HBVdb

Dataset for nucleotide sequence S of genotype G

[Download (right click)] [Edit] [Sequences] [Repertoires]

159 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


GQ325769_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ325770_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ325771_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK568536_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779357_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtatttc
KF414679_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EF464097_S_P-G      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
EF464098_S_P-G      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttc
JF439797_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439800_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439802_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439799_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JX849644_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggsggggtttttc
JN604208_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB056515_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439781_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgtcacaggcggggtttttc
JF439782_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgtcacaggcggggtttttc
JF439786_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgtcacaggcggggtttttc
JF439791_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgtcacaggcggggtttttc
JF439784_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgtcacaggcggggtttttc
GQ325762_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439788_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgtcacaggcggggtttttc
JF439812_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439780_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439785_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439803_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439804_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439805_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439806_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439807_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439808_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439809_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439810_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439811_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439813_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439814_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439815_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439816_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439817_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439818_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF767452_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF767451_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM467773_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ325774_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GU565217_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439779_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgtcacaggcggggtttttc
JF439787_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgtcacaggcggggtttttc
JF439789_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgtcacaggcggggtttttc
JF439792_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439793_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439794_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HE981171_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HE981172_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707671_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707657_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707666_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707668_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707673_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707680_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707660_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707678_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707679_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439795_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439796_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439801_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707677_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779267_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KR230749_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcgggggttttc
GQ325763_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HE981174_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HE981175_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HE981176_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB375166_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB375167_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB375168_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB375169_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB375170_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ236116_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ236117_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ236119_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JX849642_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JX849641_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JX849638_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM467770_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM467769_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EF634480_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AF405706_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB064313_S_C-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB056513_S_P-G      atggagaatatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB056514_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB056516_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB064310_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB064311_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB064312_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB375165_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AF160501_S_C-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AF369533_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY168428_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ207798_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ403176_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486843_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GU563556_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM467765_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707436_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JX849639_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JX849643_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JX849646_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC885585_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF767450_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF771917_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779233_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779235_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KJ194508_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM998716_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX264500_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY004111_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY697840_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK568529_S_P-G      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM455794_S_P-G      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ023854_S_P-G      atggagaacatcacatcaggattcctcggacccctgctcgtattacaggcgggatttttc
FJ023702_S_P-G      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcgggatttttc
FJ023705_S_P-G      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcgggatttttc
FJ023701_S_P-G      atggagagcatcacatcaggattcctcggacccctgctcgtgttacaggcgggatttttc
FJ023706_S_P-G      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcgggatttttc
FJ023674_S_P-G      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcgggatttttc
FJ023703_S_P-G      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcgggatttttc
FJ023704_S_P-G      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcgggatttttc
FJ023700_S_P-G      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcgggatttttc
FJ023707_S_P-G      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcgggatttttc
EU366212_S_P-G      atggagaacatcacatcaggattcctcggacccctgcgcgtgttacaggcggggtttttc
EU366207_S_P-G      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttc
EU366209_S_P-G      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttc
EU366208_S_P-G      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttc
FJ358594_S_P-G      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ023936_S_P-G      atggagaacatcacatcaggattcctcggacccctgctcgtattacaggcgggatttttc
FJ023968_S_P-G      atggagaacatcacatcaggattcctcggacccctgctcgtattacaggcgggatttttc
FR821983_S_P-G      atggcgaacatcacatcaggattcctcggacccctgctcgcgttacaggcggggtttttc
GQ486349_S_P-G      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttc
FJ358587_S_P-G      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttc
FR821981_S_P-G      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttc
FR821985_S_P-G      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttc
FR821986_S_P-G      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttc
FR821982_S_P-G      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttc
FR821984_S_P-G      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttc
FR821987_S_P-G      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttc
FJ023879_S_P-G      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttc
FR822067_S_P-G      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
FJ023885_S_P-G      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttc
FJ023884_S_P-G      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttc
FJ023878_S_P-G      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttc
FJ023880_S_P-G      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttc
FJ023882_S_P-G      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttc
FJ023883_S_P-G      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttc
FR822110_S_P-G      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttc
FR822113_S_P-G      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttc
FJ023881_S_P-G      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttc
KM455685_S_P-G      atggagaacatcacatcaggattactcggaaccctgctcgtgttacaggcggggtttttc
FR714503_S_P-G      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttc
KM455592_S_P-G      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttc
                    **** **  *   ******** * ** *** ****** **  * ***** **    ****

GQ325769_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ325770_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ325771_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MK568536_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779357_S_P-G      gtgttgacaagattcttcacaataccgcagagtctagactcgtggtggacttctctcaat
KF414679_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EF464097_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EF464098_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439797_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439800_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439802_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439799_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JX849644_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN604208_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB056515_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439781_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439782_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439786_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439791_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439784_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ325762_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439788_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439812_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439780_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439785_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439803_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439804_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439805_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439806_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439807_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439808_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439809_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439810_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439811_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439813_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439814_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439815_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439816_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439817_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439818_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF767452_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF767451_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
HM467773_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ325774_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GU565217_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439779_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439787_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439789_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439792_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439793_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439794_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
HE981171_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
HE981172_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707671_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707657_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707666_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707668_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707673_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707680_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707660_S_P-G      ttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
JQ707678_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707679_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439795_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439796_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439801_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707677_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779267_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KR230749_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ325763_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
HE981174_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
HE981175_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
HE981176_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB375166_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB375167_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB375168_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB375169_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB375170_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ236116_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ236117_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ236119_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JX849642_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JX849641_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JX849638_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
HM467770_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
HM467769_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EF634480_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AF405706_S_P-G      ttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AB064313_S_C-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB056513_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB056514_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB056516_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB064310_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB064311_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB064312_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB375165_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AF160501_S_C-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AF369533_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY168428_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ207798_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ403176_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486843_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GU563556_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
HM467765_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707436_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JX849639_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JX849643_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JX849646_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KC885585_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF767450_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF771917_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779233_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779235_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KJ194508_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM998716_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX264500_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KY004111_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KY697840_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MK568529_S_P-G      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM455794_S_P-G      ttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
FJ023854_S_P-G      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
FJ023702_S_P-G      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FJ023705_S_P-G      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
FJ023701_S_P-G      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FJ023706_S_P-G      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FJ023674_S_P-G      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FJ023703_S_P-G      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FJ023704_S_P-G      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FJ023700_S_P-G      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FJ023707_S_P-G      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU366212_S_P-G      ttgttgacaaaaatcctcacaataccaaagagtctagactcgtggtggacttctctcaat
EU366207_S_P-G      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EU366209_S_P-G      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EU366208_S_P-G      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
FJ358594_S_P-G      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FJ023936_S_P-G      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FJ023968_S_P-G      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FR821983_S_P-G      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
GQ486349_S_P-G      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FJ358587_S_P-G      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FR821981_S_P-G      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
FR821985_S_P-G      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
FR821986_S_P-G      ttgtcgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
FR821982_S_P-G      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
FR821984_S_P-G      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
FR821987_S_P-G      ttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
FJ023879_S_P-G      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FR822067_S_P-G      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FJ023885_S_P-G      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FJ023884_S_P-G      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FJ023878_S_P-G      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FJ023880_S_P-G      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FJ023882_S_P-G      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FJ023883_S_P-G      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FR822110_S_P-G      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FR822113_S_P-G      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FJ023881_S_P-G      ttgttgacaaaaatcctcacaatwccgcagagtctagactcgtggtggacttctctcaat
KM455685_S_P-G      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctttcaat
FR714503_S_P-G      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM455592_S_P-G      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
                     *** ***** * ** ******* **  ************************** *** *

