HBVdb

Dataset for nucleotide sequence S of genotype G

[Download (right click)] [Alignment] [Repertoires]

159 sequence(s)

>gnl|hbvcds|AB056513_S_P-G Feature FT:CDS AB056513_S_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaatatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AB056514_S_P-G Feature FT:CDS AB056514_S_P-G of [Viruses] Hepatitis B Virus genotype G. Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AB056515_S_P-G Feature FT:CDS AB056515_S_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtataaaaccttcggaaggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AB056516_S_P-G Feature FT:CDS AB056516_S_P-G of [Viruses] Hepatitis B Virus genotype G. Partial genome (Contains: HBx, MHBs, SHBs). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AB064310_S_P-G Feature FT:CDS AB064310_S_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AB064311_S_P-G Feature FT:CDS AB064311_S_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AB064312_S_P-G Feature FT:CDS AB064312_S_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AB064313_S_C-G Feature FT:CDS AB064313_S_C-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcccctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AB375165_S_P-G Feature FT:CDS AB375165_S_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AB375166_S_P-G Feature FT:CDS AB375166_S_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgatttcaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AB375167_S_P-G Feature FT:CDS AB375167_S_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgatttcaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AB375168_S_P-G Feature FT:CDS AB375168_S_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgatttcaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AB375169_S_P-G Feature FT:CDS AB375169_S_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgatttcaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AB375170_S_P-G Feature FT:CDS AB375170_S_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgatttcaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AF160501_S_C-G Feature FT:CDS AF160501_S_C-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AF369533_S_P-G Feature FT:CDS AF369533_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate MEX8c). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AF405706_S_P-G Feature FT:CDS AF405706_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 235/01). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AY168428_S_P-G Feature FT:CDS AY168428_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate ST81). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|DQ207798_S_P-G Feature FT:CDS DQ207798_S_P-G of [Viruses] Hepatitis B Virus genotype G. Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|DQ236116_S_P-G Feature FT:CDS DQ236116_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate MEX C16). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgatttcaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|DQ236117_S_P-G Feature FT:CDS DQ236117_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate MEX C17). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgatttcaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|DQ236119_S_P-G Feature FT:CDS DQ236119_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate MEX C19). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgatttcaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|DQ403176_S_P-G Feature FT:CDS DQ403176_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate s04004677). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|EF464097_S_P-G Feature FT:CDS EF464097_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 06hac). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF464098_S_P-G Feature FT:CDS EF464098_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 09hgg). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF634480_S_P-G Feature FT:CDS EF634480_S_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctccaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|EU366207_S_P-G Feature FT:CDS EU366207_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate DIB30). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggatcaaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcgaccaccagtacgggaccatgcagaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcaatttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU366208_S_P-G Feature FT:CDS EU366208_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate DIB118). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggatcaaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcgaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcaatttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU366209_S_P-G Feature FT:CDS EU366209_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate DIB24). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggatcaaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcgaccaccagtacgggaccatgcagaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcaatttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU366212_S_P-G Feature FT:CDS EU366212_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate DIB112). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctcggacccctgcgcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctaggggaatcaaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcgaccaccagtacgggaacatgcagaacctgcacgactcctgctcaaggcaactctatgt
atcccttatgttgctgtacaaaaccttcggacagaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagcccgtttctcctgactcaatttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaaaactgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023674_S_P-G Feature FT:CDS FJ023674_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate I2/C2_C04-0790). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcgggatttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacaaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcarggtatgttgcccgtttg
tcctctaattccaggatcctcgaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacamcaccttgagtccatttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023700_S_P-G Feature FT:CDS FJ023700_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate C04-0790). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcgggatttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacaaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcagggtatgttgcccgtttg
tcctctaattccaggatcctcgaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacaccttgagtccatttatgc
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023701_S_P-G Feature FT:CDS FJ023701_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate C04-0790). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcatcacatcaggattcctcggacccctgctcgtgttacaggcgggatttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacaaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcagggtatgttgcccgtttg
tcctctaattccaggatcctcgaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggggtgggcctcagcccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattggggaccaaatctgtacaacaccttgagtccatttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023702_S_P-G Feature FT:CDS FJ023702_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate C04-0790). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcgggatttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacaaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcctcatcctgctgctatgccccatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcgaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcaattatatggatgatgtggtattgggggccaaatctgtacaacaccttgagtccatttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023703_S_P-G Feature FT:CDS FJ023703_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate C04-0790). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcgggatttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacaaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcagggtatgttgcccgtttg
tcctctaattccaggatcctcgaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
atccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagttcactagcgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacaccttgagtccatttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023704_S_P-G Feature FT:CDS FJ023704_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate C04-0790). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcgggatttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacaaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcagggtatgttgcccgtttg
tcctctaattccaggatcctcgaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
atccctcctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgcacaacaccttgagtccatttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023705_S_P-G Feature FT:CDS FJ023705_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate C04-0790). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcgggatttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacaaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcgaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttc
ccccactgtctggcttttagttatatggatgatgtggtattgggggccaaatctgtacaccaccttgagtccatttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023706_S_P-G Feature FT:CDS FJ023706_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate C04-0790). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcgggatttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacaaccgagtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcagggtatgttgcccgtttg
tcctctaattccaggatcctcgaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttaccagcgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacaccttgagtccatttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023707_S_P-G Feature FT:CDS FJ023707_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate C04-0790). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcgggatttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacaaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcagggtatgttgcccgtttg
tcctctaattccaggatcctcgaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacaccttgagtccatttatac
cgctgttaccaattctcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023854_S_P-G Feature FT:CDS FJ023854_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate M04-3233). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctcggacccctgctcgtattacaggcgggatttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggadcamccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcatttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcgaccaccagtacgggaccatgcagaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggsctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttayatggatgatgtggtattgggggccaaatctgtacaacaccttgaagccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023878_S_P-G Feature FT:CDS FJ023878_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate M04-3692). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcgaccaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|FJ023879_S_P-G Feature FT:CDS FJ023879_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate M04-3692). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcacccaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcgaccaccagtacgggaccgtgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacccatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|FJ023880_S_P-G Feature FT:CDS FJ023880_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate M04-3692). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcgaccaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|FJ023881_S_P-G Feature FT:CDS FJ023881_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate M04-3692). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aatwccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcgaccaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|FJ023882_S_P-G Feature FT:CDS FJ023882_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate M04-3692). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcgaccaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|FJ023883_S_P-G Feature FT:CDS FJ023883_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate M04-3692). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcgaccaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|FJ023884_S_P-G Feature FT:CDS FJ023884_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate M04-3692). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcgaccaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttggggatacatctaa
>gnl|hbvcds|FJ023885_S_P-G Feature FT:CDS FJ023885_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate M04-3692). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctctaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcgaccaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|FJ023936_S_P-G Feature FT:CDS FJ023936_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate M04-4750). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctcggacccctgctcgtattacaggcgggatttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaatcaaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcgaccaccagtacgggaccatgcagaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023968_S_P-G Feature FT:CDS FJ023968_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate M05-1819). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctcggacccctgctcgtattacaggcgggatttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcaaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccgatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcgaccaccagtacgggaccatgcagaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ358587_S_P-G Feature FT:CDS FJ358587_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate M05-0659). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggcatgttgcccgtttg
tcctctagttccaggatcctcgaccaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttacaagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ358594_S_P-G Feature FT:CDS FJ358594_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate M04-2769). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcaaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcgaccaccagtacgggaccatgcagaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FR714503_S_P-G Feature FT:CDS FR714503_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate TZ306). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcgaccaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaggccatttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FR821981_S_P-G Feature FT:CDS FR821981_S_P-G of [Viruses] Hepatitis B Virus genotype G. Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcgaccaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccacactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttatac
cgctgtaaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FR821982_S_P-G Feature FT:CDS FR821982_S_P-G of [Viruses] Hepatitis B Virus genotype G. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctctccatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcgaccaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FR821983_S_P-G Feature FT:CDS FR821983_S_P-G of [Viruses] Hepatitis B Virus genotype G. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggcgaacatcacatcaggattcctcggacccctgctcgcgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtcggcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcgaccaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtaccaaaccttcggccggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tccctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FR821984_S_P-G Feature FT:CDS FR821984_S_P-G of [Viruses] Hepatitis B Virus genotype G. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcgtcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcgaccaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FR821985_S_P-G Feature FT:CDS FR821985_S_P-G of [Viruses] Hepatitis B Virus genotype G. Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcgaccaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccacactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttatac
cgctgtaaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FR821986_S_P-G Feature FT:CDS FR821986_S_P-G of [Viruses] Hepatitis B Virus genotype G. Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgtcgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcgaccaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccacactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttatac
cgctgtaaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FR821987_S_P-G Feature FT:CDS FR821987_S_P-G of [Viruses] Hepatitis B Virus genotype G. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcgaccaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatctggggctttcgcaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FR822067_S_P-G Feature FT:CDS FR822067_S_P-G of [Viruses] Hepatitis B Virus genotype G. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcgaccaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|FR822110_S_P-G Feature FT:CDS FR822110_S_P-G of [Viruses] Hepatitis B Virus genotype G. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcgaccaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|FR822113_S_P-G Feature FT:CDS FR822113_S_P-G of [Viruses] Hepatitis B Virus genotype G. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcgaccaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|GQ325762_S_P-G Feature FT:CDS GQ325762_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 1284-1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggactgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctga
>gnl|hbvcds|GQ325763_S_P-G Feature FT:CDS GQ325763_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 1284-2). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcytgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctga
>gnl|hbvcds|GQ325769_S_P-G Feature FT:CDS GQ325769_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 26278-1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggragtrcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaayctcctgtcctccaayttgtcctggytatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcwtctggactatcamggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcrtcytgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatrtrgatgatrtrgtattrggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtcyttgggtatacatctaa
>gnl|hbvcds|GQ325770_S_P-G Feature FT:CDS GQ325770_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 26278-2). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggragtrcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaayctcctgtcctccaayttgtcctggytatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcwtctggactatcamggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcrtcytgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatrtrgatgatrtrgtattrggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtcyttgggtatacatctaa
>gnl|hbvcds|GQ325771_S_P-G Feature FT:CDS GQ325771_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 26278-3). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggragtrcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaayctcctgtcctccaayttgtcctggytatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcwtctggactatcamggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcrtcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatrtrgatgatrtrgtattrggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtcyttgggtatacatctaa
>gnl|hbvcds|GQ325774_S_P-G Feature FT:CDS GQ325774_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 4089-3). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggactgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggtccgtagggctttc
ccccactgtctggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|GQ486349_S_P-G Feature FT:CDS GQ486349_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate GS314). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcaccmgkgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcgaccaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaacctttggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatctkgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486843_S_P-G Feature FT:CDS GQ486843_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate GS808). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|GU563556_S_P-G Feature FT:CDS GU563556_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate BV-55). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|GU565217_S_P-G Feature FT:CDS GU565217_S_P-G of [Viruses] Hepatitis B Virus genotype G. Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggattgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|HE981171_S_P-G Feature FT:CDS HE981171_S_P-G of [Viruses] Hepatitis B Virus genotype G. Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggtctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttttctttgggtatacatctaa
>gnl|hbvcds|HE981172_S_P-G Feature FT:CDS HE981172_S_P-G of [Viruses] Hepatitis B Virus genotype G. Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttttctttgggtatacatctaa
>gnl|hbvcds|HE981174_S_P-G Feature FT:CDS HE981174_S_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|HE981175_S_P-G Feature FT:CDS HE981175_S_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|HE981176_S_P-G Feature FT:CDS HE981176_S_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|HM467765_S_P-G Feature FT:CDS HM467765_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 1099_Colombia). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|HM467769_S_P-G Feature FT:CDS HM467769_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 1104_Colombia). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacaactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|HM467770_S_P-G Feature FT:CDS HM467770_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 1105_Colombia). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgattcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|HM467773_S_P-G Feature FT:CDS HM467773_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 1110_Colombia). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtcttttggtatacatctaa
>gnl|hbvcds|JF439779_S_P-G Feature FT:CDS JF439779_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate ANG03D1). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgtcacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggattgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JF439780_S_P-G Feature FT:CDS JF439780_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate ANG03D4). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatgtggatgatgtggtattggggaccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttgtgtctttgggtatacatctaa
>gnl|hbvcds|JF439781_S_P-G Feature FT:CDS JF439781_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate ANG03G3). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgtcacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatgtggatgatattgtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JF439782_S_P-G Feature FT:CDS JF439782_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate ANG03E10). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgtcacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatgtggatgatattgtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JF439784_S_P-G Feature FT:CDS JF439784_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate ANG03E12). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgtcacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccacactgtctggctttcagctatgtggatgatattgtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JF439785_S_P-G Feature FT:CDS JF439785_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate ANG03F1). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatgtggatgatgtggtattggggaccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttgtgtctttgggtatacatctaa
>gnl|hbvcds|JF439786_S_P-G Feature FT:CDS JF439786_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate ANG03F2). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgtcacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatgtggatgatattgtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JF439787_S_P-G Feature FT:CDS JF439787_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate ANG03F5). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgtcacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggattgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JF439788_S_P-G Feature FT:CDS JF439788_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate ANG03F6). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgtcacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttgtgtctttgggtatacatccaa
>gnl|hbvcds|JF439789_S_P-G Feature FT:CDS JF439789_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate ANG03F7). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgtcacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggattgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JF439791_S_P-G Feature FT:CDS JF439791_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate ANG03F12). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgtcacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatgtggatgatattgtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JF439792_S_P-G Feature FT:CDS JF439792_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate BIL2004G2). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcactaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JF439793_S_P-G Feature FT:CDS JF439793_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate BIL2004G4). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcactaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JF439794_S_P-G Feature FT:CDS JF439794_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate BIL2005H1). Partial genome (Contains: HBc, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaactttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JF439795_S_P-G Feature FT:CDS JF439795_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate BIL2005H2). Partial genome (Contains: HBc, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatagatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttctttcgtctttgggtatacatctaa
>gnl|hbvcds|JF439796_S_P-G Feature FT:CDS JF439796_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate BIL2005H3). Partial genome (Contains: HBc, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatagatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttctttcgtctttgggtatacatctaa
>gnl|hbvcds|JF439797_S_P-G Feature FT:CDS JF439797_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate BIL2005H4). Partial genome (Contains: HBc, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactaaccaatctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatagatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JF439799_S_P-G Feature FT:CDS JF439799_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate BIL2005H7). Partial genome (Contains: HBc, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctgtcagctatatagatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JF439800_S_P-G Feature FT:CDS JF439800_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate BIL2005H8). Partial genome (Contains: HBc, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactaaccaatctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatagatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JF439801_S_P-G Feature FT:CDS JF439801_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate BIL2005H9). Partial genome (Contains: HBc, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatagatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttctttcgtctttgggtatacatctaa
>gnl|hbvcds|JF439802_S_P-G Feature FT:CDS JF439802_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate BIL2005H10). Partial genome (Contains: HBc, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactaaccaatctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatagatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JF439803_S_P-G Feature FT:CDS JF439803_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate FOL04B1). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttgtgtctttgggtatacatctaa
>gnl|hbvcds|JF439804_S_P-G Feature FT:CDS JF439804_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate FOL04B2). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttgtgtctttgggtatacatctaa
>gnl|hbvcds|JF439805_S_P-G Feature FT:CDS JF439805_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate FOL04B3). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttgtgtctttgggtatacatctaa
>gnl|hbvcds|JF439806_S_P-G Feature FT:CDS JF439806_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate FOL04B4). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttgtgtctttgggtatacatctaa
>gnl|hbvcds|JF439807_S_P-G Feature FT:CDS JF439807_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate FOL04B5). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttgtgtctttgggtatacatctaa
>gnl|hbvcds|JF439808_S_P-G Feature FT:CDS JF439808_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate FOL04B6). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttgtgtctttgggtatacatctaa
>gnl|hbvcds|JF439809_S_P-G Feature FT:CDS JF439809_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate FOL04B8). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttgtgtctttgggtatacatctaa
>gnl|hbvcds|JF439810_S_P-G Feature FT:CDS JF439810_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate FOL04B9). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttgtgtctttgggtatacatctaa
>gnl|hbvcds|JF439811_S_P-G Feature FT:CDS JF439811_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate FOL04B10). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttgtgtctttgggtatacatctaa
>gnl|hbvcds|JF439812_S_P-G Feature FT:CDS JF439812_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate FOL04B11). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctctcagctatgtggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttgtgtctttgggtatacatctaa
>gnl|hbvcds|JF439813_S_P-G Feature FT:CDS JF439813_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate FOL04H12). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttgtgtctttgggtatacatctaa
>gnl|hbvcds|JF439814_S_P-G Feature FT:CDS JF439814_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate FOL04H7). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttgtgtctttgggtatacatctaa
>gnl|hbvcds|JF439815_S_P-G Feature FT:CDS JF439815_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate FOL04H8). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttgtgtctttgggtatacatctaa
>gnl|hbvcds|JF439816_S_P-G Feature FT:CDS JF439816_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate FOL04H9). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttgtgtctttgggtatacatctaa
>gnl|hbvcds|JF439817_S_P-G Feature FT:CDS JF439817_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate FOL04H10). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttgtgtctttgggtatacatctaa
>gnl|hbvcds|JF439818_S_P-G Feature FT:CDS JF439818_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate FOL04H11). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttgtgtctttgggtatacatctaa
>gnl|hbvcds|JN604208_S_P-G Feature FT:CDS JN604208_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 476-6039-6). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtacccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JQ707436_S_P-G Feature FT:CDS JQ707436_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate MC1_C27). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JQ707657_S_P-G Feature FT:CDS JQ707657_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatattgatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JQ707660_S_P-G Feature FT:CDS JQ707660_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_17). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatattgatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JQ707666_S_P-G Feature FT:CDS JQ707666_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_22). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatattgatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JQ707668_S_P-G Feature FT:CDS JQ707668_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_26-5). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatattgatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JQ707671_S_P-G Feature FT:CDS JQ707671_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_3). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaactttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatattgatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JQ707673_S_P-G Feature FT:CDS JQ707673_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_33). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatattgatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JQ707677_S_P-G Feature FT:CDS JQ707677_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_45). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatattgatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JQ707678_S_P-G Feature FT:CDS JQ707678_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_47). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtttgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatcgatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JQ707679_S_P-G Feature FT:CDS JQ707679_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_48). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtttgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatattgatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JQ707680_S_P-G Feature FT:CDS JQ707680_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_6). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatattgatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JX849638_S_P-G Feature FT:CDS JX849638_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate ICO003). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JX849639_S_P-G Feature FT:CDS JX849639_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate ICO008). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JX849641_S_P-G Feature FT:CDS JX849641_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate ICO946). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgggtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JX849642_S_P-G Feature FT:CDS JX849642_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate ICO354). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagggcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JX849643_S_P-G Feature FT:CDS JX849643_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate ICO125). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JX849644_S_P-G Feature FT:CDS JX849644_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 251_G). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggsggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggastgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttstctttgggtatacatctaa
>gnl|hbvcds|JX849646_S_P-G Feature FT:CDS JX849646_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 363_G). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|KC885585_S_P-G Feature FT:CDS KC885585_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate MSM13-08). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|KF414679_S_P-G Feature FT:CDS KF414679_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate B213). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcactaatctcctgtcctccaacttgtcctggctatcgctggatgtggctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacagaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|KF767450_S_P-G Feature FT:CDS KF767450_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate patient_23). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|KF767451_S_P-G Feature FT:CDS KF767451_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate patient_27). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggactgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatgtggatgatgtggtattgggggccaaatctgtacagcatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|KF767452_S_P-G Feature FT:CDS KF767452_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate patient_7). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgtctcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|KF771917_S_P-G Feature FT:CDS KF771917_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate ARC8). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|KF779233_S_P-G Feature FT:CDS KF779233_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate DEN6090). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|KF779235_S_P-G Feature FT:CDS KF779235_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate DEN6106). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|KF779267_S_P-G Feature FT:CDS KF779267_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate JFA3956). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacagaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|KF779357_S_P-G Feature FT:CDS KF779357_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate PNF5187). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtatttcgtgttgacaagattcttcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|KJ194508_S_P-G Feature FT:CDS KJ194508_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate HBV_Amsterdam_2_1994). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|KM455592_S_P-G Feature FT:CDS KM455592_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate BY640). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcgaccaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccatttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KM455685_S_P-G Feature FT:CDS KM455685_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate BY782). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattactcggaaccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctttcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcgaccaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccatttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KM455794_S_P-G Feature FT:CDS KM455794_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate NP911). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcgaccaccagtacaggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtataaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgtaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtctggctttcagttatatggatgatgtggtattgggggccacgtctgtacaacatcttgagtccctttatac
tgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|KM998716_S_P-G Feature FT:CDS KM998716_S_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|KR230749_S_P-G Feature FT:CDS KR230749_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate ENDV06GG). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcgggggttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacagaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|KX264500_S_P-G Feature FT:CDS KX264500_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate G-aej). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|KY004111_S_P-G Feature FT:CDS KY004111_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate M-2015). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|KY697840_S_P-G Feature FT:CDS KY697840_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate HBV_Mrs_G_039915_2-9-2010). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatc
>gnl|hbvcds|MK568529_S_P-G Feature FT:CDS MK568529_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 1.780). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|MK568536_S_P-G Feature FT:CDS MK568536_S_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 1.588). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctgattccaggatcctcgaccaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
© 1998-2020Legal notice