_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059394_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059395_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059396_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059397_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059398_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059399_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059400_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059401_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059402_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059403_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059404_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059405_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059406_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059407_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059408_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059409_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059410_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059411_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059412_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059413_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059414_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059415_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059416_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059417_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059419_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059420_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059421_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059422_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059423_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059424_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059426_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059427_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059428_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059429_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059430_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059431_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059432_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059433_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059434_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059435_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059436_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059437_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059439_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059440_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059441_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059442_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059443_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059444_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059445_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059446_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059447_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059448_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059449_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059450_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059452_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059453_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059454_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059455_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059456_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059457_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059458_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059459_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059461_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059462_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059463_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059464_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059465_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059467_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059468_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059469_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059470_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059471_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059472_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059473_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059476_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059477_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059478_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059479_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059480_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059481_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059482_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059483_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059484_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059485_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059486_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059487_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059488_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059489_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059490_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059491_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059492_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059493_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059494_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059496_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059497_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059498_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059499_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059500_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059501_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059502_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059503_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059504_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059505_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059506_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059507_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059508_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059509_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059510_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059512_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059513_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059514_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059515_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059516_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059517_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059518_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059519_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059520_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059521_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059522_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059524_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059525_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059526_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059527_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059528_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059529_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059530_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059531_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059532_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059533_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059534_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059535_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059536_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059537_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059538_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059539_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059540_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059541_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059542_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059543_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059544_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059545_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059546_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059547_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059548_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059549_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059550_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059551_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059552_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059553_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059555_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059556_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059557_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059558_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059559_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059560_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059561_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059562_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059564_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059565_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059566_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059567_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059568_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059569_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059570_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059571_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059572_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059573_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059575_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059576_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059577_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059578_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059579_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059580_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059581_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059582_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059583_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059584_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059585_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059586_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059587_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059588_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059589_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059590_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059591_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059592_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059593_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059594_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059595_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059596_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059597_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059598_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059599_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059600_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059601_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059602_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059603_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059604_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059605_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059606_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059607_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059608_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059610_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059611_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059612_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059613_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059614_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059615_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059616_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059617_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059618_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059619_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059621_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059622_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059623_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059624_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059625_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059626_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059627_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059628_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059629_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059630_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059631_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059632_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059633_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059634_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059635_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059636_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059637_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059638_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059639_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059640_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059641_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059642_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059643_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059644_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059645_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059646_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059647_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059648_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059649_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059650_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059651_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059653_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059654_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059655_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059656_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059657_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059658_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059659_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059660_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059661_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059662_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059663_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059664_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059665_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059666_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059667_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059668_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059669_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059670_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059671_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059672_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059673_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059675_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059676_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059677_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059678_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059679_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059680_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059681_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059682_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059683_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059684_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059685_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059686_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059687_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059689_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059690_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059691_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059692_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059693_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059695_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059696_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059697_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059698_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059699_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059701_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059702_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059703_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059704_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059705_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059707_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059708_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059709_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059710_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059712_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059713_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059714_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059715_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059716_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059717_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059718_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059720_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059721_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059722_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059723_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059724_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059726_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059727_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059728_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059729_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059730_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059731_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059732_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059734_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059736_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059738_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059739_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059719_X_P-B      attgctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU439018_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173363_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173364_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JX504543_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB073826_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