GQ325769_S_P-G      tttctaggggragtrcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
GQ325770_S_P-G      tttctaggggragtrcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
GQ325771_S_P-G      tttctaggggragtrcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
MK568536_S_P-G      tttctagggggaccacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
KF779357_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
KF414679_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
EF464097_S_P-G      tttctaggggaagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
EF464098_S_P-G      tttctaggggaagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
JF439797_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
JF439800_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
JF439802_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
JF439799_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
JX849644_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
JN604208_S_P-G      tttctagggggagtacccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
AB056515_S_P-G      tttctagggggagcgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
JF439781_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
JF439782_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
JF439786_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
JF439791_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
JF439784_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
GQ325762_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
JF439788_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
JF439812_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
JF439780_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
JF439785_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
JF439803_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
JF439804_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
JF439805_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
JF439806_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
JF439807_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
JF439808_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
JF439809_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
JF439810_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
JF439811_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
JF439813_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
JF439814_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
JF439815_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
JF439816_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
JF439817_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
JF439818_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
KF767452_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
KF767451_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
HM467773_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
GQ325774_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
GU565217_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
JF439779_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
JF439787_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
JF439789_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
JF439792_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
JF439793_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
JF439794_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
HE981171_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
HE981172_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
JQ707671_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
JQ707657_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
JQ707666_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
JQ707668_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
JQ707673_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
JQ707680_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
JQ707660_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
JQ707678_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
JQ707679_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
JF439795_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
JF439796_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
JF439801_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
JQ707677_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
KF779267_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
KR230749_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
GQ325763_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
HE981174_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
HE981175_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
HE981176_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
AB375166_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
AB375167_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
AB375168_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
AB375169_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
AB375170_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
DQ236116_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
DQ236117_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
DQ236119_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
JX849642_S_P-G      tttctagggggagggcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
JX849641_S_P-G      tttctagggggagtgcccgggtgtcctggcctaaattcgcagtccccaacctccaatcac
JX849638_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
HM467770_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
HM467769_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
EF634480_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
AF405706_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
AB064313_S_C-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
AB056513_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
AB056514_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
AB056516_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
AB064310_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
AB064311_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
AB064312_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
AB375165_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
AF160501_S_C-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
AF369533_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
AY168428_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
DQ207798_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
DQ403176_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
GQ486843_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
GU563556_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
HM467765_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
JQ707436_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
JX849639_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
JX849643_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
JX849646_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
KC885585_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
KF767450_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
KF771917_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
KF779233_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
KF779235_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
KJ194508_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
KM998716_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
KX264500_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
KY004111_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
KY697840_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
MK568529_S_P-G      tttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccccaacctccaatcac
KM455794_S_P-G      tttctagggggagcacccgcgtgtcctggccaaaattcgcagtccccaacctccaatcac
FJ023854_S_P-G      tttctagggggadcamccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FJ023702_S_P-G      tttctagggggaacaaccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FJ023705_S_P-G      tttctagggggaacaaccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FJ023701_S_P-G      tttctagggggaacaaccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FJ023706_S_P-G      tttctagggggaacaaccgagtgtcttggccaaaattcgcagtccccaacctccaatcac
FJ023674_S_P-G      tttctagggggaacaaccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FJ023703_S_P-G      tttctagggggaacaaccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FJ023704_S_P-G      tttctagggggaacaaccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FJ023700_S_P-G      tttctagggggaacaaccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FJ023707_S_P-G      tttctagggggaacaaccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
EU366212_S_P-G      tttctaggggaatcaaccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
EU366207_S_P-G      tttctagggggatcaaccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
EU366209_S_P-G      tttctagggggatcaaccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
EU366208_S_P-G      tttctagggggatcaaccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FJ358594_S_P-G      tttctagggggatcaaccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FJ023936_S_P-G      tttctaggggaatcaaccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FJ023968_S_P-G      tttctagggggatcaaccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FR821983_S_P-G      tttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
GQ486349_S_P-G      tttctagggggagcaccmgkgtgtcttggccaaaattcgcagtccccaacctccaatcac
FJ358587_S_P-G      tttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FR821981_S_P-G      tttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FR821985_S_P-G      tttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FR821986_S_P-G      tttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FR821982_S_P-G      tttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FR821984_S_P-G      tttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FR821987_S_P-G      tttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FJ023879_S_P-G      tttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FR822067_S_P-G      tttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FJ023885_S_P-G      tttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FJ023884_S_P-G      tttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FJ023878_S_P-G      tttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FJ023880_S_P-G      tttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FJ023882_S_P-G      tttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FJ023883_S_P-G      tttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FR822110_S_P-G      tttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FR822113_S_P-G      tttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FJ023881_S_P-G      tttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
KM455685_S_P-G      tttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
FR714503_S_P-G      tttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
KM455592_S_P-G      tttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcac
                    ********** *    * * ***** ***** ****************************

GQ325769_S_P-G      tcaccaayctcctgtcctccaayttgtcctggytatcgctggatgtgtctgcggcgtttt
GQ325770_S_P-G      tcaccaayctcctgtcctccaayttgtcctggytatcgctggatgtgtctgcggcgtttt
GQ325771_S_P-G      tcaccaayctcctgtcctccaayttgtcctggytatcgctggatgtgtctgcggcgtttt
MK568536_S_P-G      tcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
KF779357_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KF414679_S_P-G      tcactaatctcctgtcctccaacttgtcctggctatcgctggatgtggctgcggcgtttt
EF464097_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
EF464098_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JF439797_S_P-G      taaccaatctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgtttt
JF439800_S_P-G      taaccaatctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgtttt
JF439802_S_P-G      taaccaatctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgtttt
JF439799_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JX849644_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JN604208_S_P-G      tcaccaatctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
AB056515_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JF439781_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JF439782_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JF439786_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JF439791_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JF439784_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
GQ325762_S_P-G      tcaccaatctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JF439788_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JF439812_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JF439780_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JF439785_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JF439803_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JF439804_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JF439805_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JF439806_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JF439807_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JF439808_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JF439809_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JF439810_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JF439811_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JF439813_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JF439814_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JF439815_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JF439816_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JF439817_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JF439818_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KF767452_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KF767451_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
HM467773_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
GQ325774_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
GU565217_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JF439779_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JF439787_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JF439789_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JF439792_S_P-G      tcactaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JF439793_S_P-G      tcactaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JF439794_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
HE981171_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
HE981172_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JQ707671_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JQ707657_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JQ707666_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JQ707668_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JQ707673_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JQ707680_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JQ707660_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JQ707678_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtttgcggcgtttt
JQ707679_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtttgcggcgtttt
JF439795_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JF439796_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JF439801_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JQ707677_S_P-G      tcaccaatctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgtttt
KF779267_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KR230749_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
GQ325763_S_P-G      tcaccaatctcytgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
HE981174_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
HE981175_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
HE981176_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
AB375166_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
AB375167_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
AB375168_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
AB375169_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
AB375170_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
DQ236116_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
DQ236117_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
DQ236119_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JX849642_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JX849641_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JX849638_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
HM467770_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
HM467769_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
EF634480_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
AF405706_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
AB064313_S_C-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
AB056513_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
AB056514_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
AB056516_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
AB064310_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
AB064311_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
AB064312_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
AB375165_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
AF160501_S_C-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
AF369533_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
AY168428_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
DQ207798_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
DQ403176_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
GQ486843_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
GU563556_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
HM467765_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JQ707436_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JX849639_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JX849643_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
JX849646_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KC885585_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KF767450_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KF771917_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KF779233_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KF779235_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KJ194508_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KM998716_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KX264500_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KY004111_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KY697840_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
MK568529_S_P-G      tcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
KM455794_S_P-G      tcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
FJ023854_S_P-G      tcaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcatttt
FJ023702_S_P-G      tcaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
FJ023705_S_P-G      tcaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
FJ023701_S_P-G      tcaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
FJ023706_S_P-G      tcaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
FJ023674_S_P-G      tcaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
FJ023703_S_P-G      tcaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
FJ023704_S_P-G      tcaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
FJ023700_S_P-G      tcaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
FJ023707_S_P-G      tcaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
EU366212_S_P-G      tcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
EU366207_S_P-G      tcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
EU366209_S_P-G      tcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
EU366208_S_P-G      tcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
FJ358594_S_P-G      tcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
FJ023936_S_P-G      tcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
FJ023968_S_P-G      tcaccaacctcctgtcctccgatttgtcctggctatcgctggatgtgtctgcggcgtttt
FR821983_S_P-G      tcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtcggcggcgtttt
GQ486349_S_P-G      tcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
FJ358587_S_P-G      tcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
FR821981_S_P-G      tcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
FR821985_S_P-G      tcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
FR821986_S_P-G      tcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
FR821982_S_P-G      tcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
FR821984_S_P-G      tcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
FR821987_S_P-G      tcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
FJ023879_S_P-G      ccaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
FR822067_S_P-G      tcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
FJ023885_S_P-G      tcaccaacctcctgtcctctaatttgtcctggttatcgctggatgtgtctgcggcgtttt
FJ023884_S_P-G      tcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
FJ023878_S_P-G      tcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
FJ023880_S_P-G      tcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
FJ023882_S_P-G      tcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
FJ023883_S_P-G      tcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
FR822110_S_P-G      tcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
FR822113_S_P-G      tcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
FJ023881_S_P-G      tcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
KM455685_S_P-G      tcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
FR714503_S_P-G      tcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
KM455592_S_P-G      tcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
                      ** ** *** *******  * ********* **************   ***** ****

