HBVdb

Dataset for nucleotide sequence SP of genotype D

[Download (right click)] [Edit] [Sequences] [Repertoires]

1334 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


AB674420_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacgacga
X65258_SP_P-D        atgcccctatcctatcaacacttccggagactactgttgttagacgacga
EU155895_SP_P-D      atgcccctatcctatcaacacttccggagactgctgttgttagacgacga
EU155893_SP_P-D      atgcccctatcctatcaacacttccggaggttgctgttgttagaggacga
EU414140_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KJ647353_SP_P-D      atgcccctatcctatcaactcttccggaaactactgttgttagacgacga
JN642128_SP_P-D      atgcccctatcttatcaacacttcccgagactactgttattagatgccga
JX310733_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JX310735_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB555500_SP_P-D      atgcccctatcttatcaacacttccggagacttctgttattagacaasga
JF754630_SP_P-D      atgcccctatcttgtcaacacttccggagactactgttattagacaacga
JN040782_SP_P-D      atgcccctatcttatcaacacttccggagacttctgttattagacgaaga
JF754629_SP_P-D      atgcccctatcttatcaacgcttccggaaactactgttgttagacgacga
JN642134_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgccga
JN642133_SP_P-D      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
JX310734_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
L27106_SP_P-D        atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KT749823_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagaggacga
JN257160_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
JN257161_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
JN040802_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagaggacga
JF754602_SP_P-D      atgcccctatcttatcaacacttccggagactgctgttgttagaccacga
HQ700478_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacaacga
HQ700553_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacaacga
JN040804_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MK693109_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN040820_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN040766_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN040753_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GU456639_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacaacga
AB674435_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN642135_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacaacaa
AB674416_SP_P-D      atgcccctatcttatcaacacttccggagagtactgttattagacaacga
JN642165_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN792907_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN792908_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacgacga
KF679990_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacaacga
KF471642_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacaacga
JN257148_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN040773_SP_P-D      atgcccctatcttatcaacacttccggaaattactgttgttagacaacga
GU456654_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacaacga
AB270546_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagatgccga
AY236162_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
DQ304547_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
DQ304550_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
DQ304551_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
DQ304548_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
DQ304549_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB674419_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
HQ700472_SP_P-D      atgcccctatcttatcaacacttccggagacttgtgttattagacgacga
HQ700474_SP_P-D      atgcccctatcttatcatcacttccggagacttgtgttattagacgacga
KF584160_SP_P-D      atgcccctatcttatcmacgcttccggrgactactgttgttagacgacga
GU456682_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacaacga
GU456651_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
FJ904426_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacaacga
AB674430_SP_P-D      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB674425_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB330367_SP_P-D      atgcccctatcttatcaatgcttccggagacttctgttattagacgacga
MK618429_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MK618430_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MK618432_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MK618433_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB270541_SP_P-D      atgcccctatcttatcaacacttccggagacttctgttattagacgacga
AB674405_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacgacga
GU456657_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacgacga
JN040822_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
FJ349235_SP_P-D      atgcccctatcttatcaacacttccggagacttgtgttgttagacgacga
JN040774_SP_P-D      atgcccctatcttatcaacacttccggagacttgtgttgttagacgacga
JN792911_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacgacga
JN792912_SP_P-D      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
JN257165_SP_P-D      atgcccctatcttatcaacacttccggagactactgttcttagacgacga
JN257166_SP_P-D      atgcccctatcttatcaacacttccggagactactgttcttagacgacga
JF754617_SP_P-D      atgcccctatcttatcaatgcttccggagacttctgttattagacgacga
JN040796_SP_P-D      atgcccctatcttatcaacgcttccggagtgtactgttgttagacgacga
GU456652_SP_P-D      atgcccctatcttatcaatgcttccggagacttctgttgttagacgacga
AB674423_SP_P-D      atgcccctatcttatcaacacttccggagtgtactgttgttagacgacga
JN642161_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacgacga
JF754607_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacgacga
GU456646_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacgacga
JF754632_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacgacga
AY741794_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AY741795_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AY741796_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB674427_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacgacga
KF471640_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacgacga
MK618431_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
KU736927_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KF471647_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JX096955_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN792905_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacgacga
JN642158_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacgacga
JN642157_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagaggacga
JN642153_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
JN642146_SP_P-D      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JN642140_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagaccacga
JN642132_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN257203_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN257187_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN257188_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN257163_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN257149_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN040817_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN040806_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN040779_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
JN040776_SP_P-D      atgcccctatcttatcaacacttccggagacttctgttgttagacgacga
JF754618_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JF754609_SP_P-D      atgcccctatcttatcaacacttccggagattactgttattagacgacga
JF754593_SP_P-D      atgcccctatcttatcaacacttccggagactactgttcttagacgacga
JF754590_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GU456660_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GU456643_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagaggacga
GQ477458_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacgacga
FJ904424_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB674429_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB674415_SP_P-D      atgcccctatcttatcaacacttccggagacttctgttattagacgacga
AB270540_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KF584161_SP_P-D      atgcccctatcttatcaacgcttccggagactactgttgttagacgacga
KF584162_SP_P-D      atgcccctatcttatcaacgcttccggagactactgttgttagacgacga
KF584163_SP_P-D      atgcccctatcttatcaacgcttccggagactactgttgttagacgacga
KF584164_SP_P-D      atgcccctatcttatcaacgcttccggagactactgttgttagacgacga
KF584165_SP_P-D      atgcccctatcttatcaacgcttccggagactactgttgttagacgacga
KF584166_SP_P-D      atgcccctatcttatcaacgcttccggagactactgttgttagacgacga
KY382412_SP_P-D      atgcccctatcttatcaacgcttccggagactactgttgttagacgacga
KY382414_SP_P-D      atgcccctatcttatcaacgcttccggagactactgttgttagacgacga
GQ477459_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN040828_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN040823_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
AB104712_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
AY721612_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN642145_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN040800_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN040801_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KM524339_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JF754591_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN040813_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GU456642_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB222713_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
MK618437_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
KF471651_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KF471652_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KF471649_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KT963508_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KC774459_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KC774440_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN257199_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN257196_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN040827_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN040816_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN040815_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN040808_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN040807_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AY161157_SP_P-D      atgcccctatcttatcaacacttccggagaccactgttgttagacgacga
AF151735_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB674413_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB674426_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AY373431_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AY661792_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AY661793_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AY721609_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AY796030_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
DQ315778_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
FJ349231_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GU456649_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JF754596_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JF754608_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN040805_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN257152_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN257155_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN257169_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN257205_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MH724252_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
X02496_SP_P-D        atgcccctatcttatcaacacttccggagactactgttgttagacgacga
Y07587_SP_P-D        atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN040750_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AF121239_SP_P-D      atgcccctatcttatcaacacttccggagacttgtgttattagacgacga
AF121242_SP_P-D      atgcccctatcttatcaacacttccggagacttgtgttgttagacgacga
GU456670_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
AF121240_SP_C-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AF121241_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
FJ349220_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GU456671_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JF754604_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KF471654_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN040795_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN257201_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KM606753_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN040778_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacgaaga
HQ700439_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacgacga
JF754592_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacgacga
JF754594_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacgacga
JF754622_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacgacga
KF471641_SP_P-D      atgcccctatcttatcaacacttccggagactactgtgcttagacgacga
GU456644_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GU456640_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JF754610_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB674422_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GU456650_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JF754633_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN642151_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KF471655_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KX827300_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN257202_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN257170_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN257150_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN040830_SP_P-D      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JN040781_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacgacga
JN040771_SP_P-D      atgcccctatcttatcaacacttccggagacttctgttattagacgacga
JN040768_SP_P-D      atgcccctatcttatcaacacttccggagactagtgttgttagacgacga
JN040761_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacaacga
JN040754_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GU456675_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GU456664_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacaacga
GU456658_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacgacga
GU456663_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacgacga
EF103277_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AJ344116_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN257171_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB674409_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
FJ349217_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
FJ904431_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KF471660_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MK598645_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB222712_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB104710_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB222709_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB270542_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN040780_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707689_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707682_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707684_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707685_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707686_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707687_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707688_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707690_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707691_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707692_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707693_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707694_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707695_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707696_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707697_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707698_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707699_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707700_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707701_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707702_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707703_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707704_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707705_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707706_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707683_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KJ647352_SP_P-D      atgcccctatcttatcaatrcttccggagactactgttgttagacgacga
GQ477453_SP_P-D      atgcccctatcttatcaacacttccggagacttctgttgttagatgccga
AY090452_SP_P-D      atgcccctatcttatcaacacttccggagtgtactgttattagacgaaga
KT366494_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN257190_SP_P-D      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
KF053178_SP_P-D      atgcccctatcttatcaacgcttccggagactactgttattagatgccga
KX276856_SP_P-D      atgcccctatcttatcaacacttccggagtgtactgttgttagacaacga
KM577670_SP_P-D      atgcccctatcttatcaatacttccggagacttgtgttattagacaacga
JN257178_SP_P-D      atgcccctatcttatcaacacttccggaaactrctgttgttagacgacga
AY090453_SP_P-D      atgcccctatcttatcaacacttccggagactgctgttgttagacgacga
JN040818_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacaacga
KX276857_SP_P-D      atgcccctatcttatcaacacttccggagacttctgttattagacgacga
MH724216_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ687530_SP_P-D      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF925379_SP_P-D      atgcccctatcttatcaacacttccggagacttgtgttattagacgacga
EU594404_SP_P-D      atgcccctatcttatcaacacttccggagacttgtgttgttagacgacga
KM524346_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacaa
KM524351_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
X97849_SP_P-D        atgcccctatcttatcaacacttccggaaactactgttattagacgacga
KT749828_SP_P-D      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
KM577669_SP_P-D      atgcccctatcttatcaacacttccggaaattactgttgttagacaacga
JN642159_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GU456638_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacaacga
GQ477456_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagaggacga
AB188241_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacgacga
AB119256_SP_P-D      atgcccctatcttatcatcacttccggagattactgttgttagacgacga
AB109479_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AJ627215_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacgacga
AJ627216_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacgacga
AJ627218_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacgacga
JN664941_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacgacga
AB210820_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagaagacga
JN040793_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacaacga
JN040769_SP_P-D      atgcccctatcttatcaacacttccggagattactgttgttagacaacga
GU456668_SP_P-D      atgcccctatcttatcgacacttccggagactactgttgttagacaacga
JN040791_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacaacga
FJ904445_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacaacga
JN040792_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacaacga
KC875289_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacaacga
AB674408_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacaacga
GU456636_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacaacga
KJ647350_SP_P-D      atgcccctatcttatcaacacttccggagactactcttattagacgacga
JN642163_SP_P-D      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KC875297_SP_P-D      atgcccctatcttatcaacacttccggagacttgtgttgttagacaacga
KX196236_SP_P-D      atgcccctatcttatcaacacttccggagacttgtgttgttagacaacga
KC875301_SP_P-D      atgcccctatcttatcaacacttccggagacttgtgttgttagacgacga
KX357637_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KX357638_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KU736924_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KU736925_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KX357639_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GQ183481_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AF043593_SP_P-D      atgcccctatcttatcaacacttccggagacttgtgttgttagacgacga
MK618423_SP_P-D      atgcccctatcttatcaacaattccggagactactgttgttagacgacga
MK618424_SP_P-D      atgcccctatcttatcaacaattccggagactactgttgttagacgacga
MK618425_SP_P-D      atgcccctatcttatcaacaattccggagactactgttgttagacgacga
MK598664_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacgacga
MK598661_SP_P-D      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MH724247_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MH724238_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacaacga
MF925390_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KX260231_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KT749821_SP_P-D      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KT366511_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KT366493_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KT366491_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KT366465_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KM524344_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KC875312_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacaacga
JQ707511_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707497_SP_P-D      atgcccctatcttatcaacaattccggagactactgttgttagacgacga
JN642143_SP_P-D      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FJ349218_SP_P-D      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FJ349208_SP_P-D      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB267090_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagaggacga
AB188242_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB119255_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacgacga
AB119254_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB109478_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacgacga
AB090269_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AJ627222_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
EU594398_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MK598674_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
EU594433_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
EU594426_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AJ627220_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
EU594399_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
EU594425_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
EU594430_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JX096957_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GQ477455_SP_P-D      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF754597_SP_P-D      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KT749827_SP_P-D      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
GQ477457_SP_P-D      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FJ349206_SP_P-D      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
EU414139_SP_P-D      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
EU414138_SP_P-D      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
EU594418_SP_P-D      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FJ349205_SP_P-D      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MK598660_SP_P-D      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