DQ448628_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964112_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963971_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963970_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963967_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963964_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963960_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963968_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963972_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963974_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963961_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963965_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963966_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963969_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963973_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963975_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173384_X_P-B      atggctg-ctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC774398_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ386681_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU305548_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU305547_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171605_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC510643_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC510647_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC510650_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC510660_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171380_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964114_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964108_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964109_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964110_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964111_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964113_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964118_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964120_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964121_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964122_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964088_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964092_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964085_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964083_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964079_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964080_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964081_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964082_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964084_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964086_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964087_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964089_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964090_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964091_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC774403_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964116_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964119_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ386610_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ787444_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY470960_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY470961_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY470956_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY470954_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY470953_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY470962_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173407_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173408_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173367_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815667_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815661_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815656_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815653_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815650_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ924653_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacatcctttgtttacgtcc
FJ562237_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU439022_X_P-B      atggctg-ctaggctatgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
DQ448624_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
DQ993708_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU439020_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815646_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815647_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815648_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815649_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815651_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815652_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815657_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815658_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815659_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815660_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815662_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815663_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815664_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815665_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815666_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815668_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815673_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815674_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815675_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815676_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815677_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815678_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ688405_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173399_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173400_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963799_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963800_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963801_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963802_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963803_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963804_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963805_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963806_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963807_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963808_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963809_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963810_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963811_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963812_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963813_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171482_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ562219_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AY217368_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171478_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC774413_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173381_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173382_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173413_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173414_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173415_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ924603_X_P-B      atggctg-ctaggctgtgctgccaattggatcctgcgcgggacgtcctttgtttacgtcc
JQ040125_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ032357_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ032358_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ386669_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
KJ173368_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171290_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ377644_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU939674_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcgtttgtttacgtcc
FJ899790_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcgtttgtttacgtcc
FJ899791_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcgtttgtttacgtcc
KJ410502_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881833_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881839_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881826_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881823_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU522066_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881825_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881822_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881843_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881838_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881836_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881831_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881827_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881820_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881824_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881834_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881841_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881842_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881837_X_P-B      atgactg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881835_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881829_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881828_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881830_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC814875_X_P-B      tttgctg-ctagggtgtgctgtcaactggatcctgcgcgggacgtcctttgtttacgtcc
KX276794_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964301_X_P-B      atggctg-ctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964287_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964288_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964289_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964290_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964291_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964293_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964294_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964295_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964296_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964297_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964298_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964299_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964300_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964302_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964292_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KX276810_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC814918_X_P-B      atggctg-ctagggtgtgctgccaactgaaactcgcgcgggacagtctttgtttacgtcc
MG571341_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
HM011466_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC814890_X_P-B      aaggctg-ctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC814917_X_P-B      aaggctg-ctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ341850_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ377542_X_P-B      atggctg-ctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171420_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ341831_X_P-B      atggctg-ctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ377629_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173380_X_P-B      atggctg-ctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ377606_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ386600_X_P-B      atggctg-ctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171599_X_P-B      atggctg-ctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MG571361_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171321_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JX026883_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171528_X_P-B      atggctg-ctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ386615_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ032352_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU919175_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU919176_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MH488833_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AY206391_X_P-B      atggctg-ctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173379_X_P-B      atggctg-ctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU939559_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ377638_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB302945_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB302942_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB302944_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB302943_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KX276771_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcy
JQ027313_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ562316_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ386688_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU939664_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU522074_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KX276788_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ040138_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AY167100_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AY206375_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171371_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ032353_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AY800389_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU939673_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ032354_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KX276799_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ377639_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ377625_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KX276781_X_P-B      atggctg-ctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB073824_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MG571367_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AY217357_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
AY217358_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
MG571360_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KM213035_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ377587_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ377569_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ032349_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB900110_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
DQ904357_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ562231_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MG571353_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MG571376_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
X98077_X_P-B        atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AY167098_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AY596105_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ386682_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KM213034_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JX661470_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC510641_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC510649_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC510658_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC510651_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC510652_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC510655_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC510642_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MG571356_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173357_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK052965_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171383_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ023631_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881866_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881860_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881899_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881910_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881897_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881863_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881862_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881857_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881856_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881855_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881844_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881846_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881847_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881848_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881851_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881852_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881854_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881858_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881859_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881861_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881867_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881868_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881893_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881894_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881895_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881896_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881898_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881900_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881901_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881903_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881904_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881905_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881906_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881907_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881908_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881909_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881911_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881912_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881913_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881914_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881902_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171555_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MG571368_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC774375_X_P-B      atggctg-gtaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
X97850_X_P-B        atggctg-ctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JF436921_X_P-B      atggctg-ctaggctgtgctgccaactggaccctgcgcgggacgtcctttgtttacgtcc
EU570069_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU570070_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgttaacgtcc
EU570071_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ410490_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
HM011480_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC774417_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC774412_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcggaacgtcctttgtttacgtcc
KC774373_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC774407_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171366_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ341835_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ341799_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcgtttgtttacgtcc
JQ027330_X_P-B      atggctg-ctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ027331_X_P-B      atggctg-ctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963816_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KM392072_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ341804_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964390_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964381_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964382_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964383_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964384_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964385_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964388_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964391_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964393_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964395_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964397_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964386_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964387_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964389_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964392_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964396_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964137_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964123_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964126_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964130_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964134_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964133_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964124_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964127_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964128_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964129_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964131_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964132_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964135_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964136_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964125_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ341812_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173351_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148361_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148330_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148329_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148327_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148317_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148363_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148357_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148335_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148333_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148326_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148359_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148364_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148366_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148356_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148360_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148321_X_P-B      atggctg-ccaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148332_X_P-B      atggctg-ccaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148362_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148334_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148324_X_P-B      atggctg-ctaggctgtgctgccaactgggtcctgcgcgggacgtcctttgtttacgtcc