GQ325769_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcwtctggactat
GQ325770_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcwtctggactat
GQ325771_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcwtctggactat
MK568536_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
KF779357_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
KF414679_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
EF464097_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
EF464098_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
JF439797_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
JF439800_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
JF439802_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
JF439799_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
JX849644_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
JN604208_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
AB056515_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
JF439781_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
JF439782_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
JF439786_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
JF439791_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
JF439784_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
GQ325762_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
JF439788_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
JF439812_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
JF439780_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
JF439785_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
JF439803_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
JF439804_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
JF439805_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
JF439806_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
JF439807_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
JF439808_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
JF439809_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
JF439810_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
JF439811_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
JF439813_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
JF439814_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
JF439815_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
JF439816_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
JF439817_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
JF439818_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
KF767452_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
KF767451_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
HM467773_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
GQ325774_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
GU565217_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
JF439779_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
JF439787_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
JF439789_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
JF439792_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
JF439793_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
JF439794_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
HE981171_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
HE981172_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
JQ707671_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
JQ707657_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
JQ707666_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
JQ707668_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
JQ707673_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
JQ707680_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
JQ707660_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
JQ707678_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
JQ707679_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
JF439795_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
JF439796_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
JF439801_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
JQ707677_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
KF779267_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
KR230749_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
GQ325763_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
HE981174_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
HE981175_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
HE981176_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
AB375166_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
AB375167_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
AB375168_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
AB375169_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
AB375170_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
DQ236116_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
DQ236117_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
DQ236119_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
JX849642_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
JX849641_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
JX849638_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
HM467770_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
HM467769_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
EF634480_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
AF405706_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
AB064313_S_C-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
AB056513_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
AB056514_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
AB056516_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
AB064310_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
AB064311_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
AB064312_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
AB375165_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
AF160501_S_C-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
AF369533_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
AY168428_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
DQ207798_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
DQ403176_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
GQ486843_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
GU563556_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
HM467765_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
JQ707436_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
JX849639_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
JX849643_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
JX849646_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
KC885585_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
KF767450_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
KF771917_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
KF779233_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
KF779235_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
KJ194508_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
KM998716_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
KX264500_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
KY004111_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
KY697840_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
MK568529_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
KM455794_S_P-G      atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattat
FJ023854_S_P-G      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
FJ023702_S_P-G      atcatattcctcctcatcctgctgctatgccccatcttcttgttggttcttctggattat
FJ023705_S_P-G      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattat
FJ023701_S_P-G      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattat
FJ023706_S_P-G      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattat
FJ023674_S_P-G      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattat
FJ023703_S_P-G      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattat
FJ023704_S_P-G      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattat
FJ023700_S_P-G      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattat
FJ023707_S_P-G      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattat
EU366212_S_P-G      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattat
EU366207_S_P-G      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattat
EU366209_S_P-G      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattat
EU366208_S_P-G      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattat
FJ358594_S_P-G      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattat
FJ023936_S_P-G      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattat
FJ023968_S_P-G      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattat
FR821983_S_P-G      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattat
GQ486349_S_P-G      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattat
FJ358587_S_P-G      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattat
FR821981_S_P-G      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattat
FR821985_S_P-G      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattat
FR821986_S_P-G      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattat
FR821982_S_P-G      atcatcttcctctccatcctgctgctatgcctcatcttcttgttggttcttctggattat
FR821984_S_P-G      atcatcttcctcttcgtcctgctgctatgcctcatcttcttgttggttcttctggattat
FR821987_S_P-G      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattat
FJ023879_S_P-G      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattat
FR822067_S_P-G      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattat
FJ023885_S_P-G      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattat
FJ023884_S_P-G      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattat
FJ023878_S_P-G      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattat
FJ023880_S_P-G      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattat
FJ023882_S_P-G      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattat
FJ023883_S_P-G      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattat
FR822110_S_P-G      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattat
FR822113_S_P-G      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattat
FJ023881_S_P-G      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattat
KM455685_S_P-G      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattat
FR714503_S_P-G      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattat
KM455592_S_P-G      atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattat
                    ***** ******  * *************** ********* ******* ****** ***