X72702_SP_P-D        atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JF754621_SP_P-D      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KM577668_SP_P-D      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JN642148_SP_P-D      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JN642162_SP_P-D      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KM577671_SP_P-D      atgccccaatcttatcaacacttccggaaactactgttgttagacgacga
AB205127_SP_P-D      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MK598659_SP_P-D      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MK598670_SP_P-D      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KC875310_SP_P-D      atgcgcctatcttatcaacacttccggagactactgttgttagacgacga
JQ707491_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KF779220_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
KX827290_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KX827301_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MK618426_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
EU594411_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
EU594412_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MK598667_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MK598676_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MK598675_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MK598672_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MK598669_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MH724241_SP_P-D      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MH724231_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
EU594419_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
EU594420_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
EU594422_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
EU594423_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
EU594428_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
EU594416_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
EU594408_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
EU594407_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
EU594427_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
EU594401_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
EU594402_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
EU594409_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
EU594417_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
EU594429_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
EU594431_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
EU594432_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JX096958_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MK618422_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AF043594_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
EU594400_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
EU594403_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
EU594405_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
EU594410_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
EU594413_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
EU594414_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
EU594415_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
EU594421_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
EU594424_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GQ477452_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JX096956_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MH724217_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MH724223_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MH724244_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MK598666_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MK598671_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MK598673_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MK598677_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MK598678_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MK598679_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MK618418_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MK618419_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MK618420_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MK618421_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
Z35716_SP_P-D        atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KC875299_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
HQ700510_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacaacga
KC875302_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KC875303_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KC875311_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GQ183482_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GQ183483_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GQ183475_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GQ183474_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GQ183476_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GQ183479_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KT366510_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN642144_SP_P-D      atgcccctatcttatcaacacttccggaaattactgttgttagacgacga
MN507839_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MN507837_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MK516278_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MH724246_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MF925383_SP_P-D      atgcccctatcttatcaacacttccggagactgctgttgttagacgacga
MF925363_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KT366496_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KM524338_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KF679998_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707517_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707513_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707512_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707514_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707515_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707516_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707518_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707519_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707520_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707521_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707522_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707523_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707524_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707525_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707526_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707528_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707529_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707530_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707510_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707498_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707506_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707509_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707493_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707490_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KT151620_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707489_SP_P-D      atgcccctatcttatcgacacttccggagactactgttgttagacgacga
JQ707487_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707480_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707479_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707485_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707499_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN664939_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KF679995_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KR905423_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN664927_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KU668449_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MK598663_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GQ924652_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707483_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707486_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707527_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GQ183472_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GQ183477_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GQ183471_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AJ627223_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GQ183484_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GQ183485_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
HQ700512_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KP322601_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB210821_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB210822_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB120308_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB119252_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB119253_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB090268_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB078031_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB078033_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB090270_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB109475_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB109476_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB109477_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB110075_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB116266_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB119251_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB205126_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB471856_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB471857_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN664928_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN664930_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707476_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707477_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707478_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707481_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707482_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707484_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707488_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707492_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707494_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707495_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707496_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707500_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707501_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707502_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707503_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707504_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707505_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707507_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ707508_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KF679997_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KM524341_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KM524347_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KM524352_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KM524353_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KM524354_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KM524355_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KR905424_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KT366495_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KT366506_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KT366509_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MF925358_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MF925364_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MF925393_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MH932714_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MK598665_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB078032_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN664918_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KF679994_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KF679996_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
EU939680_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacaacga
AB674424_SP_P-D      atgcccctatcttatcaactcttccggagacttctgttattagatccaga
GU456678_SP_P-D      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
AB188244_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GU456674_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
DQ486023_SP_P-D      atgcccctatcttatcaacacttccggagactagtgttgttagacgacga
MK052947_SP_P-D      atgcccctatcttatcaacacttccggaggttactgttgttagaggacga
MK052952_SP_P-D      atgcccctatcttatcaacacttccggaggttactgttgttagaggacga
MK052972_SP_P-D      atgcccctatcttatcaacacttccggaggttactgttgttagaggacga
MK052973_SP_P-D      atgcccctatcttatcaacacttccggaggttactgttgttagaggacga
MK052975_SP_P-D      atgcccctatcttatcaacacttccggaggttactgttgttagaggacga
MK052955_SP_P-D      atgcccctatcttatcaacacttccggagattgctgttgttagaggacga
MK052974_SP_P-D      atgcccctatcttatcaacacttccggagattgctgttgttagaggacga
MK052953_SP_P-D      atgcccctatcttatcaacacttccggagattgctgttgttagaggacga
MK052956_SP_P-D      atgcccctatcttatcaacacttccggagattgctgttgttagaggacga
MK052958_SP_P-D      atgcccctatcttatcaacacttccggagattgctgttgttagaggacga
MK052960_SP_P-D      atgcccctatcttatcaacacttccggagattgctgttgttagaggacga
MK052961_SP_P-D      atgcccctatcttatcaacacttccggagattgctgttgttagaggacga
MK052963_SP_P-D      atgcccctatcttatcaacacttccggagattgctgttgttagaggacga
MK052966_SP_P-D      atgcccctatcttatcaacacttccggagattgctgttgttagaggacga
MK052971_SP_P-D      atgcccctatcttatcaacacttccggagattgctgttgttagaggacga
MK052948_SP_P-D      atgcccctatcttatcaacacttccggaggttgctgttgttagaggacga
MK052954_SP_P-D      atgcccctatcttatcaacacttccggaggttgctgttgttagaggacga
MK052951_SP_P-D      atgcccctatcttatcaacacttccggagattgctgttgttagaggacga
MK052950_SP_P-D      atgcccctatcttatcaacacttccggagattgctgttgttagaggacga
MK052949_SP_P-D      atgcccctatcttatcaacacttccggagattgctgttgttagaggacga
MK052959_SP_P-D      atgcccctatcttatcaacacttccggaggttgctgttgttagaggacga
JN040755_SP_P-D      atgcccctatcttatcaacgcttccggagactactgttgttagacgacga
JF754612_SP_P-D      atgcccctatcttatcaacacttccggagacttgtgttattagacaacga
JF754611_SP_P-D      atgcccctatcttatcaacacttccggaggctactgttattagaggacga
GQ477454_SP_P-D      atgcccctatcttatcaacacttccggaatgtactgttgttagacgacga
AB674410_SP_P-D      atgcccctatcttatcaacacttccggagacttctgttgttagacgacga
AB270550_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
X80924_SP_P-D        atgcccctatcttatcaacacttccggagacttgtgttattagacaacga
X80926_SP_P-D        atgcccctatcttatcaacacttccggagacttgtgttattagacaacga
AB674417_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagaccaaga
AB674418_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagaccaaga
JN040784_SP_P-D      atgcccctatcttatcaacacttccggagacttgtgttgttagacgaaga
KF922432_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN642156_SP_P-D      atgcccctatcttatcaacgcttccggagactactgttattagacgacga
DQ464182_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB674404_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KY629633_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN664932_SP_P-D      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KY629634_SP_P-D      atgcccctatcttatcaacacttccggagactgctgttattagacgacga
EU939681_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
FJ899792_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN257176_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN257177_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MK507913_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KT366499_SP_P-D      atgcccctatcttatcaacacttccggagactgctgttgttagacgacga
KP995100_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KF170739_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN642166_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN642154_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacaacga
JN040810_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacgacga
JN040775_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
HQ833466_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GU456684_SP_P-D      atgcccctatcttatcaacacttccggagacttgtgttgttagacgacga
FJ562309_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AY741797_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB270549_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB270547_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB222710_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacgacga
JN257153_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacgacga
JN257195_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacgacga
FJ904427_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacgacga
GU456681_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacgacga
MK598641_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MK598638_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MK598636_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MK598639_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MK598640_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MK598637_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN257172_SP_P-D      atgcccctatcttatcgacacttccggagactactgttattagacgacga
JN257173_SP_P-D      atgcccctatcttatcgacacttccggagactactgttattagacgacga
DQ464181_SP_P-D      atgcccctatcttatcaacacttccggagacttgtgttgttagacgacga
JN664919_SP_P-D      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JN664920_SP_P-D      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
DQ111986_SP_P-D      atgcccctatcttatcaacacttccggagacttgtgttgttagacnacga
MK598646_SP_P-D      atgcccctatcttatcaacacttccggagacttgtgttgttagacaacga
GQ183480_SP_P-D      atgcccctatcttatcgacacttccggagactactgttgttagacgacga
KM524348_SP_P-D      atgcccctatcttatcaactcttccggagactactgttgttagacgacga
JN040752_SP_P-D      atgcccctatcttatcaatccttccggagactactgttgttagacgacga
JF754599_SP_P-D      atgcccctatcttatcaacacttccggagacttgtgttgttagacgacga
JF754623_SP_P-D      atgcccctatcttatcaacacttccggagacttgtgttgttagacgacga
JN642167_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
M32138_SP_P-D        atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GQ205380_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KM524342_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KU736926_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KF471650_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JQ687531_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AY945307_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JF754603_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN040767_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
HM750155_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
HM750156_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
DQ336683_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
DQ336682_SP_P-D      atgcccctatcttatcaacgcttccggagactactgttgttagacgacga
DQ336680_SP_P-D      atgcccctatcttatcaacgcttccggagactactgttgttagacgacga
DQ336684_SP_P-D      atgcccctatcttatcaacgcttccggagactactgttgttagacgacga
DQ336681_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
FJ349233_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN040826_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN642142_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KC774444_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JF754624_SP_P-D      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
HM750151_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN257182_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GQ183473_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KC774460_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MK598655_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GQ183478_SP_P-D      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JN664948_SP_P-D      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KC774477_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB104711_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AY721607_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
EU414141_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
EU414142_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
EU594382_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KF779214_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MK598651_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KF679992_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KF679993_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KT366497_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KT366507_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MK507912_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MK598657_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
FJ562338_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN642126_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KC774436_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KC774437_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KF679989_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
LT992454_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MK541688_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
X59795_SP_P-D        atgcccctatcttatcaacacttccggagacttgtgttgttagacgacga
JN688695_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN257200_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN040756_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GU456677_SP_P-D      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
GU456676_SP_P-D      atgcccctatcttatcatcacttccggagactactgttgttagacgacga
AJ627224_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GU456665_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MF925391_SP_P-D      atgcccctatcttatcaacacttccggagtgtactgttgttagacgacga
KF471656_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JF754606_SP_P-D      atgcccctatcttatcaacacttccggagacttgtgttgttagacgacga
AB674406_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MK598648_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KF061170_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KF061167_SP_P-D      atgcccctatcttatcmacacttccggagactactgttgttagacgacga
KC774445_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN257211_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN257159_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN040783_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN040772_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
HQ833468_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
HQ833465_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
HQ700489_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
HQ700481_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
HQ700463_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacgacga
EU787441_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
EU787439_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacaacga
EU787438_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacgacga
EU787437_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AY741798_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacaacga
AB222711_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JF754588_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MN507853_SP_P-D      atgcccctatcttatcaacgcttccggagactactgttgttagacgacga
MK618427_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MK598650_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MK598649_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MK598647_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KY629630_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN040790_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
HQ833467_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
HM750152_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
EU919197_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
EU787447_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
HM750154_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
EU787445_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
EU787443_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
EU787440_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
EU787442_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
HM750153_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
HQ833469_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
HQ833470_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
HQ833471_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KC774462_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
EF103276_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB246348_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB270548_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
EU787446_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MN507838_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN040757_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB674403_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GQ183448_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GQ183449_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GQ183450_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GQ183451_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GQ183452_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GQ183453_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GQ183454_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GQ183456_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GQ183457_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GQ183458_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GQ183459_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GQ183460_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GQ183461_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GQ183462_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GQ183463_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GQ183464_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GQ183465_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GQ183466_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GQ183467_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GQ183468_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GQ183469_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN040797_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacgacga
JN040829_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacgacga
MN507836_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MK618434_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MK618435_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MK618436_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MK598642_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KT366508_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN792906_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacgacga
JN792904_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN642150_SP_P-D      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JN257183_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN040760_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JF754598_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN040758_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MK598643_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MK598644_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MK618428_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MN507851_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
HQ700467_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GQ183470_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
FJ349230_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN642164_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
EF103280_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
EF103281_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
EF103275_SP_P-D      atgcccctatcttatcaacgcttccggagactactgttgttagacgacga
HQ700468_SP_P-D      atgcccctatcttatcaacgcttccggagactactgttgttagacgacga
AB246347_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KT366498_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KT366500_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KT366501_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KT366502_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB270543_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB583680_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AF280817_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
EU414135_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
EU594397_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
EU787436_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GQ183455_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GQ377589_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GU357846_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
HQ700440_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
HQ700441_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
HQ700442_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
HQ700443_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
HQ700444_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
HQ700445_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
HQ700446_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
HQ700447_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
HQ700448_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
HQ700449_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
HQ700450_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
HQ700451_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
HQ700459_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
HQ700464_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
HQ700466_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
HQ700469_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
HQ700470_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
HQ700471_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
HQ700473_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
HQ700477_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
HQ700479_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
HQ700480_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
HQ700482_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
HQ700483_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
HQ700484_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
HQ700487_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
HQ700488_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN040794_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN257179_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN257185_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN664931_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN792903_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN792909_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN792910_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KF061168_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
LC365689_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MK507910_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MK507911_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MK507914_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GU456648_SP_P-D      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JN040809_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GU456667_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JF754627_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN040770_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KJ647355_SP_P-D      atgcccctatcctatcaacacttccggagacttgtgttattagacgacga
JN688712_SP_P-D      atgcccctatcctatcaacacttccggagactactgttattagaagacga
MH724245_SP_P-D      atgcccctatcctatcaacacttccggagactactgttattagacaacga
JF439694_SP_P-D      atgcctctatcctatcaacacttccggaaactactgttgttagacgacga
JF439704_SP_P-D      atgcccctaccctatcaacacttccggaaacttgtgttgttagacgacga
JF439705_SP_P-D      atgcccctaccctatcaacacttccggaaacttgtgttgttagacgacga
JF439713_SP_P-D      atgcccctatcctatcaacacttccggaaactactgttgttagacgacga
JF439712_SP_P-D      atgcccctatcctatcaacacttccggaaactactgttgttagacgacga
JF439700_SP_P-D      atgcctctaccctatcaacacttccggaaactactgttgttagacgacga
JF439701_SP_P-D      atgcctctaccctatcaacacttccggaaactactgttgttagacgacga
JF439695_SP_P-D      atgcccctatcctatcaacacttccggaaacttgtgttgttagacgacga
JF439717_SP_P-D      atgcccctatcctatcaacacttccggaaactactgttgttagacgacga
JF439716_SP_P-D      atgcccctatcctatcaacacttccggaaactactgttgttagacgacga
JF439706_SP_P-D      atgcctctatcctatcaacacttccggaaactactgttgttagacgacga
JF439710_SP_P-D      atgcctctatcctatcaacacttccggaaactactgttgttagacgacga
JF439711_SP_P-D      atgcctctatcctatcaacacttccggaaactactgttgttagacgacga
JF439719_SP_P-D      atgcctctatcctatcaacacttccggaaactactgttgttagacgacga
JF439702_SP_P-D      atgcccctatcctatcaacacttccggaaactactgttgttagacgacga
JF439715_SP_P-D      atgcccctatcctatcaacacttccggaaactactgttgttagacgacga
JF439696_SP_P-D      atgcctctatcctatcaacacttccggaaactactgttgttagacgacga
JF439692_SP_P-D      atgcctctatcctatcaacacttccggaaactactgttgttagacgacga
JF439699_SP_P-D      atgcctctatcctatcaacacttccggaaactactgttgttagacgacga
JF439703_SP_P-D      atgcctctatcctatcaacacttccggaaactactgttgttagacgacga
JF439708_SP_P-D      atgcctctatcctatcaacacttccggaaactactgttgttagacgacga
JF439709_SP_P-D      atgcctctatcctatcaacacttccggaaactactgttgttagacgacga
JF439718_SP_P-D      atgcctctatcctatcaacacttccggaaactactgttgttagacgacga
JF439693_SP_P-D      atgcctctatcctatcaacacttccggaaactactgttgttagacgacga
JF439707_SP_P-D      atgcctctatcctatcaacacttccggaaactactgttgttagacgacga
JF754625_SP_P-D      atgcccctatcctatcaacacttccggagactactgttattagacaacga
KF779218_SP_P-D      atgcccctatccaatcaacacttccggaaactactgttgttagaggacga
FJ349211_SP_P-D      atgcccctatcctatcaacacttccggagacttgtgttgttagacgacga
KT749845_SP_P-D      atgcccctatcctatcaacacttccggagactactgttattagacgacga
KF779224_SP_P-D      atgcccctatcctatcaacacttccggaaactactgttgttagacgacga
FJ349214_SP_P-D      atgcccctatcctatcaacgcttccggaaactactgttattagacgacga
KF779289_SP_P-D      atgcccctatcctatcaacacttccggaaactactgttgttagacgacga
JX898694_SP_P-D      atgcccctatcctatcaacacttccggaaactactgttgttagacgacga
KM606745_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
JX470760_SP_P-D      atgcccctatcctatcaacacttccggaaactactgttgttagacgacga
KC012652_SP_P-D      atgcccctatcctatcaacacttccggaaactactgttgttagacgacga
KJ843187_SP_P-D      atgcccctatcctatcaacacttccggaaactactgttgttagacgacga
KX827292_SP_P-D      atgcccctatcctaccaacacttccggaaactactgttgttagacgacga
KF779376_SP_P-D      atgcccctatcctatcaacacttccggaaactactgttgttagacgacga
KF779377_SP_P-D      atgcccctatcctatcaacacttccggaaactactgttgttagacgacga
KF779340_SP_P-D      atgcccctatcctatcaacacttccggaaactactgttgttagacgacga
KF779341_SP_P-D      atgcccctatcctatcaacacttccggaaactactgttgttagacgacga
KF779296_SP_P-D      atgcccctatcctatcaacacttccggaaactactgttgttagacgacga
KF779219_SP_P-D      atgcccctatcctatcaacacttccggaaactactgttgttagacgacga
KF779217_SP_P-D      atgcccctatcctatcaacacttccggaaactactgttgttagacgacga
KF779223_SP_P-D      atgcccctatcctatcaacacttccggaaactactgttgttagacgacga
KF779225_SP_P-D      atgcccctatcctatcaacacttccggaaactactgttgttagacgacga
KF779228_SP_P-D      atgcccctatcctatcaacacttccggaaactactgttgttagacgacga
KF779229_SP_P-D      atgcccctatcctatcaacacttccggaaactactgttgttagacgacga
KF779230_SP_P-D      atgcccctatcctatcaacacttccggaaactactgttgttagacgacga
KF779216_SP_P-D      atgcccctatcctatcaacacttccggaaactactgttgttagacgacga
JX898697_SP_P-D      atgcccctatcctatcaacacttccggaaactactgttgttagacgacga
KF779301_SP_P-D      atgcccctatcctatcaacacttccggaaactactgttgttagacgacga
KF779302_SP_P-D      atgcccctatcctatcaacacttccggaaactactgttgttagacgacga
AJ131956_SP_P-D      atgcccctatcctatcaacacttccggaaactactgttgttagacgacga
JX898691_SP_P-D      atgcccctatcctatcaacacttccggaaactactgttgttagacgacga
JX898692_SP_P-D      atgcccctatcctatcaacacttccggaaactactgttgttagacgacga
JX898689_SP_P-D      atgcccctatcctatcaacacttccggaaactactgttgttagacgacga
KF779209_SP_P-D      atgcccctatcctatcaacacttccggaaactactgttgttagacgacga
KF779212_SP_P-D      atgcccctatcctatcaacacttccggaaactactgttgttagacgacga
KF779222_SP_P-D      atgcccctatcctatcaacacttccggaaactactgttgttagacgacga
KF779285_SP_P-D      atgcccctatcctatcaacacttccggaaactactgttgttagacgacga
KF779288_SP_P-D      atgcccctatcctatcaacacttccggaaactactgttgttagacgacga
KF779292_SP_P-D      atgcccctatcctatcaacacttccggaaactactgttgttagacgacga
KF779303_SP_P-D      atgcccctatcctatcaacacttccggaaactactgttgttagacgacga
KF779318_SP_P-D      atgcccctatcctatcaacacttccggaaactactgttgttagacgacga
KP090178_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
KM524361_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
KU668442_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
KC875334_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacaacga
KX196221_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacaacga
KX196233_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacaacga
KC875333_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
KC875326_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
KC875325_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
KC875317_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
KX196222_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
KX196234_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
KC875316_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
KC875314_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
KC875313_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
KC875319_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
KX196216_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
KC875315_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
KC875332_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
KC875335_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
KP090177_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
KX196218_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
KX196230_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
MH724218_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
MH724219_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
KC875337_SP_P-D      atgcccctatcctatcaacacttccggagacttgtgttgttagacgacga
KX196220_SP_P-D      atgcccctatcctatcaacacttccggagacttgtgttgttagacgacga
KX196232_SP_P-D      atgcccctatcctatcaacacttccggagacttgtgttgttagacgacga
KC875318_SP_P-D      atgcccctatcctatcaacacttccggagacttgtgttgttagacgacga
KC875320_SP_P-D      atgcccctatcctatcaacacttccggagacttgtgttgttagacgacga
KX196217_SP_P-D      atgcccctatcctatcaacacttccggagacttgtgttgttagacgacga
KX196231_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
AM422939_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
DQ315776_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
DQ464168_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
DQ464169_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
DQ464170_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
JN257181_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
JN664910_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
JN664911_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
JN664917_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
JN664937_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
JN664938_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
KM524349_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
KM524350_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
KU668434_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
KU668436_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
KU668437_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
KU668438_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
KU668446_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
MF488704_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
MF618339_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
MF618340_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
MF618341_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
V01460_SP_P-D        atgcccctatcctatcaacacttccggagactactgttgttagacgacga
KC875321_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
KC875336_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
KX196219_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
JN664922_SP_P-D      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FJ349209_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN664909_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN664914_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN664936_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KU668445_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KU668433_SP_P-D      atgcccttatcttatcaacacttccggagactactgttgttagacgacga
KU668435_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN688713_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgagaa
JN664912_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
DQ329356_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgctagacgacga
DQ329357_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
DQ336691_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
FJ349213_SP_P-D      atgcccctatcctatcaacacttccggagacttgtgttgttagacaacga
JN688678_SP_P-D      atgcccctatcctatcaacacttccggagattgttgttgttagacgacga
MH724235_SP_P-D      atgcccctatcctatcaacacttccggagactactgtgcttagacgacga
DQ464172_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacaacga
KF779382_SP_P-D      atgcccctatcctatcaacacttccggagactactgttattagacgacga
DQ336689_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
DQ336685_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
MN507852_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
MH724234_SP_P-D      atgcccctatcctatcaacgcttccggagactactgttattagacgacga
JN688711_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
JN688710_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
JN688683_SP_P-D      atgcccctatcctatcaacacttccggagacttgtgttgttaaacaacaa
HQ236015_SP_P-D      atgcccctatcctatcaacacttccggagacttgtgttgttagacgacga
GQ922000_SP_P-D      atgcccctatcctatcaacacttccggagactactgttattagacgacga
EU921419_SP_P-D      atgcccctatcctatcaacacttccggaaactactgttgttagacgacga
DQ486025_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgaaga
DQ336686_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
DQ336687_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
DQ336688_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
DQ336692_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
AY236164_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
DQ486022_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
DQ464174_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
DQ464173_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
DQ464175_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
DQ336676_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
DQ336677_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
DQ336679_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
DQ464176_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
DQ464177_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
DQ336674_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
AY236160_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
DQ336675_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
DQ336678_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
DQ336690_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
DQ464178_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
DQ486021_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
X85254_SP_P-D        atgcccctatcctatcaacacttccggagactactgttgttagacgacga
MK618441_SP_P-D      atgcccctatcctatcaacacttccggaaactactgttgttagacgacga
MK618443_SP_P-D      atgcccctatcctatcaacacttccggaaactactgttgttagacgacga
MH724242_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
KP090180_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
KC875324_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacaacga
HQ236016_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
EU921418_SP_P-D      atgcccctatcctatcaacacttccggagactactgttattagacgacga
EU594434_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
EU414143_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
AY233296_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
AY233291_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB270537_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
KX196235_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacaacga
FJ692506_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
FJ692507_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
KC875329_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacaacga
MH724233_SP_P-D      atgcccctatcctatcaacacttccggagactagtgttgttagacgacga
KX196224_SP_P-D      atgcccctatcctatcaacacttccggagacttgtgttgttagacgacga
KC875328_SP_P-D      atgcccctatcctatcaacacttccggagacttgtgttgttagacgacga
JN688708_SP_P-D      atgcccctatcctatcaacacttccggagacttgtgttgttagacgacga
JN688679_SP_P-D      atgcccctatcctatcaacacttccggagacttgtgttgttagacgacga
KC875322_SP_P-D      atgcccctatcctatcaacacttccggagacttgtgttgttagacgacga
KC875323_SP_P-D      atgcccctatcctatcaacacttccggagacttgtgttgttagacgacga
KX196225_SP_P-D      atgcccctatcctatcaacacttccggagacttgtgttgttagacgacga
KP090179_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
MH724248_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
MH724237_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
MH724232_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
MH724229_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
MH724225_SP_P-D      atgcccctatcctatcaacacttccggagactactgtggttagacgacga
KP090181_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
KC875331_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
KC875330_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
JN688722_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
HQ236014_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
GQ922001_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
FJ349232_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
AY233294_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
AB493846_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
AY233292_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
GQ922002_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