KP148322_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148318_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148314_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148319_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148320_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148323_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148325_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148328_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148331_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148365_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC774395_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ755833_X_P-B      -ggactatcaaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171592_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ924631_X_P-B      atggctg-ctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171424_X_P-B      atggctg-ctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173361_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcatttgtttacgtcc
KJ173362_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcatttgtttacgtcc
JQ341823_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ341793_X_P-B      atggctg-ctaggctgtgctgccaactggatcttacgcgggacgtcctttgtttacgtcc
KJ173353_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EF473974_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AY596109_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AY596106_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173422_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173423_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ341822_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148344_X_P-B      atggctg-ctaggctgcgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148343_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173352_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173354_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173341_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173342_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173356_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173355_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MG571355_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MG571362_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148348_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148346_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148345_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148342_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148341_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148339_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtcc
KP148338_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148336_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148340_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148347_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148349_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK052962_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK052964_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171372_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173360_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ801514_X_P-B      atggctg-ctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881721_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
KY881722_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
KY881723_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
KY881724_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
KY881725_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
KY881726_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
KY881727_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
KY881728_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
KY881729_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
KY881730_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
KY881731_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
KY881732_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
KY881733_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
KY881734_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
KY881735_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
KY881740_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
KY881741_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
KY881745_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
KY881746_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
KY881747_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
KY881752_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
KY881753_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
KY881756_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
KY881757_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
KY881759_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
KY881760_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
KY881761_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
KY881778_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
KY881779_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
KY881869_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
AB642094_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ562321_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
MG571363_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173418_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173419_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AY167089_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ751769_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JX429910_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815770_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815747_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815748_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815750_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815751_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815752_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815753_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815754_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815755_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815756_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815757_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815759_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815760_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815761_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815762_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815764_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815765_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815766_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815767_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815768_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815769_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815771_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815749_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171495_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ341802_X_P-B      atggctg-ctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MG571374_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MG571323_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674427_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KM359440_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC774419_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JF412801_X_P-B      atggctg-ctcggctgtgctgccaactggatcttgcgcgggacgtcctttgtttacgtcc
GU815623_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ924634_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ924606_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU350409_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
DQ993697_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
DQ448627_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttatttacgtcc
AB073837_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
MG571365_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC774374_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB073827_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC774396_X_P-B      atggctg-ctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KM392083_X_P-B      atggctg-ctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171421_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171613_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674450_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KX276815_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ410507_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ410516_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ410517_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ801474_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ040171_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815669_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815643_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815642_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815639_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815637_X_P-B      atggctg-ctaggctgcgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815631_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815616_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815560_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815640_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815549_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815570_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815571_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815548_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ924610_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EF473975_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
DQ448619_X_P-B      atggctg-ctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
D00330_X_P-B        atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB073828_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB073834_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815550_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815551_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815552_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815553_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815554_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815555_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815556_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815557_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815558_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815559_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815561_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815562_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815563_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815564_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815565_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815566_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815567_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815568_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815569_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815575_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815576_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815618_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815625_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815626_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815627_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815629_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815630_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815632_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815635_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815638_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815641_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815644_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815645_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ341794_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ341810_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ341837_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JX869998_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173424_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173425_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MG571337_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MG571342_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MH488847_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MH488819_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ803820_X_P-B      atggctg-ctaggctgtgctgccaactggatactgcgcggaacgtcctttgtttacgtcc
GQ924644_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674485_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgagggacgtcctttgtttacgtcc
AB073831_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ924607_X_P-B      atggctg-ctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ341853_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC774382_X_P-B      atggctg-gtagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU939639_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC774416_X_P-B      atggctg-ctagggtgtgctgccaactggatcctacgcgggacgtcctttatttacgtcc
KC774362_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC774383_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
MF674512_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC774390_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC774363_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC774391_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC774389_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC774386_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ803764_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC774385_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC774387_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
KC774388_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC774378_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
KC774392_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
MG571326_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MG571329_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
HM011504_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcgtttgtttacgtcc
KM392084_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MH488846_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815732_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815720_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815725_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815740_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815738_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815726_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttggttacgtcc
GU815724_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815723_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815722_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815728_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815730_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815731_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815734_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815735_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815736_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815737_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815739_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815741_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815742_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815743_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815744_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815745_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815746_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815721_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815729_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815733_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815727_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815711_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815712_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815713_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815715_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815716_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815717_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815718_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815719_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
HM011473_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MH488841_X_P-B      atggctg-ctgggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MH488848_X_P-B      atggctg-ctgggctgtgctgccaactggatcctgcgcggaacgtcctttgtttacgtcc
KX276807_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JX429897_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttctttacgtcc
DQ993711_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MH488828_X_P-B      atggctg-caaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KX276778_X_P-B      atggctg-ctaggctgtgctgccaactggatactacgcgggacgtcctttgtttacgtcc
HM011476_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AY167094_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AY596104_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU882002_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MG571352_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC774379_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KX765856_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171306_X_P-B      atggctg-ctaggctgcgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ341808_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU487257_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ924647_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ386642_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB555498_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB073830_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674480_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU882004_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ341826_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU919172_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU919173_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815707_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815704_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815692_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815688_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815685_X_P-B      atggctg-ctaggctgtgctgccaactggatcttgcgcgggacgtcctttgtttacgtcc
GU815684_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815679_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815680_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815681_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815683_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815686_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815687_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815689_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815691_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815693_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815695_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815696_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815697_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815698_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815699_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815700_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815701_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815702_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815703_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815705_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815706_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815708_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815709_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815710_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
DQ993696_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EF134945_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttatttacgtcc
EF134946_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacatcctttatttacgtcc
AB205119_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB205120_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