GQ325769_S_P-G      camggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
GQ325770_S_P-G      camggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
GQ325771_S_P-G      camggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
MK568536_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggacca
KF779357_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
KF414679_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
EF464097_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
EF464098_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
JF439797_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
JF439800_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
JF439802_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
JF439799_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
JX849644_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
JN604208_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
AB056515_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
JF439781_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
JF439782_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
JF439786_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
JF439791_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
JF439784_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
GQ325762_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
JF439788_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
JF439812_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
JF439780_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
JF439785_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
JF439803_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
JF439804_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
JF439805_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
JF439806_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
JF439807_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
JF439808_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
JF439809_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
JF439810_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
JF439811_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
JF439813_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
JF439814_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
JF439815_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
JF439816_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
JF439817_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
JF439818_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
KF767452_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
KF767451_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
HM467773_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
GQ325774_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
GU565217_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
JF439779_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
JF439787_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
JF439789_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
JF439792_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
JF439793_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
JF439794_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
HE981171_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
HE981172_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
JQ707671_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
JQ707657_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
JQ707666_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
JQ707668_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
JQ707673_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
JQ707680_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
JQ707660_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
JQ707678_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
JQ707679_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
JF439795_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
JF439796_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
JF439801_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
JQ707677_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
KF779267_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
KR230749_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
GQ325763_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
HE981174_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagcacgggaccc
HE981175_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagcacgggaccc
HE981176_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagcacgggaccc
AB375166_S_P-G      caaggtatgttgcccgtttgtcctctgatttcaggatcctcgaccaccagtacgggaccc
AB375167_S_P-G      caaggtatgttgcccgtttgtcctctgatttcaggatcctcgaccaccagtacgggaccc
AB375168_S_P-G      caaggtatgttgcccgtttgtcctctgatttcaggatcctcgaccaccagtacgggaccc
AB375169_S_P-G      caaggtatgttgcccgtttgtcctctgatttcaggatcctcgaccaccagtacgggaccc
AB375170_S_P-G      caaggtatgttgcccgtttgtcctctgatttcaggatcctcgaccaccagtacgggaccc
DQ236116_S_P-G      caaggtatgttgcccgtttgtcctctgatttcaggatcctcgaccaccagtacgggaccc
DQ236117_S_P-G      caaggtatgttgcccgtttgtcctctgatttcaggatcctcgaccaccagtacgggaccc
DQ236119_S_P-G      caaggtatgttgcccgtttgtcctctgatttcaggatcctcgaccaccagtacgggaccc
JX849642_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
JX849641_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
JX849638_S_P-G      cacggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
HM467770_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
HM467769_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
EF634480_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctccaccaccagtacgggaccc
AF405706_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
AB064313_S_C-G      caaggtatgttgcccgtttgtcccctgattccaggatcctcgaccaccagtacgggaccc
AB056513_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
AB056514_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
AB056516_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
AB064310_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
AB064311_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
AB064312_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
AB375165_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
AF160501_S_C-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
AF369533_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
AY168428_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
DQ207798_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
DQ403176_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
GQ486843_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
GU563556_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
HM467765_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
JQ707436_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
JX849639_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
JX849643_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
JX849646_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
KC885585_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
KF767450_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
KF771917_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
KF779233_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
KF779235_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
KJ194508_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
KM998716_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
KX264500_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
KY004111_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
KY697840_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
MK568529_S_P-G      caaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccc
KM455794_S_P-G      caaggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacaggacca
FJ023854_S_P-G      caaggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggacca
FJ023702_S_P-G      caaggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggaccc
FJ023705_S_P-G      caaggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggaccc
FJ023701_S_P-G      cagggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggaccc
FJ023706_S_P-G      cagggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggaccc
FJ023674_S_P-G      carggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggaccc
FJ023703_S_P-G      cagggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggaccc
FJ023704_S_P-G      cagggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggaccc
FJ023700_S_P-G      cagggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggaccc
FJ023707_S_P-G      cagggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggaccc
EU366212_S_P-G      caaggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggaaca
EU366207_S_P-G      caaggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggacca
EU366209_S_P-G      caaggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggacca
EU366208_S_P-G      caaggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggaccc
FJ358594_S_P-G      caaggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggacca
FJ023936_S_P-G      caaggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggacca
FJ023968_S_P-G      caaggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggacca
FR821983_S_P-G      caaggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggacca
GQ486349_S_P-G      caaggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggacca
FJ358587_S_P-G      caaggcatgttgcccgtttgtcctctagttccaggatcctcgaccaccagtacgggacca
FR821981_S_P-G      caaggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggacca
FR821985_S_P-G      caaggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggacca
FR821986_S_P-G      caaggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggacca
FR821982_S_P-G      caaggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggacca
FR821984_S_P-G      caaggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggacca
FR821987_S_P-G      caaggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggacca
FJ023879_S_P-G      caaggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggaccg
FR822067_S_P-G      caaggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggacca
FJ023885_S_P-G      caaggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggacca
FJ023884_S_P-G      caaggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggacca
FJ023878_S_P-G      caaggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggacca
FJ023880_S_P-G      caaggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggacca
FJ023882_S_P-G      caaggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggacca
FJ023883_S_P-G      caaggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggacca
FR822110_S_P-G      caaggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggacca
FR822113_S_P-G      caaggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggacca
FJ023881_S_P-G      caaggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggacca
KM455685_S_P-G      caaggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggacca
FR714503_S_P-G      caaggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggacca
KM455592_S_P-G      caaggtatgttgcccgtttgtcctctaattccaggatcctcgaccaccagtacgggacca
                    ** ** ***************** **  ** ********** ******** ** *** * 

GQ325769_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
GQ325770_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
GQ325771_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
MK568536_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtaca
KF779357_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
KF414679_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
EF464097_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
EF464098_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
JF439797_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
JF439800_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
JF439802_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
JF439799_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
JX849644_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
JN604208_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
AB056515_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtata
JF439781_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
JF439782_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
JF439786_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
JF439791_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
JF439784_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
GQ325762_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
JF439788_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
JF439812_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
JF439780_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
JF439785_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
JF439803_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
JF439804_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
JF439805_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
JF439806_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
JF439807_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
JF439808_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
JF439809_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
JF439810_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
JF439811_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
JF439813_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
JF439814_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
JF439815_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
JF439816_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
JF439817_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
JF439818_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
KF767452_S_P-G      tgcaaaacctgcacgtctcctgctcaaggcaactctatgtatccctcatgttgctgtaca
KF767451_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
HM467773_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
GQ325774_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
GU565217_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
JF439779_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
JF439787_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
JF439789_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
JF439792_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
JF439793_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
JF439794_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
HE981171_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
HE981172_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
JQ707671_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
JQ707657_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
JQ707666_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
JQ707668_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
JQ707673_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
JQ707680_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
JQ707660_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
JQ707678_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
JQ707679_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
JF439795_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
JF439796_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
JF439801_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
JQ707677_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
KF779267_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
KR230749_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
GQ325763_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
HE981174_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
HE981175_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
HE981176_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
AB375166_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
AB375167_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
AB375168_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
AB375169_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
AB375170_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
DQ236116_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
DQ236117_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
DQ236119_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
JX849642_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
JX849641_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
JX849638_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
HM467770_S_P-G      tgcaaaacctgcacgattcctgctcaaggcaactctatgtatccctcatgttgctgtaca
HM467769_S_P-G      tgcaaaacctgcacaactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
EF634480_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
AF405706_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
AB064313_S_C-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
AB056513_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
AB056514_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
AB056516_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
AB064310_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
AB064311_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
AB064312_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
AB375165_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
AF160501_S_C-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
AF369533_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
AY168428_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
DQ207798_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
DQ403176_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
GQ486843_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
GU563556_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
HM467765_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
JQ707436_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
JX849639_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
JX849643_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
JX849646_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
KC885585_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
KF767450_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
KF771917_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
KF779233_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
KF779235_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
KJ194508_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
KM998716_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
KX264500_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
KY004111_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
KY697840_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
MK568529_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
KM455794_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtata
FJ023854_S_P-G      tgcagaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
FJ023702_S_P-G      tgcagaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
FJ023705_S_P-G      tgcagaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
FJ023701_S_P-G      tgcagaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
FJ023706_S_P-G      tgcagaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
FJ023674_S_P-G      tgcagaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
FJ023703_S_P-G      tgcagaacctgcacgactcctgctcaaggcaactctatgtatccctcctgttgctgtaca
FJ023704_S_P-G      tgcagaacctgcacgactcctgctcaaggcaactctatgtatccctcctgttgctgtaca
FJ023700_S_P-G      tgcagaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
FJ023707_S_P-G      tgcagaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
EU366212_S_P-G      tgcagaacctgcacgactcctgctcaaggcaactctatgtatcccttatgttgctgtaca
EU366207_S_P-G      tgcagaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
EU366209_S_P-G      tgcagaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
EU366208_S_P-G      tgcagaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
FJ358594_S_P-G      tgcagaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
FJ023936_S_P-G      tgcagaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
FJ023968_S_P-G      tgcagaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
FR821983_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacc
GQ486349_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
FJ358587_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacc
FR821981_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacc
FR821985_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacc
FR821986_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacc
FR821982_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacc
FR821984_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacc
FR821987_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacc
FJ023879_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacc
FR822067_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacc
FJ023885_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacc
FJ023884_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacc
FJ023878_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacc
FJ023880_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacc
FJ023882_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacc
FJ023883_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacc
FR822110_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacc
FR822113_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacc
FJ023881_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacc
KM455685_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacc
FR714503_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtaca
KM455592_S_P-G      tgcaaaacctgcacgactcctgctcaaggcaactctatgtatccctcatgttgctgtacc
                    **** *********   *********************** *****  **********  