JN688685_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
KM519455_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
KT347090_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
LT992438_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
MH724214_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
MH724221_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
MH724224_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
MH724227_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
MH724228_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
MH724230_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
X65257_SP_P-D        atgcccctatcctatcaacacttccggagactactgttgttagacgacga
MH724215_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
MH724220_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
HQ700458_SP_P-D      atgcccctatcctatcaacacttccggagactactgttattagacgacga
FJ904439_SP_P-D      atgcccctatcttatcaacacttccggagactgctgttgttagatcaaga
FJ904433_SP_C-D      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
FJ904438_SP_P-D      atgcccctatcttatcaacacttccggagacttgtgttgttagacgacga
JQ927384_SP_P-D      atgcccctatcttatcaacacttccggagacttgtgttrttagacgaaga
KP168419_SP_P-D      atgcccctatcttatcaacacttccggagacttgtgttattagacgaaga
FJ904419_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacgaaga
FJ904395_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
FJ904435_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagaggaaga
FJ904410_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
KJ470889_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KM524358_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacgacga
KF192834_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KF192830_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KF192831_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KF192832_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MF618348_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KJ470896_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KJ470885_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KJ470894_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KJ470893_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KJ470895_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MH724251_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KM606754_SP_P-D      atgcccctatcctatcaacacttccggagtgtactgttgttagacgacga
AB048701_SP_P-D      atgcccctatcctatcaacacttccggaaactactgttgttagacaacga
GQ922005_SP_P-D      atgcccctatcctatccacacttccggagactactgttattagacgacga
KM606755_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
KM606744_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
KM606752_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
GQ922003_SP_P-D      atgcccctatcctatccacacttccggagactactgttattagacgacga
GQ922004_SP_P-D      atgcccctatcctatccacacttccggagactactgttattagacgacga
FJ692532_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
AJ627219_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
FJ692533_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
HQ700455_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
FJ904415_SP_P-D      atgcccctatcttatcaacacttccggagcattctgttgttagacgacga
AB674431_SP_P-D      atgcccctatcttatcatcacttccggagacttgtgttgttagacgacga
GU456637_SP_P-D      atgcccctatcttgtcaacacttccggagacttgtgttgttagacgacga
KX357622_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
JN257214_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN257215_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN664926_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN664924_SP_P-D      atgcccctatcttatcaacacttccggagacttgtgttattagacgacga
JF754619_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacaacga
X97848_SP_P-D        atgcccctatcttatcaacacttccggagactactgttgttagacaacga
GQ167301_SP_P-D      atgcccctatcttatcaacacttcctgagactactgttgttagacgaaga
GQ167302_SP_P-D      atgcccctatcttatcaacacttcctgagactactgttgttagacgaaga
GQ184322_SP_P-D      atgcccctatcttatcaacacttcctgagactactgttgttagacgaaga
JN257186_SP_P-D      atgcccctatcttatcaacacttccggagattactgttgttagacgacga
JF754600_SP_P-D      atgcccctatcttatcaacacttccggagactgctgttattagaccacga
FJ904399_SP_P-D      atgcccctatcttatcaacacttccggagacttctgttgttagacgacga
AY161150_SP_P-D      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AY161151_SP_P-D      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AY161152_SP_P-D      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AY161153_SP_P-D      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AY161154_SP_P-D      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AY161155_SP_P-D      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AY161156_SP_P-D      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB126581_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MH724226_SP_P-D      atgcccctatcttatcaacacttccggagacttgtgttgttagacgacga
MH724249_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MH724250_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MK355501_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacgacga
MF925366_SP_P-D      atgcccctatcttatctacacttccggagacttgtgttgttagacaacga
JN642129_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacaaaga
KF471645_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MK693108_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KM524345_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN642147_SP_P-D      atgcccctatcttatcaacacttcccgagactactgttgttagacgacga
JN642138_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB555496_SP_P-D      atgcccctatcttatcaacacttctggagactgctgttgttagacgacga
JN040787_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
KM524356_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
MF618349_SP_P-D      atgcccctatcttatcaacgcttccggagactactgttgttagacgacga
JN664947_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
JN040814_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
FJ904402_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB674411_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN040812_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GU456669_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagatcccga
AB674428_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacgacga
GU456673_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagaggacga
MH724236_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AY796031_SP_P-D      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JN664921_SP_P-D      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KM524340_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GQ205388_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
GQ205385_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GQ205389_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GQ205382_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MF618342_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GQ205384_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacggcga
MF618343_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
KU668441_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
KU668444_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
JN664913_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
KU668439_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
KU668447_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
KU668448_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
KC875341_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacaacga
JF754614_SP_P-D      atgcccctatcttatcaacacttccggagacttgtgttgttagacgacga
MK598658_SP_P-D      atgcccctatcctatcaacacttccggagactactgttgttagacgacga
MK355500_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MK693107_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KX827291_SP_P-D      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KC875342_SP_P-D      atgcccctatcttatcaacacttccggagacttgtgttgttagacgacga
KX196229_SP_P-D      atgcccctatcttatcaacacttccggagacttgtgttgttagacgacga
JN642155_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN642136_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacgacga
JN257162_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN040788_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN040765_SP_P-D      atgcccctatcttatcaatacttccggagactactgttattagacgacga
JF754631_SP_P-D      atgcccctatcttatcaacacttccggagactgctgttgttagacgacga
JF754626_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacgacga
GU456679_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagaggacga
GU456659_SP_P-D      atgcccctatcttatcaacacttccggagactgctgttattagacgacga
GU456656_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GU456655_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacgacga
GU456641_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
FJ904432_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
FJ904422_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
FJ349234_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagatgccga
FJ349219_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB270539_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB555501_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KC875298_SP_P-D      atgcccctatcttatcaacacttccggagacttgtgttgttagacgacga
KC875300_SP_P-D      atgcccctatcttatcaacacttccggagacttgtgttgttagacgacga
KC875304_SP_P-D      atgcccctatcttatcaacacttccggagacttgtgttgttagacgacga
KX196226_SP_P-D      atgcccctatcttatcaacacttccggagacttgtgttgttagacgacga
KC875276_SP_P-D      atgcccctatcttatcaacacttccggagtctactgttgttagacgacga
KX196214_SP_P-D      atgcccctatcttatcaacacttccggagtctactgttgttagacgacga
KC875282_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KF471657_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KC875280_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KC875275_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KC875278_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KC875281_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KC875284_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KC875285_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KC875291_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KX196210_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KX196213_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JF754635_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN040821_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GU456635_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
EU594396_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB674407_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
HQ700513_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
HQ700514_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MK598668_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB330369_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JX096954_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
MK598662_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB205128_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB330370_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GU456645_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacgacga
JF754595_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacgacga
AY721608_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KF471658_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagatgccga
JN040777_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
EF103279_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
FJ904420_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
FJ904421_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AY161158_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN642130_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GU456647_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacgacga
JN040799_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacgacga
AY161159_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AY161160_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GU456661_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KC875290_SP_P-D      atgcccctatcttatcaacacttccggagacttgtgttgttagacgacga
KC875296_SP_P-D      atgcccctatcttatcaacacttccggagacttgtgttgttagacgacga
KC875307_SP_P-D      atgcccctatcttatcaacacttccggagacttgtgttgttagacgacga
KX196209_SP_P-D      atgcccctatcttatcaacacttccggagacttgtgttgttagacgacga
KX196212_SP_P-D      atgcccctatcttatcaacacttccggagacttgtgttgttagacgacga
KX196228_SP_P-D      atgcccctatcttatcaacacttccggagacttgtgttgttagacgacga
KC875305_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN040751_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KC875288_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KC875293_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KC875294_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KC875306_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KC875308_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KC875309_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KX196208_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KX196211_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN040762_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacgacga
FJ904429_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacgacga
GU456683_SP_P-D      atgcccctatcttatcaacacttccggagactactgttattagacgacga
LT992444_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
LT992439_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KF471653_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KF471644_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KC875340_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KC875292_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KC875279_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN642149_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN257167_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN257151_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN040824_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN040811_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN040786_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN040785_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JF754634_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JF754605_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GU456672_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GU456666_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
FJ904446_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
FJ904418_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
FJ386590_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
HQ700454_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
EU414136_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AY721611_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AY721606_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AY721605_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
FJ904412_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB555497_SP_P-D      atgcccctatcttatcaacacttctggagactactgttgttagacgacga
AB104709_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JF754601_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KF471646_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AY721610_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AY796032_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
FJ349215_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
FJ349216_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
FJ349228_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
FJ349229_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
FJ904443_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GU456653_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GU456662_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
GU456680_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
HQ700511_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JF754615_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JF754628_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN040759_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN040819_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN257193_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN257194_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN257209_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
JN642131_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KC875277_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KC875283_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KC875286_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KC875287_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KC875295_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KF061169_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KP322599_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KP322600_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KX196215_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KX196227_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
KF471659_SP_P-D      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
                     ****    * *    *     ***  *       * *   ** *     *

AB674420_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
X65258_SP_P-D        ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU155895_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU155893_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU414140_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KJ647353_SP_P-D      ggcaggtcccctaaaagaagaactccctcgcctcgcagacgaaggtctca
JN642128_SP_P-D      ggcagggcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JX310733_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JX310735_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB555500_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctaa
JF754630_SP_P-D      gtcaggtcctctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040782_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JF754629_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN642134_SP_P-D      gtcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctaa
JN642133_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JX310734_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
L27106_SP_P-D        ggcaggtcccctagaagaagaactccctcgcctcgccgacgaaggcctca
KT749823_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
JN257160_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN257161_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040802_SP_P-D      cgcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
JF754602_SP_P-D      ggcaggacccctagaagaagaactccctcgcctcgcagacgaagatctca
HQ700478_SP_P-D      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
HQ700553_SP_P-D      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040804_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK693109_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040820_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040766_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040753_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU456639_SP_P-D      ggcaggtcccatagaagaagaactccctcgcctcgcagacgaaggtctca
AB674435_SP_P-D      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN642135_SP_P-D      cgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB674416_SP_P-D      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN642165_SP_P-D      cgcaggacccttagaagaagaactccctcgcctcgcagacgaaggtctca
JN792907_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagaccaaggtctaa
JN792908_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagaccaaggtctaa
KF679990_SP_P-D      ggcaggtcccttagaagaagaactccctcgcctcgcagacgaaggtctca
KF471642_SP_P-D      cgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN257148_SP_P-D      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040773_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU456654_SP_P-D      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB270546_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AY236162_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
DQ304547_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
DQ304550_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
DQ304551_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
DQ304548_SP_P-D      ggcaggtcccctagaagaagaactctctcgcctcgcagacgaaggtctca
DQ304549_SP_P-D      ggcaggtcccctagaagaagaactctctcgcctcgcagacgaaggtctca
AB674419_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HQ700472_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HQ700474_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF584160_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU456682_SP_P-D      agcaggtcctctagaagaagaactccctcgcctcgcagacgaaggtctca
GU456651_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ904426_SP_P-D      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB674430_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB674425_SP_P-D      ggcaggtcccctagaagacgaactccctcgcctcgcagacgaaggtcyca
AB330367_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK618429_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK618430_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK618432_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK618433_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB270541_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB674405_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU456657_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040822_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ349235_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040774_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN792911_SP_P-D      ggcaggtcccctagaacaagaactccctcgcctcgcagacgaaggtctaa
JN792912_SP_P-D      ggcaggtcccctagaacaagaactccctcgcctcgcagacgaaggtctaa
JN257165_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN257166_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JF754617_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040796_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU456652_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB674423_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
JN642161_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JF754607_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU456646_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JF754632_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AY741794_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AY741795_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AY741796_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB674427_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF471640_SP_P-D      ggcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
MK618431_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU736927_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF471647_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JX096955_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