DQ448620_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ855529_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU882003_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KX276777_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815612_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171486_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KX276803_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EF473973_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674503_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674506_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815610_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MH488842_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815608_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815605_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815603_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ801524_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815602_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815601_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815594_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815590_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815583_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815579_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815581_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815584_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815585_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815586_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815587_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815588_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815589_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815591_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815593_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815595_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815596_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815597_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815598_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815599_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815600_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815604_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815606_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815607_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815609_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815611_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815613_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815614_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MG571375_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MH488826_X_P-B      atggctg-ctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC774369_X_P-B      atggctg-ctagggtgtgctgccaaatggatcctgcgcgggacgtcctttgtttacgtcc
MH488811_X_P-B      atggctg-ctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ803795_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY417926_X_P-B      atggctg-ctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
MK171467_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB073855_X_P-B      atggctg-ctaggatgtgctgccaactggatactgcgcgggacgtcctttgtttacgtcc
JQ801506_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ377567_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KX276798_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KX276802_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK818223_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KX276795_X_P-B      atggctg-ctaggctgtgctgccaactggatcytrcgcgggacgtcctttgtttacgtcc
KX276786_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KX276774_X_P-B      atggctr-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MG571351_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcggaacgtcctttgtttacgtcc
KX276813_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171644_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ377641_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ562289_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ386583_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ562257_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KX276776_X_P-B      atggctg-ctaggctgtrctgccaactggatyctdcgcgggacgtcctttgtttacgtcc
KJ803825_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ341798_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
HM011477_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB073825_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU919171_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK818222_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcytttgtttacgtcc
KX276818_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
LC416037_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AP011089_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KM875427_X_P-B      atggctg-ctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU881997_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU881998_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173297_X_P-B      atggctg-ctaggctgtgctgccaattggatcctgcgcgggacgtcctttgtctacgtcc
KJ173298_X_P-B      atggctg-ctaggctgtgctgccaattggatcctgcgcgggacgtcctttgtctacgtcc
AP011093_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AP011094_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AP011095_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KX276796_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
FJ032342_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ032344_X_P-B      ctggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MH488829_X_P-B      atggctg-ctgggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU158263_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KX276790_X_P-B      atggctg-ctaggctgtrctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ803816_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JX661479_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ027311_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU796066_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KX276806_X_P-B      atggctg-ctaggctgtgctgccaactggatcytgcgcgggacgtcctttgtttacgtcc
KJ803789_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
GQ924628_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ562311_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
FJ899787_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ899785_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ899784_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ562322_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU939672_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ899786_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ386660_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171587_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU939666_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ386658_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171376_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB073843_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB900108_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
HM011474_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KX765854_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB642093_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ341838_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171396_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ341811_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171409_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC774405_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC774370_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JX504533_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
HM011496_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ924624_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ377566_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MG571334_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ386680_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB073832_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MH488836_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtcc
EU939661_X_P-B      atggctg-gtaggttgtgctgccaactggatactgcgcgggacgtcctttgtttacgtcc
AY800391_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AY800392_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC774418_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171542_X_P-B      atggctg-ctaggctgtgctgccaactggatactgcgcgggacgtcctttgtttacgtcc
KX276792_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB073849_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
HM011469_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KX276822_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171632_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KX276783_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC774381_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
JX661477_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881954_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881946_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881945_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881947_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881956_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881955_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881957_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881953_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881951_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881950_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881944_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881948_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881952_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881958_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KY881949_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674465_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KX276791_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AJ627225_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AF461360_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171343_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171272_X_P-B      atggctg-ctagggtgtgctgccaattggatcctgcgcgggacgtcctttgtttacgtcc
KX276827_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KM875420_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
DQ993702_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB362933_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171468_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171427_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171403_X_P-B      atggctg-ctaggctgtgctgccaactggatcttgcgcgggacgtcctttgtttacgtcc
MK171331_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171283_X_P-B      atggctg-ctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ341827_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
AF121246_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AF121243_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AF121245_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AF121244_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171649_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MG571346_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KX276809_X_P-B      atggctg-ctaggctgtgctgccaactggatcctrcgcgggacgtcctttgtttacgtcc
KX276800_X_P-B      atggctg-ctaggctgygctgccaactggatmctgcgcggracgtcctttgtttacgtcc
KX276797_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JX507213_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JX026886_X_P-B      atggctg-ctaggctgtgctgccaaccggatcctgcgcgggacgtcctttgtttacgtcc
JQ027334_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ377550_X_P-B      atggctg-ctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ518811_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ386608_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU564826_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU547563_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU439023_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EF494381_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AP011084_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB365445_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KX276772_X_P-B      atggctg-ctaggctgtgctgccaactggatcctrcgcgggacgtcctttgtttacgtcc
HM011484_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ924651_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ924654_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU939676_X_P-B      atggctg-ctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB713531_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171418_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ027316_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ562236_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ386584_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC774400_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU939665_X_P-B      atggctg-ctaggstgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU796067_X_P-B      atggctg-ctaggctgtgctgccaactgggtcctgcgcgggacgtcctttgtttacgtcc
MG571339_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KR232337_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AY217362_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AY217361_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MG571373_X_P-B      atggctg-ctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ803763_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC774406_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcatttgtttacgtcc
JX429902_X_P-B      atggctg-ctaggctgtgctgccaactggatcttgcgcgggacgtcctttgtttacgtcc
FJ386634_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU796071_X_P-B      atagctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU139543_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB073839_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964164_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964154_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964166_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964153_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964155_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964156_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964158_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964159_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964160_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964161_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964162_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964163_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964165_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964167_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964168_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964157_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173373_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC774367_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK075117_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173374_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171374_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC774376_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC774404_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963948_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963955_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963958_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963957_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963945_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963946_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963947_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963949_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963950_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963951_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963953_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963954_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963956_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963959_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963952_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AY596110_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AY596112_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173377_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173378_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171501_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcggaacgtcctttgtttacgtcc
MK171498_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171407_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171365_X_P-B      atggctg-ctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171284_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ790200_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtcc
JX429901_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ341821_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ341819_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ341795_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MG571327_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MG571324_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
LC349868_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KX276805_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KX276804_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcgtttgtttacgtcc
KX276782_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KR152339_X_P-B      atggctg-ctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ803768_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC774410_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC774377_X_P-B      atggctg-ctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
HM011471_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ855522_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ562240_X_P-B      atggctg-ctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU939677_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AY596102_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AY217359_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AY217360_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AY163869_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AY163870_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173383_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173389_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173390_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171369_X_P-B      atggctg-ctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ341809_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MH488823_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MG571350_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173397_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173398_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JX661473_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ562259_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU439021_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC774402_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JX661481_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
HM011478_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB675676_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MG571357_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MG571338_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ386683_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU939667_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU522067_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ377561_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MG571370_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ803817_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttggctacgtcc
HM011503_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
GQ377643_X_P-B      atggctg-ctaggctgcgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ377612_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB073822_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KM875426_X_P-B      atggctg-ctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK818225_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ341828_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KX276785_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173359_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC774380_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ377610_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ377568_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ377588_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815783_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815772_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815773_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815774_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815775_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815776_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815777_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815778_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815779_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815781_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815782_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815780_X_P-B      atggctg-ctaggctgcgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ803781_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ803797_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ803783_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171515_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171490_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171395_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171292_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ341830_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MH488852_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgccc
MG826153_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MG571354_X_P-B      atggctg-ctaggctgtgctgccaactggatcttgcgcgggacgtcctttgtttacgtcc
MG571325_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MG571321_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059706_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KX276801_X_P-B      atggctg-ctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KX276787_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KX276784_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KX276775_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KX276773_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KX276770_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU964138_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KU964139_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KU964140_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KU964141_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KU964142_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KU964143_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KU964144_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KU964145_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KU964146_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KU964147_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KU964148_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KU964149_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KU964150_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KU964151_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KU964152_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcc
KU963814_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KT749853_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148579_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ803752_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173420_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173421_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173386_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC774411_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JX869999_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JX661480_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JX661471_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JX507210_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JX504538_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ040157_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ924632_X_P-B      atggctg-ctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ787477_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU796068_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU043344_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
EU043345_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
EU043343_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU043342_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
DQ995804_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
DQ448622_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB287329_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB246339_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB287328_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC774415_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
DQ377158_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU306695_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU306696_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU306697_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU306698_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ377519_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KM875416_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KM875417_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ803756_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171364_X_P-B      atggctg-ctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcc
JX661478_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ341814_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttatttacgtcc
JQ341807_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MH061283_X_P-B      atggctg-ctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MG571372_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MG571333_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF674449_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KX429647_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KX276793_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JX507215_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JX429908_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JN827419_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815634_X_P-B      atggctg-ctaggctgtgctgccaactggaccctgcgcgggacgtcctttgtttacgtcc
GU815617_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815622_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ924611_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ377558_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU939638_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
DQ993701_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
DQ448623_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AY596111_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB073829_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MG571366_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AY167097_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815619_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815620_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815621_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815624_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815628_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815633_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU815636_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC315393_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963842_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963843_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963844_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963845_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963846_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963847_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963848_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963849_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963850_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963851_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963852_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963853_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KX276808_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AB073833_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ341796_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ562246_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ341839_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ562296_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC774394_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AP011096_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC774384_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JX661475_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JX661474_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JX661472_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC774371_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC774409_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JX661476_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC774401_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ803801_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ803808_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KC774365_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059460_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059511_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059735_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
FJ386654_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AY220703_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AY220704_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MF059425_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171499_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963824_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173385_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173375_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173376_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963815_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963817_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963818_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963819_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963820_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963821_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963822_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963823_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963825_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963826_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963827_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KU963854_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MG571349_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171385_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
JQ341842_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148583_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148580_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ843165_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU357842_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EF494380_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148581_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KP148582_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171546_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171448_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173372_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GU451682_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
KJ173371_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
EU939679_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MG571336_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
MK171643_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
AY167101_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
DQ993709_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
GQ924630_X_P-B      atggctg-ctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
                         *     ** *   *                   **       *            

KC774372_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KC774368_X_P-B      cgttggcgctgaatcccgcggacgacccctcccggggccgcttggggctttaccccccgc
AB219430_X_P-B      cgtcagcgctgaatcccgcggacgacccttcgcgaggtcgcttgggactctttcgtcccc
KC814883_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgccccc
MH488818_X_P-B      cgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcgcc
EU939637_X_P-B      cgtcggcgatgaatcccgcggacgacccttcccggggccgcttggggatctaccgtccgc
AB231909_X_P-B      cgtcggcgctgaatcctgcggacgacccctctcggggccgcttggggatctaccgtcctc
AB048705_X_P-B      cgtcggcgctgaatcccgcggacgacccgtctcggggccgcttggggatctaccgtcccc
KU679959_X_P-B      cgtcggcgctgaatcccgcggacgacccttctcggggccgcttggggctctaccgtcccc
AB976562_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AB100695_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MH488840_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MH488825_X_P-B      cgtcggcgctaaatcccgcggacgacccctcccggggccgcttggggctctaccgcccac
EU158262_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgyccgc
KC814873_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgtccgc
MH488860_X_P-B      cgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggactctgccgtcccc
MK171606_X_P-B      cgtcggcgctgaatcccgcggacgacccgtctcggggccgtttgggcctctgccgtcccc
KY881821_X_P-B      cgtcggcgcagaatgcagcgaaggacacagcacggggacgctaagagctctaccgcccgc
MK171413_X_P-B      cgtcggcgctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccc
FJ386648_X_P-B      cgtcggcgctgaatcccgcggacgacccctcycggggccgcttgggrctctaccgcccgc
MH488855_X_P-B      cgtctccgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KX276812_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MH488830_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MH488856_X_P-B      cgtcagcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MK171285_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AY206387_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AB073823_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KY881792_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KJ803773_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgaccgc
KJ803775_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgaccgc
AB073836_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KY881784_X_P-B      cgtcggcgctgaatcccgcggacgacccctcaccgggccgcttggggctctaccgcccgc
KY881800_X_P-B      cgtcggcgctgaatcccgcggacgacccctcacggggccgcttggggctctaccgcccgc
KY881797_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KY881781_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KY881801_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcctgc
KY881795_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KY881793_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KY881787_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KY881783_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KY881780_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KY881782_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KY881786_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KY881788_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KY881789_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KY881790_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KY881791_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KY881794_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KY881796_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KY881798_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KY881799_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KY881808_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KY881850_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KY881785_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
HM011475_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
AY217364_X_P-B      cgtcggcgctgaatcccgcggacgacccctccaggggccgcttagggctgtaccgcccgc
JQ341813_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggacgcttggggcyctaccgcccgc
FJ787476_X_P-B      cgtcggcgctgaatcccgcggacgacccttcccggggccgcttggagctctaccgcccgc
JQ040169_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgaccgc
GQ377525_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
EF494382_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MK171525_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MH488845_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
DQ995803_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
AY283777_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AY206390_X_P-B      cgtcggcgctgaatcccgcggacgacccctcacggggccgcttggggctctaccgcccgc
AY238972_X_P-B      cgtcggcgctgaatcccgcggacgacccctcacggggccgcttggggctctaccgcccgc
JQ341836_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcwtggggctctaccgcccgc
KM875418_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
GQ377622_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
EU939633_X_P-B      cgtcagcgctgaatcccgcggacgacccctcccggggccgtttggggctctaccgcccgc
EU939634_X_P-B      cgtcagcgctgaatcccgcggacgacccctcccggggccgtttggggctctaccgcccgc
DQ993710_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
DQ993698_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
DQ993699_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JQ027329_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
EU939660_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MG571331_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KX276789_X_P-B      cgtcggcgctgaatcccgcggacgacccttcccggggccgcttggggctctaccgcccgc
JX504532_X_P-B      cgtcagcgctgaatcccgcggacgacccctcccggggtcgcttggggctctaccgcccgc
KJ803821_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MK171589_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
GQ377582_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
FJ562312_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MK171579_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggtgctaccgcccgc
JQ801485_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgcccgc
DQ995802_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctccaccgcccgc
JQ040147_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
EU487256_X_P-B      cgtcggcgctgaatcccgcggacgacccctccaggggccgcttggggctctaccgcccgc
EU660224_X_P-B      cgtcggcgctgaatcccgcggacgacccctccaggggccgcttggggctctaccgcccgc
MK171476_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MH488853_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KJ410500_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KY470834_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KY470837_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KY470841_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KY470838_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KY470835_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctgccgcccgc
KY470830_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KY470832_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KY470833_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KY470836_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KY470839_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KY470840_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KT749820_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JQ341803_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttgggactctaccgcccgc
KU964272_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964284_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964283_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964273_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964274_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964275_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964276_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964277_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964278_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964279_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964280_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964282_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964285_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964286_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964281_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
FJ787475_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
EU939669_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
FJ899779_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MH488834_X_P-B      cgtcggcgctgaatcccgcggacgacccctcacggggccgcttggggctctaccgcccgc
DQ995801_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
AY206373_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MK171545_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
HM011482_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
EU564823_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
EU564824_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
EU564822_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MK171475_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KC774397_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
EU522072_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
EU522075_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
EU522073_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MK171377_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgacctc
MG372436_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
FJ562262_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AY167102_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AB195933_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AB195934_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AB195935_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JQ040128_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccggccgc
JQ341816_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JQ027315_X_P-B      cgtcggcgctgaatcccgcggacgacccctcgcggggccgcttggggctctaccgcccgc
FJ562224_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MK171507_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AY220697_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MH488820_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KY881864_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
FJ562260_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
EU939671_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
EU939636_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
DQ995805_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
AF121247_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KC492739_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KC492740_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KY881845_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
FJ518812_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AY596103_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MH663473_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JX870001_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctataccgcccgc
MK171516_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JQ341797_X_P-B      cgtcagcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KY881865_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KY881853_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgt
KY881849_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KX276811_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KC774408_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
HM011494_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
EU939670_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MK171603_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AY217355_X_P-B      cgtcggcgctgaaccccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AY217356_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
FJ386636_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
FJ386676_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