GQ325769_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcrtcytgggctttcgcaaaa
GQ325770_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcrtcytgggctttcgcaaaa
GQ325771_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcrtcttgggctttcgcaaaa
MK568536_S_P-G      aaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
KF779357_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
KF414679_S_P-G      aaaccttcggacagaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
EF464097_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
EF464098_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
JF439797_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
JF439800_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
JF439802_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
JF439799_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
JX849644_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
JN604208_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
AB056515_S_P-G      aaaccttcggaaggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
JF439781_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
JF439782_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
JF439786_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
JF439791_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
JF439784_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
GQ325762_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
JF439788_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
JF439812_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
JF439780_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
JF439785_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
JF439803_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
JF439804_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
JF439805_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
JF439806_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
JF439807_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
JF439808_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
JF439809_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
JF439810_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
JF439811_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
JF439813_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
JF439814_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
JF439815_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
JF439816_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
JF439817_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
JF439818_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
KF767452_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
KF767451_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
HM467773_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
GQ325774_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
GU565217_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
JF439779_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
JF439787_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
JF439789_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
JF439792_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
JF439793_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
JF439794_S_P-G      aaactttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
HE981171_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
HE981172_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
JQ707671_S_P-G      aaactttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
JQ707657_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
JQ707666_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
JQ707668_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
JQ707673_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
JQ707680_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
JQ707660_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
JQ707678_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
JQ707679_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
JF439795_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
JF439796_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
JF439801_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
JQ707677_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
KF779267_S_P-G      aaaccttcggacagaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
KR230749_S_P-G      aaaccttcggacagaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
GQ325763_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
HE981174_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
HE981175_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
HE981176_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
AB375166_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
AB375167_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
AB375168_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
AB375169_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
AB375170_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
DQ236116_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
DQ236117_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
DQ236119_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
JX849642_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
JX849641_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
JX849638_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
HM467770_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
HM467769_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
EF634480_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
AF405706_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
AB064313_S_C-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
AB056513_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
AB056514_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
AB056516_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
AB064310_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
AB064311_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
AB064312_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
AB375165_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
AF160501_S_C-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
AF369533_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
AY168428_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
DQ207798_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
DQ403176_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
GQ486843_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
GU563556_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
HM467765_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
JQ707436_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
JX849639_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
JX849643_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
JX849646_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
KC885585_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
KF767450_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
KF771917_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
KF779233_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
KF779235_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
KJ194508_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
KM998716_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
KX264500_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
KY004111_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
KY697840_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
MK568529_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
KM455794_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgtaaaa
FJ023854_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
FJ023702_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
FJ023705_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
FJ023701_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
FJ023706_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
FJ023674_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
FJ023703_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
FJ023704_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
FJ023700_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
FJ023707_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
EU366212_S_P-G      aaaccttcggacagaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
EU366207_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
EU366209_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
EU366208_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
FJ358594_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
FJ023936_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
FJ023968_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
FR821983_S_P-G      aaaccttcggccggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
GQ486349_S_P-G      aaacctttggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
FJ358587_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
FR821981_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
FR821985_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
FR821986_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
FR821982_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
FR821984_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
FR821987_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatctggggctttcgcaaaa
FJ023879_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
FR822067_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
FJ023885_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
FJ023884_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
FJ023878_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
FJ023880_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
FJ023882_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
FJ023883_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
FR822110_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
FR822113_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
FJ023881_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
KM455685_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
FR714503_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
KM455592_S_P-G      aaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
                    **** *  **   **************************** **  ********* ****

GQ325769_S_P-G      tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgtt
GQ325770_S_P-G      tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgtt
GQ325771_S_P-G      tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgtt
MK568536_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
KF779357_S_P-G      tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgtt
KF414679_S_P-G      tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgtt
EF464097_S_P-G      tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgtt
EF464098_S_P-G      tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgtt
JF439797_S_P-G      tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgtt
JF439800_S_P-G      tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgtt
JF439802_S_P-G      tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgtt
JF439799_S_P-G      tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgtt
JX849644_S_P-G      tacctatgggastgggcctcagtccgtttctcatggctcagtttactagtgccatttgtt
JN604208_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
AB056515_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
JF439781_S_P-G      tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgtt
JF439782_S_P-G      tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgtt
JF439786_S_P-G      tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgtt
JF439791_S_P-G      tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgtt
JF439784_S_P-G      tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgtt
GQ325762_S_P-G      tacctatgggactgggcctcagtccgtttctcatggctcagtttactagtgccatttgtt
JF439788_S_P-G      tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgtt
JF439812_S_P-G      tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgtt
JF439780_S_P-G      tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgtt
JF439785_S_P-G      tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgtt
JF439803_S_P-G      tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgtt
JF439804_S_P-G      tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgtt
JF439805_S_P-G      tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgtt
JF439806_S_P-G      tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgtt
JF439807_S_P-G      tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgtt
JF439808_S_P-G      tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgtt
JF439809_S_P-G      tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgtt
JF439810_S_P-G      tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgtt
JF439811_S_P-G      tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgtt
JF439813_S_P-G      tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgtt
JF439814_S_P-G      tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgtt
JF439815_S_P-G      tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgtt
JF439816_S_P-G      tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgtt
JF439817_S_P-G      tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgtt
JF439818_S_P-G      tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgtt
KF767452_S_P-G      tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgtt
KF767451_S_P-G      tacctatgggactgggcctcagtccgtttctcatggctcagtttactagtgccatttgtt
HM467773_S_P-G      tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgtt
GQ325774_S_P-G      tacctatgggactgggcctcagtccgtttctcatggctcagtttactagtgccatttgtt
GU565217_S_P-G      tacctatgggattgggcctcagtccgtttctcatggctcagtttactagtgccatttgtt
JF439779_S_P-G      tacctatgggattgggcctcagtccgtttctcatggctcagtttactagtgccatttgtt
JF439787_S_P-G      tacctatgggattgggcctcagtccgtttctcatggctcagtttactagtgccatttgtt
JF439789_S_P-G      tacctatgggattgggcctcagtccgtttctcatggctcagtttactagtgccatttgtt
JF439792_S_P-G      tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgtt
JF439793_S_P-G      tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgtt
JF439794_S_P-G      tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgtt
HE981171_S_P-G      tacctatgggagtgggtctcagtccgtttctcatggctcagtttactagtgccatttgtt
HE981172_S_P-G      tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgtt
JQ707671_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
JQ707657_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
JQ707666_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
JQ707668_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
JQ707673_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
JQ707680_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
JQ707660_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
JQ707678_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
JQ707679_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
JF439795_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
JF439796_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
JF439801_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
JQ707677_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
KF779267_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
KR230749_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
GQ325763_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
HE981174_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
HE981175_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
HE981176_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
AB375166_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
AB375167_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
AB375168_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
AB375169_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
AB375170_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
DQ236116_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
DQ236117_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
DQ236119_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
JX849642_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
JX849641_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
JX849638_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
HM467770_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
HM467769_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
EF634480_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
AF405706_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
AB064313_S_C-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
AB056513_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
AB056514_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
AB056516_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
AB064310_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
AB064311_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
AB064312_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
AB375165_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
AF160501_S_C-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
AF369533_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
AY168428_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
DQ207798_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
DQ403176_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
GQ486843_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
GU563556_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
HM467765_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
JQ707436_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
JX849639_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
JX849643_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
JX849646_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
KC885585_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
KF767450_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
KF771917_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
KF779233_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
KF779235_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
KJ194508_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
KM998716_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
KX264500_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
KY004111_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
KY697840_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
MK568529_S_P-G      tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
KM455794_S_P-G      tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
FJ023854_S_P-G      tacctatgggagtgggsctcagcccgtttctcctggctcagtttactagtgccatttgtt
FJ023702_S_P-G      tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagcgccatttgtt
FJ023705_S_P-G      tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagcgccatttgtt
FJ023701_S_P-G      tacctatgggggtgggcctcagcccgtttctcctggctcagtttactagcgccatttgtt
FJ023706_S_P-G      tacctatgggagtgggcctcagcccgtttctcctggctcagtttaccagcgccatttgtt
FJ023674_S_P-G      tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagcgccatttgtt
FJ023703_S_P-G      tacctatgggagtgggcctcagcccgtttctcctggctcagttcactagcgccatttgtt
FJ023704_S_P-G      tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagcgccatttgtt
FJ023700_S_P-G      tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagcgccatttgtt
FJ023707_S_P-G      tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagcgccatttgtt
EU366212_S_P-G      tacctatgggagtgggcctcagcccgtttctcctgactcaatttactagtgccatttgtt
EU366207_S_P-G      tacctatgggagtgggcctcagcccgtttctcctggctcaatttactagtgccatttgtt
EU366209_S_P-G      tacctatgggagtgggcctcagcccgtttctcctggctcaatttactagtgccatttgtt
EU366208_S_P-G      tacctatgggagtgggcctcagcccgtttctcctggctcaatttactagtgccatttgtt
FJ358594_S_P-G      tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
FJ023936_S_P-G      tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
FJ023968_S_P-G      tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
FR821983_S_P-G      tccctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
GQ486349_S_P-G      tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
FJ358587_S_P-G      tacctatgggagtgggcctcagcccgtttctcctggctcagtttacaagtgccatttgtt
FR821981_S_P-G      tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
FR821985_S_P-G      tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
FR821986_S_P-G      tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
FR821982_S_P-G      tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
FR821984_S_P-G      tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
FR821987_S_P-G      tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
FJ023879_S_P-G      tacccatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
FR822067_S_P-G      tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
FJ023885_S_P-G      tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
FJ023884_S_P-G      tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
FJ023878_S_P-G      tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
FJ023880_S_P-G      tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
FJ023882_S_P-G      tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
FJ023883_S_P-G      tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
FR822110_S_P-G      tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
FR822113_S_P-G      tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
FJ023881_S_P-G      tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
KM455685_S_P-G      tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
FR714503_S_P-G      tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtt
KM455592_S_P-G      tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgtt
                    * ** *****  **** ***** ********* ** **** ** ** ** **********