JN792905_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN642158_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN642157_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN642153_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN642146_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN642140_SP_P-D      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN642132_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN257203_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN257187_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN257188_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN257163_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN257149_SP_P-D      ggcaggycccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040817_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040806_SP_P-D      gacaggttccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040779_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040776_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JF754618_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JF754609_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JF754593_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JF754590_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU456660_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU456643_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ477458_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ904424_SP_P-D      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
AB674429_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB674415_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB270540_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF584161_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF584162_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF584163_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF584164_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF584165_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF584166_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY382412_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY382414_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ477459_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040828_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040823_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB104712_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AY721612_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN642145_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtcgcc
JN040800_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040801_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KM524339_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JF754591_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
JN040813_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GU456642_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB222713_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK618437_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF471651_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF471652_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF471649_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KT963508_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC774459_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC774440_SP_P-D      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
JN257199_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN257196_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040827_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040816_SP_P-D      ggcaggtcccctagaagacgaactccctcgcctcgcagacgaaggtctca
JN040815_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040808_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040807_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AY161157_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AF151735_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB674413_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB674426_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AY373431_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AY661792_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AY661793_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AY721609_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AY796030_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
DQ315778_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ349231_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU456649_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JF754596_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JF754608_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040805_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN257152_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN257155_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN257169_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN257205_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MH724252_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
X02496_SP_P-D        ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
Y07587_SP_P-D        ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040750_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AF121239_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AF121242_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU456670_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AF121240_SP_C-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AF121241_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ349220_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU456671_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JF754604_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF471654_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040795_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN257201_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KM606753_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040778_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgcaggtctca
HQ700439_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JF754592_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JF754594_SP_P-D      gtcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JF754622_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF471641_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU456644_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU456640_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JF754610_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB674422_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtmtca
GU456650_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JF754633_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN642151_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF471655_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX827300_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN257202_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN257170_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN257150_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040830_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040781_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040771_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040768_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040761_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040754_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU456675_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU456664_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU456658_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU456663_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EF103277_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AJ344116_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN257171_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB674409_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ349217_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ904431_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF471660_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK598645_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB222712_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB104710_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB222709_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB270542_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040780_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707689_SP_P-D      ggcaggccccctagaggaagaactccctcgcctcgcagacgaaggtctca
JQ707682_SP_P-D      ggcaggccccctagaggaagaactccctcgcctcgcagacgaaggtctca
JQ707684_SP_P-D      ggcaggccccctagaggaagaactccctcgcctcgcagacgaaggtctca
JQ707685_SP_P-D      ggcaggccccctagaggaagaactccctcgcctcgcagacgaaggtctca
JQ707686_SP_P-D      ggcaggccccctagaggaagaactccctcgcctcgcagacgaaggtctca
JQ707687_SP_P-D      ggcaggccccctagaggaagaactccctcgcctcgcagacgaaggtctca
JQ707688_SP_P-D      ggcaggccccctagaggaagaactccctcgcctcgcagacgaaggtctca
JQ707690_SP_P-D      ggcaggccccctagaggaagaactccctcgcctcgcagacgaaggtctca
JQ707691_SP_P-D      ggcaggccccctagaggaagaactccctcgcctcgcagacgaaggtctca
JQ707692_SP_P-D      ggcaggccccctagaggaagaactccctcgcctcgcagacgaaggtctca
JQ707693_SP_P-D      ggcaggccccctagaggaagaactccctcgcctcgcagacgaaggtctca
JQ707694_SP_P-D      ggcaggccccctagaggaagaactccctcgcctcgcagacgaaggtctca
JQ707695_SP_P-D      ggcaggccccctagaggaagaactccctcgcctcgcagacgaaggtctca
JQ707696_SP_P-D      ggcaggccccctagaggaagaactccctcgcctcgcagacgaaggtctca
JQ707697_SP_P-D      ggcaggccccctagaggaagaactccctcgcctcgcagacgaaggtctca
JQ707698_SP_P-D      ggcaggccccctagaggaagaactccctcgcctcgcagacgaaggtctca
JQ707699_SP_P-D      ggcaggccccctagaggaagaactccctcgcctcgcagacgaaggtctca
JQ707700_SP_P-D      ggcaggccccctagaggaagaactccctcgcctcgcagacgaaggtctca
JQ707701_SP_P-D      ggcaggccccctagaggaagaactccctcgcctcgcagacgaaggtctca
JQ707702_SP_P-D      ggcaggccccctagaggaagaactccctcgcctcgcagacgaaggtctca
JQ707703_SP_P-D      ggcaggccccctagaggaagaactccctcgcctcgcagacgaaggtctca
JQ707704_SP_P-D      ggcaggccccctagaggaagaactccctcgcctcgcagacgaaggtctca
JQ707705_SP_P-D      ggcaggccccctagaggaagaactccctcgcctcgcagacgaaggtctca
JQ707706_SP_P-D      ggcaggccccctagaggaagaactccctcgcctcgcagacgaaggtctca
JQ707683_SP_P-D      ggcaggccccctagaggaagaactccctcgcctcgcagacgaaggtctca
KJ647352_SP_P-D      gtcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ477453_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AY090452_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KT366494_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN257190_SP_P-D      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF053178_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctaa
KX276856_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctaa
KM577670_SP_P-D      cgcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
JN257178_SP_P-D      kgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AY090453_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040818_SP_P-D      ggcaggtccactagaagaagaactccctcgcctcgcagacgaaggtctca
KX276857_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcmgacgaaggtctca
MH724216_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcakacgaagatctca
JQ687530_SP_P-D      ggcaggtcccctaaaagaagaactccctcgcctcgcaaacgaagatctca
MF925379_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU594404_SP_P-D      ggcaggacccctagaagaagaactccctcgcctcgcagacgaagatctca
KM524346_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KM524351_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
X97849_SP_P-D        ggcaggacccctagaagaagaactccctcgcctcgcagacgaagatctca
KT749828_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcaaacgaagatctca
KM577669_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN642159_SP_P-D      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
GU456638_SP_P-D      ggcaggttccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ477456_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagaccaagatctaa
AB188241_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB119256_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB109479_SP_P-D      ggcaggtcctctagaagaagaactccctcgcctcgcagacgaaggtctca
AJ627215_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AJ627216_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AJ627218_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
JN664941_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgccgacgaaggtctca
AB210820_SP_P-D      gtcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
JN040793_SP_P-D      ggcaggttccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040769_SP_P-D      ggcaggtcctctagaagaagaactccctcgcctcgcagacgaaggtctca
GU456668_SP_P-D      agcaggttccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040791_SP_P-D      ggcaggttccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ904445_SP_P-D      ggcaggttccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040792_SP_P-D      ggcaggttccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875289_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB674408_SP_P-D      ggcaggtccactagaagaagaactccctcgcctcgcagacgaaggtctca
GU456636_SP_P-D      ggcaggtccactagaagaagaactccctcgcctcgcagacgaaggtctca
KJ647350_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN642163_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875297_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX196236_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875301_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX357637_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KX357638_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KU736924_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KU736925_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KX357639_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ183481_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AF043593_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MK618423_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK618424_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK618425_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK598664_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK598661_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MH724247_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcaaacgaagatctca
MH724238_SP_P-D      ggcaggtcctctagaagaagaactccctcgcctcgcagacgaagatctca
MF925390_SP_P-D      tgcgggtccactagaagaagaactccctcgcctcgcagacgaaggtctca
KX260231_SP_P-D      ggcaggacccctagaagaagaactccctcgcctcgcagacgaagatctca
KT749821_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KT366511_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KT366493_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KT366491_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KT366465_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KM524344_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875312_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707511_SP_P-D      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707497_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN642143_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ349218_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ349208_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB267090_SP_P-D      ggcaggtcctctagaagaagaactccctcgcctcgcagacgaaggtctca
AB188242_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB119255_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB119254_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB109478_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB090269_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AJ627222_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgmagatctca
EU594398_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MK598674_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
EU594433_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
EU594426_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AJ627220_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
EU594399_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
EU594425_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
EU594430_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
JX096957_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ477455_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
JF754597_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KT749827_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ477457_SP_P-D      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
FJ349206_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
EU414139_SP_P-D      ggcaggtcccctagaagaagaamtccctcgcctcgcagacgaagatctca
EU414138_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
EU594418_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
FJ349205_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MK598660_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
X72702_SP_P-D        ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
JF754621_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KM577668_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN642148_SP_P-D      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
JN642162_SP_P-D      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
KM577671_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB205127_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK598659_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK598670_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875310_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707491_SP_P-D      tgcaggtcccgtagaagaagaactccctcgcctcgcagacgaaggtctca
KF779220_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KX827290_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KX827301_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MK618426_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
EU594411_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
EU594412_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MK598667_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MK598676_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MK598675_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MK598672_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MK598669_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MH724241_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MH724231_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
EU594419_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
EU594420_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
EU594422_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
EU594423_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
EU594428_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
EU594416_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
EU594408_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctaa
EU594407_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
EU594427_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
EU594401_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
EU594402_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
EU594409_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
EU594417_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
EU594429_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
EU594431_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
EU594432_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
JX096958_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MK618422_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AF043594_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
EU594400_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
EU594403_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
EU594405_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
EU594410_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
EU594413_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
EU594414_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
EU594415_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
EU594421_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
EU594424_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ477452_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
JX096956_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MH724217_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MH724223_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MH724244_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MK598666_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MK598671_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MK598673_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MK598677_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MK598678_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MK598679_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MK618418_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MK618419_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MK618420_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MK618421_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
Z35716_SP_P-D        ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KC875299_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HQ700510_SP_P-D      cgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875302_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875303_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875311_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ183482_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ183483_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ183475_SP_P-D      ggcaggtcccctagaagaaaaactccctcgcctcgcagacgaaggtctca
GQ183474_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ183476_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ183479_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KT366510_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN642144_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MN507839_SP_P-D      ggcaggtcccctagaagaagaactcccttgcctcgcagacgaaggtctca
MN507837_SP_P-D      ggcaggtcccctagaagaagaaatccctcgcctcgcagacgaaggtctca
MK516278_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MH724246_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MF925383_SP_P-D      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MF925363_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KT366496_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggactca
KM524338_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF679998_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707517_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707513_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707512_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707514_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707515_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707516_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707518_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707519_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707520_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707521_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707522_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707523_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707524_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707525_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707526_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707528_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707529_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707530_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707510_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707498_SP_P-D      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707506_SP_P-D      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707509_SP_P-D      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707493_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707490_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KT151620_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707489_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707487_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707480_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707479_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707485_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707499_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN664939_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF679995_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KR905423_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN664927_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU668449_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK598663_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ924652_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707483_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707486_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707527_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ183472_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ183477_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ183471_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AJ627223_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ183484_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ183485_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HQ700512_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP322601_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB210821_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB210822_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB120308_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB119252_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB119253_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB090268_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB078031_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB078033_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB090270_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB109475_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB109476_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB109477_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB110075_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB116266_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB119251_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB205126_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB471856_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB471857_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN664928_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN664930_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707476_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707477_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707478_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707481_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707482_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707484_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707488_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707492_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707494_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707495_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707496_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707500_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707501_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707502_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707503_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707504_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707505_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707507_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707508_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF679997_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KM524341_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KM524347_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KM524352_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KM524353_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KM524354_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KM524355_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KR905424_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KT366495_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KT366506_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KT366509_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MF925358_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MF925364_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MF925393_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MH932714_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK598665_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB078032_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN664918_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF679994_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF679996_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU939680_SP_P-D      ggcaggtaccctagaagaagaactccctcgcctcgccgacgaaggtctca
AB674424_SP_P-D      agcagggcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU456678_SP_P-D      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB188244_SP_P-D      ggcaggwcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU456674_SP_P-D      ggcaggacccctagaagacgaactccctcgcctcgcagacgaagatctca
DQ486023_SP_P-D      ggcaggacccctagaagaagaactccctcgcctcgaagacgaaggtctca
MK052947_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK052952_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctta
MK052972_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK052973_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK052975_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK052955_SP_P-D      ggcgggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK052974_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgacggtctca
MK052953_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK052956_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK052958_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK052960_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK052961_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK052963_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK052966_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK052971_SP_P-D      ggcaggtcccctagaagaagaactccctcgccccgcagacgaaggtctca
MK052948_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK052954_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK052951_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK052950_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK052949_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK052959_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040755_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
JF754612_SP_P-D      agcaggacctctagaagaagaactccctcgcctcgcagacgaagatctca
JF754611_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ477454_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB674410_SP_P-D      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB270550_SP_P-D      agcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
X80924_SP_P-D        ggcaggacccctagaagaagaactccctcgcctcgcagacgaagatctca
X80926_SP_P-D        ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB674417_SP_P-D      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB674418_SP_P-D      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040784_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF922432_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
JN642156_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
DQ464182_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB674404_SP_P-D      ggcaggycccctggaagaagaactccctcgcctcgcagacgaaggtctca
KY629633_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN664932_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY629634_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU939681_SP_P-D      agcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ899792_SP_P-D      agcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN257176_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN257177_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK507913_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KT366499_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP995100_SP_P-D      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF170739_SP_P-D      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN642166_SP_P-D      ggcaggtcccttagaagaagaactccctcgcctcgcagacgaaggtctca
JN642154_SP_P-D      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040810_SP_P-D      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040775_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HQ833466_SP_P-D      kgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU456684_SP_P-D      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ562309_SP_P-D      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AY741797_SP_P-D      ggcaggtcccctggaagaagaactccctcgcctcgcagacgaaggtctca
AB270549_SP_P-D      tgcaggacccctagaagaagaactccctcgcctcgccgacgaaggtctca
AB270547_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB222710_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN257153_SP_P-D      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN257195_SP_P-D      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ904427_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU456681_SP_P-D      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK598641_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK598638_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK598636_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MK598639_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MK598640_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MK598637_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
JN257172_SP_P-D      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN257173_SP_P-D      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
DQ464181_SP_P-D      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN664919_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN664920_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
DQ111986_SP_P-D      cgcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MK598646_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ183480_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KM524348_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040752_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
JF754599_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JF754623_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN642167_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
M32138_SP_P-D        ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ205380_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KM524342_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU736926_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF471650_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ687531_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AY945307_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcaaacgaaggtctca
JF754603_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040767_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HM750155_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HM750156_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
DQ336683_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
DQ336682_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
DQ336680_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
DQ336684_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
DQ336681_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ349233_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040826_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN642142_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC774444_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JF754624_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HM750151_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN257182_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ183473_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KC774460_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MK598655_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ183478_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
JN664948_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KC774477_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB104711_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AY721607_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU414141_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcrcagacgaaggtctca
EU414142_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU594382_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF779214_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK598651_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF679992_SP_P-D      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
KF679993_SP_P-D      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
KT366497_SP_P-D      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
KT366507_SP_P-D      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
MK507912_SP_P-D      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
MK598657_SP_P-D      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
FJ562338_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN642126_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC774436_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC774437_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF679989_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
LT992454_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK541688_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
X59795_SP_P-D        ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN688695_SP_P-D      ggcaggtcccatagaagaagaactccctcgcctcgcagacgaaggtctca
JN257200_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040756_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU456677_SP_P-D      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU456676_SP_P-D      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
AJ627224_SP_P-D      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU456665_SP_P-D      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
MF925391_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF471656_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JF754606_SP_P-D      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB674406_SP_P-D      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK598648_SP_P-D      cgcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KF061170_SP_P-D      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF061167_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC774445_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcaaacgaaggtctca
JN257211_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN257159_SP_P-D      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040783_SP_P-D      tgcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040772_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HQ833468_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HQ833465_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HQ700489_SP_P-D      ggcaggwcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HQ700481_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgccgacgaaggtctca
HQ700463_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU787441_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU787439_SP_P-D      ggcaggtcccctagaagaagacctccctcgcctcgcagacgaaggtctca
EU787438_SP_P-D      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU787437_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AY741798_SP_P-D      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB222711_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
JF754588_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MN507853_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK618427_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK598650_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK598649_SP_P-D      cgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK598647_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KY629630_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040790_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HQ833467_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HM750152_SP_P-D      ggcaggtcccctagaaaaagaactccctcgcctcgcagacgaaggtctca
EU919197_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU787447_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HM750154_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU787445_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU787443_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU787440_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU787442_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HM750153_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HQ833469_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HQ833470_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HQ833471_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC774462_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EF103276_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB246348_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB270548_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU787446_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MN507838_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040757_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB674403_SP_P-D      tgcgggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ183448_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ183449_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ183450_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ183451_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ183452_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ183453_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ183454_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ183456_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ183457_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ183458_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ183459_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ183460_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ183461_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ183462_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ183463_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ183464_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ183465_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ183466_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ183467_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ183468_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ183469_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040797_SP_P-D      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040829_SP_P-D      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
MN507836_SP_P-D      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK618434_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK618435_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK618436_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK598642_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KT366508_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN792906_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN792904_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN642150_SP_P-D      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN257183_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040760_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JF754598_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040758_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK598643_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK598644_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK618428_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MN507851_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HQ700467_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ183470_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ349230_SP_P-D      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN642164_SP_P-D      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
EF103280_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EF103281_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EF103275_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HQ700468_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB246347_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KT366498_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KT366500_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KT366501_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KT366502_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB270543_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB583680_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AF280817_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU414135_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU594397_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU787436_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ183455_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ377589_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU357846_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HQ700440_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HQ700441_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HQ700442_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HQ700443_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HQ700444_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HQ700445_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HQ700446_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HQ700447_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HQ700448_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HQ700449_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HQ700450_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HQ700451_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HQ700459_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HQ700464_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HQ700466_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HQ700469_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HQ700470_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HQ700471_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HQ700473_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HQ700477_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HQ700479_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HQ700480_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HQ700482_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HQ700483_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HQ700484_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HQ700487_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HQ700488_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040794_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN257179_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN257185_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN664931_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN792903_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN792909_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN792910_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF061168_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