FJ562254_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MK171497_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MK171601_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JQ341817_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KM213036_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674422_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059711_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP036970_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JX429900_X_P-B      cgtcagcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AY220698_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
DQ993700_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
EU939678_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
FJ562222_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
FJ386675_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JQ341844_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
DQ361535_X_P-B      cgtcagcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccac
GQ855689_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AB106884_X_P-B      cgtcggcgctgaatcccgcggacgacccctccaggggccgcctggggctataccgcccgc
AB900097_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctttaccgcccgc
AB073858_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674492_X_P-B      cgtcggcgctgaatcccgcggacgacccttcccggggccgcttggggctctaccgcccgc
HM011487_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctgtaccgcccgc
AB931168_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttagggctctaccgcccgc
AB931169_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttagggctctaccgcccgc
AB900112_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
HM011499_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
KX276858_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
JX661484_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AB073853_X_P-B      cgtcggcgatgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AB073850_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MG826152_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctttaccgtccgc
KP659249_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggtcgcttggggctctaccgcccrc
AB219427_X_P-B      cctcagcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AB104890_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AB104891_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AB115551_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
DQ993681_X_P-B      cgtcggcgctgaatcctgcggacgacccctcccggggccgcttggggctctaccgccctc
MF674448_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttagggctctaccgcccgc
MF674385_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AB212625_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgaccgc
JQ341840_X_P-B      cgtcrgcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674436_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggcygcttggggctctaccgcccgc
KU234318_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674483_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
FJ023634_X_P-B      cgtcggcgctgaatcccgcggacgacccctcgcggggccgcttggggctctaccgcccgc
DQ993685_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
MF674499_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674495_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
DQ993682_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674420_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgaccgc
MF674432_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgaccgc
MF674508_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttagggctctaccgcccgc
MF674415_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcctggggctctaccgcccgc
MF674476_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674456_X_P-B      cgtcggcgctgaatcccgcagacgacccctcccggggccgcttggggctctaccgcccgc
MF674500_X_P-B      cgtcggcgctgaatcccgcagacgatccctcccggggccgcttggggctctaccgcccgc
AB031267_X_P-B      cgtcggcgctgaatcccgcagacgacccctcccggggccgcttggggctctaccgcccgc
MF674434_X_P-B      cgtcggcgctgaatcccgcagacgacccctcccggggccgcttggggctctaccgcccgc
JQ341824_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctataccgcccgc
MF674515_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674462_X_P-B      cgtcgacgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674409_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674396_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctttaccgcccgc
MF674395_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674394_X_P-B      cgtcggcgctgaatcccgcagacgacccctcccggggccgcttggggctctaccgcccgc
KX765841_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674383_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
GQ855526_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
MF674479_X_P-B      cgtcggcgctgaatcccgcagacgacccctcccggggccgcttggggctctaccgcccgc
AB212626_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674507_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674459_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674392_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccggccgc
MF674413_X_P-B      cgtcggcgctgaatcccgcggacgacccctcgcggggccgcttggggctctaccgcccgc
MF674404_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JQ341848_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674511_X_P-B      cgtcagcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674466_X_P-B      cgtcagcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674445_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674441_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctatcgcccgc
MF674440_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674433_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgtttggggctctaccgcccgc
MF674401_X_P-B      cgtcagcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674400_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674393_X_P-B      cgtcggcgctgaatcctgcggacgacccctcccggggccgcttggggctctaccgcccgc
DQ993686_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AB073835_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674419_X_P-B      cgtcggcgctgaatcccgcagacgacccctcccggggccgcttggggctctaccgcccgc
MF674482_X_P-B      cgtcggcgctgaatcccgcagacgacccctcccggggccgcttggggctctaccgcccgc
MF674452_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674451_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674510_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674513_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674423_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674387_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674461_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674389_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674469_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccga
AB031266_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgattggggctctaccgcccgc
MF674455_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674505_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674493_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674491_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674478_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674447_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674498_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674443_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674437_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674477_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674405_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
DQ993684_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AB117759_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674414_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
GQ924635_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
GQ358144_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgcccgc
AB900102_X_P-B      cgtcagcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
GQ358145_X_P-B      cgtcagcgctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgcccgc
GQ358146_X_P-B      cgtcagcgctgaatcccgcggacgacccctcccgggcccccttggggctctaccgcccgc
GQ358147_X_P-B      cgtcagcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AB300370_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AB900107_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AB828708_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AB713527_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AB246343_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AB219428_X_C-B      cgtcagcgctgaatcccgcggacgacccctctcggggccgcttggggctttaccgcccgc
AB073846_X_P-B      cgtcagcgctgaatcccgcagacgacccctcccggggccgcttggggctctaccgcccgc
AB073845_X_P-B      cgtcggcgctgaatcccgcggacgacccctccaggggccgcttggggctctaccgcccgc
AB073842_X_P-B      cgtcggcgctgaatcccgcggacgacccctccaggggccgcttgggcctctaccgcccgc
AB246342_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MH932712_X_P-B      cgtcagcgctgaatcccgcggacgacccctcccggggccgtttggggctctaccgcccgc
AB900103_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AB287327_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AB205121_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
D23678_X_P-B        cgtcggcgctgaatcccgcggacgacccctcccggggccgcttagggctctaccgcccgc
AB010289_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
D00329_X_P-B        cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AB073848_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
LC279268_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctttaccgcccgc
LC279269_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctttaccgcccgc
LC279270_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctttaccgcccgc
LC279271_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctttaccgcccgc
LC279272_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctttaccgcccgc
LC279273_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctttaccgcccgc
KY629636_X_P-B      cgtcggcgttgaatcccgcagacgacccctcccggggccgcttggggctctaccgaccgc
GQ358151_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
GQ358150_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctaccgcccgc
GQ358149_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
GQ358152_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
GQ358148_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
LC349871_X_P-B      cgtcggcgctgaatcccgcggacgacccttcccggggtcgcttggggctctaccgcccgc
KX276824_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AB900106_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctataccgcccgc
AB010290_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctataccgcccgc
AB010291_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctataccgcccgc
AB010292_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctataccgcccgc
AB302095_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AB073856_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgcccgc
AB073844_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggtcgcttggggctctaccgcccgc
AB900111_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AB246341_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AB073857_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AB073851_X_P-B      cgtcggcgctgaatcccgccgacgacccctcccggggccgcttggggctctaccgcccgc
AB073838_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AB493827_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AB073847_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
D23679_X_P-B        cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
D50521_X_P-B        cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
D50522_X_P-B        cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AB642101_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AB073854_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AB900105_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AB241116_X_P-B      cctcggcgctgaatcctgcggacgacccctcccggggccgcttggggctctaccgcccgc
AB241117_X_P-B      cctcggcgctgaatcctgcggacgacccctcccggggccgcttggggctctaccgcccgc
JQ429082_X_P-B      cgtcggcgctgaatcctgcggacgacccctcccggggccgcttggggctctaccgcccgc
GQ924641_X_P-B      cgtcggcgctgaatcctgcggacgacccctcccggggccgcttggggctctaccgcccgc
AB900104_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP148420_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP148430_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP148426_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP148394_X_P-B      cgtcggcgctgaatcccgcggacaacccctcccggggccgcttggggctctaccgcccgc
KP148383_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP148374_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP148414_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP148411_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP148405_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP148425_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP148410_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP148416_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP148421_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP148429_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP148433_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP148418_X_P-B      cgtcggcgctgaatcccgcggacgaccccccccggggccgcttggggctctaccgcccgc
KP148423_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP148419_X_P-B      cgtcggcgctgaatcccgcggacgactcctcccggggccgcttggggctctaccgcccgc
KP148427_X_P-B      cgtcggcgctgaatcccgcggacgactcctcccggggccgcttggggctctaccgcccgc
KP148409_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP148415_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP148399_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP148389_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP148384_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggcactaccgcccgc
KP148379_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgtccgc
KP148377_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP148371_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP148369_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP148451_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP148368_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP148367_X_P-B      cgtcggcgctggatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP148370_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP148373_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP148375_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP148376_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP148378_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP148380_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP148382_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP148385_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP148386_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP148387_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP148388_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP148390_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP148391_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP148392_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP148395_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP148396_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP148397_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP148398_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP148400_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP148401_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP148402_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP148403_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP148437_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP148372_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP148440_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP148439_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP148406_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP148407_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP148413_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP148424_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP148435_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP148438_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AB219426_X_P-B      cctcggcgctgaatcctgcggacgacccctcccggggccgcttggggctctaccgcccgc
AB219429_X_P-B      cctcggcgctgaatcctgcggacgacccctcccggggccgcttggggctctaccgcccgc
GQ924645_X_P-B      cctcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
GQ924638_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttgggtctctaccgcccgc
AP011088_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
GQ358142_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
GQ358143_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
AB713528_X_P-B      cgtcggcgctgaatcccgcggacgacccctccaggggccgcttggggctctaccgcccgc
AB713532_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
GQ924625_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KX276819_X_P-B      cgtcggcgctgaatccygcggacgacccctcccggggccgcttggggctctaccgcccgc
HQ700549_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctgtaccgcccgc
GQ358140_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
GQ358139_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccccccgc
GQ358138_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctaccgcccgc
AB287326_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
AP011091_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
AP011092_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
GQ358137_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
AP011090_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
EF473976_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
GQ358141_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
GQ924639_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttgggtctctaccgcccgc
HM011467_X_P-B      cgtcggcgctgaatcccgcggacgacccctcacggggccgcttggggctctaccgcccgc
KX276820_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KX429628_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
EF473977_X_P-B      cgtcggcgctgaatcccgcggacgacccctcacggggccgcttggggctctaccgcccgc
LC349877_X_P-B      cgtcggcgctgaatcccgcggacgacccctcacggggccgcttggggctctaccgcccgc
KX429622_X_P-B      cgtcggcgctgaatcccgcagacgacccctcccggggccgcttggggctctaccgcccgc
AB205122_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
GQ924640_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AB900095_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AP011086_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AP011087_X_P-B      cgtcggcgctgaatcctgcggacgacccctcccggggccgcttggggctctaccgcccgc
KJ173401_X_P-B      cgtcggcgctgaatcccgcagacgatccctcccggggccgcttggggctctaccgaccgc
KJ173402_X_P-B      cgtcggcgctgaatcccgcagacgatccctcccggggccgcttggggctctaccgaccgc
KX276823_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctwccgcccgc
KJ803786_X_P-B      cgtcggcgctgaatcctgcggacgacccctcccggggccgcttggggctctaccgcccgc
JQ429079_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KX429630_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KY629635_X_P-B      cgtcggcgctgaatcccgcggacgacccctcacggggccgcttggggctctaccgcccgc
AB900098_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
LC349878_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AB073852_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674439_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
EU660230_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
EU660231_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
EU660232_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
EU660233_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MH488817_X_P-B      cgtcggcgctgaaccccgcggacgacccctcccggggccgcttggggctctaccgcccgc
FJ023637_X_P-B      cgtcagcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
FJ023638_X_P-B      cgtcagcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
KP148452_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcatggggctctaccgcccgc
KP148453_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcatggggctctaccgcccgc
KP148461_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcatggggctctaccgccctc
KP148458_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcatggggctctaccgcccgc
KP148457_X_P-B      cgtcggcgctgaatcccgcggacgacccctcgcggggccgcatggggctttaccgcccgc
KP148459_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcatggggctctaccgcccgc
KP148455_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcatggggctctaccgcccgc
KP148460_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcatggggctctaccgcccgc
KP148456_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcatggggctctaccgcccgc
EU330994_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgactggggctctaccgcccgc
EU330997_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgactggggctctaccgcccgc
EU330996_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgactggggctctaccgcccgc
EU330989_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgactggggctctaccgcccgc
EU330990_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgactggggctctaccgcccgc
EU330995_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgactggggctctaccgcccgc
EU330992_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgactggggctctaccgcccgc
EU330998_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgactggggctctaccgcccgc
EU330999_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgactggggctctaccgcccgc
EU331000_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgactggggctctaccgcccgc
EU331001_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgactggggctctaccgcccgc
KP659255_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
KP659220_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
DQ463798_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccga
JN792899_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccga
DQ463791_X_P-B      cgtcgccgctgaatcccgcggacgacccctctcggggacgcttggggctgtaccgcccgc
DQ463800_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
JN792898_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
JN792897_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
DQ463796_X_P-B      cgtcgaagctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
DQ463795_X_P-B      cgtcggcgctgaatcccgcggacgacccctcgcggggccgcttggggctctaccgcccgc
DQ463792_X_P-B      cgtcgccgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
DQ463799_X_P-B      cgtcgccgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
JN792894_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccac
JN792900_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
DQ463790_X_P-B      cgtcgaagctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
DQ463793_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
DQ463801_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
JN792893_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
DQ463787_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
DQ463802_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
DQ463788_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
DQ463794_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
AB287324_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctccaccgcccgc
AB287323_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
KP659250_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
AB287321_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccac
AB287320_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
AB287325_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
KP659221_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
KP659251_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
JN792901_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgccccc
JN792902_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgccccc
KP659245_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
AB287322_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
KP659253_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
JN792896_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
DQ463789_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
DQ463797_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
JN792895_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
KP659223_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
AB287319_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
KP659224_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
KP659248_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
AB287317_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
KP659234_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
AB287318_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
KP659219_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
KP659254_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
KP659252_X_P-B      cgtcagcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
KP659246_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
AB287314_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
AB287315_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
AB287316_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
KP659235_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
KP659237_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
KP659247_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
KX276821_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccsc
KJ803796_X_P-B      cgtcagcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KX276830_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggacgcttggggctctaccgcccgc
AB713529_X_P-B      cgtcagcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
HM011490_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AB713530_X_P-B      cgtcagcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
EF473971_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KX429623_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgccccc
KX429620_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgtttggggctctaccgcccgc
AB033555_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggtcgcttggggctctaccgccctc
JQ429081_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttagggctctaccgcccgc
JQ341843_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgccccc
KX276828_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KX429631_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
M54923_X_P-B        cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
LC349879_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KX429651_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccac
KX276829_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctntaccgcccgc
KJ803784_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
GQ358136_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
LC349872_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KJ803819_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AB493833_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttagggctctaccgcccgc
LC349870_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AB033554_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
D00331_X_C-B        cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
LC349874_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
LC349869_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KX276814_X_P-B      cgtcggcgctgaatcccgcagacgacccctcccggggccgcttggggctctaccgcccgc
KJ803824_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JQ429080_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
HQ700548_X_P-B      cgtcggcgctgaatcccgcggacgacccctcacggggccgcttggggctgtaccgcccgc
HM011492_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgyttggggctctaccgcccgc
EF473972_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
GQ924617_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AB493835_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KX429616_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KX429627_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
LC349873_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
LC349875_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KX429648_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KX429624_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KX276825_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KJ803787_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KJ803758_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AP011085_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KX429621_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KX429626_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KJ803755_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JQ341815_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgcccgc
KX276817_X_P-B      cgtcggcgctgaatccygcggacgacccctcccggggccgcttggggctctaccgcccgc
GQ924656_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JQ341833_X_P-B      cgtcagcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
GQ924621_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccac
DQ993694_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggacgcttggggctttaccgcccgc
GQ924637_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674464_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF621878_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JQ707751_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JQ707741_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JQ707736_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JQ707748_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JQ707752_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JQ707754_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JQ707756_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JQ707760_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JQ707761_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JQ707757_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JQ707740_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JQ707745_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JQ707746_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JQ707753_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JQ707766_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JQ707762_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JQ707735_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JQ707765_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JQ707758_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JQ707744_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctacagcccgc
JQ707734_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JQ707737_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JQ707738_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JQ707739_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JQ707742_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JQ707743_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JQ707747_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JQ707749_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JQ707750_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JQ707755_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JQ707759_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JQ707763_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JQ707764_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JQ707767_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674410_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674407_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctttaccgcccgc
HQ700546_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttgggcctttaccgcccgc
AY033072_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccggccgc
AY033073_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccggccgc
DQ993704_X_P-B      cgtcgacgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
DQ993703_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
DQ993705_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
DQ993706_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
DQ993707_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
DQ993687_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctttaccgcccgc
MF674453_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgcccgc
FJ023632_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgcccgc
AB368295_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctatcgtccgc
MF674487_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674446_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctttaccgcccgc
MG571348_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674473_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674470_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
FJ023636_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctttaccgcccgc
DQ993683_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
FJ023633_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctttaccgcccgc
MF674488_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctttaccgcccgc
MF674490_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctttaccgcccgc
MF674497_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctttaccgcccgc
MF674481_X_P-B      cgtcggcgctgaatccagcggacgacccctcccggggccgcttggggctctaccgcccgc
DQ993680_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674509_X_P-B      cgtcggcgctgaatcctgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674397_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccac
FJ023635_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674416_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674421_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674424_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JQ341845_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674406_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggacgcttggggctctaccgcccgc
GQ924626_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctttaccgcccgc
MF674460_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674438_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccac
MF674382_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
FJ349236_X_P-B      cgtcggcgctgaatcccgcggacgacccctccaggggccgcttggggctctaccgcccgc
MF674384_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674496_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JQ040170_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MH488843_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggtcgcttggggccctaccgcccgc
MK171636_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgaccgc
AB555499_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059694_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059700_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JX661482_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JX661483_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccac
KC510644_X_P-B      cgtctgcgctgaatcccgcggacgacccctcccggggccgcttagggctctaccgcccgc
KC510648_X_P-B      cgtcagcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KC510653_X_P-B      cgtctgcgctgaatcccgcggacgacccctcccggggccgcttagggctctaccgcccgc
KC510646_X_P-B      cgtcagcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KC510659_X_P-B      cgtcagcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AY167093_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttgggtctctaccgcccgc
FJ386668_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KP406170_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MH488814_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MH488812_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctgccgcccgc
KC510656_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KC510657_X_P-B      cgtcagcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AF282917_X_P-B      cgtcggcgctgaatcccgcggacgacccttcccggggccgcttggggctctaccgcccgc
JX504531_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KX276779_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggmcgcttggggctctaccgcccgc
MH488816_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JX026879_X_P-B      cgtcggagctgaatcccgcggacgacccctcccggggccgcttagggctctaccgcccgc
AY766463_X_P-B      cgtcagcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KJ173347_X_P-B      cgtcggcgctgaatcctgcggacgacccctcccggggccgcttggggctctaccgcccgc
KJ173348_X_P-B      cgtcggcgctgaatcctgcggacgacccctcccggggccgcttggggctctaccgcccgc
KJ173343_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KJ173345_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
GU815572_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AB073821_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KC163805_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MG571340_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctaccgcccgc
MH488851_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MH488813_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059418_X_P-B      cgtcggcgctgaatcccgcggacgacccgtcccggggccgtttggggctctaccgcccgc
KJ173339_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KJ173340_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KC774393_X_P-B      cgtcggcgctgaatcctgcggacgacccctcacggggccgcttggggctctaccgcccgc
AB246340_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KJ803805_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
EU570075_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059554_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
EU306712_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
EU306700_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
EU306708_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
EU306707_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
EU306701_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
EU306702_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
EU306704_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
EU306705_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
EU306706_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
EU306709_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
EU306710_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
EU306711_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
EU306703_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059563_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MH488832_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
FJ386656_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964264_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964261_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964257_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964258_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964259_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964262_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964263_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964265_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964266_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964267_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964268_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964269_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964271_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964260_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964270_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964105_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964093_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964094_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964095_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964097_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964099_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964100_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964103_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964104_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964106_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964096_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964098_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964101_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964102_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964107_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MK171273_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KM213032_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JQ341800_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MH488835_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059620_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgccccc
JX429911_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttgggcctctaccgcccgc
GQ475340_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
FJ562303_X_P-B      cgtcggcgctgaatcccgcggacgacccttcccggggccgcttggggctctaccgcccgc
FJ386666_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
EU306699_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
DQ448625_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccggccgc
DQ448621_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AY206383_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KC510654_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JQ801512_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AF479684_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctataccgcccgc
MF059466_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059495_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
GU815670_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU963828_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU963829_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU963830_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU963831_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU963832_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU963833_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU963834_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU963835_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU963836_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU963837_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU963838_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU963839_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU963840_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU963841_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU963855_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MK171304_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674391_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgcccgc
MG571347_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
FJ562234_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttgggtctctaccgcccgc
HM011483_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
EU939663_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KJ173387_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KJ173388_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
EU579441_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
EU589335_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
GU815574_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
GU815577_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
GU815578_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MK171638_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MK171536_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MK171552_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MK171466_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MK171460_X_P-B      cgtcggcgctgaatcctgcggacgacccctcccggggccgcttggggctctaccgcccgc