GQ325769_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatrtrgatgatrtrgtat
GQ325770_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatrtrgatgatrtrgtat
GQ325771_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatrtrgatgatrtrgtat
MK568536_S_P-G      cagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtat
KF779357_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtat
KF414679_S_P-G      cagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggtat
EF464097_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtat
EF464098_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtat
JF439797_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatagatgatgtggtat
JF439800_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatagatgatgtggtat
JF439802_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatagatgatgtggtat
JF439799_S_P-G      cagtggttcgtagggctttcccccactgtctggctgtcagctatatagatgatgtggtat
JX849644_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtat
JN604208_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtat
AB056515_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtat
JF439781_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatattgtat
JF439782_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatattgtat
JF439786_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatattgtat
JF439791_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatattgtat
JF439784_S_P-G      cagtggttcgtagggctttcccacactgtctggctttcagctatgtggatgatattgtat
GQ325762_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtat
JF439788_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtat
JF439812_S_P-G      cagtggttcgtagggctttcccccactgtctggctctcagctatgtggatgatgtggtat
JF439780_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtat
JF439785_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtat
JF439803_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtat
JF439804_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtat
JF439805_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtat
JF439806_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtat
JF439807_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtat
JF439808_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtat
JF439809_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtat
JF439810_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtat
JF439811_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtat
JF439813_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtat
JF439814_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtat
JF439815_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtat
JF439816_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtat
JF439817_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtat
JF439818_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtat
KF767452_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtat
KF767451_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtat
HM467773_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtat
GQ325774_S_P-G      cagtggtccgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtat
GU565217_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtat
JF439779_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtat
JF439787_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtat
JF439789_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtat
JF439792_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtat
JF439793_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtat
JF439794_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtggtat
HE981171_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtat
HE981172_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtat
JQ707671_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatattgatgatgtggtat
JQ707657_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatattgatgatgtggtat
JQ707666_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatattgatgatgtggtat
JQ707668_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatattgatgatgtggtat
JQ707673_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatattgatgatgtggtat
JQ707680_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatattgatgatgtggtat
JQ707660_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatattgatgatgtggtat
JQ707678_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatcgatgatgtggtat
JQ707679_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatattgatgatgtggtat
JF439795_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatagatgatgtggtat
JF439796_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatagatgatgtggtat
JF439801_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatagatgatgtggtat
JQ707677_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatattgatgatgtggtat
KF779267_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtat
KR230749_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtat
GQ325763_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtat
HE981174_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtat
HE981175_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtat
HE981176_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtat
AB375166_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtat
AB375167_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtat
AB375168_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtat
AB375169_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtat
AB375170_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtat
DQ236116_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtat
DQ236117_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtat
DQ236119_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtat
JX849642_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtat
JX849641_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtat
JX849638_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtat
HM467770_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtat
HM467769_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtat
EF634480_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtat
AF405706_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtat
AB064313_S_C-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtat
AB056513_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtat
AB056514_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtat
AB056516_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtat
AB064310_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtat
AB064311_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtat
AB064312_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtat
AB375165_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtat
AF160501_S_C-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtat
AF369533_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtat
AY168428_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtat
DQ207798_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtat
DQ403176_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtat
GQ486843_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtat
GU563556_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtat
HM467765_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtat
JQ707436_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtat
JX849639_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtat
JX849643_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtat
JX849646_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtat
KC885585_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtat
KF767450_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtat
KF771917_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtat
KF779233_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtat
KF779235_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtat
KJ194508_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtat
KM998716_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtat
KX264500_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtat
KY004111_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtat
KY697840_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtat
MK568529_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtat
KM455794_S_P-G      cagtggttcgtagggctttcccccattgtctggctttcagttatatggatgatgtggtat
FJ023854_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagttayatggatgatgtggtat
FJ023702_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcaattatatggatgatgtggtat
FJ023705_S_P-G      cagtggttcgtagggctttcccccactgtctggcttttagttatatggatgatgtggtat
FJ023701_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtat
FJ023706_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtat
FJ023674_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtat
FJ023703_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtat
FJ023704_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtat
FJ023700_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtat
FJ023707_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtat
EU366212_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttt
EU366207_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttt
EU366209_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttt
EU366208_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttt
FJ358594_S_P-G      cagtggttcgcagggctttcccccactgtctggctttcagttatatggatgatgtggtat
FJ023936_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtat
FJ023968_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtat
FR821983_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtat
GQ486349_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtat
FJ358587_S_P-G      cagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtat
FR821981_S_P-G      cagtggttcgtagggctttcccacactgtctggctttcagttatatggatgatgtggtat
FR821985_S_P-G      cagtggttcgtagggctttcccacactgtctggctttcagttatatggatgatgtggtat
FR821986_S_P-G      cagtggttcgtagggctttcccacactgtctggctttcagttatatggatgatgtggtat
FR821982_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtat
FR821984_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtat
FR821987_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtat
FJ023879_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtat
FR822067_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtat
FJ023885_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtat
FJ023884_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtat
FJ023878_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtat
FJ023880_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtat
FJ023882_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtat
FJ023883_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtat
FR822110_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtat
FR822113_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtat
FJ023881_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtat
KM455685_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtat
FR714503_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtat
KM455592_S_P-G      cagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtat
                    ******* ** *********** ** *** ***** * *  **  * ****** * ** *