LC365689_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK507910_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK507911_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK507914_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU456648_SP_P-D      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040809_SP_P-D      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU456667_SP_P-D      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
JF754627_SP_P-D      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040770_SP_P-D      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
KJ647355_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN688712_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MH724245_SP_P-D      ggcaggacccctagaagaagaactccctcacctcgcagacgaaggtctca
JF439694_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JF439704_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JF439705_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JF439713_SP_P-D      ggcaggtcccctagaagaaggactccctcgcctcgcagacgaaggtctca
JF439712_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JF439700_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JF439701_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JF439695_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JF439717_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JF439716_SP_P-D      ggcaggtcccctagaagaagaaccccctcgcctcgcagacgaaggtctca
JF439706_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JF439710_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JF439711_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JF439719_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JF439702_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JF439715_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JF439696_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JF439692_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JF439699_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JF439703_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JF439708_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JF439709_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JF439718_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JF439693_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JF439707_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JF754625_SP_P-D      cgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF779218_SP_P-D      ggcaggtcccctagaagaagaactccctcccctcgcagacgaaggtctca
FJ349211_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KT749845_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF779224_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagaccaaggtctct
FJ349214_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF779289_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctct
JX898694_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KM606745_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JX470760_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC012652_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KJ843187_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX827292_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF779376_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF779377_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF779340_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF779341_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF779296_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF779219_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF779217_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF779223_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF779225_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF779228_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF779229_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF779230_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF779216_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctggcagacgaaggtctca
JX898697_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF779301_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF779302_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AJ131956_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JX898691_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JX898692_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JX898689_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF779209_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF779212_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF779222_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF779285_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF779288_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF779292_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF779303_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF779318_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP090178_SP_P-D      ggcaggtcccctagaaaaagaactccctcgcctcgcaaacgaaggtctca
KM524361_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtccca
KU668442_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagaagaaggtctca
KC875334_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX196221_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX196233_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875333_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875326_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875325_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875317_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX196222_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX196234_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875316_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875314_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875313_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875319_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX196216_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875315_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875332_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875335_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP090177_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX196218_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX196230_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MH724218_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MH724219_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875337_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX196220_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX196232_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875318_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875320_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX196217_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX196231_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AM422939_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
DQ315776_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
DQ464168_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
DQ464169_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
DQ464170_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN257181_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN664910_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN664911_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN664917_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN664937_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN664938_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KM524349_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KM524350_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU668434_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU668436_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU668437_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU668438_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU668446_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MF488704_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MF618339_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MF618340_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MF618341_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
V01460_SP_P-D        ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875321_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875336_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX196219_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN664922_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ349209_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN664909_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN664914_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN664936_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU668445_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU668433_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU668435_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN688713_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctagcagacgaaggtctca
JN664912_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
DQ329356_SP_P-D      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
DQ329357_SP_P-D      ggcaggtcccctagaagaagaactccctcacctcgcagacgaagggctca
DQ336691_SP_P-D      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
FJ349213_SP_P-D      cacaggtccactagaagaagaactccctcgcctcgcagacgaaggtctca
JN688678_SP_P-D      ggcaggacccytagaagaagaactccctcgcctcgcagacgaaggtctca
MH724235_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
DQ464172_SP_P-D      ggcaggtcccctacaagaagaactccctcacctcgcagacgaaggtctca
KF779382_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
DQ336689_SP_P-D      ggcaggtcccctagaagaagaactctctcacctcgcagacgaaggtctca
DQ336685_SP_P-D      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
MN507852_SP_P-D      ggcaggacccctagaagaagaactccctcacctcgcagacgaaggtctca
MH724234_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN688711_SP_P-D      ggcaggtcccgtagaagaagaactccctcgcctcgcagacgaaggtctca
JN688710_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagaccaaggtctca
JN688683_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HQ236015_SP_P-D      tgcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
GQ922000_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU921419_SP_P-D      ggcaggtcccctagaagacgaactccctcgcctcgcagacgaaggtctca
DQ486025_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
DQ336686_SP_P-D      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
DQ336687_SP_P-D      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
DQ336688_SP_P-D      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
DQ336692_SP_P-D      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
AY236164_SP_P-D      ggcaggtcccctagaagaagaactctctcacctcgcagacgaaggtctca
DQ486022_SP_P-D      ggcaggtcccctagaagaagaactctctcacctcgcagacgaaggtctca
DQ464174_SP_P-D      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
DQ464173_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
DQ464175_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
DQ336676_SP_P-D      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
DQ336677_SP_P-D      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
DQ336679_SP_P-D      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
DQ464176_SP_P-D      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
DQ464177_SP_P-D      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
DQ336674_SP_P-D      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
AY236160_SP_P-D      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
DQ336675_SP_P-D      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
DQ336678_SP_P-D      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
DQ336690_SP_P-D      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
DQ464178_SP_P-D      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
DQ486021_SP_P-D      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
X85254_SP_P-D        tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK618441_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK618443_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MH724242_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP090180_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875324_SP_P-D      ggcaggtcccccagaagaagaactccctcgcctcgcagacgaaggtctca
HQ236016_SP_P-D      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
EU921418_SP_P-D      ggcaggtcccctagaagacgaactccctcgcctcgcagacgaaggtctca
EU594434_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU414143_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AY233296_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AY233291_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB270537_SP_P-D      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
KX196235_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ692506_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ692507_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875329_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MH724233_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KX196224_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875328_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN688708_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
JN688679_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875322_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875323_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX196225_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP090179_SP_P-D      ggcaggtccccaggaagaagaactccctcgcctcgcagacgaaggtctca
MH724248_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MH724237_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MH724232_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MH724229_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MH724225_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP090181_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875331_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875330_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN688722_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HQ236014_SP_P-D      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
GQ922001_SP_P-D      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ349232_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AY233294_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB493846_SP_P-D      ggcaggtcccctagaagacgaactccctcgcctcgcagacgaaggtctca
AY233292_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ922002_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN688685_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KM519455_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KT347090_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
LT992438_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MH724214_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MH724221_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MH724224_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MH724227_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MH724228_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MH724230_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
X65257_SP_P-D        ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MH724215_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MH724220_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HQ700458_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
FJ904439_SP_P-D      agcaggtcccttagaagaagaactccctcgcctcgcagacgaaggtctca
FJ904433_SP_C-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ904438_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ927384_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP168419_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ904419_SP_P-D      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ904395_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ904435_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ904410_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctaa
KJ470889_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KM524358_SP_P-D      gtcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF192834_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF192830_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF192831_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF192832_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MF618348_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KJ470896_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KJ470885_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KJ470894_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KJ470893_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KJ470895_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MH724251_SP_P-D      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KM606754_SP_P-D      ggcaggtcccctacaagaagaactccctcgcctcgcagacgaagatctca
AB048701_SP_P-D      ggcaggaccattagaagaagaactccctcgcctcgcagacgaagatctca
GQ922005_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KM606755_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KM606744_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KM606752_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ922003_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ922004_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
FJ692532_SP_P-D      ggcaggtcccctagaagaagaactccctcscctcgcagacgaagatctca
AJ627219_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
FJ692533_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
HQ700455_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctygcaramgaaggtytca
FJ904415_SP_P-D      ggcaggtcccctagaagaagaactccctcgcgtagcagtcgaaggtgtca
AB674431_SP_P-D      cgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU456637_SP_P-D      cgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX357622_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN257214_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN257215_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN664926_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN664924_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JF754619_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
X97848_SP_P-D        ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GQ167301_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ167302_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ184322_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcg
JN257186_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JF754600_SP_P-D      ggcaggtcccttagaagaagaactccctcgcctcgcagacgaaggtctca
FJ904399_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagwcgaaggtstca
AY161150_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AY161151_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AY161152_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AY161153_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AY161154_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AY161155_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AY161156_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB126581_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MH724226_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MH724249_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MH724250_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK355501_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MF925366_SP_P-D      cgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN642129_SP_P-D      cgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF471645_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK693108_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KM524345_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgacggtctca
JN642147_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN642138_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB555496_SP_P-D      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040787_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KM524356_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MF618349_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN664947_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040814_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
FJ904402_SP_P-D      ggcaggacccctagaagaagaactccctcgcctagcagacgaaggtgtca
AB674411_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040812_SP_P-D      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU456669_SP_P-D      cgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctaa
AB674428_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU456673_SP_P-D      cgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MH724236_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AY796031_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN664921_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KM524340_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ205388_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ205385_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ205389_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ205382_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MF618342_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ205384_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MF618343_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU668441_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU668444_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN664913_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU668439_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU668447_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU668448_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875341_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JF754614_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK598658_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK355500_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK693107_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX827291_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgccgacgaaggtctca
KC875342_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX196229_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN642155_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN642136_SP_P-D      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN257162_SP_P-D      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040788_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040765_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JF754631_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JF754626_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU456679_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctaa
GU456659_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU456656_SP_P-D      gtcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GU456655_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU456641_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ904432_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctmgcagacgaagatctca
FJ904422_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ349234_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ349219_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB270539_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB555501_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875298_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875300_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875304_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX196226_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875276_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX196214_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875282_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF471657_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875280_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875275_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875278_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875281_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875284_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875285_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875291_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX196210_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX196213_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JF754635_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
JN040821_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GU456635_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
EU594396_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB674407_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HQ700513_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HQ700514_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK598668_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB330369_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
JX096954_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
MK598662_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB205128_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB330370_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
GU456645_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JF754595_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AY721608_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF471658_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040777_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EF103279_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcaaacgaaggtctca
FJ904420_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ904421_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AY161158_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN642130_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU456647_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040799_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AY161159_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AY161160_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU456661_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875290_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875296_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875307_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX196209_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX196212_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX196228_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875305_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040751_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875288_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875293_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875294_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875306_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875308_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875309_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX196208_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX196211_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040762_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ904429_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU456683_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
LT992444_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
LT992439_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF471653_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF471644_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875340_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875292_SP_P-D      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875279_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN642149_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN257167_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN257151_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040824_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040811_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040786_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040785_SP_P-D      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JF754634_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JF754605_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU456672_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU456666_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ904446_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ904418_SP_P-D      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ386590_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HQ700454_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU414136_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AY721611_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AY721606_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AY721605_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ904412_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB555497_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB104709_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JF754601_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF471646_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AY721610_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AY796032_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ349215_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ349216_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ349228_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ349229_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ904443_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU456653_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU456662_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU456680_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HQ700511_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JF754615_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JF754628_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040759_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN040819_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN257193_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN257194_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN257209_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN642131_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875277_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875283_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875286_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875287_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC875295_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF061169_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP322599_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP322600_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX196215_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX196227_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF471659_SP_P-D      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
                       * **  *     *  *      * **  *            *      

AB674420_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aacctcaatgatctt
X65258_SP_P-D        atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgaacaa
EU155895_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatcatcct
EU155893_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatcct
EU414140_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatcwt
KJ647353_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---gatctcaatgatctt
JN642128_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
JX310733_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
JX310735_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aacctcaatgatctt
AB555500_SP_P-D      atcgccgtgtcgcagaagatctcaatctcggg---acgcccaatgatctt
JF754630_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatcccaatgatctt
JN040782_SP_P-D      atcgccgcgtcgcagaagatctcaatctaggg---aatccagatgatctt
JF754629_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---gatctcaatgatctt
JN642134_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
JN642133_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---gatctcaatgatcat
JX310734_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
L27106_SP_P-D        atcgccgcgtcgcagaagatctcaatctcggg---gatctcaatgatctt
KT749823_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aacctcaatgatctt
JN257160_SP_P-D      atcgcckcgtcgcagamgatctaaatctcggg---aatctcaatgatctt
JN257161_SP_P-D      atcgcckcgtcgcagamgatctaaatctcggg---aatctcaatgatctt
JN040802_SP_P-D      atcgccgcgtcgcagaagatctcaatctaggg---aatctcaatgatctt
JF754602_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatcccaatgatctt
HQ700478_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
HQ700553_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
JN040804_SP_P-D      atcgccgcgtcgcagaagatctaaatctcggg---aatctca---atctt
MK693109_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aacctcaatgattct
JN040820_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatcgt
JN040766_SP_P-D      atcgcctcgtcgcagaagatctcaatctaggg---aagctcaatgatctt
JN040753_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatccaaatgatctt
GU456639_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
AB674435_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatcttaatgatctt
JN642135_SP_P-D      atcgccgcgtcgcagaagatctcagtctcggg---aatctcaatgatctt
AB674416_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatcccaatgatctt
JN642165_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
JN792907_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aacctcaatgatctt
JN792908_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aacctcaatgatctt
KF679990_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---gatcccaatgatcct
KF471642_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctaaatgatctt
JN257148_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctaaatgatcat
JN040773_SP_P-D      atcgccgcgtcgcagaagatctccatctcggg---gatctcaatgatctt
GU456654_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---actcccaatgatcgt
AB270546_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
AY236162_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---gatctcaatgatctt
DQ304547_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---gatctcaatgatctt
DQ304550_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---gatctcaatgatctt
DQ304551_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---gatctcaatgatctt
DQ304548_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---gatctcaatgatctt
DQ304549_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---gatctcaatgatctt
AB674419_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---actctcaatgatctt
HQ700472_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatcccactgatctt
HQ700474_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
KF584160_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatytcaatgatctt
GU456682_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aacctcaatgatctt
GU456651_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aacctccatgatctt
FJ904426_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aacctcaatgatctt
AB674430_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aacctcaatgatctt
AB674425_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
AB330367_SP_P-D      atcgccgcgtcgccgaagatctcaatctcggg---aatctcaatgatctt
MK618429_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
MK618430_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
MK618432_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
MK618433_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
AB270541_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---gatctcaatgatctt
AB674405_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---gatctcaatgatctt
GU456657_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcactgatctt
JN040822_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatcccaatgatctt
FJ349235_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---gatctcaatgatctt
JN040774_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---gatctcaatgatctt
JN792911_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aacctcaatgatctt
JN792912_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aacctcaatgatctt
JN257165_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---gatcccaatgatctt
JN257166_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---gatcccaatgatctt
JF754617_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---gatctcaatgatctt
JN040796_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---gatctcaatgatctt
GU456652_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aacctcaatgatctt
AB674423_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---actctcaatgatctt
JN642161_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aacctcaatgatctt
JF754607_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---gatctcaatgatctt
GU456646_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aacctcaatgatctt
JF754632_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aacctcaatgatcct
AY741794_SP_P-D      atcgccgcgtcgcacaagatctcaatctcggg---gatctcaatgatctt
AY741795_SP_P-D      atcgccgcgtcgcacaaaatctcaatctcggg---gatctcaatgatctt
AY741796_SP_P-D      atcgccgcgtcgcacaaaatctcaatctcggg---gatctcaatgatctt
AB674427_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---gatcccaatgatctt
KF471640_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---gatcccaatgatctt
MK618431_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
KU736927_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aacctcaatgatcct
KF471647_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
JX096955_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
JN792905_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aacctcaatgatctt
JN642158_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aacctcaatgatctt
JN642157_SP_P-D      atcgccgcgtcgcagaagatctccatctcggg---gatctcaatgatctt
JN642153_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aacctcaatgatctt
JN642146_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatcat
JN642140_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aacctcaatgatctt
JN642132_SP_P-D      atcgccgcgtcgcagaagatctcaatctaggg---aatctcactgatctt
JN257203_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
JN257187_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
JN257188_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
JN257163_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aacctcaatgatctt
JN257149_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
JN040817_SP_P-D      atcgccgcgtcgcagaagatctaaatctcggg---aatctcaatgatctt
JN040806_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
JN040779_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aacctcaatgatctt
JN040776_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aaccccaatgatctt
JF754618_SP_P-D      atcgccgcgtcgcaaaagatctcaatctcggg---aatctcaatgatctt
JF754609_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aacctcaatgatcgt
JF754593_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aacctcaatgatctt
JF754590_SP_P-D      atcgccgcgtcgcagaagatctcaatctaggg---aacctcaatgatctt
GU456660_SP_P-D      atcgccgcgtcgcagaagatctcaatctaggg---aacctcaatgatctt
GU456643_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
GQ477458_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aacctcaatgatctt
FJ904424_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aacctcaatgatctt
AB674429_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgaactt
AB674415_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---gatcccaatgatctt
AB270540_SP_P-D      atcgccgcgtcgcagaagatctcaatctaggg---aaccccaatgatctt
KF584161_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
KF584162_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
KF584163_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
KF584164_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
KF584165_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
KF584166_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
KY382412_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
KY382414_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
GQ477459_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
JN040828_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
JN040823_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
AB104712_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
AY721612_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
JN642145_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
JN040800_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcgatgatctt
JN040801_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcgatgatctt
KM524339_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcgatgatctt
JF754591_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
JN040813_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
GU456642_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatccaaatgatctt
AB222713_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatcat
MK618437_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
KF471651_SP_P-D      atcgccgcgtcgccgaagatctcaatctcggg---aatctcaatgatctt
KF471652_SP_P-D      atcgccgcgtcgccgaagatctcaatctcggg---aatctcaatgatctt
KF471649_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
KT963508_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
KC774459_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
KC774440_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
JN257199_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
JN257196_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
JN040827_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
JN040816_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
JN040815_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
JN040808_SP_P-D      atcgccgcatcgcagaagatctcaatctcggg---aatctcaatgatctt
JN040807_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
AY161157_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
AF151735_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
AB674413_SP_P-D      atcgccgcgtcgcagaagatctcaatctaggg---aatctcaatgatctt
AB674426_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
AY373431_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
AY661792_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
AY661793_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
AY721609_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
AY796030_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
DQ315778_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
FJ349231_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
GU456649_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
JF754596_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
JF754608_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
JN040805_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
JN257152_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
JN257155_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
JN257169_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
JN257205_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
MH724252_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
X02496_SP_P-D        atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
Y07587_SP_P-D        atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
JN040750_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---gatctcaatgatctt
AF121239_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---gatctcaatgatctt
AF121242_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---gatctcaatgatctt
GU456670_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---gatctcaatgatctt
AF121240_SP_C-D      atcgccgcgtcgcagaagatctcaatctcggg---gatctcaatgatctt
AF121241_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---gatctcaatgatctt
FJ349220_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---gatctcaatgatctt
GU456671_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---gatctcaatgatctt
JF754604_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---gatctcaatgatctt
KF471654_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---gatctcaatgatctt
JN040795_SP_P-D      atcgccgcgtcgcagaagatctccatctcggg---gatctcaatgatctt
JN257201_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---gatctcaatgatctt
KM606753_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aatctcaatgatctt
JN040778_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aacctcaatgatctt
HQ700439_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---gatcccaatgatctt
JF754592_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aacctcaatgatctt
JF754594_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aacctcaatgatctt
JF754622_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aacctcaatgatctt
KF471641_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aacctcaatgatctt
GU456644_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aacctcaatgacctt
GU456640_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aacctcaatgatctt
JF754610_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aacctcaatgatctt
AB674422_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aacctcaatgatctt
GU456650_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aacctcaatgatctt
JF754633_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aacctcaatgatctt
JN642151_SP_P-D      atcgccgcgtcgcagaagatctcaatctcggg---aacctcaatgatctt
KF471655_SP_P-D      atcgccgcgtcgcagaagatc