HBVdb

Dataset for nucleotide sequence SP of genotype D

[Download (right click)] [Alignment] [Repertoires]

1334 sequence(s)

>gnl|hbvcds|AB048701_SP_P-D Feature FT:CDS AB048701_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacaacgaggcaggaccattagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggatg
gaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB078031_SP_P-D Feature FT:CDS AB078031_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FH1-YS). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB078032_SP_P-D Feature FT:CDS AB078032_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AH1-SY). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcgtcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB078033_SP_P-D Feature FT:CDS AB078033_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IS1-OY). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB090268_SP_P-D Feature FT:CDS AB090268_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB090269_SP_P-D Feature FT:CDS AB090269_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatctccaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB090270_SP_P-D Feature FT:CDS AB090270_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB104709_SP_P-D Feature FT:CDS AB104709_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EG64). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaacctttggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB104710_SP_P-D Feature FT:CDS AB104710_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EG105). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgctgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB104711_SP_P-D Feature FT:CDS AB104711_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EG104). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcgtcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB104712_SP_P-D Feature FT:CDS AB104712_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EG75). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgctgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB109475_SP_P-D Feature FT:CDS AB109475_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB109476_SP_P-D Feature FT:CDS AB109476_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB109477_SP_P-D Feature FT:CDS AB109477_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB109478_SP_P-D Feature FT:CDS AB109478_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB109479_SP_P-D Feature FT:CDS AB109479_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcctctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttccaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB110075_SP_P-D Feature FT:CDS AB110075_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB116266_SP_P-D Feature FT:CDS AB116266_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB119251_SP_P-D Feature FT:CDS AB119251_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB119252_SP_P-D Feature FT:CDS AB119252_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB119253_SP_P-D Feature FT:CDS AB119253_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB119254_SP_P-D Feature FT:CDS AB119254_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB119255_SP_P-D Feature FT:CDS AB119255_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgctgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB119256_SP_P-D Feature FT:CDS AB119256_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcatcacttccggagattactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB120308_SP_P-D Feature FT:CDS AB120308_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB126581_SP_P-D Feature FT:CDS AB126581_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-RU301). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctggacgactcctggtcaaggaacctctatgtatccctcctggtgctggaccaaacctttggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB188241_SP_P-D Feature FT:CDS AB188241_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate KAMCHATKA25). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcgtcaaccaccagcgc
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB188242_SP_P-D Feature FT:CDS AB188242_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate KAMCHATKA38). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcgaccaccagcgt
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB188244_SP_P-D Feature FT:CDS AB188244_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate UZ24). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggwcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtggccctcatgttgctgtaccaaacctacggacg
gaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagcccgtttctck
tggctcagtttactag
>gnl|hbvcds|AB205126_SP_P-D Feature FT:CDS AB205126_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-IF714-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB205127_SP_P-D Feature FT:CDS AB205127_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-RU313-2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcttgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB205128_SP_P-D Feature FT:CDS AB205128_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-RU316-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB210820_SP_P-D Feature FT:CDS AB210820_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagaagacgagtcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgactactgcacaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB210821_SP_P-D Feature FT:CDS AB210821_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcaaaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB210822_SP_P-D Feature FT:CDS AB210822_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcaaaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB222709_SP_P-D Feature FT:CDS AB222709_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate UZBV34). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB222710_SP_P-D Feature FT:CDS AB222710_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate UZNVC6M). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctgc
tggctcagtttactag
>gnl|hbvcds|AB222711_SP_P-D Feature FT:CDS AB222711_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate UZNV24). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatcgtcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB222712_SP_P-D Feature FT:CDS AB222712_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate UZBV61). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgctgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB222713_SP_P-D Feature FT:CDS AB222713_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate UZNVC6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB246347_SP_P-D Feature FT:CDS AB246347_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcgaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB246348_SP_P-D Feature FT:CDS AB246348_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatatatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB267090_SP_P-D Feature FT:CDS AB267090_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Ehime 22-HS). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagaggacgaggcaggtcctctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB270537_SP_P-D Feature FT:CDS AB270537_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL22F). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacatgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB270539_SP_P-D Feature FT:CDS AB270539_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL200F). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtatcaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB270540_SP_P-D Feature FT:CDS AB270540_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL241F). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctagggaaccccaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB270541_SP_P-D Feature FT:CDS AB270541_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL47F). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttctgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcttcaaccaccagcac
gggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB270542_SP_P-D Feature FT:CDS AB270542_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL12F). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB270543_SP_P-D Feature FT:CDS AB270543_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL209F). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB270546_SP_P-D Feature FT:CDS AB270546_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL88F). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagatgccgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggatcatgcagaacctgcacgactcctgctcaaggaacctctatgaatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB270547_SP_P-D Feature FT:CDS AB270547_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL295F). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaacatgcagaacctgcacgacccctgctcgcggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB270548_SP_P-D Feature FT:CDS AB270548_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL207F). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB270549_SP_P-D Feature FT:CDS AB270549_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL79F). Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgatgcaggacccctagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatatatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB270550_SP_P-D Feature FT:CDS AB270550_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL247F). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaagcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatccaactgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB330367_SP_P-D Feature FT:CDS AB330367_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TAJ14HBV). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaatgcttccggagacttctgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB330369_SP_P-D Feature FT:CDS AB330369_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TAJ5HBV). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB330370_SP_P-D Feature FT:CDS AB330370_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TAJ6HBV). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB471856_SP_P-D Feature FT:CDS AB471856_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate F3O-C1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB471857_SP_P-D Feature FT:CDS AB471857_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate F3O-C2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB493846_SP_P-D Feature FT:CDS AB493846_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 17UC). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagacgaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB555496_SP_P-D Feature FT:CDS AB555496_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-TA31). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttctggagactgctgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctgtatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB555497_SP_P-D Feature FT:CDS AB555497_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-TA37). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttctggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB555500_SP_P-D Feature FT:CDS AB555500_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-TA64). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttctgttattagacaasgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctaaatcgccgtgtcgcagaagatctcaatctcgggacgcccaatgatcttcaaccaccagcac
gggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB555501_SP_P-D Feature FT:CDS AB555501_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-TA65). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgatcttcaacaaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB583680_SP_P-D Feature FT:CDS AB583680_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Pkst7912). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB674403_SP_P-D Feature FT:CDS AB674403_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SamsunD87). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgatgcgggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB674404_SP_P-D Feature FT:CDS AB674404_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AnkaraE39). Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggycccctggaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggamcatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB674405_SP_P-D Feature FT:CDS AB674405_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AnkaraHCCA12). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcttcaaccaccagcac
gggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB674406_SP_P-D Feature FT:CDS AB674406_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IstambulB23). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcrtcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB674407_SP_P-D Feature FT:CDS AB674407_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SamsunD35). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB674408_SP_P-D Feature FT:CDS AB674408_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SamsunD83). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacaacgaggcaggtccactagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB674409_SP_P-D Feature FT:CDS AB674409_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SamsunD40). Partial genome (Contains: HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB674410_SP_P-D Feature FT:CDS AB674410_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SamsunD27). Partial genome (Contains: HBc, HBx). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttctgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcttcgaccaccagcac
gggaccatgcagaacctgcatgactcctgctcaaggaacctctatgaatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB674411_SP_P-D Feature FT:CDS AB674411_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SamsunD84). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgatcttcaacgaccagtac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|AB674413_SP_P-D Feature FT:CDS AB674413_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IstambulB27). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctagggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB674415_SP_P-D Feature FT:CDS AB674415_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GaziantepLCC24). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttctgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcmtgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB674416_SP_P-D Feature FT:CDS AB674416_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AnkaraE19). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagagtactgttattagacaacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcttcaacaaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB674417_SP_P-D Feature FT:CDS AB674417_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AnkaraLCE1). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagaccaagaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagacgatctaaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|AB674418_SP_P-D Feature FT:CDS AB674418_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GaziantepLCC7). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagaccaagaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagacgatctaaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|AB674419_SP_P-D Feature FT:CDS AB674419_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GaziantepLCC16). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgatcttcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgttgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|AB674420_SP_P-D Feature FT:CDS AB674420_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SamsunLCD2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaactaccagtac
gggaccatgcaaaacctgcacgactcctgctcaaggcacctctatgtttccctcatgttgctgtacaaaacctacggatg
gaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB674422_SP_P-D Feature FT:CDS AB674422_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AnkaraE15). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtmtcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB674423_SP_P-D Feature FT:CDS AB674423_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SamsunD18). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagtgtactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB674424_SP_P-D Feature FT:CDS AB674424_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AnkaraE24). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaactcttccggagacttctgttattagatccagaagcagggcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaacgaccagcac
gggaccatgcagaacctgcacgagtcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctca
tggctcaatttactag
>gnl|hbvcds|AB674425_SP_P-D Feature FT:CDS AB674425_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AnkaraE44). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagacgaactccctcg
cctcgcagacgaaggtcycaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB674426_SP_P-D Feature FT:CDS AB674426_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SamsunD50). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB674427_SP_P-D Feature FT:CDS AB674427_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SamsunD54). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB674428_SP_P-D Feature FT:CDS AB674428_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IstambulB26). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacccagatgatcttcaacgaccagcac
gggaccatgcagaacctgcacgagtcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB674429_SP_P-D Feature FT:CDS AB674429_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SamsunD89). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgaatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB674430_SP_P-D Feature FT:CDS AB674430_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GaziantepLCC2). Partial genome (Contains: HBe, HBc, HBx). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaactaccagcac
gggatcatgcagaacctgcacgactcctgctcaaggaacctctatgaatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB674431_SP_P-D Feature FT:CDS AB674431_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GaziantepLCC27). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcatcacttccggagacttgtgttgttagacgacgacgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgttgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB674435_SP_P-D Feature FT:CDS AB674435_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IstambulB24). Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcttcaactaccagcac
gggaccatgcagaatctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggcccagtttactag
>gnl|hbvcds|AF043593_SP_P-D Feature FT:CDS AF043593_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 6/89). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgaccactgttcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AF043594_SP_P-D Feature FT:CDS AF043594_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 1/91). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AF121239_SP_P-D Feature FT:CDS AF121239_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV/1303). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttgtgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcatgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AF121240_SP_C-D Feature FT:CDS AF121240_SP_C-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV/11066). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcatgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AF121241_SP_P-D Feature FT:CDS AF121241_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV/1758). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcatgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AF121242_SP_P-D Feature FT:CDS AF121242_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV/1218). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcatgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AF151735_SP_P-D Feature FT:CDS AF151735_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggaag
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AF280817_SP_P-D Feature FT:CDS AF280817_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-D1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AJ131956_SP_P-D Feature FT:CDS AJ131956_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaacctttggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AJ344116_SP_P-D Feature FT:CDS AJ344116_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBsAg negative patient GX27). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgctgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AJ627215_SP_P-D Feature FT:CDS AJ627215_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 06115). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AJ627216_SP_P-D Feature FT:CDS AJ627216_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 17707). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AJ627218_SP_P-D Feature FT:CDS AJ627218_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 21116). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AJ627219_SP_P-D Feature FT:CDS AJ627219_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 24039). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggatg
gaaactgcacctgtattcccatcccatcgtcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|AJ627220_SP_P-D Feature FT:CDS AJ627220_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 29234). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgactactgctcaaggaaactctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AJ627222_SP_P-D Feature FT:CDS AJ627222_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 31228). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgmagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AJ627223_SP_P-D Feature FT:CDS AJ627223_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 33720). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AJ627224_SP_P-D Feature FT:CDS AJ627224_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 33852). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AM422939_SP_P-D Feature FT:CDS AM422939_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate X28). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
gggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY090452_SP_P-D Feature FT:CDS AY090452_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagtgtactgttattagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaaactcaatgatcctcaaccaccagcac
gggaccatgcaaaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY090453_SP_P-D Feature FT:CDS AY090453_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactgctgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcaagacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttcttc
tggctcaatttactag
>gnl|hbvcds|AY161150_SP_P-D Feature FT:CDS AY161150_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaaactctattcatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY161151_SP_P-D Feature FT:CDS AY161151_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaaactctattcatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY161152_SP_P-D Feature FT:CDS AY161152_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaaactctattcatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY161153_SP_P-D Feature FT:CDS AY161153_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaaactctattcatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY161154_SP_P-D Feature FT:CDS AY161154_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaaactctattcatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY161155_SP_P-D Feature FT:CDS AY161155_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaaactctattcatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY161156_SP_P-D Feature FT:CDS AY161156_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaaactctattcatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY161157_SP_P-D Feature FT:CDS AY161157_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagaccactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY161158_SP_P-D Feature FT:CDS AY161158_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagagctaaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY161159_SP_P-D Feature FT:CDS AY161159_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacatgtattcccatcccatcatcctgggctttcggaaaattcctatggaagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY161160_SP_P-D Feature FT:CDS AY161160_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacatgtattcccatcccatcatcctgggctttcggaaaattcctatggaagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY233291_SP_P-D Feature FT:CDS AY233291_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 179). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctggcctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY233292_SP_P-D Feature FT:CDS AY233292_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 184). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY233294_SP_P-D Feature FT:CDS AY233294_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 305). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccctgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY233296_SP_P-D Feature FT:CDS AY233296_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 185). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
gggaccatgccggacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY236160_SP_P-D Feature FT:CDS AY236160_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 1A). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcttgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggcgtgggcctcagcccgttcctcc
tggctcagtttactag
>gnl|hbvcds|AY236162_SP_P-D Feature FT:CDS AY236162_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 23A). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcttcaaccaccagcac
gggatcatgcagaacctgcacgactcctgctcaaggaacctctatgaatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY236164_SP_P-D Feature FT:CDS AY236164_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 30). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactctctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaatctgcacgactcttgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggcgtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY373431_SP_P-D Feature FT:CDS AY373431_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY661792_SP_P-D Feature FT:CDS AY661792_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate ayw). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY661793_SP_P-D Feature FT:CDS AY661793_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY721605_SP_P-D Feature FT:CDS AY721605_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AK1.1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcgaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY721606_SP_P-D Feature FT:CDS AY721606_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AT1.2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagtac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY721607_SP_P-D Feature FT:CDS AY721607_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HIY1.3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcgtcaaccaccagcac
gggaccatgcagaacctgcacaactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY721608_SP_P-D Feature FT:CDS AY721608_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IB1.4). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgccgaacatgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY721609_SP_P-D Feature FT:CDS AY721609_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AA1.5). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY721610_SP_P-D Feature FT:CDS AY721610_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FK1.6). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY721611_SP_P-D Feature FT:CDS AY721611_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SK1.7). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtatcaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY721612_SP_P-D Feature FT:CDS AY721612_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BL1.8). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgctgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY741794_SP_P-D Feature FT:CDS AY741794_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-IPI-50). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcacaagatctcaatctcggggatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccgtcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY741795_SP_P-D Feature FT:CDS AY741795_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-IPI-Hi). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcacaaaatctcaatctcggggatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccgtcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY741796_SP_P-D Feature FT:CDS AY741796_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-IPI-P3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcacaaaatctcaatctcggggatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccgtcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY741797_SP_P-D Feature FT:CDS AY741797_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-IPI-21). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctggaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaaaatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY741798_SP_P-D Feature FT:CDS AY741798_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-IPI-P4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacaacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaaaatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY796030_SP_P-D Feature FT:CDS AY796030_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FC1.9). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY796031_SP_P-D Feature FT:CDS AY796031_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate RA1.10). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactactgctcaagggacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY796032_SP_P-D Feature FT:CDS AY796032_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NA1.11). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AY945307_SP_P-D Feature FT:CDS AY945307_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcaaacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcgtcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttgggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ111986_SP_P-D Feature FT:CDS DQ111986_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MBT181). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacnacgacgcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ304547_SP_P-D Feature FT:CDS DQ304547_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcttcaaccaccagcac
gggatcatgcagaacctgcacgactcctgctcaaggaacctctatgaatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ304548_SP_P-D Feature FT:CDS DQ304548_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactctctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcttcaaccaccagcac
gggatcatgcagaacctgcacgactcctgctcaaggaacctctatgaatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ304549_SP_P-D Feature FT:CDS DQ304549_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT4). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactctctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcttcaaccaccagcac
gggatcatgcagaacctgcacgactcctgctcaaggaacctctatgaatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ304550_SP_P-D Feature FT:CDS DQ304550_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcttcaaccaccagcac
gggatcatgcagaacctgcacgactcctgctcaaggaacctctatgaatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ304551_SP_P-D Feature FT:CDS DQ304551_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcttcaaccaccagcac
gggatcatgcagaacctgcacgactcctgctcaaggaacctctatgaatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ315776_SP_P-D Feature FT:CDS DQ315776_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EI00615). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
gggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ315778_SP_P-D Feature FT:CDS DQ315778_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EI0388). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ329356_SP_P-D Feature FT:CDS DQ329356_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgctagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcggcggagaagatctaaatctcgggaatctcaatgatcctcaacaaccagcac
gggaccatgccggacttgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ329357_SP_P-D Feature FT:CDS DQ329357_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaagggctcaatcgccgcggcggagaagatctaaatctcgggaatctcaatgatcctcaacaaccagcac
gggaccatgccggacttgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ336674_SP_P-D Feature FT:CDS DQ336674_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcttgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggcgtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ336675_SP_P-D Feature FT:CDS DQ336675_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcttgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggcgtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ336676_SP_P-D Feature FT:CDS DQ336676_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcttgctcaaggaacctctatgtatccctcatgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggcgtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ336677_SP_P-D Feature FT:CDS DQ336677_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcttgctcaaggaacctctatgtatccctcatgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggcgtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ336678_SP_P-D Feature FT:CDS DQ336678_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcttgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggcgtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ336679_SP_P-D Feature FT:CDS DQ336679_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcttgctcaaggaacctctatgtatccctcatgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggcgtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ336680_SP_P-D Feature FT:CDS DQ336680_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S2). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaagctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaatctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ336681_SP_P-D Feature FT:CDS DQ336681_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S2). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaagctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaatctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ336682_SP_P-D Feature FT:CDS DQ336682_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S2). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaagctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaatctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|DQ336683_SP_P-D Feature FT:CDS DQ336683_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S2). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaatctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ336684_SP_P-D Feature FT:CDS DQ336684_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S2). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaagctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaatctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ336685_SP_P-D Feature FT:CDS DQ336685_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctccttgatcctcgaccaccagcac
gggtccttgccgaacctgcacgactcttgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggcgtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ336686_SP_P-D Feature FT:CDS DQ336686_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcctcgaccaccagcac
gggaccatgccggacctgcacgactcttgctcaaggaacctctatgtatccttcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggcgtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ336687_SP_P-D Feature FT:CDS DQ336687_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcctcgaccaccagcac
gggaccatgccggacctgcacgactcttgctcaaggaacctctatgtatccttcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggcgtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ336688_SP_P-D Feature FT:CDS DQ336688_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcctcgaccaccagcac
gggaccatgccggacctgcacgactcttgctcaaggaacctctatgtatccttcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggcgtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ336689_SP_P-D Feature FT:CDS DQ336689_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactctctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcctcgacaaccagcac
gggaccatgccggacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggcgtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ336690_SP_P-D Feature FT:CDS DQ336690_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcttgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggcgtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ336691_SP_P-D Feature FT:CDS DQ336691_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT5). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcctcaacaaccagcac
gggaccatgccggacttgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggcgtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ336692_SP_P-D Feature FT:CDS DQ336692_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcctcgaccaccagcac
gggaccatgccggacctgcacgactcttgctcaaggaacctctatgtatccttcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggcgtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ464168_SP_P-D Feature FT:CDS DQ464168_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT8). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
gggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ464169_SP_P-D Feature FT:CDS DQ464169_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT8). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
gggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ464170_SP_P-D Feature FT:CDS DQ464170_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT8). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
gggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ464172_SP_P-D Feature FT:CDS DQ464172_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcaggtcccctacaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcaggaatctcactgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcttgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggcgtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ464173_SP_P-D Feature FT:CDS DQ464173_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcttgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggcgtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ464174_SP_P-D Feature FT:CDS DQ464174_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcctcaaccaccagcac
gggtccatgccgaacctgcacgactcttgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggcgtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ464175_SP_P-D Feature FT:CDS DQ464175_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcttgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggcgtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ464176_SP_P-D Feature FT:CDS DQ464176_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT6). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcttgctcaaggaacctctatgtatccctcatgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggcgtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ464177_SP_P-D Feature FT:CDS DQ464177_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT6). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcttgctcaaggaacctctatgtatccctcatgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggcgtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ464178_SP_P-D Feature FT:CDS DQ464178_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcttgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggcgtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ464181_SP_P-D Feature FT:CDS DQ464181_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S3). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcctgttgctgtaccaaaccttcggacg
gaaattgcacatgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ464182_SP_P-D Feature FT:CDS DQ464182_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatctccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgcagaacctgcacgacttttgctcaaggaacctctatgaatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ486021_SP_P-D Feature FT:CDS DQ486021_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT13). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcttgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggcgtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ486022_SP_P-D Feature FT:CDS DQ486022_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT11). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactctctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaatctgcacgactcttgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggcgtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|DQ486023_SP_P-D Feature FT:CDS DQ486023_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT10). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactagtgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgaagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctggtgctgtaccaaaactttggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcctgttccttc
tggctcagtttactag
>gnl|hbvcds|DQ486025_SP_P-D Feature FT:CDS DQ486025_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT12). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgatcctcaacaaccagcac
gggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggatg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EF103275_SP_P-D Feature FT:CDS EF103275_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Ran11). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EF103276_SP_P-D Feature FT:CDS EF103276_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Ran22). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EF103277_SP_P-D Feature FT:CDS EF103277_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Ran33). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgctgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EF103279_SP_P-D Feature FT:CDS EF103279_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Ran99). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcaaacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgttgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EF103280_SP_P-D Feature FT:CDS EF103280_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Ran100). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtggccctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EF103281_SP_P-D Feature FT:CDS EF103281_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Ran102). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtggccctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU155893_SP_P-D Feature FT:CDS EU155893_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaggttgctgttgttagaggacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccctgccgaccctgcataacaactgctcaagaaacctctatgtttgcctcatgttgctgtaccaaacctttggacg
gaaattacacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagttcactag
>gnl|hbvcds|EU155895_SP_P-D Feature FT:CDS EU155895_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 5b). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactgctgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatcatcctcaaacaccagcag
gggcacatgccgaagctgcatgatacatgctccaggaacctctatgtctcccttctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggggtgggcctcagcccgtttctcc
tggctcagttcactag
>gnl|hbvcds|EU414135_SP_P-D Feature FT:CDS EU414135_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU414136_SP_P-D Feature FT:CDS EU414136_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
caaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU414138_SP_P-D Feature FT:CDS EU414138_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU414139_SP_P-D Feature FT:CDS EU414139_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaamtccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU414140_SP_P-D Feature FT:CDS EU414140_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcwtcaaccaccagyry
gggaccmtgcmraacctgcacgactmytgytcaaggaacctctatgtwtccctcmtgttgctgtwcmaaaccttcggacg
gaaattgcacytgtattcccatcccatcatcmtgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU414141_SP_P-D Feature FT:CDS EU414141_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcrcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU414142_SP_P-D Feature FT:CDS EU414142_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU414143_SP_P-D Feature FT:CDS EU414143_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcrtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgcacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU594382_SP_P-D Feature FT:CDS EU594382_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU594396_SP_P-D Feature FT:CDS EU594396_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgctgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU594397_SP_P-D Feature FT:CDS EU594397_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU594398_SP_P-D Feature FT:CDS EU594398_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgactgctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU594399_SP_P-D Feature FT:CDS EU594399_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU594400_SP_P-D Feature FT:CDS EU594400_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU594401_SP_P-D Feature FT:CDS EU594401_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcatgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU594402_SP_P-D Feature FT:CDS EU594402_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcatgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU594403_SP_P-D Feature FT:CDS EU594403_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU594404_SP_P-D Feature FT:CDS EU594404_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctagggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU594405_SP_P-D Feature FT:CDS EU594405_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU594407_SP_P-D Feature FT:CDS EU594407_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU594408_SP_P-D Feature FT:CDS EU594408_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU594409_SP_P-D Feature FT:CDS EU594409_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcatgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU594410_SP_P-D Feature FT:CDS EU594410_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU594411_SP_P-D Feature FT:CDS EU594411_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactattgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU594412_SP_P-D Feature FT:CDS EU594412_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactattgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU594413_SP_P-D Feature FT:CDS EU594413_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU594414_SP_P-D Feature FT:CDS EU594414_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU594415_SP_P-D Feature FT:CDS EU594415_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU594416_SP_P-D Feature FT:CDS EU594416_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcgaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcatgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU594417_SP_P-D Feature FT:CDS EU594417_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcatgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU594418_SP_P-D Feature FT:CDS EU594418_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU594419_SP_P-D Feature FT:CDS EU594419_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcaggacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU594420_SP_P-D Feature FT:CDS EU594420_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcaggacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU594421_SP_P-D Feature FT:CDS EU594421_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU594422_SP_P-D Feature FT:CDS EU594422_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcaggacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU594423_SP_P-D Feature FT:CDS EU594423_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcaggacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU594424_SP_P-D Feature FT:CDS EU594424_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU594425_SP_P-D Feature FT:CDS EU594425_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU594426_SP_P-D Feature FT:CDS EU594426_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU594427_SP_P-D Feature FT:CDS EU594427_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU594428_SP_P-D Feature FT:CDS EU594428_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcaggacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU594429_SP_P-D Feature FT:CDS EU594429_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcatgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU594430_SP_P-D Feature FT:CDS EU594430_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU594431_SP_P-D Feature FT:CDS EU594431_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcatgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU594432_SP_P-D Feature FT:CDS EU594432_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcatgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU594433_SP_P-D Feature FT:CDS EU594433_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaacatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU594434_SP_P-D Feature FT:CDS EU594434_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcctgctcaaggaccctctatgtatccctcctgttgttgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU787436_SP_P-D Feature FT:CDS EU787436_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 165). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU787437_SP_P-D Feature FT:CDS EU787437_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 17). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggatcctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccctcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|EU787438_SP_P-D Feature FT:CDS EU787438_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 7). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccctcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU787439_SP_P-D Feature FT:CDS EU787439_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 89). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacaacgaggcaggtcccctagaagaagacctccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcttgttgctgtaccaaaccctcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU787440_SP_P-D Feature FT:CDS EU787440_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate W17). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccctcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU787441_SP_P-D Feature FT:CDS EU787441_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate W32). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcttgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcaatttactag
>gnl|hbvcds|EU787442_SP_P-D Feature FT:CDS EU787442_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate W37). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccctcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU787443_SP_P-D Feature FT:CDS EU787443_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate w40). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcttcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccctcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU787445_SP_P-D Feature FT:CDS EU787445_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate W51). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccctgcagaacatgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccctcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU787446_SP_P-D Feature FT:CDS EU787446_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate W75). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU787447_SP_P-D Feature FT:CDS EU787447_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate W46). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcttgttgctgtaccaaaccctcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU919197_SP_P-D Feature FT:CDS EU919197_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate XJU). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctactgttgctgtaccaaaccctcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU921418_SP_P-D Feature FT:CDS EU921418_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 22.165.07). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagacgaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU921419_SP_P-D Feature FT:CDS EU921419_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 22.252.07). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcctcaaccaccagcac
gggaccatgtcgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EU939680_SP_P-D Feature FT:CDS EU939680_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C186). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacaacgaggcaggtaccctagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgcagaacctgcacgattcctgctcaaggaacctctatgtatccctcttgttgctgtaccaaagcttcggaca
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccatttctcc
ttgctcagtttactag
>gnl|hbvcds|EU939681_SP_P-D Feature FT:CDS EU939681_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D146). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaagcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcgtcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcttgttgctgtaccaaaccctcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ349205_SP_P-D Feature FT:CDS FJ349205_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ349206_SP_P-D Feature FT:CDS FJ349206_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctccatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ349208_SP_P-D Feature FT:CDS FJ349208_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H25). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgttgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ349209_SP_P-D Feature FT:CDS FJ349209_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H29). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ349211_SP_P-D Feature FT:CDS FJ349211_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H34). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcgatgatcctcaacaaccagcac
gggaccatgccggacctgcatgactactgctcaaggaacctctatgtttccctcctgttgctgtaccaaacctacggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ349213_SP_P-D Feature FT:CDS FJ349213_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H59). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagacttgtgttgttagacaacgacacaggtccactagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcgtcgaccaccagcac
gggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ349214_SP_P-D Feature FT:CDS FJ349214_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H61). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacgcttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgacaactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ349215_SP_P-D Feature FT:CDS FJ349215_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H82). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ349216_SP_P-D Feature FT:CDS FJ349216_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H113). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ349217_SP_P-D Feature FT:CDS FJ349217_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H129). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ349218_SP_P-D Feature FT:CDS FJ349218_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H135). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggattgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|FJ349219_SP_P-D Feature FT:CDS FJ349219_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H138). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcacggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ349220_SP_P-D Feature FT:CDS FJ349220_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H144). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ349228_SP_P-D Feature FT:CDS FJ349228_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C11). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ349229_SP_P-D Feature FT:CDS FJ349229_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C26). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ349230_SP_P-D Feature FT:CDS FJ349230_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ349231_SP_P-D Feature FT:CDS FJ349231_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C22). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ349232_SP_P-D Feature FT:CDS FJ349232_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C51). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgacttctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ349233_SP_P-D Feature FT:CDS FJ349233_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C54). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcgactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ349234_SP_P-D Feature FT:CDS FJ349234_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C82). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagatgccgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcttgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ349235_SP_P-D Feature FT:CDS FJ349235_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C90). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ386590_SP_P-D Feature FT:CDS FJ386590_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 1841). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaacctttggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562309_SP_P-D Feature FT:CDS FJ562309_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I200). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatcttaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ562338_SP_P-D Feature FT:CDS FJ562338_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I192). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgcagaacctgcacgacttctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ692506_SP_P-D Feature FT:CDS FJ692506_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D3_50157). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactattgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ692507_SP_P-D Feature FT:CDS FJ692507_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D3_50158). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactattgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ692532_SP_P-D Feature FT:CDS FJ692532_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D4_50053). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcs
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcctgttgctgtacaaaaccttcggatg
gaaactgcacctgtattcccatcccatcgtcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ692533_SP_P-D Feature FT:CDS FJ692533_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D4_50064). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggatg
gaaactgcacttgtattcccatcccatcgtcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ899792_SP_P-D Feature FT:CDS FJ899792_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D146-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaagcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcgtcaaccaccggcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcttgttgctgtaccaaaccctcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ904395_SP_P-D Feature FT:CDS FJ904395_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A10a). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcatgttgctgtacaaaaccttcggatg
gaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ904399_SP_P-D Feature FT:CDS FJ904399_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A18). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttctgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagwcgaaggtstcaatcgscgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ904402_SP_P-D Feature FT:CDS FJ904402_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A26). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctagcagacgaaggtgtcaatcgccgcgtcgcagaagatctcaatctcgggaatcscaatgatcttcgaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ904410_SP_P-D Feature FT:CDS FJ904410_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A54b). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcgtcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggatg
gaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ904412_SP_P-D Feature FT:CDS FJ904412_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A56). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcgaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ904415_SP_P-D Feature FT:CDS FJ904415_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A63). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagcattctgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cgtagcagtcgaaggtgtcaatcggcgggtagcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgttgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ904418_SP_P-D Feature FT:CDS FJ904418_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A69a). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcgaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ904419_SP_P-D Feature FT:CDS FJ904419_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A70). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgaagaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacttgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggatg
gaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ904420_SP_P-D Feature FT:CDS FJ904420_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A71a). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgttgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ904421_SP_P-D Feature FT:CDS FJ904421_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A71b). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgttgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ904422_SP_P-D Feature FT:CDS FJ904422_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A76). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccmtgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ904424_SP_P-D Feature FT:CDS FJ904424_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A79a). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgacacctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ904426_SP_P-D Feature FT:CDS FJ904426_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacaacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ904427_SP_P-D Feature FT:CDS FJ904427_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggaaa
gaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ904429_SP_P-D Feature FT:CDS FJ904429_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B8). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ904431_SP_P-D Feature FT:CDS FJ904431_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B12). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ904432_SP_P-D Feature FT:CDS FJ904432_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B14). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctmgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ904433_SP_C-D Feature FT:CDS FJ904433_SP_C-D of [Viruses] Hepatitis B Virus genotype D (isolate B15). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagacgatctaaatctcgggaatstcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggatg
gaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ904435_SP_P-D Feature FT:CDS FJ904435_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B27). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagaggaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggatg
gaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ904438_SP_P-D Feature FT:CDS FJ904438_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B32). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggatg
gaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ904439_SP_P-D Feature FT:CDS FJ904439_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B34). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactgctgttgttagatcaagaagcaggtcccttagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcac
gggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggatg
gaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ904443_SP_P-D Feature FT:CDS FJ904443_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B46). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ904445_SP_P-D Feature FT:CDS FJ904445_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B62). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacaacgaggcaggttccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|FJ904446_SP_P-D Feature FT:CDS FJ904446_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B64a). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagttcactag
>gnl|hbvcds|GQ167301_SP_P-D Feature FT:CDS GQ167301_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate ZADGM452). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttcctgagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggactctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ167302_SP_P-D Feature FT:CDS GQ167302_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate ZADGM4521). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttcctgagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggactctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ183448_SP_P-D Feature FT:CDS GQ183448_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4629). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggattctcaatgatcttcaaccaccagcac
gggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ183449_SP_P-D Feature FT:CDS GQ183449_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4591). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ183450_SP_P-D Feature FT:CDS GQ183450_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4589). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ183451_SP_P-D Feature FT:CDS GQ183451_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4588). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ183452_SP_P-D Feature FT:CDS GQ183452_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4590). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ183453_SP_P-D Feature FT:CDS GQ183453_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4574). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ183454_SP_P-D Feature FT:CDS GQ183454_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4582). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ183455_SP_P-D Feature FT:CDS GQ183455_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4573). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ183456_SP_P-D Feature FT:CDS GQ183456_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4572). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ183457_SP_P-D Feature FT:CDS GQ183457_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4583). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ183458_SP_P-D Feature FT:CDS GQ183458_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4587). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ183459_SP_P-D Feature FT:CDS GQ183459_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4585). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ183460_SP_P-D Feature FT:CDS GQ183460_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4584). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ183461_SP_P-D Feature FT:CDS GQ183461_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4586). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ183462_SP_P-D Feature FT:CDS GQ183462_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4567). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ183463_SP_P-D Feature FT:CDS GQ183463_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4613). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ183464_SP_P-D Feature FT:CDS GQ183464_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4703). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ183465_SP_P-D Feature FT:CDS GQ183465_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4614). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ183466_SP_P-D Feature FT:CDS GQ183466_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4577). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ183467_SP_P-D Feature FT:CDS GQ183467_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4705). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ183468_SP_P-D Feature FT:CDS GQ183468_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4632). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ183469_SP_P-D Feature FT:CDS GQ183469_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4602). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ183470_SP_P-D Feature FT:CDS GQ183470_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4639). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ183471_SP_P-D Feature FT:CDS GQ183471_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4610). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgacttctgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ183472_SP_P-D Feature FT:CDS GQ183472_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4691). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgacaactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ183473_SP_P-D Feature FT:CDS GQ183473_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4601). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcctcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ183474_SP_P-D Feature FT:CDS GQ183474_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4594). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggagcctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ183475_SP_P-D Feature FT:CDS GQ183475_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4575). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaaaaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggagcctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ183476_SP_P-D Feature FT:CDS GQ183476_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4603). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggagcctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ183477_SP_P-D Feature FT:CDS GQ183477_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4604). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgacaactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ183478_SP_P-D Feature FT:CDS GQ183478_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4605). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ183479_SP_P-D Feature FT:CDS GQ183479_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4607). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggagcctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ183480_SP_P-D Feature FT:CDS GQ183480_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4609). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcgacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaccctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ183481_SP_P-D Feature FT:CDS GQ183481_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4569). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactactgttcaaggagcctctatgtatccctcttgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ183482_SP_P-D Feature FT:CDS GQ183482_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4570). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggagcctctatgtatccctcttgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ183483_SP_P-D Feature FT:CDS GQ183483_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4566). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggagcctctatgtatccctcttgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ183484_SP_P-D Feature FT:CDS GQ183484_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4598). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ183485_SP_P-D Feature FT:CDS GQ183485_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4599). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ184322_SP_P-D Feature FT:CDS GQ184322_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate ZADGM4522). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttcctgagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcgatcgccgcgtcgcagaagatctaaatctcgggactctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ205380_SP_P-D Feature FT:CDS GQ205380_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T1245). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcacggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ205382_SP_P-D Feature FT:CDS GQ205382_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T1360d). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgatcttcgaccaccagcac
gggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ205384_SP_P-D Feature FT:CDS GQ205384_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T1434d). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacggcgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgatcttcgaccaccagcac
gggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ205385_SP_P-D Feature FT:CDS GQ205385_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T1469). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgatcttcgaccaccagcac
gggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
aaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ205388_SP_P-D Feature FT:CDS GQ205388_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T1562). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgatcttcgaccaccagcac
gggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ205389_SP_P-D Feature FT:CDS GQ205389_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T1667). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgatcttcgaccaccagcac
gggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
aaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ377589_SP_P-D Feature FT:CDS GQ377589_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate J145). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ477452_SP_P-D Feature FT:CDS GQ477452_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P32). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ477453_SP_P-D Feature FT:CDS GQ477453_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P39). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttctgttgttagatgccgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctcgggactcccaatgatcttccaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcgtcctgggctttcggaaaattcctatgggaatgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ477454_SP_P-D Feature FT:CDS GQ477454_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P68). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaatgtactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcgtcaaccaccagcac
gggaacatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tttctcagttcactac
>gnl|hbvcds|GQ477455_SP_P-D Feature FT:CDS GQ477455_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P73). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcatgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ477456_SP_P-D Feature FT:CDS GQ477456_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P84). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagaggacgaggcaggtcccctagaagaagaactccctcg
cctcgcagaccaagatctaaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ477457_SP_P-D Feature FT:CDS GQ477457_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P118). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ477458_SP_P-D Feature FT:CDS GQ477458_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P126). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcttgctcaaggaacctctatgtatccctcctgttgctgtatcaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ477459_SP_P-D Feature FT:CDS GQ477459_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P127). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggcacctctatgtatccctcatgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ922000_SP_P-D Feature FT:CDS GQ922000_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 1B3552). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatcccaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ922001_SP_P-D Feature FT:CDS GQ922001_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 2B3654). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ922002_SP_P-D Feature FT:CDS GQ922002_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 1B3624). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ922003_SP_P-D Feature FT:CDS GQ922003_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 2B3225). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggatg
gaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ922004_SP_P-D Feature FT:CDS GQ922004_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 2B3284). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggatg
gaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ922005_SP_P-D Feature FT:CDS GQ922005_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 2B2894). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatccacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctcgggactctcaatgatcatcgaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcttgttgctgtacaaaaccttcggatg
gaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ924652_SP_P-D Feature FT:CDS GQ924652_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate M89). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GU357846_SP_P-D Feature FT:CDS GU357846_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Y10). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GU456635_SP_P-D Feature FT:CDS GU456635_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T26). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GU456636_SP_P-D Feature FT:CDS GU456636_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacaacgaggcaggtccactagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GU456637_SP_P-D Feature FT:CDS GU456637_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T49). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttgtcaacacttccggagacttgtgttgttagacgacgacgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcgtcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GU456638_SP_P-D Feature FT:CDS GU456638_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T35). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacaacgaggcaggttccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggaatgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU456639_SP_P-D Feature FT:CDS GU456639_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T129). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacaacgaggcaggtcccatagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcatgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GU456640_SP_P-D Feature FT:CDS GU456640_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T12). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GU456641_SP_P-D Feature FT:CDS GU456641_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T53). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaacctttggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GU456642_SP_P-D Feature FT:CDS GU456642_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T70). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccaaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GU456643_SP_P-D Feature FT:CDS GU456643_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T52). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagaggacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcaatttactag
>gnl|hbvcds|GU456644_SP_P-D Feature FT:CDS GU456644_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T58). Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaccttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GU456645_SP_P-D Feature FT:CDS GU456645_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T80). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgatcttcaacgaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GU456646_SP_P-D Feature FT:CDS GU456646_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T77). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcatgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GU456647_SP_P-D Feature FT:CDS GU456647_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T130). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatgtaaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GU456648_SP_P-D Feature FT:CDS GU456648_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T85). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GU456649_SP_P-D Feature FT:CDS GU456649_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T57). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GU456650_SP_P-D Feature FT:CDS GU456650_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T62). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GU456651_SP_P-D Feature FT:CDS GU456651_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T34). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctccatgatcttcaactaccagcac
gggaccatgcagaacttgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacatgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GU456652_SP_P-D Feature FT:CDS GU456652_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T44). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaatgcttccggagacttctgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GU456653_SP_P-D Feature FT:CDS GU456653_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T59). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GU456654_SP_P-D Feature FT:CDS GU456654_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T39). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacaacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactcccaatgatcgtcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GU456655_SP_P-D Feature FT:CDS GU456655_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T95). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GU456656_SP_P-D Feature FT:CDS GU456656_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T9). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgagtcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GU456657_SP_P-D Feature FT:CDS GU456657_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T83). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgatcttcaaccaccagcac
gggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GU456658_SP_P-D Feature FT:CDS GU456658_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T114). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GU456659_SP_P-D Feature FT:CDS GU456659_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T24). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactgctgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GU456660_SP_P-D Feature FT:CDS GU456660_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T64). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctagggaacctcaatgatcttcgaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GU456661_SP_P-D Feature FT:CDS GU456661_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T99). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacatgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GU456662_SP_P-D Feature FT:CDS GU456662_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T23). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GU456663_SP_P-D Feature FT:CDS GU456663_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T86). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GU456664_SP_P-D Feature FT:CDS GU456664_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T40). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacaacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GU456665_SP_P-D Feature FT:CDS GU456665_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T76). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacttgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactgg
>gnl|hbvcds|GU456666_SP_P-D Feature FT:CDS GU456666_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacttgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GU456667_SP_P-D Feature FT:CDS GU456667_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T120). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcatgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GU456668_SP_P-D Feature FT:CDS GU456668_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T21). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcgacacttccggagactactgttgttagacaacgaagcaggttccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GU456669_SP_P-D Feature FT:CDS GU456669_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T94). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagatcccgacgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GU456670_SP_P-D Feature FT:CDS GU456670_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T27). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GU456671_SP_P-D Feature FT:CDS GU456671_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T56). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GU456672_SP_P-D Feature FT:CDS GU456672_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T73). Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctggggtttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GU456673_SP_P-D Feature FT:CDS GU456673_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T75). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagaggacgacgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GU456674_SP_P-D Feature FT:CDS GU456674_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T16). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagacgaactccctcg
cctcgcagacgaagatctcaatcgccgcatcgcagaagatctcaatctcggggatctcaatgatcttcaacaaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcatgttgctgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GU456675_SP_P-D Feature FT:CDS GU456675_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T13). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU456676_SP_P-D Feature FT:CDS GU456676_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T98). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcatcacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GU456677_SP_P-D Feature FT:CDS GU456677_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T46). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GU456678_SP_P-D Feature FT:CDS GU456678_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T97). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatggtcttcgaccaccagcac
ggaacagtgcagaacctgcacgactcctgctcaaggaacctctatgtatctctcctgttgctgtacaaaaccttcgggag
gaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GU456679_SP_P-D Feature FT:CDS GU456679_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T63). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagaggacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GU456680_SP_P-D Feature FT:CDS GU456680_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T88). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GU456681_SP_P-D Feature FT:CDS GU456681_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T79). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GU456682_SP_P-D Feature FT:CDS GU456682_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T42). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacaacgaagcaggtcctctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttaggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GU456683_SP_P-D Feature FT:CDS GU456683_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T101). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GU456684_SP_P-D Feature FT:CDS GU456684_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T60). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcgtcaaccacaagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM750151_SP_P-D Feature FT:CDS HM750151_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GSD-8). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|HM750152_SP_P-D Feature FT:CDS HM750152_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate QHN-99). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaaaaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM750153_SP_P-D Feature FT:CDS HM750153_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate XJW-12). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccctcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM750154_SP_P-D Feature FT:CDS HM750154_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate XGW-23). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcttgttgctgtaccaaaccctcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM750155_SP_P-D Feature FT:CDS HM750155_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GSF-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcgtcaaccaccagcac
gggtccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HM750156_SP_P-D Feature FT:CDS HM750156_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GSF-12). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcgtcaaccaccagcac
gggtccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ236014_SP_P-D Feature FT:CDS HQ236014_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate RS1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ236015_SP_P-D Feature FT:CDS HQ236015_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate RS2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagacttgtgttgttagacgacgatgcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ236016_SP_P-D Feature FT:CDS HQ236016_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate RS3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgatcttcaaccaccagcac
gggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700439_SP_P-D Feature FT:CDS HQ700439_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_AD03_1999). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700440_SP_P-D Feature FT:CDS HQ700440_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_AD05_1984). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700441_SP_P-D Feature FT:CDS HQ700441_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_AN10_1984). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700442_SP_P-D Feature FT:CDS HQ700442_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_AN12_1984). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700443_SP_P-D Feature FT:CDS HQ700443_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_AN12_1999). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700444_SP_P-D Feature FT:CDS HQ700444_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_AN19_1984). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700445_SP_P-D Feature FT:CDS HQ700445_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_BU12_1984). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700446_SP_P-D Feature FT:CDS HQ700446_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_BU12_1999). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700447_SP_P-D Feature FT:CDS HQ700447_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_CH02_1984). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700448_SP_P-D Feature FT:CDS HQ700448_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_CH02_1999). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700449_SP_P-D Feature FT:CDS HQ700449_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_GE06_1984). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700450_SP_P-D Feature FT:CDS HQ700450_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_GE09_1984). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700451_SP_P-D Feature FT:CDS HQ700451_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_GI11_1984). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700454_SP_P-D Feature FT:CDS HQ700454_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_HA53_1984). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaacctttggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700455_SP_P-D Feature FT:CDS HQ700455_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_HA53_1999). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctygcaramgaaggtytcaatygccgcgtcgcaaaagatytcaatytcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaacctttggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700458_SP_P-D Feature FT:CDS HQ700458_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_HE35_1997). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcgaccacaagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgttgtacaaaaccttcggacg
gaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|HQ700459_SP_P-D Feature FT:CDS HQ700459_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_HE55_1993). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700463_SP_P-D Feature FT:CDS HQ700463_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_HI43_1984). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcttcaaccaccagcac
gggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700464_SP_P-D Feature FT:CDS HQ700464_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_KA40_1984). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700466_SP_P-D Feature FT:CDS HQ700466_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_MI26_1984). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700467_SP_P-D Feature FT:CDS HQ700467_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_MI26_1999). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700468_SP_P-D Feature FT:CDS HQ700468_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_MI27_1984). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700469_SP_P-D Feature FT:CDS HQ700469_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_MO59_1984). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700470_SP_P-D Feature FT:CDS HQ700470_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_MO59_1999). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700471_SP_P-D Feature FT:CDS HQ700471_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_MO70_1984). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700472_SP_P-D Feature FT:CDS HQ700472_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_MO77_1997). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttgtgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccactgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700473_SP_P-D Feature FT:CDS HQ700473_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_PA31_1984). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700474_SP_P-D Feature FT:CDS HQ700474_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_PA31_1999). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcatcacttccggagacttgtgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700477_SP_P-D Feature FT:CDS HQ700477_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_PE09_1984). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700478_SP_P-D Feature FT:CDS HQ700478_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_PE09_1994). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacaacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaaacaactctatgtatccctcatgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700479_SP_P-D Feature FT:CDS HQ700479_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_RA11_1984). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700480_SP_P-D Feature FT:CDS HQ700480_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_RA37_1984). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700481_SP_P-D Feature FT:CDS HQ700481_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_RA37_1999). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtatcaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700482_SP_P-D Feature FT:CDS HQ700482_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_TA40_1984). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700483_SP_P-D Feature FT:CDS HQ700483_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_TA120_1984). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700484_SP_P-D Feature FT:CDS HQ700484_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_TA229_1984). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700487_SP_P-D Feature FT:CDS HQ700487_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_TU25_1984). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700488_SP_P-D Feature FT:CDS HQ700488_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_WA13_1984). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700489_SP_P-D Feature FT:CDS HQ700489_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_WA13_1999). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggwcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggagcctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700510_SP_P-D Feature FT:CDS HQ700510_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NC_128225_2003). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacaacgacgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700511_SP_P-D Feature FT:CDS HQ700511_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NC_164317_2001). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700512_SP_P-D Feature FT:CDS HQ700512_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NC_182089_2001). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700513_SP_P-D Feature FT:CDS HQ700513_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NC_16600_2001). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700514_SP_P-D Feature FT:CDS HQ700514_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NC_1664337_2001). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ700553_SP_P-D Feature FT:CDS HQ700553_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_PE09_1999). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacaacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaaacaactctatgtatccctcatgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ833465_SP_P-D Feature FT:CDS HQ833465_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Xinjiang HB6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccctgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccctcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ833466_SP_P-D Feature FT:CDS HQ833466_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Xinjiang HB26). Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgakgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctyaatgatcttcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtacmaaaccctcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ833467_SP_P-D Feature FT:CDS HQ833467_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Xinjiang HB27). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaycaaaccctcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ833468_SP_P-D Feature FT:CDS HQ833468_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Xinjiang HB52). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgatcttcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccctcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ833469_SP_P-D Feature FT:CDS HQ833469_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Xinjiang HB79). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccctcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ833470_SP_P-D Feature FT:CDS HQ833470_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Xinjiang HB80). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccctcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|HQ833471_SP_P-D Feature FT:CDS HQ833471_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Xinjiang HB97). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccctcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JF439692_SP_P-D Feature FT:CDS JF439692_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN132). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcctctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcatgttgctgtatcaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggccttagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JF439693_SP_P-D Feature FT:CDS JF439693_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN133). Partial genome (Contains: HBe, HBc, HBx, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcctctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcatgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggccttagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JF439694_SP_P-D Feature FT:CDS JF439694_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN134). Partial genome (Contains: HBx, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcctctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccactgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctacgtatctctcatgttgctgtatcaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggccttagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JF439695_SP_P-D Feature FT:CDS JF439695_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN135). Partial genome (Contains: HBe, HBc, HBx, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcatgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggccttagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JF439696_SP_P-D Feature FT:CDS JF439696_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN136). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcctctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcatgttgctgtatcaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggccttagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JF439699_SP_P-D Feature FT:CDS JF439699_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN142). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcctctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcatgttgctgtatcaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggccttagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JF439700_SP_P-D Feature FT:CDS JF439700_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN143). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcctctaccctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactactgctcaaggaacctctatgtatccctcatgttgctgtatcaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggccttagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JF439701_SP_P-D Feature FT:CDS JF439701_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN144). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcctctaccctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactactgctcaaggaacctctatgtatccctcatgttgctgtatcaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggccttagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JF439702_SP_P-D Feature FT:CDS JF439702_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN145). Partial genome (Contains: HBx, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcatgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggccttagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JF439703_SP_P-D Feature FT:CDS JF439703_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN146). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcctctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcatgttgctgtatcaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggccttagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JF439704_SP_P-D Feature FT:CDS JF439704_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN149). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctaccctatcaacacttccggaaacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcatgttgctgtatcaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggccttagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JF439705_SP_P-D Feature FT:CDS JF439705_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN150). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctaccctatcaacacttccggaaacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcatgttgctgtatcaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggccttagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JF439706_SP_P-D Feature FT:CDS JF439706_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN152). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcctctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcatgttgctgtatcaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggccttagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JF439707_SP_P-D Feature FT:CDS JF439707_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN153). Partial genome (Contains: HBe, HBc, HBx, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcctctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcatgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggccttagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JF439708_SP_P-D Feature FT:CDS JF439708_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN154). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcctctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcatgttgctgtatcaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggccttagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JF439709_SP_P-D Feature FT:CDS JF439709_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN155). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcctctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcatgttgctgtatcaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggccttagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JF439710_SP_P-D Feature FT:CDS JF439710_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN156). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcctctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcatgttgctgtatcaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggccttagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JF439711_SP_P-D Feature FT:CDS JF439711_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN157). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcctctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcatgttgctgtatcaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggccttagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JF439712_SP_P-D Feature FT:CDS JF439712_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN158). Partial genome (Contains: HBe, HBc, HBx, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatctctcatgttgctgtatcaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggccttagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JF439713_SP_P-D Feature FT:CDS JF439713_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN159). Partial genome (Contains: HBx, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaaggactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatcccccatgttgctgtatcaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggccttagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JF439715_SP_P-D Feature FT:CDS JF439715_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN163). Partial genome (Contains: HBe, HBc, HBx, SHBs). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcatgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggccttagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JF439716_SP_P-D Feature FT:CDS JF439716_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN164). Partial genome (Contains: HBe, HBc, HBx, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaaccccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcatgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggccttagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JF439717_SP_P-D Feature FT:CDS JF439717_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN166). Partial genome (Contains: HBe, HBc, HBx, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagtac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcatgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggccttagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JF439718_SP_P-D Feature FT:CDS JF439718_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN167). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcctctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcatgttgctgtatcaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggccttagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JF439719_SP_P-D Feature FT:CDS JF439719_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN172). Partial genome (Contains: HBe, HBc, HBx, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcctctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcatgttgctgtatcaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggccttagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JF754588_SP_P-D Feature FT:CDS JF754588_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK61). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgacccctgctcaaggaacctctatgtatccctcatgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JF754590_SP_P-D Feature FT:CDS JF754590_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK41). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctagggaacctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JF754591_SP_P-D Feature FT:CDS JF754591_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK38). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgcacaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JF754592_SP_P-D Feature FT:CDS JF754592_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK64). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcac
gggaccctgccggacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JF754593_SP_P-D Feature FT:CDS JF754593_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK170). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttcttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagcttactag
>gnl|hbvcds|JF754594_SP_P-D Feature FT:CDS JF754594_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK165). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgagtcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JF754595_SP_P-D Feature FT:CDS JF754595_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK164). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JF754596_SP_P-D Feature FT:CDS JF754596_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK106). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JF754597_SP_P-D Feature FT:CDS JF754597_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK105). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JF754598_SP_P-D Feature FT:CDS JF754598_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK104). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JF754599_SP_P-D Feature FT:CDS JF754599_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK173). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcgtcaaccaccagcac
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccatcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JF754600_SP_P-D Feature FT:CDS JF754600_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK91). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactgctgttattagaccacgaggcaggtcccttagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcgtcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JF754601_SP_P-D Feature FT:CDS JF754601_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK88). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaacctttggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JF754602_SP_P-D Feature FT:CDS JF754602_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK83). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactgctgttgttagaccacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcttcaactaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JF754603_SP_P-D Feature FT:CDS JF754603_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK8). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcgtcaacaaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JF754604_SP_P-D Feature FT:CDS JF754604_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK79). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JF754605_SP_P-D Feature FT:CDS JF754605_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK77). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcttgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JF754606_SP_P-D Feature FT:CDS JF754606_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK73). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JF754607_SP_P-D Feature FT:CDS JF754607_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK67). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcatgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JF754608_SP_P-D Feature FT:CDS JF754608_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK63). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JF754609_SP_P-D Feature FT:CDS JF754609_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK45). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagattactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcgtcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JF754610_SP_P-D Feature FT:CDS JF754610_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK157). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JF754611_SP_P-D Feature FT:CDS JF754611_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK152). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaggctactgttattagaggacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcgactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaacctttggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|JF754612_SP_P-D Feature FT:CDS JF754612_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK148). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttgtgttattagacaacgaagcaggacctctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagacgatctcaatctcgggactctcaatgatcttcaaccaccagcac
gggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JF754614_SP_P-D Feature FT:CDS JF754614_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgaatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JF754615_SP_P-D Feature FT:CDS JF754615_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK141). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JF754617_SP_P-D Feature FT:CDS JF754617_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK131). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaatgcttccggagacttctgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JF754618_SP_P-D Feature FT:CDS JF754618_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK129). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcaaaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggccttagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JF754619_SP_P-D Feature FT:CDS JF754619_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK62). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacaacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggactctcaatgatcttcaaccaccagcac
gggaccatgccgaacatgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacg
gaaattgcacatgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JF754621_SP_P-D Feature FT:CDS JF754621_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK161). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactas
>gnl|hbvcds|JF754622_SP_P-D Feature FT:CDS JF754622_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK16). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JF754623_SP_P-D Feature FT:CDS JF754623_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK171). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcgtcaaccaccagcac
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccatcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JF754624_SP_P-D Feature FT:CDS JF754624_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK28). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|JF754625_SP_P-D Feature FT:CDS JF754625_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK25). Partial genome (Contains: HBe, HBc, HBx, SHBs). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttattagacaacgacgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagttcactag
>gnl|hbvcds|JF754626_SP_P-D Feature FT:CDS JF754626_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK23). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggactctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JF754627_SP_P-D Feature FT:CDS JF754627_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK37). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JF754628_SP_P-D Feature FT:CDS JF754628_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK32). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JF754629_SP_P-D Feature FT:CDS JF754629_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK176). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcttgctcaaggaacctctatgtatccctcctgttgttgtatcaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JF754630_SP_P-D Feature FT:CDS JF754630_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK175). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttgtcaacacttccggagactactgttattagacaacgagtcaggtcctctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JF754631_SP_P-D Feature FT:CDS JF754631_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK193). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactgctgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcttgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JF754632_SP_P-D Feature FT:CDS JF754632_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK186). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcctcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcatgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JF754633_SP_P-D Feature FT:CDS JF754633_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK128). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JF754634_SP_P-D Feature FT:CDS JF754634_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK12). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcttcgaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JF754635_SP_P-D Feature FT:CDS JF754635_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK113). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040750_SP_P-D Feature FT:CDS JN040750_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919078). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcttcaaccaccagcat
gggatcatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040751_SP_P-D Feature FT:CDS JN040751_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919047). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactattgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040752_SP_P-D Feature FT:CDS JN040752_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919033). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaatccttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcgaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040753_SP_P-D Feature FT:CDS JN040753_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919064). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccaaatgatcttcaaccaccagcac
gggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgaatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JN040754_SP_P-D Feature FT:CDS JN040754_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919045). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcac
gggatcatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040755_SP_P-D Feature FT:CDS JN040755_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919086). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgatccccaaccaccagcac
gggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040756_SP_P-D Feature FT:CDS JN040756_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919039). Partial genome (Contains: HBe, HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgatcttcaaccaccagcac
gggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcgtcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040757_SP_P-D Feature FT:CDS JN040757_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919056). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgacccctgctcaaggaacctctatgtatccctcatgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040758_SP_P-D Feature FT:CDS JN040758_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919037). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040759_SP_P-D Feature FT:CDS JN040759_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919063). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040760_SP_P-D Feature FT:CDS JN040760_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919059). Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040761_SP_P-D Feature FT:CDS JN040761_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919002). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacaacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040762_SP_P-D Feature FT:CDS JN040762_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919007). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040765_SP_P-D Feature FT:CDS JN040765_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919006). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaatacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040766_SP_P-D Feature FT:CDS JN040766_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919046). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgcctcgtcgcagaagatctcaatctagggaagctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgttcctcc
tggctcagtttactag
>gnl|hbvcds|JN040767_SP_P-D Feature FT:CDS JN040767_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919019). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctagggcatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|JN040768_SP_P-D Feature FT:CDS JN040768_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919051). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactagtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|JN040769_SP_P-D Feature FT:CDS JN040769_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919015). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagattactgttgttagacaacgaggcaggtcctctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040770_SP_P-D Feature FT:CDS JN040770_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919087). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040771_SP_P-D Feature FT:CDS JN040771_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919013). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttctgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040772_SP_P-D Feature FT:CDS JN040772_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919065). Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaaaatctcaatctcgggaatctcaatgatcatcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040773_SP_P-D Feature FT:CDS JN040773_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919084). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaattactgttgttagacaacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctccatctcggggatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|JN040774_SP_P-D Feature FT:CDS JN040774_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919088). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040775_SP_P-D Feature FT:CDS JN040775_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919049). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggattgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JN040776_SP_P-D Feature FT:CDS JN040776_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919043). Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttctgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040777_SP_P-D Feature FT:CDS JN040777_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919017). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaaacacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040778_SP_P-D Feature FT:CDS JN040778_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919038). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgcaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040779_SP_P-D Feature FT:CDS JN040779_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919070). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040780_SP_P-D Feature FT:CDS JN040780_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919072). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040781_SP_P-D Feature FT:CDS JN040781_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919029). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040782_SP_P-D Feature FT:CDS JN040782_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919041). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttctgttattagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctagggaatccagatgatcttcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040783_SP_P-D Feature FT:CDS JN040783_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919090). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgatgcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040784_SP_P-D Feature FT:CDS JN040784_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919030). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattcctatgggattgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JN040785_SP_P-D Feature FT:CDS JN040785_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919022). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040786_SP_P-D Feature FT:CDS JN040786_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919035). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggatcatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040787_SP_P-D Feature FT:CDS JN040787_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919040). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggatcatgcagaacctgcacgactcctgctcaaggaacctctatgactccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040788_SP_P-D Feature FT:CDS JN040788_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919024). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggatcatgcagaacctgcacgactcctgctcgaggaacctctatgtctccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040790_SP_P-D Feature FT:CDS JN040790_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919054). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcaatttactag
>gnl|hbvcds|JN040791_SP_P-D Feature FT:CDS JN040791_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919082). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcaggttccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040792_SP_P-D Feature FT:CDS JN040792_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919079). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacaacgaggcaggttccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040793_SP_P-D Feature FT:CDS JN040793_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919083). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcaggttccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040794_SP_P-D Feature FT:CDS JN040794_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919075). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040795_SP_P-D Feature FT:CDS JN040795_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919003). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctccatctcggggatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040796_SP_P-D Feature FT:CDS JN040796_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919018). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggagtgtactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040797_SP_P-D Feature FT:CDS JN040797_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919021). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040799_SP_P-D Feature FT:CDS JN040799_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919080). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040800_SP_P-D Feature FT:CDS JN040800_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919012). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcgatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040801_SP_P-D Feature FT:CDS JN040801_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919042). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcgatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040802_SP_P-D Feature FT:CDS JN040802_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919074). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagaggacgacgcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctagggaatctcaatgatcttcaactaccagtac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaacctttggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040804_SP_P-D Feature FT:CDS JN040804_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919028). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=333 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatcttcaaataccagcacggg
accatgcagaacctgcacgactactgctcaaggaacctctacgtatccctcctgttgctgtaccaaaccttcggacggaa
attgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcatgg
ctcagtttactag
>gnl|hbvcds|JN040805_SP_P-D Feature FT:CDS JN040805_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919058). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040806_SP_P-D Feature FT:CDS JN040806_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919066). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgagacaggttccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040807_SP_P-D Feature FT:CDS JN040807_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919034). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctggggtttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040808_SP_P-D Feature FT:CDS JN040808_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919011). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcatcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040809_SP_P-D Feature FT:CDS JN040809_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919014). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040810_SP_P-D Feature FT:CDS JN040810_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919060). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgctgctgtacaaaacctttggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040811_SP_P-D Feature FT:CDS JN040811_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919048). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040812_SP_P-D Feature FT:CDS JN040812_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919027). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgatcttcaacaaccagcac
gggaccatgcagaacttgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040813_SP_P-D Feature FT:CDS JN040813_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919025). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040814_SP_P-D Feature FT:CDS JN040814_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919032). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggggtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JN040815_SP_P-D Feature FT:CDS JN040815_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919073). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtatcaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040816_SP_P-D Feature FT:CDS JN040816_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919016). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagacgaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtatcaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040817_SP_P-D Feature FT:CDS JN040817_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919020). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtatcaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040818_SP_P-D Feature FT:CDS JN040818_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919081). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacaacgaggcaggtccactagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcgtcaacaaccagcac
gggaccatgcaggacctgcaccactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040819_SP_P-D Feature FT:CDS JN040819_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919067). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040820_SP_P-D Feature FT:CDS JN040820_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919010). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcgtcaactaccagcac
gggaccatgcagaacctgcacgactcttgctcaaggaacctctatgtatccctcctgttgctgtatcaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggactgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JN040821_SP_P-D Feature FT:CDS JN040821_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919085). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040822_SP_P-D Feature FT:CDS JN040822_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919044). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctca
tggctcagttttctag
>gnl|hbvcds|JN040823_SP_P-D Feature FT:CDS JN040823_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919005). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040824_SP_P-D Feature FT:CDS JN040824_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919071). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaaaatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040826_SP_P-D Feature FT:CDS JN040826_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919055). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|JN040827_SP_P-D Feature FT:CDS JN040827_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919008). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgacgcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040828_SP_P-D Feature FT:CDS JN040828_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919069). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcatgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040829_SP_P-D Feature FT:CDS JN040829_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919089). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN040830_SP_P-D Feature FT:CDS JN040830_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919052). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN257148_SP_P-D Feature FT:CDS JN257148_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHAMF). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgatcatcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JN257149_SP_P-D Feature FT:CDS JN257149_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHSFN). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggycccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcaraacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN257150_SP_P-D Feature FT:CDS JN257150_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHABS). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaycatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgctgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN257151_SP_P-D Feature FT:CDS JN257151_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHHHR). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN257152_SP_P-D Feature FT:CDS JN257152_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHRJB). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN257153_SP_P-D Feature FT:CDS JN257153_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHHRS1). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcaggacctgcacgacgcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN257155_SP_P-D Feature FT:CDS JN257155_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHJHM1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN257159_SP_P-D Feature FT:CDS JN257159_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHMRW). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcycaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgttyctcc
tggctcagtttactag
>gnl|hbvcds|JN257160_SP_P-D Feature FT:CDS JN257160_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHATR1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgcckcgtcgcagamgatctaaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcttgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN257161_SP_P-D Feature FT:CDS JN257161_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHATR2). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgcckcgtcgcagamgatctaaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcttgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN257162_SP_P-D Feature FT:CDS JN257162_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHSDQ). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcytcaacwaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN257163_SP_P-D Feature FT:CDS JN257163_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHAZI). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcac
gggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtatccctcctgctgctgtaccaaacctttggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN257165_SP_P-D Feature FT:CDS JN257165_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHHLL1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttcttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgctgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN257166_SP_P-D Feature FT:CDS JN257166_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHHLL2). Partial genome (Contains: HBe, HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttcttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgctgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN257167_SP_P-D Feature FT:CDS JN257167_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHHMM1). Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctaygtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN257169_SP_P-D Feature FT:CDS JN257169_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHAFF). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN257170_SP_P-D Feature FT:CDS JN257170_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHJWB). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgctgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN257171_SP_P-D Feature FT:CDS JN257171_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHKML). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgctgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN257172_SP_P-D Feature FT:CDS JN257172_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHMYD1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcgacacttccggagactactgttattagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgttgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN257173_SP_P-D Feature FT:CDS JN257173_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHMYD2). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcgacacttccggagactactgttattagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgttgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN257176_SP_P-D Feature FT:CDS JN257176_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHFRJ1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacgtgaatrmtcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN257177_SP_P-D Feature FT:CDS JN257177_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHFRJ2). Complete genome. [Hepadnaviridae] (length=339 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacaacatcaatrmtcttcaaccaccag
cacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcgg
acggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttc
tcctggctcagtttactag
>gnl|hbvcds|JN257178_SP_P-D Feature FT:CDS JN257178_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHTRK). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactrctgttgttagacgacgakgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgy
gggaccatgcagaacctgcacgactactgctcaargaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN257179_SP_P-D Feature FT:CDS JN257179_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHMJD1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN257181_SP_P-D Feature FT:CDS JN257181_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHNDA). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
gggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN257182_SP_P-D Feature FT:CDS JN257182_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHMSL). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|JN257183_SP_P-D Feature FT:CDS JN257183_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHKSH). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN257185_SP_P-D Feature FT:CDS JN257185_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHZYD). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN257186_SP_P-D Feature FT:CDS JN257186_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHDHM). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagattactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaacgaccagcac
gggamcatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JN257187_SP_P-D Feature FT:CDS JN257187_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHMLL1). Partial genome (Contains: HBe, HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaycatgcagaacctgcacgactcctgctcaaggaacctctatgtmtccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN257188_SP_P-D Feature FT:CDS JN257188_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHMLL2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaycatgcagaacctgcacgactcctgctcaaggaacctctatgtmtccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN257190_SP_P-D Feature FT:CDS JN257190_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHYHY). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatctccgcgtcgcagaagatctcaatctagggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggrgtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN257193_SP_P-D Feature FT:CDS JN257193_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHRKN1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN257194_SP_P-D Feature FT:CDS JN257194_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHRKN2). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN257195_SP_P-D Feature FT:CDS JN257195_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHHRS2). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcaggacctgcacgacgcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN257196_SP_P-D Feature FT:CDS JN257196_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHABR1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaargaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN257199_SP_P-D Feature FT:CDS JN257199_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHSOD2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcttgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN257200_SP_P-D Feature FT:CDS JN257200_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHMNM). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaatctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagttcactag
>gnl|hbvcds|JN257201_SP_P-D Feature FT:CDS JN257201_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHFAD). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN257202_SP_P-D Feature FT:CDS JN257202_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHSLI). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaacgaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN257203_SP_P-D Feature FT:CDS JN257203_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHJKF). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcgaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagttcactag
>gnl|hbvcds|JN257205_SP_P-D Feature FT:CDS JN257205_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHRYD). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN257209_SP_P-D Feature FT:CDS JN257209_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHAMR2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN257211_SP_P-D Feature FT:CDS JN257211_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHBRH1). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtacmaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN257214_SP_P-D Feature FT:CDS JN257214_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHJDR1). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgygtcgcagaagatctmaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgkttccctcctgttgctgtaccaaaccttcggacg
raaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcm
tggctcagtttactag
>gnl|hbvcds|JN257215_SP_P-D Feature FT:CDS JN257215_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHJDR2). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgygtcgcagaagatctmaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgkttccctcctgttgctgtaccaaaccttcggacg
raaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcm
tggctcagtttactag
>gnl|hbvcds|JN642126_SP_P-D Feature FT:CDS JN642126_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb9). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN642128_SP_P-D Feature FT:CDS JN642128_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb11). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttcccgagactactgttattagatgccgaggcagggcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcaaaacctgcacgactcctgcacaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggggtgggtctcagcccgtttctcc
tggctcaatttactag
>gnl|hbvcds|JN642129_SP_P-D Feature FT:CDS JN642129_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb12). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacaaagacgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaacaaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcttgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN642130_SP_P-D Feature FT:CDS JN642130_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb13). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN642131_SP_P-D Feature FT:CDS JN642131_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb16). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN642132_SP_P-D Feature FT:CDS JN642132_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb18). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctagggaatctcactgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN642133_SP_P-D Feature FT:CDS JN642133_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb21). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcatcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaaactcttcgtatccctcctgttgctgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN642134_SP_P-D Feature FT:CDS JN642134_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb22). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgccgagtcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaacatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccgtcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN642135_SP_P-D Feature FT:CDS JN642135_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb24). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacaacaacgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcagtctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctgctgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN642136_SP_P-D Feature FT:CDS JN642136_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb25). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcgaccaccagcac
gggaccatgcagaacatgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN642138_SP_P-D Feature FT:CDS JN642138_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb28). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcgacgaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcactttactag
>gnl|hbvcds|JN642140_SP_P-D Feature FT:CDS JN642140_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb30). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagaccacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN642142_SP_P-D Feature FT:CDS JN642142_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb32). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|JN642143_SP_P-D Feature FT:CDS JN642143_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb33). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgttgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN642144_SP_P-D Feature FT:CDS JN642144_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb34). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaattactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN642145_SP_P-D Feature FT:CDS JN642145_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb36). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtcgccatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN642146_SP_P-D Feature FT:CDS JN642146_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb38). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN642147_SP_P-D Feature FT:CDS JN642147_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb39). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttcccgagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcgaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgctgttgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN642148_SP_P-D Feature FT:CDS JN642148_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb40). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN642149_SP_P-D Feature FT:CDS JN642149_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb41). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN642150_SP_P-D Feature FT:CDS JN642150_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb43). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN642151_SP_P-D Feature FT:CDS JN642151_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb44). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN642153_SP_P-D Feature FT:CDS JN642153_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb47). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcac
gggaccctgcaaaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN642154_SP_P-D Feature FT:CDS JN642154_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb48). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacaacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN642155_SP_P-D Feature FT:CDS JN642155_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb49). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgctgctgtaccaaacctttggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN642156_SP_P-D Feature FT:CDS JN642156_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb50). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgatcgtcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN642157_SP_P-D Feature FT:CDS JN642157_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb51). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagaggacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctccatctcggggatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN642158_SP_P-D Feature FT:CDS JN642158_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb57). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctatatgtatccctcatgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN642159_SP_P-D Feature FT:CDS JN642159_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb52). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgttgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN642161_SP_P-D Feature FT:CDS JN642161_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb54). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaactaccagcac
gggaccatgcagaacttgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN642162_SP_P-D Feature FT:CDS JN642162_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb58). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN642163_SP_P-D Feature FT:CDS JN642163_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb59). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgaactgcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN642164_SP_P-D Feature FT:CDS JN642164_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb60). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN642165_SP_P-D Feature FT:CDS JN642165_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb17). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgacgcaggacccttagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgctgctgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN642166_SP_P-D Feature FT:CDS JN642166_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb35). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccttagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgatcttcaaccaccagcac
gggatcatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN642167_SP_P-D Feature FT:CDS JN642167_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb37). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccacgtcgcagaagaactcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN664909_SP_P-D Feature FT:CDS JN664909_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate THB36_IC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN664910_SP_P-D Feature FT:CDS JN664910_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate THB43_IC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
gggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN664911_SP_P-D Feature FT:CDS JN664911_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate THB47_IC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
gggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN664912_SP_P-D Feature FT:CDS JN664912_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate THB49_IC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaacctgccgaacctgcatgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggatg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|JN664913_SP_P-D Feature FT:CDS JN664913_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EN01_IC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcgtcgaccaccagcac
gggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN664914_SP_P-D Feature FT:CDS JN664914_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EN48_IC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
gggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN664917_SP_P-D Feature FT:CDS JN664917_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SKR_IC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
gggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN664918_SP_P-D Feature FT:CDS JN664918_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T2198_IC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcgtcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN664919_SP_P-D Feature FT:CDS JN664919_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T2320_IC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgcaaaacctgcacgactcctgctcacggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN664920_SP_P-D Feature FT:CDS JN664920_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T1903_IC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN664921_SP_P-D Feature FT:CDS JN664921_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EN47_IC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcgtcgaccaccagcac
gggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN664922_SP_P-D Feature FT:CDS JN664922_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate DH01_IC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
gggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN664924_SP_P-D Feature FT:CDS JN664924_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EN32_CHB). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttgtgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcttcgaccaccagcac
gggaccatgccgcacctgcatgaccactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN664926_SP_P-D Feature FT:CDS JN664926_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EN63_CHB). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcgaccaccagcac
gggaccatgccgcacttgcatgactactgctcaaggaacctctatgtttccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcgtcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN664927_SP_P-D Feature FT:CDS JN664927_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HE20_CHB). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JN664928_SP_P-D Feature FT:CDS JN664928_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HE27_CHB). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN664930_SP_P-D Feature FT:CDS JN664930_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HEN9_CHB). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN664931_SP_P-D Feature FT:CDS JN664931_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate THB6_CHB). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN664932_SP_P-D Feature FT:CDS JN664932_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T2235_CHB). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcgaccaccagcac
gggaccatgcagaacttgcataaccactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN664936_SP_P-D Feature FT:CDS JN664936_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate E3529_LC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
gggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN664937_SP_P-D Feature FT:CDS JN664937_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EN45_LC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
gggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN664938_SP_P-D Feature FT:CDS JN664938_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EN46_LC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
gggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN664939_SP_P-D Feature FT:CDS JN664939_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EN71_LC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN664941_SP_P-D Feature FT:CDS JN664941_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate THB21_LC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgacgactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|JN664947_SP_P-D Feature FT:CDS JN664947_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate THB41_LC). Partial genome (Contains: HBe, HBc, HBx, SHBs). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcttcgaccaccagcac
gggaccatgcagaacctgcatgactactgctcaaggagcctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcgtcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN664948_SP_P-D Feature FT:CDS JN664948_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EN64_LC). Partial genome (Contains: HBe, HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN688678_SP_P-D Feature FT:CDS JN688678_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV007). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagattgttgttgttagacgacgaggcaggacccytagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaaccaccagcac
gggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN688679_SP_P-D Feature FT:CDS JN688679_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV010). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN688683_SP_P-D Feature FT:CDS JN688683_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV087). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagacttgtgttgttaaacaacaaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgttgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN688685_SP_P-D Feature FT:CDS JN688685_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV097). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN688695_SP_P-D Feature FT:CDS JN688695_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV128). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccatagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcgaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN688708_SP_P-D Feature FT:CDS JN688708_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV142). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN688710_SP_P-D Feature FT:CDS JN688710_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV144). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagaccaaggtctcaatcaccgcgtcgcagaagatctcaatctcggggatctcaatgatcatcaaccaccagcac
gggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN688711_SP_P-D Feature FT:CDS JN688711_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV161). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccgtagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccctgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacatgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN688712_SP_P-D Feature FT:CDS JN688712_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV163). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttattagaagacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaactctcgggactctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcttgctcaaggaacctctatgtatccctcttgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggggtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN688713_SP_P-D Feature FT:CDS JN688713_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV173). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgagaaggcaggtcccctagaagaagaactccctcg
cctagcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcttgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN688722_SP_P-D Feature FT:CDS JN688722_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV228). Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
gggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN792903_SP_P-D Feature FT:CDS JN792903_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 310000127). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN792904_SP_P-D Feature FT:CDS JN792904_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 111002943). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacttgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN792905_SP_P-D Feature FT:CDS JN792905_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 312000345). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcac
gggaccatgcagaacttgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttaggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN792906_SP_P-D Feature FT:CDS JN792906_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 111002958). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacttgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN792907_SP_P-D Feature FT:CDS JN792907_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 312000473). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagaccaaggtctaaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcac
gggaccatgcaggacttgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN792908_SP_P-D Feature FT:CDS JN792908_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 111002951). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagaccaaggtctaaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcac
gggaccatgcaggacttgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN792909_SP_P-D Feature FT:CDS JN792909_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 312000479). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN792910_SP_P-D Feature FT:CDS JN792910_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 109001205). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN792911_SP_P-D Feature FT:CDS JN792911_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 111002952). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaacaagaactccctcg
cctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JN792912_SP_P-D Feature FT:CDS JN792912_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 307000449). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaacaagaactccctcg
cctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ687530_SP_P-D Feature FT:CDS JQ687530_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Srb 200). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctaaaagaagaactccctcg
cctcgcaaacgaagatctcaatcgccgcgtcgcaaaagatctcaatctcgggaatctcaatgatcttcaacaaccagcgc
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ687531_SP_P-D Feature FT:CDS JQ687531_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Srb 205). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgatcatcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ707476_SP_P-D Feature FT:CDS JQ707476_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ707477_SP_P-D Feature FT:CDS JQ707477_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C11). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ707478_SP_P-D Feature FT:CDS JQ707478_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C12). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ707479_SP_P-D Feature FT:CDS JQ707479_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C13). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgaccactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ707480_SP_P-D Feature FT:CDS JQ707480_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C14). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ707481_SP_P-D Feature FT:CDS JQ707481_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C16). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ707482_SP_P-D Feature FT:CDS JQ707482_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C17-2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ707483_SP_P-D Feature FT:CDS JQ707483_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C18). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ707484_SP_P-D Feature FT:CDS JQ707484_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C19). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ707485_SP_P-D Feature FT:CDS JQ707485_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C22). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgaccactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ707486_SP_P-D Feature FT:CDS JQ707486_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C24). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ707487_SP_P-D Feature FT:CDS JQ707487_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C25). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacttctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ707488_SP_P-D Feature FT:CDS JQ707488_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C26). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ707489_SP_P-D Feature FT:CDS JQ707489_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C28). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcgacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ707490_SP_P-D Feature FT:CDS JQ707490_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C29). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcaggacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ707491_SP_P-D Feature FT:CDS JQ707491_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C3). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgatgcaggtcccgtagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttcccc
tggctcagtttactag
>gnl|hbvcds|JQ707492_SP_P-D Feature FT:CDS JQ707492_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C30). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ707493_SP_P-D Feature FT:CDS JQ707493_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C31). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgagcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ707494_SP_P-D Feature FT:CDS JQ707494_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C32). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ707495_SP_P-D Feature FT:CDS JQ707495_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C33). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ707496_SP_P-D Feature FT:CDS JQ707496_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C34-2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ707497_SP_P-D Feature FT:CDS JQ707497_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C36). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacaattccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccttttctcc
tggctcagtttactag
>gnl|hbvcds|JQ707498_SP_P-D Feature FT:CDS JQ707498_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C37). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ707499_SP_P-D Feature FT:CDS JQ707499_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C38). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgaccactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ707500_SP_P-D Feature FT:CDS JQ707500_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C40). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ707501_SP_P-D Feature FT:CDS JQ707501_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C41). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ707502_SP_P-D Feature FT:CDS JQ707502_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C42). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ707503_SP_P-D Feature FT:CDS JQ707503_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C43). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ707504_SP_P-D Feature FT:CDS JQ707504_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C44). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ707505_SP_P-D Feature FT:CDS JQ707505_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C45). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ707506_SP_P-D Feature FT:CDS JQ707506_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C46). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ707507_SP_P-D Feature FT:CDS JQ707507_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C48). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ707508_SP_P-D Feature FT:CDS JQ707508_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ707509_SP_P-D Feature FT:CDS JQ707509_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C7). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ707510_SP_P-D Feature FT:CDS JQ707510_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C8). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggcccagtttactag
>gnl|hbvcds|JQ707511_SP_P-D Feature FT:CDS JQ707511_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C9). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcat
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggtctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ707512_SP_P-D Feature FT:CDS JQ707512_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C1-22). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707513_SP_P-D Feature FT:CDS JQ707513_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C11). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggattgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707514_SP_P-D Feature FT:CDS JQ707514_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C12). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707515_SP_P-D Feature FT:CDS JQ707515_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C13). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707516_SP_P-D Feature FT:CDS JQ707516_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C15). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707517_SP_P-D Feature FT:CDS JQ707517_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C16). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggactgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707518_SP_P-D Feature FT:CDS JQ707518_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C17-3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707519_SP_P-D Feature FT:CDS JQ707519_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C22). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707520_SP_P-D Feature FT:CDS JQ707520_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C24). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707521_SP_P-D Feature FT:CDS JQ707521_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C32). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707522_SP_P-D Feature FT:CDS JQ707522_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C35). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707523_SP_P-D Feature FT:CDS JQ707523_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C36). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707524_SP_P-D Feature FT:CDS JQ707524_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707525_SP_P-D Feature FT:CDS JQ707525_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C40). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707526_SP_P-D Feature FT:CDS JQ707526_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C43). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707527_SP_P-D Feature FT:CDS JQ707527_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C44). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JQ707528_SP_P-D Feature FT:CDS JQ707528_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C45). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707529_SP_P-D Feature FT:CDS JQ707529_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C46). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707530_SP_P-D Feature FT:CDS JQ707530_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C9). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707682_SP_P-D Feature FT:CDS JQ707682_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_1-10). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgattactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggaca
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707683_SP_P-D Feature FT:CDS JQ707683_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_10). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgattattgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggaca
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707684_SP_P-D Feature FT:CDS JQ707684_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_11). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgattactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggaca
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707685_SP_P-D Feature FT:CDS JQ707685_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_12). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgattactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggaca
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707686_SP_P-D Feature FT:CDS JQ707686_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_14). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgattactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggaca
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707687_SP_P-D Feature FT:CDS JQ707687_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_15). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgattactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggaca
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707688_SP_P-D Feature FT:CDS JQ707688_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_16). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgattactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggaca
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707689_SP_P-D Feature FT:CDS JQ707689_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_17). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccaacgc
gagaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaactttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707690_SP_P-D Feature FT:CDS JQ707690_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_20). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgattactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggaca
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707691_SP_P-D Feature FT:CDS JQ707691_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_25). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgattactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggaca
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707692_SP_P-D Feature FT:CDS JQ707692_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_26). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgattactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggaca
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707693_SP_P-D Feature FT:CDS JQ707693_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_27). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgattactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggaca
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707694_SP_P-D Feature FT:CDS JQ707694_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_28). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgattactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggaca
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707695_SP_P-D Feature FT:CDS JQ707695_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_29). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgattactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggaca
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707696_SP_P-D Feature FT:CDS JQ707696_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgattactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggaca
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707697_SP_P-D Feature FT:CDS JQ707697_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_30). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgattactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggaca
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707698_SP_P-D Feature FT:CDS JQ707698_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_32). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgattactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggaca
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707699_SP_P-D Feature FT:CDS JQ707699_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_35). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgattactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggaca
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707700_SP_P-D Feature FT:CDS JQ707700_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_36-11). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgattactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggaca
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707701_SP_P-D Feature FT:CDS JQ707701_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_37). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgattactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggaca
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707702_SP_P-D Feature FT:CDS JQ707702_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_43). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgattactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggaca
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707703_SP_P-D Feature FT:CDS JQ707703_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_45). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgattactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggaca
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707704_SP_P-D Feature FT:CDS JQ707704_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgattactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggaca
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707705_SP_P-D Feature FT:CDS JQ707705_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgattactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggaca
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707706_SP_P-D Feature FT:CDS JQ707706_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_8-2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgattactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggaca
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ927384_SP_P-D Feature FT:CDS JQ927384_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate KM2109). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttgtgttrttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggatg
gaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JX096954_SP_P-D Feature FT:CDS JX096954_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 1-3242). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JX096955_SP_P-D Feature FT:CDS JX096955_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 2-3051). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgacttctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcaatttactag
>gnl|hbvcds|JX096956_SP_P-D Feature FT:CDS JX096956_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 5-6154). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JX096957_SP_P-D Feature FT:CDS JX096957_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 6-2646). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JX096958_SP_P-D Feature FT:CDS JX096958_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 7-1276). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcatgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JX310733_SP_P-D Feature FT:CDS JX310733_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D23_1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcat
gggaacatgcagaggctgcacgactcctgctccaggaacctctatgtatccctcctgttgctgtaccaaaccttcggama
gaaattgcacctgtattcccatcccatcatcatgggctttcggaagattcctatgggrgtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JX310734_SP_P-D Feature FT:CDS JX310734_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D23_3). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctctaggaacctctatgtatccctcctgttgctgtaccaaaattttggaaa
aaaattgcacctgtattcccatcccatcatcatgggctttcggaagattcctatgggagtgggcctcagcccgtttctcc
tggctcagttcactag
>gnl|hbvcds|JX310735_SP_P-D Feature FT:CDS JX310735_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D23_4). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaactaccagcac
gggacaatgcaaaacctgcacgactcttgctctaggaacctctatgtatccctcctgttgctgtaccaaaccttcggaca
gaaattgcacctgtattcccatcccatcatcatgggctttcggaagattcctatgggagtgggcctcagcccgtttctcc
tggctcagttcactag
>gnl|hbvcds|JX470760_SP_P-D Feature FT:CDS JX470760_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H-IDU6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcagcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaacctttggacg
gaaattgcacctgtattcrcatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JX898689_SP_P-D Feature FT:CDS JX898689_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P29). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JX898691_SP_P-D Feature FT:CDS JX898691_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P17). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaacctttggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JX898692_SP_P-D Feature FT:CDS JX898692_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P19). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaacctttggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JX898694_SP_P-D Feature FT:CDS JX898694_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P24). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactactgctcaaggaacctctatgtatccctactgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|JX898697_SP_P-D Feature FT:CDS JX898697_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P32). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC012652_SP_P-D Feature FT:CDS KC012652_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcagcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaacctttggacg
gaaattgcacctgtattcrcatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774436_SP_P-D Feature FT:CDS KC774436_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate dww1008). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774437_SP_P-D Feature FT:CDS KC774437_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate dww1009). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774440_SP_P-D Feature FT:CDS KC774440_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate dww1028). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774444_SP_P-D Feature FT:CDS KC774444_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate dww1038). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774445_SP_P-D Feature FT:CDS KC774445_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate dww1040). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcaaacgaaggtctcaatcgccgcgtcgcaaaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774459_SP_P-D Feature FT:CDS KC774459_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate dww1111). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggatg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774460_SP_P-D Feature FT:CDS KC774460_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate dww1112). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774462_SP_P-D Feature FT:CDS KC774462_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate dxa2047). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccctcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC774477_SP_P-D Feature FT:CDS KC774477_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate dxn1031). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcgtcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875275_SP_P-D Feature FT:CDS KC875275_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV39). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875276_SP_P-D Feature FT:CDS KC875276_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagtctactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcatgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875277_SP_P-D Feature FT:CDS KC875277_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875278_SP_P-D Feature FT:CDS KC875278_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV38). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875279_SP_P-D Feature FT:CDS KC875279_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV11). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccattcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875280_SP_P-D Feature FT:CDS KC875280_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV20). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcatgactactgctcaaggaccctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875281_SP_P-D Feature FT:CDS KC875281_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV32). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875282_SP_P-D Feature FT:CDS KC875282_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV13). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcatgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875283_SP_P-D Feature FT:CDS KC875283_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV15). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875284_SP_P-D Feature FT:CDS KC875284_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV28). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875285_SP_P-D Feature FT:CDS KC875285_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV29). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875286_SP_P-D Feature FT:CDS KC875286_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV17). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875287_SP_P-D Feature FT:CDS KC875287_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV18). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875288_SP_P-D Feature FT:CDS KC875288_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV56). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactattgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875289_SP_P-D Feature FT:CDS KC875289_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV55). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacaacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875290_SP_P-D Feature FT:CDS KC875290_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV57). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactattgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875291_SP_P-D Feature FT:CDS KC875291_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV58). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875292_SP_P-D Feature FT:CDS KC875292_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV21). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaacctttggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875293_SP_P-D Feature FT:CDS KC875293_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV69). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactattgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875294_SP_P-D Feature FT:CDS KC875294_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV70). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactattgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875295_SP_P-D Feature FT:CDS KC875295_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV81). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875296_SP_P-D Feature FT:CDS KC875296_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV82). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactattgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875297_SP_P-D Feature FT:CDS KC875297_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV84). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacaacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875298_SP_P-D Feature FT:CDS KC875298_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV76). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875299_SP_P-D Feature FT:CDS KC875299_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV85). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgactcttgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875300_SP_P-D Feature FT:CDS KC875300_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV80). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875301_SP_P-D Feature FT:CDS KC875301_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV89). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgactcctgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875302_SP_P-D Feature FT:CDS KC875302_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV86). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcatgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875303_SP_P-D Feature FT:CDS KC875303_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV92). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcatgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875304_SP_P-D Feature FT:CDS KC875304_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV91). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875305_SP_P-D Feature FT:CDS KC875305_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV41). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactattgctcaaggaacctctatgaatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875306_SP_P-D Feature FT:CDS KC875306_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV71). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactattgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875307_SP_P-D Feature FT:CDS KC875307_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV74). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactattgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875308_SP_P-D Feature FT:CDS KC875308_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV72). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactattgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875309_SP_P-D Feature FT:CDS KC875309_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV43). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactattgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875310_SP_P-D Feature FT:CDS KC875310_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV9). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcgcctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctaagtttactag
>gnl|hbvcds|KC875311_SP_P-D Feature FT:CDS KC875311_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV10). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcatgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875312_SP_P-D Feature FT:CDS KC875312_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV22). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacaacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875313_SP_P-D Feature FT:CDS KC875313_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV25). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgcacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875314_SP_P-D Feature FT:CDS KC875314_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV2). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgcgctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875315_SP_P-D Feature FT:CDS KC875315_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV8). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875316_SP_P-D Feature FT:CDS KC875316_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV16). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacgtctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875317_SP_P-D Feature FT:CDS KC875317_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV48). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875318_SP_P-D Feature FT:CDS KC875318_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV40). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875319_SP_P-D Feature FT:CDS KC875319_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV30). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgcacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875320_SP_P-D Feature FT:CDS KC875320_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV31). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875321_SP_P-D Feature FT:CDS KC875321_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV19). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875322_SP_P-D Feature FT:CDS KC875322_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV54). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875323_SP_P-D Feature FT:CDS KC875323_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV53). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875324_SP_P-D Feature FT:CDS KC875324_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV59). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcaggtcccccagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875325_SP_P-D Feature FT:CDS KC875325_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV60). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgcacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875326_SP_P-D Feature FT:CDS KC875326_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV37). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcctcaaccaccagcac
gggaccatgccgcacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875328_SP_P-D Feature FT:CDS KC875328_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV83). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875329_SP_P-D Feature FT:CDS KC875329_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV90). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactattgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875330_SP_P-D Feature FT:CDS KC875330_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV87). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctagggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875331_SP_P-D Feature FT:CDS KC875331_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV88). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875332_SP_P-D Feature FT:CDS KC875332_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV42). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875333_SP_P-D Feature FT:CDS KC875333_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV75). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcctcaaccaccagcac
gggaccatgccgcacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875334_SP_P-D Feature FT:CDS KC875334_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV47). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgcacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875335_SP_P-D Feature FT:CDS KC875335_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV44). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875336_SP_P-D Feature FT:CDS KC875336_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV45). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875337_SP_P-D Feature FT:CDS KC875337_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV46). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcttgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875340_SP_P-D Feature FT:CDS KC875340_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV34). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgatcttcgaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875341_SP_P-D Feature FT:CDS KC875341_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV67). Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacaacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgatcttcgaccaccagcac
gggaccatgcagaacctgcacgactattgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KC875342_SP_P-D Feature FT:CDS KC875342_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV79). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaccctcaatgatcttcgaccaccagcac
gggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF053178_SP_P-D Feature FT:CDS KF053178_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MY62981). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggagactactgttattagatgccgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacatgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF061167_SP_P-D Feature FT:CDS KF061167_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate RST_PAK_1a). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcmacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|KF061168_SP_P-D Feature FT:CDS KF061168_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate RST_PAK_3a). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF061169_SP_P-D Feature FT:CDS KF061169_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate RST_PAK_7a). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF061170_SP_P-D Feature FT:CDS KF061170_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate RST_PAK_13a). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgagtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggccttagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF170739_SP_P-D Feature FT:CDS KF170739_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SDAC_024). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaaactctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggccttcgggaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF192830_SP_P-D Feature FT:CDS KF192830_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TP71). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaacatgcagaacctgcacgactcctgctcgaggaacctctatgtatccctcctgttgctgtacaaaaccttcggatg
gaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|KF192831_SP_P-D Feature FT:CDS KF192831_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TP59). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaacctgcagaacctgcacgactcctgctcgaggaacctctatgtatccctcctgttgctgtacaaaaccttcggatg
gaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|KF192832_SP_P-D Feature FT:CDS KF192832_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TP67). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaacctgcagaacctgcacgactcctgctcgaggaacctctatgtatccctcctgttgctgtacaaaaccttcggatg
gaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|KF192834_SP_P-D Feature FT:CDS KF192834_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TP63). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaacctgcaaaacctgcacgactcctgctcgaggaacctctatgtatccctcctgttgctgtacaaaaccttcggatg
gaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|KF471640_SP_P-D Feature FT:CDS KF471640_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-86). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctcgaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF471641_SP_P-D Feature FT:CDS KF471641_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-66). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgtgcttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF471642_SP_P-D Feature FT:CDS KF471642_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-65). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacaacgacgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcatgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF471644_SP_P-D Feature FT:CDS KF471644_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-52). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcttgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF471645_SP_P-D Feature FT:CDS KF471645_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-50). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtggacctcagcccgtttctct
tgactcagattactag
>gnl|hbvcds|KF471646_SP_P-D Feature FT:CDS KF471646_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-37). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaacctttggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF471647_SP_P-D Feature FT:CDS KF471647_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-35). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagttcactag
>gnl|hbvcds|KF471649_SP_P-D Feature FT:CDS KF471649_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-31). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF471650_SP_P-D Feature FT:CDS KF471650_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-25). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcgtcaaccaccagcac
gggatcatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgttgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF471651_SP_P-D Feature FT:CDS KF471651_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-22). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF471652_SP_P-D Feature FT:CDS KF471652_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-20). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF471653_SP_P-D Feature FT:CDS KF471653_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-18). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF471654_SP_P-D Feature FT:CDS KF471654_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-14). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF471655_SP_P-D Feature FT:CDS KF471655_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-11). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF471656_SP_P-D Feature FT:CDS KF471656_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-8). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctaagggagtgggcctcagcccgtttctcc
tggtacagtttactag
>gnl|hbvcds|KF471657_SP_P-D Feature FT:CDS KF471657_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctactgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF471658_SP_P-D Feature FT:CDS KF471658_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG_4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagatgccgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF471659_SP_P-D Feature FT:CDS KF471659_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaacaaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF471660_SP_P-D Feature FT:CDS KF471660_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF584160_SP_P-D Feature FT:CDS KF584160_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate M3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcmacgcttccggrgactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatytcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggcacctctatgtatccctcatgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF584161_SP_P-D Feature FT:CDS KF584161_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S1a). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggcacctctatgtatccctcatgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF584162_SP_P-D Feature FT:CDS KF584162_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S1b). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggcacctctatgtatccctcatgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF584163_SP_P-D Feature FT:CDS KF584163_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S2a). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggcacctctatgtatccctcatgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF584164_SP_P-D Feature FT:CDS KF584164_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S2b). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggcacctctatgtatccctcatgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF584165_SP_P-D Feature FT:CDS KF584165_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Da). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggcacctctatgtatccctcatgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF584166_SP_P-D Feature FT:CDS KF584166_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Db). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggcacctctatgtatccctcatgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF679989_SP_P-D Feature FT:CDS KF679989_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EICI-49). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF679990_SP_P-D Feature FT:CDS KF679990_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EICI-57). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacaacgaggcaggtcccttagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgatcctcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF679992_SP_P-D Feature FT:CDS KF679992_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EICI-75). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF679993_SP_P-D Feature FT:CDS KF679993_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EICI-76). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF679994_SP_P-D Feature FT:CDS KF679994_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EICI-10). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF679995_SP_P-D Feature FT:CDS KF679995_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EICI-37). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF679996_SP_P-D Feature FT:CDS KF679996_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EICI-51). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF679997_SP_P-D Feature FT:CDS KF679997_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EICI-56). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF679998_SP_P-D Feature FT:CDS KF679998_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EICI-63). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|KF779209_SP_P-D Feature FT:CDS KF779209_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate DEN5536). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF779212_SP_P-D Feature FT:CDS KF779212_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate DEN5739). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF779214_SP_P-D Feature FT:CDS KF779214_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate DEN5754). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF779216_SP_P-D Feature FT:CDS KF779216_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate DEN5770). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctggcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF779217_SP_P-D Feature FT:CDS KF779217_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate DEN5809). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcagtctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF779218_SP_P-D Feature FT:CDS KF779218_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate DEN5876). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatccaatcaacacttccggaaactactgttgttagaggacgaggcaggtcccctagaagaagaactccctcc
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcactctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF779219_SP_P-D Feature FT:CDS KF779219_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate DEN5909). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccatcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF779220_SP_P-D Feature FT:CDS KF779220_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate DEN5910). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF779222_SP_P-D Feature FT:CDS KF779222_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate DEN5978). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF779223_SP_P-D Feature FT:CDS KF779223_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate DEN6024). Partial genome (Contains: HBe, HBc, HBx, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcagtctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF779224_SP_P-D Feature FT:CDS KF779224_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate DEN6026). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagaccaaggtctctatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF779225_SP_P-D Feature FT:CDS KF779225_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate DEN6036). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcagtctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF779228_SP_P-D Feature FT:CDS KF779228_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate DEN6067). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcagtctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF779229_SP_P-D Feature FT:CDS KF779229_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate DEN6077). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcagtctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF779230_SP_P-D Feature FT:CDS KF779230_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate DEN6078). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcagtctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF779285_SP_P-D Feature FT:CDS KF779285_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MLT0596). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF779288_SP_P-D Feature FT:CDS KF779288_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MLT0643). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF779289_SP_P-D Feature FT:CDS KF779289_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MLT0730). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctctatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacttgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF779292_SP_P-D Feature FT:CDS KF779292_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MLT0767). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF779296_SP_P-D Feature FT:CDS KF779296_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MLT0869). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcacggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF779301_SP_P-D Feature FT:CDS KF779301_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MLT1003). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF779302_SP_P-D Feature FT:CDS KF779302_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MLT1009). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF779303_SP_P-D Feature FT:CDS KF779303_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MLT1018). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF779318_SP_P-D Feature FT:CDS KF779318_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PNF4312). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF779340_SP_P-D Feature FT:CDS KF779340_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PNF4854). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF779341_SP_P-D Feature FT:CDS KF779341_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PNF4864). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF779376_SP_P-D Feature FT:CDS KF779376_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PRC6029). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagtccgattctcc
tggctcagtttactag
>gnl|hbvcds|KF779377_SP_P-D Feature FT:CDS KF779377_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PRC6034). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagtccgattctcc
tggctcagtttactag
>gnl|hbvcds|KF779382_SP_P-D Feature FT:CDS KF779382_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PRC6295). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KF922432_SP_P-D Feature FT:CDS KF922432_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate N011). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccctgcagaacctgcacgacacctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacg
gaaactgcacctgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ470885_SP_P-D Feature FT:CDS KJ470885_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 8136). Partial genome (Contains: HBc, HBx, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgaatccctcctgttgctgtacaaaaccttcggmtg
gaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ470889_SP_P-D Feature FT:CDS KJ470889_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 8034). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaamctctaygtatccctcctgttgctgtayaaaaccttcggatg
gaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ470893_SP_P-D Feature FT:CDS KJ470893_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 8118). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcatgttgctgtacaaaaccttcggatg
gaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ470894_SP_P-D Feature FT:CDS KJ470894_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 8066). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcctgttgctgtacaaaaccttcggacg
gaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ470895_SP_P-D Feature FT:CDS KJ470895_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 8120). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgatcttcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggatg
gaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ470896_SP_P-D Feature FT:CDS KJ470896_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 8122). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgmgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggatg
gaaactgcacctgtattcccatcccatcatcctgggctttcgsaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ647350_SP_P-D Feature FT:CDS KJ647350_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV197). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactcttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcgtctaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ647352_SP_P-D Feature FT:CDS KJ647352_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV219). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaatrcttccggagactactgttgttagacgacgagtcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagacgatctcaatctcgggaatctcagtgatcttcaaccaccagcgt
gggaccatgccaaacctgcacaactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcgaaaaattcctatggragtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ647353_SP_P-D Feature FT:CDS KJ647353_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV230). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaactcttccggaaactactgttgttagacgacgaggcaggtcccctaaaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcttcaaccaccagcac
gggaccatgccaaacctgcatgactcctgctcaaggaacctctatgtttccctcatgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcaatttactag
>gnl|hbvcds|KJ647355_SP_P-D Feature FT:CDS KJ647355_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV247). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagacttgtgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgatcctcaaccaccagcac
gggaccttgccaaacctgcacractcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcgracg
gaaattgcacctgtattcccatcccatcatcctgggctttcgraaaattcctatggragtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KJ843187_SP_P-D Feature FT:CDS KJ843187_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Ag26). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcagcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaacctttggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KM519455_SP_P-D Feature FT:CDS KM519455_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D3_WT_SA). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KM524338_SP_P-D Feature FT:CDS KM524338_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV136_EP-CHB). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactcctgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KM524339_SP_P-D Feature FT:CDS KM524339_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EHBV064_EP-CHB). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcgatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KM524340_SP_P-D Feature FT:CDS KM524340_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EHBV094_EP-CHB). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggactctcaatgatcttcgaccaccagcac
gggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KM524341_SP_P-D Feature FT:CDS KM524341_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EHBV128_EP-CHB). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KM524342_SP_P-D Feature FT:CDS KM524342_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate DR003_EP-CHB). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcacggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|KM524344_SP_P-D Feature FT:CDS KM524344_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MK070_EP-CHB). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcaaaacctgcacgactcctgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KM524345_SP_P-D Feature FT:CDS KM524345_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MK082_EP-CHB). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgacggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcgaccaccagcac
gggaccatgccgcacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KM524346_SP_P-D Feature FT:CDS KM524346_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MK096_EP-CHB). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacaaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccacccgcgt
gggaccatgcaaaacctgcacgactactgttcaaggaacctctatgtatccctactgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggtgtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KM524347_SP_P-D Feature FT:CDS KM524347_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MK102_EP-CHB). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KM524348_SP_P-D Feature FT:CDS KM524348_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MK129_EP-CHB). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaactcttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaccctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KM524349_SP_P-D Feature FT:CDS KM524349_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV.I-015_HIV-HBV). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
gggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KM524350_SP_P-D Feature FT:CDS KM524350_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV.I-017_HIV-HBV). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
gggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KM524351_SP_P-D Feature FT:CDS KM524351_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV.I-020_HIV-HBV). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccacccgcgt
gggaccatgcaaaacctgcacgactactgttcaaggaacctctatgtatccctactgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggtgtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KM524352_SP_P-D Feature FT:CDS KM524352_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV.I-025_HIV-HBV). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KM524353_SP_P-D Feature FT:CDS KM524353_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV.I-031_HIV-HBV). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KM524354_SP_P-D Feature FT:CDS KM524354_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV.I-058_HIV-HBV). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KM524355_SP_P-D Feature FT:CDS KM524355_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV.I-092_HIV-HBV). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KM524356_SP_P-D Feature FT:CDS KM524356_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV.I-123_HIV-HBV). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggatcatgcagaacctgcacgactcctgctcaaggaacctttatgtttccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KM524358_SP_P-D Feature FT:CDS KM524358_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EHBV.I-057_HIV-HBV). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgagtcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaccctcaatgatcttcaaccaccagcac
gggaacctgcagaacctgcacgactcctgctcgaggaacctctatgtatccctcctgttgctgtacaaaaccttcggatg
gaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|KM524361_SP_P-D Feature FT:CDS KM524361_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EHBV.I-112_HIV-HBV). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtcccaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
gggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KM577668_SP_P-D Feature FT:CDS KM577668_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NIR-6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KM577669_SP_P-D Feature FT:CDS KM577669_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NIR-7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaattactgttgttagacaacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaaccccaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KM577670_SP_P-D Feature FT:CDS KM577670_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NIR-8). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaatacttccggagacttgtgttattagacaacgacgcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcatgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KM577671_SP_P-D Feature FT:CDS KM577671_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NIR-9). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgccccaatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KM606744_SP_P-D Feature FT:CDS KM606744_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Cuba9). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
gggaccctgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacg
gaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|KM606745_SP_P-D Feature FT:CDS KM606745_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Cuba12). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KM606752_SP_P-D Feature FT:CDS KM606752_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Cuba100). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaaaatctcaatctcgggaatctcaatgatcatcaaccaccagcac
gggaccctgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggatg
gaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|KM606753_SP_P-D Feature FT:CDS KM606753_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Cuba109). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccctgcagaacatgcacgactcctgctcaaggaacctctatgtatccctcctgctgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KM606754_SP_P-D Feature FT:CDS KM606754_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Cuba120). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagtgtactgttgttagacgacgaggcaggtcccctacaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaatatctcaatctcgggaatcataatgatcatcgaccaccagcac
gggaccctgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggatg
gaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|KM606755_SP_P-D Feature FT:CDS KM606755_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Cuba139). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatgtcgggaatctcaaggatcatcaaccaccagcac
gggaccctgcaggacctgcacgactcctgctcaaggaacctctatgaatccctcctgttgctgtacaaaaccttcggatg
gaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP090177_SP_P-D Feature FT:CDS KP090177_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KP090178_SP_P-D Feature FT:CDS KP090178_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaaaaagaactccctcg
cctcgcaaacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KP090179_SP_P-D Feature FT:CDS KP090179_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtccccaggaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KP090180_SP_P-D Feature FT:CDS KP090180_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR14). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacaactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KP090181_SP_P-D Feature FT:CDS KP090181_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR40). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KP168419_SP_P-D Feature FT:CDS KP168419_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate KN109). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttgtgttattagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggatg
gaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KP322599_SP_P-D Feature FT:CDS KP322599_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H2811). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KP322600_SP_P-D Feature FT:CDS KP322600_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H2812). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KP322601_SP_P-D Feature FT:CDS KP322601_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H2813). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KP995100_SP_P-D Feature FT:CDS KP995100_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 49-Cirrhosis). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggatcatgcagaacctgcacgactcctgctcaaggaacctttatgtatccctcttgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KR905423_SP_P-D Feature FT:CDS KR905423_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EICI-36). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KR905424_SP_P-D Feature FT:CDS KR905424_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EICI-42). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KT151620_SP_P-D Feature FT:CDS KT151620_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 121). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcaggacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KT347090_SP_P-D Feature FT:CDS KT347090_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate ZADGMTMG). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KT366465_SP_P-D Feature FT:CDS KT366465_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C-EICI.49). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcaaaacctgcatgactactgttcaaggaacctctatgtatccctactgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KT366491_SP_P-D Feature FT:CDS KT366491_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C-EICI.38). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatacctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KT366493_SP_P-D Feature FT:CDS KT366493_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C-EICI.41). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcaaaacctgcacgactactgttcaaggaacctctatatatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KT366494_SP_P-D Feature FT:CDS KT366494_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C-EICI.42). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcga
ggaaccatgcagaacctgcacgactactgttcaaggaatctctctacagccctcctgttgctgtaccaaacgttcggaag
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KT366495_SP_P-D Feature FT:CDS KT366495_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C-EICI.45). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KT366496_SP_P-D Feature FT:CDS KT366496_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C-EICI.46). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggactcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgacaactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KT366497_SP_P-D Feature FT:CDS KT366497_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C-EICI.48). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KT366498_SP_P-D Feature FT:CDS KT366498_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate O-EICI.7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcgaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KT366499_SP_P-D Feature FT:CDS KT366499_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate O-EICI.11). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactgctgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
caaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KT366500_SP_P-D Feature FT:CDS KT366500_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate O-EICI.18). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcgaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KT366501_SP_P-D Feature FT:CDS KT366501_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate O-EICI.23). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcgaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KT366502_SP_P-D Feature FT:CDS KT366502_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate O-EICI.27). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcgaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KT366506_SP_P-D Feature FT:CDS KT366506_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C-EICI.18). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KT366507_SP_P-D Feature FT:CDS KT366507_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C-EICI.24). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KT366508_SP_P-D Feature FT:CDS KT366508_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C-EICI.25). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KT366509_SP_P-D Feature FT:CDS KT366509_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C-EICI.26). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KT366510_SP_P-D Feature FT:CDS KT366510_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C-EICI.36). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggagcctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KT366511_SP_P-D Feature FT:CDS KT366511_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C-EICI.37). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactcctgttcaaggaacctctatatatccctcctgttgctgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KT749821_SP_P-D Feature FT:CDS KT749821_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FL20). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagaactccatctcgggaatctcaatgatcctcaaccaccagcgc
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KT749823_SP_P-D Feature FT:CDS KT749823_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FL3). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagaggacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttccactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattcctatgggggtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KT749827_SP_P-D Feature FT:CDS KT749827_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FL14). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KT749828_SP_P-D Feature FT:CDS KT749828_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FL13). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcaaacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtggggctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KT749845_SP_P-D Feature FT:CDS KT749845_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FL24). Partial genome (Contains: HBc, HBx, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcctcaaccaccagcac
gggaccatgccggacctgcatgacaactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KT963508_SP_P-D Feature FT:CDS KT963508_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KU668433_SP_P-D Feature FT:CDS KU668433_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV-HCV071). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccttatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgatcctcaacaaccagcac
gggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KU668434_SP_P-D Feature FT:CDS KU668434_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV-HCV072). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
gggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KU668435_SP_P-D Feature FT:CDS KU668435_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV-HCV102). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgatcctcaacaaccagcac
gggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KU668436_SP_P-D Feature FT:CDS KU668436_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV-HCV103). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
gggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KU668437_SP_P-D Feature FT:CDS KU668437_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV-HCV108). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
gggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KU668438_SP_P-D Feature FT:CDS KU668438_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV-HCV111). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
gggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KU668439_SP_P-D Feature FT:CDS KU668439_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV-HCV124). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcgaccaccagcac
gggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KU668441_SP_P-D Feature FT:CDS KU668441_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV-HCV170). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcgacaaccagcac
gggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KU668442_SP_P-D Feature FT:CDS KU668442_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV-HCV175). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagaagaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
gggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KU668444_SP_P-D Feature FT:CDS KU668444_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV-HCV180). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcgacaaccagcac
gggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KU668445_SP_P-D Feature FT:CDS KU668445_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV-HCV181). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
gggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KU668446_SP_P-D Feature FT:CDS KU668446_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV-HCV183). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
gggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KU668447_SP_P-D Feature FT:CDS KU668447_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV-HCV191). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcgaccaccagcac
gggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KU668448_SP_P-D Feature FT:CDS KU668448_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV-HCV192). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcgaccaccagcac
gggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KU668449_SP_P-D Feature FT:CDS KU668449_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV-HCV207). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|KU736924_SP_P-D Feature FT:CDS KU736924_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Sudan_14). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcgc
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacatgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|KU736925_SP_P-D Feature FT:CDS KU736925_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Sudan_15). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcgc
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacatgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|KU736926_SP_P-D Feature FT:CDS KU736926_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Sudan_18). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcycatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagttcactag
>gnl|hbvcds|KU736927_SP_P-D Feature FT:CDS KU736927_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Sudan_20). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcctcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagttcactag
>gnl|hbvcds|KX196208_SP_P-D Feature FT:CDS KX196208_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL093). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactattgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KX196209_SP_P-D Feature FT:CDS KX196209_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL094). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactattgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KX196210_SP_P-D Feature FT:CDS KX196210_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL095). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KX196211_SP_P-D Feature FT:CDS KX196211_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL096). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactattgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KX196212_SP_P-D Feature FT:CDS KX196212_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL097). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactattgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KX196213_SP_P-D Feature FT:CDS KX196213_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL098). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KX196214_SP_P-D Feature FT:CDS KX196214_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL099). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagtctactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcatgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KX196215_SP_P-D Feature FT:CDS KX196215_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL0100). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KX196216_SP_P-D Feature FT:CDS KX196216_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL0101). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgcacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KX196217_SP_P-D Feature FT:CDS KX196217_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL0102). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KX196218_SP_P-D Feature FT:CDS KX196218_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL0103). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KX196219_SP_P-D Feature FT:CDS KX196219_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL0104). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KX196220_SP_P-D Feature FT:CDS KX196220_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL0105). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcttgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KX196221_SP_P-D Feature FT:CDS KX196221_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL0106). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgcacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KX196222_SP_P-D Feature FT:CDS KX196222_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL0107). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KX196224_SP_P-D Feature FT:CDS KX196224_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL0109). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggactatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KX196225_SP_P-D Feature FT:CDS KX196225_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL0110). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KX196226_SP_P-D Feature FT:CDS KX196226_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL0111). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KX196227_SP_P-D Feature FT:CDS KX196227_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL0112). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KX196228_SP_P-D Feature FT:CDS KX196228_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL0113). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactattgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KX196229_SP_P-D Feature FT:CDS KX196229_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL0114). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaccctcaatgatcttcgaccaccagcac
gggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KX196230_SP_P-D Feature FT:CDS KX196230_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL0115). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KX196231_SP_P-D Feature FT:CDS KX196231_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL0116). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaatttctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KX196232_SP_P-D Feature FT:CDS KX196232_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL0117). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcttgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KX196233_SP_P-D Feature FT:CDS KX196233_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL0118). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgcacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KX196234_SP_P-D Feature FT:CDS KX196234_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL0119). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KX196235_SP_P-D Feature FT:CDS KX196235_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL0120). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactattgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagttgactag
>gnl|hbvcds|KX196236_SP_P-D Feature FT:CDS KX196236_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL0121). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacaacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KX260231_SP_P-D Feature FT:CDS KX260231_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR-32). Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcaaaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaagattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KX276856_SP_P-D Feature FT:CDS KX276856_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagtgtactgttgttagacaacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctaaatctcgggactctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgttgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KX276857_SP_P-D Feature FT:CDS KX276857_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttctgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcmgacgaaggtctcaatcgccgcgtcgcagaagatctmaatctcgggaatcycaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KX357622_SP_P-D Feature FT:CDS KX357622_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GD104ETH). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggactctcaatgatcttcaactaccagcac
gggtccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacg
gaaactgcacatgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KX357637_SP_P-D Feature FT:CDS KX357637_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MK20ETH). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcgc
gggaccatgcagaacctgcacgaccactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacatgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KX357638_SP_P-D Feature FT:CDS KX357638_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AA95ETH). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcgc
gggaccatgcagaacctgcacgaccactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacatgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KX357639_SP_P-D Feature FT:CDS KX357639_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GD82ETH). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcgc
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacatgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KX827290_SP_P-D Feature FT:CDS KX827290_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate geno1.2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KX827291_SP_P-D Feature FT:CDS KX827291_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate geno2.2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KX827292_SP_P-D Feature FT:CDS KX827292_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate geno3.1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctaccaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KX827300_SP_P-D Feature FT:CDS KX827300_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate geno21.2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgacacctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KX827301_SP_P-D Feature FT:CDS KX827301_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate geno30.4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KY382412_SP_P-D Feature FT:CDS KY382412_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D1_1896). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggcacctctatgtatccctcatgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KY382414_SP_P-D Feature FT:CDS KY382414_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D1_wt). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggcacctctatgtatccctcatgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KY629630_SP_P-D Feature FT:CDS KY629630_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TYM13097). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcgtcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaycaaaccctcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KY629633_SP_P-D Feature FT:CDS KY629633_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate KLMY14). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcttgctgctgtacmaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|KY629634_SP_P-D Feature FT:CDS KY629634_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate KLMY16). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactgctgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagacgaactcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|L27106_SP_P-D Feature FT:CDS L27106_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaaggcctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcttcgactaccagcac
gggaccatgcagaacctgcatgactcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|LC365689_SP_P-D Feature FT:CDS LC365689_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HB17-0791). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|LT992438_SP_P-D Feature FT:CDS LT992438_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate DA29). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|LT992439_SP_P-D Feature FT:CDS LT992439_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate DA27). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcgaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|LT992444_SP_P-D Feature FT:CDS LT992444_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate DA51). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggatg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|LT992454_SP_P-D Feature FT:CDS LT992454_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate DA222). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|M32138_SP_P-D Feature FT:CDS M32138_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-21). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccacgtcgcagaagaactcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MF488704_SP_P-D Feature FT:CDS MF488704_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV-PCP229). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
gggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MF618339_SP_P-D Feature FT:CDS MF618339_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV-HIV006). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
gggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MF618340_SP_P-D Feature FT:CDS MF618340_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV-HIV009). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
gggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MF618341_SP_P-D Feature FT:CDS MF618341_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV-HIV011). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
gggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MF618342_SP_P-D Feature FT:CDS MF618342_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV-HIV053). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgatcttcgaccaccagcac
gggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MF618343_SP_P-D Feature FT:CDS MF618343_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV-HIV054). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcgaccaccagcac
gggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaagattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MF618348_SP_P-D Feature FT:CDS MF618348_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV-HIV137). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaacctgcagaacctgcacgactcctgctcgaggaacctctatgtatccctcctgttgctgtacaaaaccttcggatg
gaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|MF618349_SP_P-D Feature FT:CDS MF618349_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV-HIV165). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggcaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MF925358_SP_P-D Feature FT:CDS MF925358_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BD-HBV01). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MF925363_SP_P-D Feature FT:CDS MF925363_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BD-HBV07). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgaatactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MF925364_SP_P-D Feature FT:CDS MF925364_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BD-HBV08). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MF925366_SP_P-D Feature FT:CDS MF925366_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BD-HBV10). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatctacacttccggagacttgtgttgttagacaacgacgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcgaccaccagcac
gggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MF925379_SP_P-D Feature FT:CDS MF925379_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BD-HBV23). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttgtgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggcacctctatgtatccctcatgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MF925383_SP_P-D Feature FT:CDS MF925383_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BD-HBV27). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactgctgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MF925390_SP_P-D Feature FT:CDS MF925390_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BD-HBV34). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgatgcgggtccactagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MF925391_SP_P-D Feature FT:CDS MF925391_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BD-HBV35). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagtgtactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcatgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MF925393_SP_P-D Feature FT:CDS MF925393_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BD-HBV38). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH724214_SP_P-D Feature FT:CDS MH724214_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH724215_SP_P-D Feature FT:CDS MH724215_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
gggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH724216_SP_P-D Feature FT:CDS MH724216_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcakacgaagatctcaatcgccgcgtcgcagaakatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggaag
gaaattgcacctgtattctcatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH724217_SP_P-D Feature FT:CDS MH724217_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH724218_SP_P-D Feature FT:CDS MH724218_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR8). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH724219_SP_P-D Feature FT:CDS MH724219_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR9). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH724220_SP_P-D Feature FT:CDS MH724220_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR10). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
gggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH724221_SP_P-D Feature FT:CDS MH724221_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR11). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH724223_SP_P-D Feature FT:CDS MH724223_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR13). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH724224_SP_P-D Feature FT:CDS MH724224_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR15). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH724225_SP_P-D Feature FT:CDS MH724225_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR16). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgtggttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH724226_SP_P-D Feature FT:CDS MH724226_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR17). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccctgccgaacctgcacgacaactgctcaaggaacctctatgtatccctactgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH724227_SP_P-D Feature FT:CDS MH724227_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR18). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH724228_SP_P-D Feature FT:CDS MH724228_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR19). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH724229_SP_P-D Feature FT:CDS MH724229_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR20). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgtcgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH724230_SP_P-D Feature FT:CDS MH724230_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR21). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH724231_SP_P-D Feature FT:CDS MH724231_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR22). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgaccactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH724232_SP_P-D Feature FT:CDS MH724232_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR23). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH724233_SP_P-D Feature FT:CDS MH724233_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR24). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactagtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH724234_SP_P-D Feature FT:CDS MH724234_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR25). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacgcttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH724235_SP_P-D Feature FT:CDS MH724235_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR26). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgtgcttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctaaatctcgggactctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH724236_SP_P-D Feature FT:CDS MH724236_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR27). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcctcgaccaccagcac
gggaccatgcagaacctgcacgactattgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH724237_SP_P-D Feature FT:CDS MH724237_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR28). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH724238_SP_P-D Feature FT:CDS MH724238_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR29). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacaacgaggcaggtcctctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH724241_SP_P-D Feature FT:CDS MH724241_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR33). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH724242_SP_P-D Feature FT:CDS MH724242_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR34). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgatcatcaaccaccagcac
gggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH724244_SP_P-D Feature FT:CDS MH724244_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR36). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH724245_SP_P-D Feature FT:CDS MH724245_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR37). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttattagacaacgaggcaggacccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctccatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacatgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH724246_SP_P-D Feature FT:CDS MH724246_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR38). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH724247_SP_P-D Feature FT:CDS MH724247_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR39). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcaaacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH724248_SP_P-D Feature FT:CDS MH724248_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR41). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatttcaatctccggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH724249_SP_P-D Feature FT:CDS MH724249_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR42). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccctgccgaacctgcacgacaactgctcaaggaacctctatgtatccctactgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH724250_SP_P-D Feature FT:CDS MH724250_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR43). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcaaaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccctgccgaacctgcacgacaactgctcaaggaacctctatgtatccctactgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH724251_SP_P-D Feature FT:CDS MH724251_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR44). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggatg
gaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|MH724252_SP_P-D Feature FT:CDS MH724252_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR48). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MH932714_SP_P-D Feature FT:CDS MH932714_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Hiroshima GtD CL2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK052947_SP_P-D Feature FT:CDS MK052947_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NP137-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaggttactgttgttagaggacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatcacaatctcgggaacctcaatgatcctcaacaaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccgtcgtcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK052948_SP_P-D Feature FT:CDS MK052948_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NP137-2). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaggttgctgttgttagaggacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcctcaacaaccagcac
gggaccatgcagaacctgcacgactcctgcacaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccgtcgtcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK052949_SP_P-D Feature FT:CDS MK052949_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NP137-3). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagattgctgttgttagaggacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatttcaatctcgggaacctcaatgatcctcaacaaccagcac
gggaccatgcagaacttgcacgactcctgctcaagcaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacatgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK052950_SP_P-D Feature FT:CDS MK052950_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NP137-4). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagattgctgttgttagaggacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaaccgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcctcaacaaccagcac
gggaccatgcagaacttgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacatgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtctactag
>gnl|hbvcds|MK052951_SP_P-D Feature FT:CDS MK052951_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NP137-5). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagattgctgttgttagaggacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcctcaacaaccagcac
gggaccatgcagaacctgcacgactcctgcacaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccgtcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK052952_SP_P-D Feature FT:CDS MK052952_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NP137-6). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaggttactgttgttagaggacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtcttaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcctcaacaaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK052953_SP_P-D Feature FT:CDS MK052953_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NP137-7). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagattgctgttgttagaggacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcctcaacaaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK052954_SP_P-D Feature FT:CDS MK052954_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NP137-8). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaggttgctgttgttagaggacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcctcaacaaccagcac
gggaccatgcagaacctgcacgactcctgcacaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccgtcgtcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK052955_SP_P-D Feature FT:CDS MK052955_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NP137-9). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagattgctgttgttagaggacgaggcgggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcctcaacaaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacccgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK052956_SP_P-D Feature FT:CDS MK052956_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NP137-10). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagattgctgttgttagaggacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcctcaacaaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK052958_SP_P-D Feature FT:CDS MK052958_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NP137-12). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagattgctgttgttagaggacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcctcaacaaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK052959_SP_P-D Feature FT:CDS MK052959_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NP137-13). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaggttgctgttgttagaggacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcctcaacaaccagcac
gggaccatgcagaacttgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacatgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK052960_SP_P-D Feature FT:CDS MK052960_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NP137-14). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagattgctgttgttagaggacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcctcaacaaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK052961_SP_P-D Feature FT:CDS MK052961_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NP137-15). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagattgctgttgttagaggacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcctcaacaaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtacccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK052963_SP_P-D Feature FT:CDS MK052963_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NP137Q-2). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagattgctgttgttagaggacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcctcaacaaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK052966_SP_P-D Feature FT:CDS MK052966_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NP137Q-5). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagattgctgttgttagaggacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcctcaacaaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK052971_SP_P-D Feature FT:CDS MK052971_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NP137Q-11). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagattgctgttgttagaggacgaggcaggtcccctagaagaagaactccctcg
ccccgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcctcaacaaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK052972_SP_P-D Feature FT:CDS MK052972_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NP137Q-12). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaggttactgttgttagaggacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK052973_SP_P-D Feature FT:CDS MK052973_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NP137Q-14). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaggttactgttgttagaggacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK052974_SP_P-D Feature FT:CDS MK052974_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NP137Q-15). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagattgctgttgttagaggacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgacggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcctcaacaaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK052975_SP_P-D Feature FT:CDS MK052975_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NP137Q-17). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaggttactgttgttagaggacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK355500_SP_P-D Feature FT:CDS MK355500_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Ahvaz30). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaactttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctaagggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK355501_SP_P-D Feature FT:CDS MK355501_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Ahvaz34). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgaatcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccctttctcc
tggctcagtttactag
>gnl|hbvcds|MK507910_SP_P-D Feature FT:CDS MK507910_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HEP/13/0051). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK507911_SP_P-D Feature FT:CDS MK507911_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HEP-44). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK507912_SP_P-D Feature FT:CDS MK507912_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 012/14/0562). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK507913_SP_P-D Feature FT:CDS MK507913_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HEP/14/0134). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcaaaacctgcacgactcctgctcgaggaacctctacgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK507914_SP_P-D Feature FT:CDS MK507914_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 12/16/1214). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK516278_SP_P-D Feature FT:CDS MK516278_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HEP-108). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgctgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK541688_SP_P-D Feature FT:CDS MK541688_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 12/16/0148). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK598636_SP_P-D Feature FT:CDS MK598636_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaataatcttcaaccaccagcac
gggaccttgcagaacatgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK598637_SP_P-D Feature FT:CDS MK598637_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg22). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaataatcttcaaccaccagcac
gggaccttgcagaacatgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK598638_SP_P-D Feature FT:CDS MK598638_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg13). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaataatcttcaaccaccagcac
gggaccttgcagaacatgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK598639_SP_P-D Feature FT:CDS MK598639_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg47). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaataatcttcaaccaccagcac
gggaccttgcagaacatgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK598640_SP_P-D Feature FT:CDS MK598640_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg18). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaataatcttcaaccaccagcac
gggaccttgcagaacatgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK598641_SP_P-D Feature FT:CDS MK598641_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg26). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactaatcttcaaccaccagcac
gggaccttgcagaacatgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK598642_SP_P-D Feature FT:CDS MK598642_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg59). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctcctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK598643_SP_P-D Feature FT:CDS MK598643_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg34). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK598644_SP_P-D Feature FT:CDS MK598644_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg62). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK598645_SP_P-D Feature FT:CDS MK598645_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg46). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK598646_SP_P-D Feature FT:CDS MK598646_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg71). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacaacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK598647_SP_P-D Feature FT:CDS MK598647_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg55). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK598648_SP_P-D Feature FT:CDS MK598648_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg58). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgacgcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK598649_SP_P-D Feature FT:CDS MK598649_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg15). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgacgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK598650_SP_P-D Feature FT:CDS MK598650_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg69). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctcttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK598651_SP_P-D Feature FT:CDS MK598651_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg45). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK598655_SP_P-D Feature FT:CDS MK598655_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg39). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK598657_SP_P-D Feature FT:CDS MK598657_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg50). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK598658_SP_P-D Feature FT:CDS MK598658_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg11). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaagggacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK598659_SP_P-D Feature FT:CDS MK598659_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg72). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK598660_SP_P-D Feature FT:CDS MK598660_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg27). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK598661_SP_P-D Feature FT:CDS MK598661_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg60). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacatgcacgactactgctcaaggaacctctatgtatccctcatgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK598662_SP_P-D Feature FT:CDS MK598662_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg28). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK598663_SP_P-D Feature FT:CDS MK598663_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg31). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctca
tggctcagtttactag
>gnl|hbvcds|MK598664_SP_P-D Feature FT:CDS MK598664_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg20). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactattgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK598665_SP_P-D Feature FT:CDS MK598665_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg38). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK598666_SP_P-D Feature FT:CDS MK598666_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg37). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK598667_SP_P-D Feature FT:CDS MK598667_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg68). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactattgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK598668_SP_P-D Feature FT:CDS MK598668_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg10). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK598669_SP_P-D Feature FT:CDS MK598669_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg42). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactcctgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK598670_SP_P-D Feature FT:CDS MK598670_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg36). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK598671_SP_P-D Feature FT:CDS MK598671_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg30). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK598672_SP_P-D Feature FT:CDS MK598672_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg53). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcaaaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK598673_SP_P-D Feature FT:CDS MK598673_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK598674_SP_P-D Feature FT:CDS MK598674_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg66). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK598675_SP_P-D Feature FT:CDS MK598675_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg75). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK598676_SP_P-D Feature FT:CDS MK598676_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctcaatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK598677_SP_P-D Feature FT:CDS MK598677_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg41). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK598678_SP_P-D Feature FT:CDS MK598678_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg14). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK598679_SP_P-D Feature FT:CDS MK598679_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg33). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK618418_SP_P-D Feature FT:CDS MK618418_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_Arkh7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK618419_SP_P-D Feature FT:CDS MK618419_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_Arkh16). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK618420_SP_P-D Feature FT:CDS MK618420_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_Arkh11). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK618421_SP_P-D Feature FT:CDS MK618421_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_Arkh43). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK618422_SP_P-D Feature FT:CDS MK618422_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_Arkh21). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcatgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK618423_SP_P-D Feature FT:CDS MK618423_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_Arkh28). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacaattccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcaaaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK618424_SP_P-D Feature FT:CDS MK618424_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_Arkh54). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacaattccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcaaaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK618425_SP_P-D Feature FT:CDS MK618425_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_Arkh47). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacaattccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcaaaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK618426_SP_P-D Feature FT:CDS MK618426_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_Arkh3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK618427_SP_P-D Feature FT:CDS MK618427_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_Arkh15). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK618428_SP_P-D Feature FT:CDS MK618428_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_Arkh33). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK618429_SP_P-D Feature FT:CDS MK618429_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_Arkh46). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtatcaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctggggcttcggaaaattcccatgggagtgggccacagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK618430_SP_P-D Feature FT:CDS MK618430_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_Arkh18). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtatcaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctggggcttcggaaaattcccatgggagtgggccacagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK618431_SP_P-D Feature FT:CDS MK618431_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_Arkh36). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggcccatgcagaacctgcacgactcctgctcacggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK618432_SP_P-D Feature FT:CDS MK618432_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_Arkh58). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtatcaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctggggcttcggaaaattcccatgggagtgggccacagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK618433_SP_P-D Feature FT:CDS MK618433_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_Arkh23). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtatcaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctggggcttcggaaaattcccatgggagtgggccacagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK618434_SP_P-D Feature FT:CDS MK618434_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_Arkh37). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK618435_SP_P-D Feature FT:CDS MK618435_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_Arkh2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK618436_SP_P-D Feature FT:CDS MK618436_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_Arkh61). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK618437_SP_P-D Feature FT:CDS MK618437_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_Arkh50). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK618441_SP_P-D Feature FT:CDS MK618441_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_Arkh55). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgttgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK618443_SP_P-D Feature FT:CDS MK618443_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_Arkh44). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgttgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK693107_SP_P-D Feature FT:CDS MK693107_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Ahvaz8). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaactttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctaagggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK693108_SP_P-D Feature FT:CDS MK693108_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Ahvaz29). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgccggacctgcacgaatcctggtcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MK693109_SP_P-D Feature FT:CDS MK693109_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Ahvaz31). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgattctcaaccaccagcac
gggaccatgcagaacctgcacgaatcctggtcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaaatgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MN507836_SP_P-D Feature FT:CDS MN507836_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 1037_ocHBVd_GC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MN507837_SP_P-D Feature FT:CDS MN507837_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 2505_ocHBVd_GC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaaatccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MN507838_SP_P-D Feature FT:CDS MN507838_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 1170_HBVd_GC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MN507839_SP_P-D Feature FT:CDS MN507839_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 1976_ocHBVd_GC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactcccttg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MN507851_SP_P-D Feature FT:CDS MN507851_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 2530_ocHBVd_GC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MN507852_SP_P-D Feature FT:CDS MN507852_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 2562_ocHBVd_GC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcccgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|MN507853_SP_P-D Feature FT:CDS MN507853_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 2564_ocHBVd_GC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|V01460_SP_P-D Feature FT:CDS V01460_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
gggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|X02496_SP_P-D Feature FT:CDS X02496_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|X59795_SP_P-D Feature FT:CDS X59795_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Patient MG; HBV/S). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcaggacctgcacgactcctgctcaaggcaactctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|X65257_SP_P-D Feature FT:CDS X65257_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate patient C; HBsAg positiv;HBV subtype ayw). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|X65258_SP_P-D Feature FT:CDS X65258_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate patient CI; HBV subtype ayw). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacaacaacaaccagtac
gggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtaccaaaacttcggatg
gaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|X72702_SP_P-D Feature FT:CDS X72702_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate patient C1005). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcgc
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|X80924_SP_P-D Feature FT:CDS X80924_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate patient 4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttgtgttattagacaacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|X80926_SP_P-D Feature FT:CDS X80926_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate patient 5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttgtgttattagacaacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaaccaccagcac
gggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|X85254_SP_P-D Feature FT:CDS X85254_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
gggaccatgccgcacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|X97848_SP_P-D Feature FT:CDS X97848_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate patient 2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacaacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctctggaatctcaatgatcatcaaccaccagcac
gggaccatgccggacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|X97849_SP_P-D Feature FT:CDS X97849_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate patient 3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcgc
gggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|Y07587_SP_P-D Feature FT:CDS Y07587_SP_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaactaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
>gnl|hbvcds|Z35716_SP_P-D Feature FT:CDS Z35716_SP_P-D of [Viruses] Hepatitis B Virus genotype D (isolate hb321). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcttcaacaaccagcgt
gggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcc
tggctcagtttactag
© 1998-2020Legal notice