GQ325769_S_P-G      trggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
GQ325770_S_P-G      trggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
GQ325771_S_P-G      trggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
MK568536_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
KF779357_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
KF414679_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
EF464097_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
EF464098_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
JF439797_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
JF439800_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
JF439802_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
JF439799_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
JX849644_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
JN604208_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
AB056515_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
JF439781_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
JF439782_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
JF439786_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
JF439791_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
JF439784_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
GQ325762_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
JF439788_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttg
JF439812_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttg
JF439780_S_P-G      tggggaccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttg
JF439785_S_P-G      tggggaccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttg
JF439803_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttg
JF439804_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttg
JF439805_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttg
JF439806_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttg
JF439807_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttg
JF439808_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttg
JF439809_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttg
JF439810_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttg
JF439811_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttg
JF439813_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttg
JF439814_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttg
JF439815_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttg
JF439816_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttg
JF439817_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttg
JF439818_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttg
KF767452_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
KF767451_S_P-G      tgggggccaaatctgtacagcatcttgagtccctttataccgctgttaccaattttcttt
HM467773_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
GQ325774_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
GU565217_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
JF439779_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
JF439787_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
JF439789_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
JF439792_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttttaccgctgttaccaattttcttt
JF439793_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttttaccgctgttaccaattttcttt
JF439794_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttttaccgctgttaccaattttcttt
HE981171_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
HE981172_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
JQ707671_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttttaccgctgttaccaattttcttt
JQ707657_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttttaccgctgttaccaattttcttt
JQ707666_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttttaccgctgttaccaattttcttt
JQ707668_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttttaccgctgttaccaattttcttt
JQ707673_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttttaccgctgttaccaattttcttt
JQ707680_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttttaccgctgttaccaattttcttt
JQ707660_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttttaccgctgttaccaattttcttt
JQ707678_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
JQ707679_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
JF439795_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
JF439796_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
JF439801_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
JQ707677_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
KF779267_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
KR230749_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
GQ325763_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
HE981174_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
HE981175_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
HE981176_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
AB375166_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
AB375167_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
AB375168_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
AB375169_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
AB375170_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
DQ236116_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
DQ236117_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
DQ236119_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
JX849642_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
JX849641_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
JX849638_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
HM467770_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
HM467769_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
EF634480_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
AF405706_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
AB064313_S_C-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
AB056513_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
AB056514_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
AB056516_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
AB064310_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
AB064311_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
AB064312_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
AB375165_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
AF160501_S_C-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
AF369533_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
AY168428_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
DQ207798_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
DQ403176_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
GQ486843_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
GU563556_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
HM467765_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
JQ707436_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
JX849639_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
JX849643_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
JX849646_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
KC885585_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
KF767450_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
KF771917_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
KF779233_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
KF779235_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
KJ194508_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
KM998716_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
KX264500_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
KY004111_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
KY697840_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
MK568529_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
KM455794_S_P-G      tgggggccacgtctgtacaacatcttgagtccctttatactgctgttaccaattttcttt
FJ023854_S_P-G      tgggggccaaatctgtacaacaccttgaagccctttataccgctgttaccaattttcttt
FJ023702_S_P-G      tgggggccaaatctgtacaacaccttgagtccatttataccgctgttaccaattttcttt
FJ023705_S_P-G      tgggggccaaatctgtacaccaccttgagtccatttataccgctgttaccaattttcttt
FJ023701_S_P-G      tggggaccaaatctgtacaacaccttgagtccatttataccgctgttaccaattttcttt
FJ023706_S_P-G      tgggggccaaatctgtacaacaccttgagtccatttataccgctgttaccaattttcttt
FJ023674_S_P-G      tgggggccaaatctgtacamcaccttgagtccatttataccgctgttaccaattttcttt
FJ023703_S_P-G      tgggggccaaatctgtacaacaccttgagtccatttataccgctgttaccaattttcttt
FJ023704_S_P-G      tgggggccaaatctgcacaacaccttgagtccatttataccgctgttaccaattttcttt
FJ023700_S_P-G      tgggggccaaatctgtacaacaccttgagtccatttatgccgctgttaccaattttcttt
FJ023707_S_P-G      tgggggccaaatctgtacaacaccttgagtccatttataccgctgttaccaattctcttt
EU366212_S_P-G      tgggggccaaaactgtacaacatcttgagtccctttataccgctgttaccaattttcttt
EU366207_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
EU366209_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
EU366208_S_P-G      tgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
FJ358594_S_P-G      tgggggccaagtctgtacaacatcttgagtccctttataccgctattaccaattttcttt
FJ023936_S_P-G      tgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
FJ023968_S_P-G      tgggggccaagtctgtacaacatcttgagtccctttttaccgctgttaccaattttcttt
FR821983_S_P-G      tgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
GQ486349_S_P-G      tgggggccaagtctgtacaacatctkgagtccctttataccgctgttaccaattttcttt
FJ358587_S_P-G      tgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
FR821981_S_P-G      tgggggccaagtctgtacaacatcttgaatccctttataccgctgtaaccaattttcttt
FR821985_S_P-G      tgggggccaagtctgtacaacatcttgaatccctttataccgctgtaaccaattttcttt
FR821986_S_P-G      tgggggccaagtctgtacaacatcttgaatccctttataccgctgtaaccaattttcttt
FR821982_S_P-G      tgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
FR821984_S_P-G      tgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
FR821987_S_P-G      tgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
FJ023879_S_P-G      tgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
FR822067_S_P-G      tgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
FJ023885_S_P-G      tgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
FJ023884_S_P-G      tgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
FJ023878_S_P-G      tgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
FJ023880_S_P-G      tgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
FJ023882_S_P-G      tgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
FJ023883_S_P-G      tgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
FR822110_S_P-G      tgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
FR822113_S_P-G      tgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
FJ023881_S_P-G      tgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttt
KM455685_S_P-G      tgggggccaagtctgtacaacatcttgagtccatttataccgctgttaccaattttcttt
FR714503_S_P-G      tgggggccaagtctgtacaacatcttgaggccatttataccgctgttaccaattttcttt
KM455592_S_P-G      tgggggccaagtctgtacaacatcttgagtccatttataccgctgttaccaattttcttt
                    * *** ***   *** *** ** ** **  ** *** * * *** * ******* **** 