MK171334_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MK171280_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
JQ341825_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
FJ386684_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MG571371_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MG571364_X_P-B      cgtcggcgctgaatccagcggacgacccctcccggggccgcttggggctctaccgcccac
MG571358_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964115_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964117_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU963962_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU963963_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KJ173416_X_P-B      cgtcggcgctgaatccggcggacgacccctcccggggccgcttggggctctaccgcccgc
KJ173417_X_P-B      cgtcggcgctgaatccggcggacgacccctcccggggccgcttggggctctaccgcccgc
KJ173411_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KJ173412_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KC774399_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KC774366_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttgggactctaccgcccgc
KC163809_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttgaggctctaccgcccgc
JX429899_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JQ801516_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JQ040173_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgaccgc
JQ027325_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JN406371_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
HM011470_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
GU815573_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
FJ386655_X_P-B      cgtcggcgctgaatcctgcggacgacccctcccggggccgcttggggctctatcgcccgc
FJ386582_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
EU939675_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
EU595031_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AY518556_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AF282918_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
X97851_X_P-B        cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AF121251_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AF100309_X_P-B      cgtcggcgctgaatcccgcggacgacccctcgcggggccgcttggggctctaccgcccgc
AF100308_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KC163830_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccgggaccgcttggggctctaccgcccgc
KC163829_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KC163831_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU963989_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KJ173403_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KJ173404_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KC163833_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KC163815_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KC163814_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KC163813_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgtttggggctctaccgcccgc
KC163811_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KC163810_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
GU434373_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU963976_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU963977_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU963978_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU963979_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU963981_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU963982_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU963983_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU963984_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU963985_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU963986_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
GU434372_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctccaccgcccgc
KC163812_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KC163816_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KC163817_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KC163818_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KC163819_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KC163820_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KC163821_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KC163822_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KC163823_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KC163824_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KC163825_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KC163826_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KC163827_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KC163828_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU963980_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU963987_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU963988_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
FJ562253_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JQ801471_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
GQ377537_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MK171558_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JQ341818_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MG571369_X_P-B      cgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgc
MG571322_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF674426_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KJ173369_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KJ173370_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
GQ924608_X_P-B      cgtcggcgctgaatcccgcggacgacccctcacggggccgcttggggctctaccgcccgc
GQ377547_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AB471854_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AB471855_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KJ173365_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KJ173366_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MG571328_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MK171598_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JQ801507_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JQ801479_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AB073840_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AB073841_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AF121248_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AF121249_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AF121250_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MG571344_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgcccgc
GQ924648_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
GQ924605_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgcccgc
GQ924627_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
GQ924646_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
HM153811_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JQ801494_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KJ173405_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KJ173406_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MK171523_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JX978431_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
GU815654_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KJ173409_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KJ173410_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059609_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MK171419_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059737_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059733_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059523_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059438_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964255_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964256_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964251_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964249_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964394_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964245_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964244_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964246_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964247_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964248_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964250_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964252_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964253_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
KU964254_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
EU306681_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
DQ975271_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AY310322_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AY293309_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
AB300364_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
EU306677_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
EU306678_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
EU306679_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
EU306680_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
DQ448626_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
GU815672_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
JF899335_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059357_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059358_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059359_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059360_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059361_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059362_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059363_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059364_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059365_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059366_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059367_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059368_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059369_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059370_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059371_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059372_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059373_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059374_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059375_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059376_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059377_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059378_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059379_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059380_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059381_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059382_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059383_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059384_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059385_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059386_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059387_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059388_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059389_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059390_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059391_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059392_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059393_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059394_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059395_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059396_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059397_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059398_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059399_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059400_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059401_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059402_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059403_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059404_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059405_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059406_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059407_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059408_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059409_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059410_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059411_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059412_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059413_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059414_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059415_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059416_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059417_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059419_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059420_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059421_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059422_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059423_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059424_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059426_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059427_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059428_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059429_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059430_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059431_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059432_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059433_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059434_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059435_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059436_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059437_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059439_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059440_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059441_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059442_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059443_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059444_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059445_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059446_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059447_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059448_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059449_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059450_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059452_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059453_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059454_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059455_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059456_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059457_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059458_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059459_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059461_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059462_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059463_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059464_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059465_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059467_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059468_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059469_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059470_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059471_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059472_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059473_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059476_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059477_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059478_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059479_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059480_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059481_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059482_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059483_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059484_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059485_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059486_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059487_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059488_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059489_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059490_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059491_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059492_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059493_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059494_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059496_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059497_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059498_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059499_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059500_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059501_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059502_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059503_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059504_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059505_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059506_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059507_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059508_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059509_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059510_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059512_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059513_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059514_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059515_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059516_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059517_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059518_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059519_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059520_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059521_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059522_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059524_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059525_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059526_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059527_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059528_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059529_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059530_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059531_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059532_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059533_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059534_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059535_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059536_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059537_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059538_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059539_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059540_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059541_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059542_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059543_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059544_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059545_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059546_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059547_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059548_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059549_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059550_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059551_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059552_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059553_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059555_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059556_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059557_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059558_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059559_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059560_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059561_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059562_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059564_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059565_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059566_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059567_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059568_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059569_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059570_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059571_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059572_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059573_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059575_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgc
MF059576_X_P-B      cgtcggcgctgaatcccgcggacgacccctcccgg