GQ325769_S_P-G      tgtcyttgggtatacatctaa
GQ325770_S_P-G      tgtcyttgggtatacatctaa
GQ325771_S_P-G      tgtcyttgggtatacatctaa
MK568536_S_P-G      tgtctttgggtatacatctaa
KF779357_S_P-G      tgtctttgggtatacatctaa
KF414679_S_P-G      tgtctttgggtatacatctaa
EF464097_S_P-G      tgtctttgggtatacatttaa
EF464098_S_P-G      tgtctttgggtatacatttaa
JF439797_S_P-G      tgtctttgggtatacatctaa
JF439800_S_P-G      tgtctttgggtatacatctaa
JF439802_S_P-G      tgtctttgggtatacatctaa
JF439799_S_P-G      tgtctttgggtatacatctaa
JX849644_S_P-G      tstctttgggtatacatctaa
JN604208_S_P-G      tgtctttgggtatacatctaa
AB056515_S_P-G      tgtctttgggtatacatctaa
JF439781_S_P-G      tgtctttgggtatacatctaa
JF439782_S_P-G      tgtctttgggtatacatctaa
JF439786_S_P-G      tgtctttgggtatacatctaa
JF439791_S_P-G      tgtctttgggtatacatctaa
JF439784_S_P-G      tgtctttgggtatacatctaa
GQ325762_S_P-G      tgtctttgggtatacatctga
JF439788_S_P-G      tgtctttgggtatacatccaa
JF439812_S_P-G      tgtctttgggtatacatctaa
JF439780_S_P-G      tgtctttgggtatacatctaa
JF439785_S_P-G      tgtctttgggtatacatctaa
JF439803_S_P-G      tgtctttgggtatacatctaa
JF439804_S_P-G      tgtctttgggtatacatctaa
JF439805_S_P-G      tgtctttgggtatacatctaa
JF439806_S_P-G      tgtctttgggtatacatctaa
JF439807_S_P-G      tgtctttgggtatacatctaa
JF439808_S_P-G      tgtctttgggtatacatctaa
JF439809_S_P-G      tgtctttgggtatacatctaa
JF439810_S_P-G      tgtctttgggtatacatctaa
JF439811_S_P-G      tgtctttgggtatacatctaa
JF439813_S_P-G      tgtctttgggtatacatctaa
JF439814_S_P-G      tgtctttgggtatacatctaa
JF439815_S_P-G      tgtctttgggtatacatctaa
JF439816_S_P-G      tgtctttgggtatacatctaa
JF439817_S_P-G      tgtctttgggtatacatctaa
JF439818_S_P-G      tgtctttgggtatacatctaa
KF767452_S_P-G      tgtctttgggtatacatctaa
KF767451_S_P-G      tgtctttgggtatacatctaa
HM467773_S_P-G      tgtcttttggtatacatctaa
GQ325774_S_P-G      tgtctttgggtatacatctaa
GU565217_S_P-G      tgtctttgggtatacatctaa
JF439779_S_P-G      tgtctttgggtatacatctaa
JF439787_S_P-G      tgtctttgggtatacatctaa
JF439789_S_P-G      tgtctttgggtatacatctaa
JF439792_S_P-G      tgtctttgggtatacatctaa
JF439793_S_P-G      tgtctttgggtatacatctaa
JF439794_S_P-G      tgtctttgggtatacatctaa
HE981171_S_P-G      tttctttgggtatacatctaa
HE981172_S_P-G      tttctttgggtatacatctaa
JQ707671_S_P-G      tgtctttgggtatacatctaa
JQ707657_S_P-G      tgtctttgggtatacatctaa
JQ707666_S_P-G      tgtctttgggtatacatctaa
JQ707668_S_P-G      tgtctttgggtatacatctaa
JQ707673_S_P-G      tgtctttgggtatacatctaa
JQ707680_S_P-G      tgtctttgggtatacatctaa
JQ707660_S_P-G      tgtctttgggtatacatctaa
JQ707678_S_P-G      tgtctttgggtatacatctaa
JQ707679_S_P-G      tgtctttgggtatacatctaa
JF439795_S_P-G      cgtctttgggtatacatctaa
JF439796_S_P-G      cgtctttgggtatacatctaa
JF439801_S_P-G      cgtctttgggtatacatctaa
JQ707677_S_P-G      tgtctttgggtatacatctaa
KF779267_S_P-G      tgtctttgggtatacatctaa
KR230749_S_P-G      tgtctttgggtatacatctaa
GQ325763_S_P-G      tgtctttgggtatacatctga
HE981174_S_P-G      tgtctttgggtatacatctaa
HE981175_S_P-G      tgtctttgggtatacatctaa
HE981176_S_P-G      tgtctttgggtatacatctaa
AB375166_S_P-G      tgtctttgggtatacatctaa
AB375167_S_P-G      tgtctttgggtatacatctaa
AB375168_S_P-G      tgtctttgggtatacatctaa
AB375169_S_P-G      tgtctttgggtatacatctaa
AB375170_S_P-G      tgtctttgggtatacatctaa
DQ236116_S_P-G      tgtctttgggtatacatctaa
DQ236117_S_P-G      tgtctttgggtatacatctaa
DQ236119_S_P-G      tgtctttgggtatacatctaa
JX849642_S_P-G      tgtctttgggtatacatctaa
JX849641_S_P-G      tgtctttgggtatacatctaa
JX849638_S_P-G      tgtctttgggtatacatctaa
HM467770_S_P-G      tgtctttgggtatacatctaa
HM467769_S_P-G      tgtctttgggtatacatctaa
EF634480_S_P-G      tgtctttgggtatacatctaa
AF405706_S_P-G      tgtctttgggtatacatctaa
AB064313_S_C-G      tgtctttgggtatacatctaa
AB056513_S_P-G      tgtctttgggtatacatctaa
AB056514_S_P-G      tgtctttgggtatacatctaa
AB056516_S_P-G      tgtctttgggtatacatctaa
AB064310_S_P-G      tgtctttgggtatacatctaa
AB064311_S_P-G      tgtctttgggtatacatctaa
AB064312_S_P-G      tgtctttgggtatacatctaa
AB375165_S_P-G      tgtctttgggtatacatctaa
AF160501_S_C-G      tgtctttgggtatacatctaa
AF369533_S_P-G      tgtctttgggtatacatctaa
AY168428_S_P-G      tgtctttgggtatacatctaa
DQ207798_S_P-G      tgtctttgggtatacatctaa
DQ403176_S_P-G      tgtctttgggtatacatctaa
GQ486843_S_P-G      tgtctttgggtatacatctaa
GU563556_S_P-G      tgtctttgggtatacatctaa
HM467765_S_P-G      tgtctttgggtatacatctaa
JQ707436_S_P-G      tgtctttgggtatacatctaa
JX849639_S_P-G      tgtctttgggtatacatctaa
JX849643_S_P-G      tgtctttgggtatacatctaa
JX849646_S_P-G      tgtctttgggtatacatctaa
KC885585_S_P-G      tgtctttgggtatacatctaa
KF767450_S_P-G      tgtctttgggtatacatctaa
KF771917_S_P-G      tgtctttgggtatacatctaa
KF779233_S_P-G      tgtctttgggtatacatctaa
KF779235_S_P-G      tgtctttgggtatacatctaa
KJ194508_S_P-G      tgtctttgggtatacatctaa
KM998716_S_P-G      tgtctttgggtatacatctaa
KX264500_S_P-G      tgtctttgggtatacatctaa
KY004111_S_P-G      tgtctttgggtatacatctaa
KY697840_S_P-G      tgtctttgggtatacatc---
MK568529_S_P-G      tgtctttgggtatacatctaa
KM455794_S_P-G      tgtctttgggtatacatttaa
FJ023854_S_P-G      tgtctttgggtatacatttaa
FJ023702_S_P-G      tgtctttgggtatacatttaa
FJ023705_S_P-G      tgtctttgggtatacatttaa
FJ023701_S_P-G      tgtctttgggtatacatttaa
FJ023706_S_P-G      tgtctttgggtatacatttaa
FJ023674_S_P-G      tgtctttgggtatacatttaa
FJ023703_S_P-G      tgtctttgggtatacatttaa
FJ023704_S_P-G      tgtctttgggtatacatttaa
FJ023700_S_P-G      tgtctttgggtatacatttaa
FJ023707_S_P-G      tgtctttgggtatacatttaa
EU366212_S_P-G      tgtctttgggtatacatttaa
EU366207_S_P-G      tgtctttgggtatacatttaa
EU366209_S_P-G      tgtctttgggtatacatttaa
EU366208_S_P-G      tgtctttgggtatacatttaa
FJ358594_S_P-G      tgtctttgggtatacatttaa
FJ023936_S_P-G      tgtctttgggtatacatttaa
FJ023968_S_P-G      tgtctttgggtatacatttaa
FR821983_S_P-G      tgtctttgggtatacatttaa
GQ486349_S_P-G      tgtctttgggtatacatttaa
FJ358587_S_P-G      tgtctttgggtatacatttaa
FR821981_S_P-G      tgtctttgggtatacatttaa
FR821985_S_P-G      tgtctttgggtatacatttaa
FR821986_S_P-G      tgtctttgggtatacatttaa
FR821982_S_P-G      tgtctttgggtatacatttaa
FR821984_S_P-G      tgtctttgggtatacatttaa
FR821987_S_P-G      tgtctttgggtatacatttaa
FJ023879_S_P-G      tgtctttgggtatacatctaa
FR822067_S_P-G      tgtctttgggtatacatctaa
FJ023885_S_P-G      tgtctttgggtatacatctaa
FJ023884_S_P-G      tgtctttggggatacatctaa
FJ023878_S_P-G      tgtctttgggtatacatctaa
FJ023880_S_P-G      tgtctttgggtatacatctaa
FJ023882_S_P-G      tgtctttgggtatacatctaa
FJ023883_S_P-G      tgtctttgggtatacatctaa
FR822110_S_P-G      tgtctttgggtatacatctaa
FR822113_S_P-G      tgtctttgggtatacatctaa
FJ023881_S_P-G      tgtctttgggtatacatctaa
KM455685_S_P-G      tgtctttgggtatacatttaa
FR714503_S_P-G      tgtctttgggtatacatttaa
KM455592_S_P-G      tgtctttgggtatacatttaa
                      ** ** ** ******    

© 1998-2020Legal notice