HBVdb

Dataset for nucleotide sequence SP of genotype B

[Download (right click)] [Alignment] [Repertoires]

2282 sequence(s)

>gnl|hbvcds|AB010289_SP_P-B Feature FT:CDS AB010289_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Yamagata-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggatg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB010290_SP_P-B Feature FT:CDS AB010290_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Yamagata-2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB010291_SP_P-B Feature FT:CDS AB010291_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Yamagata-3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB010292_SP_P-B Feature FT:CDS AB010292_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Yamagata-4). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcctaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB014366_SP_P-B Feature FT:CDS AB014366_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 07D07HCC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB031266_SP_P-B Feature FT:CDS AB031266_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV VietF-3). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB031267_SP_P-B Feature FT:CDS AB031267_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV VietF-6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB033554_SP_P-B Feature FT:CDS AB033554_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate RTB299). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgatcatcaaccaccagcac
aggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtataaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB033555_SP_P-B Feature FT:CDS AB033555_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate PAD744). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccccgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctttgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB048705_SP_P-B Feature FT:CDS AB048705_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcaacgaccaccagcac
gggaccttgcagaacctgcacgatcactgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB073821_SP_P-B Feature FT:CDS AB073821_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi20). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaygaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073822_SP_P-B Feature FT:CDS AB073822_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi32). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073823_SP_P-B Feature FT:CDS AB073823_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi35). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacgaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatccctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073824_SP_P-B Feature FT:CDS AB073824_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaccacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgatcgtcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073825_SP_P-B Feature FT:CDS AB073825_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi51). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaacgcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073826_SP_P-B Feature FT:CDS AB073826_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi89). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggatg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073827_SP_P-B Feature FT:CDS AB073827_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-HK11). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073828_SP_P-B Feature FT:CDS AB073828_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-HK37). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgttcaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073829_SP_P-B Feature FT:CDS AB073829_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-HK38). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073830_SP_P-B Feature FT:CDS AB073830_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-TH57). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacrcttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactactgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073831_SP_P-B Feature FT:CDS AB073831_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-TH61). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073832_SP_P-B Feature FT:CDS AB073832_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Th65). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaggaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073833_SP_P-B Feature FT:CDS AB073833_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi59). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073834_SP_P-B Feature FT:CDS AB073834_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Vi16). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073835_SP_P-B Feature FT:CDS AB073835_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Vi29). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073836_SP_P-B Feature FT:CDS AB073836_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Tw25). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073837_SP_P-B Feature FT:CDS AB073837_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ku1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcatgggcttccgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073838_SP_P-B Feature FT:CDS AB073838_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ho7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacaacgaygcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctaaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073839_SP_P-B Feature FT:CDS AB073839_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Tw174). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073840_SP_P-B Feature FT:CDS AB073840_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Tw36). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073841_SP_P-B Feature FT:CDS AB073841_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Tw30). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
cggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073842_SP_P-B Feature FT:CDS AB073842_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Iw11). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcctaatgatcttcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgctgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073843_SP_P-B Feature FT:CDS AB073843_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Iw27). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcaccactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073844_SP_P-B Feature FT:CDS AB073844_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-T11). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073845_SP_P-B Feature FT:CDS AB073845_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ya16). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073846_SP_P-B Feature FT:CDS AB073846_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry565). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccacgtcgcagaagatctcaatctcgggaatcccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggatg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073847_SP_P-B Feature FT:CDS AB073847_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Fu53). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073848_SP_P-B Feature FT:CDS AB073848_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-HUS). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggatg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073849_SP_P-B Feature FT:CDS AB073849_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Na101). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaacttstgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcrccgcgtcgcagaagatctcaatctagggaaccccaatgatcatcaaccaccagcac
gggrccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073850_SP_P-B Feature FT:CDS AB073850_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Na102). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggatg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073851_SP_P-B Feature FT:CDS AB073851_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacagctcctgctcaaggaaactttacgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttcttt
tggctcagtttactag
>gnl|hbvcds|AB073852_SP_P-B Feature FT:CDS AB073852_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry11). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073853_SP_P-B Feature FT:CDS AB073853_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry24). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073854_SP_P-B Feature FT:CDS AB073854_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry30). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073855_SP_P-B Feature FT:CDS AB073855_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry34). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgacgcaggtcccctagaagaagaactccctcg
cctcgcagacgagggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcctaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073856_SP_P-B Feature FT:CDS AB073856_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry46). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaatccttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcataagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggatg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073857_SP_P-B Feature FT:CDS AB073857_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry48). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccactgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB073858_SP_P-B Feature FT:CDS AB073858_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Shin). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaacttgtgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctaggggatcccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctttgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB100695_SP_P-B Feature FT:CDS AB100695_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-VH133). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccccccttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB106884_SP_P-B Feature FT:CDS AB106884_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB115551_SP_P-B Feature FT:CDS AB115551_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-CB15). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB117759_SP_P-B Feature FT:CDS AB117759_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-CB14). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcgaaacccctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB195933_SP_P-B Feature FT:CDS AB195933_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
gggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB195934_SP_P-B Feature FT:CDS AB195934_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
gggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB195935_SP_P-B Feature FT:CDS AB195935_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
gggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB205119_SP_P-B Feature FT:CDS AB205119_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-IF687-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB205120_SP_P-B Feature FT:CDS AB205120_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-IF687-2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggcttccgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB205121_SP_P-B Feature FT:CDS AB205121_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-IF720-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggatg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB205122_SP_P-B Feature FT:CDS AB205122_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-VH69-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcccgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB212625_SP_P-B Feature FT:CDS AB212625_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate VT1026). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaacaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcgaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB212626_SP_P-B Feature FT:CDS AB212626_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate VT1022). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatggttccctcatgttgctgtacaaaacctacggaca
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB219426_SP_P-B Feature FT:CDS AB219426_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Patient #4014, PNN1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttattagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcctgttgctgtataaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB219427_SP_P-B Feature FT:CDS AB219427_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Patient #4075, PNN2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttattagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcctgttgctgtacaaaacctacggaag
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB219428_SP_C-B Feature FT:CDS AB219428_SP_C-B of [Viruses] Hepatitis B Virus genotype B (isolate Patient #4076, PNN3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcctgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB219429_SP_P-B Feature FT:CDS AB219429_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Patient #4101, PNN4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttattagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcgaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcctgttgctgtataaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB219430_SP_P-B Feature FT:CDS AB219430_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Patient #4148, PNN5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB231909_SP_P-B Feature FT:CDS AB231909_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate VH10). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtttcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
tggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB241116_SP_P-B Feature FT:CDS AB241116_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate PhHCC03). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttattagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctacgtttccctcctgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB241117_SP_P-B Feature FT:CDS AB241117_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate PhHCC05). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttattagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctacgtttccctcctgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB246339_SP_P-B Feature FT:CDS AB246339_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccgtcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB246340_SP_P-B Feature FT:CDS AB246340_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB246341_SP_P-B Feature FT:CDS AB246341_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaaccaccagcac
gggatcatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggatg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB246342_SP_P-B Feature FT:CDS AB246342_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggatg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB246343_SP_P-B Feature FT:CDS AB246343_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB287314_SP_P-B Feature FT:CDS AB287314_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alaska433). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaaccaccagcac
cggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB287315_SP_P-B Feature FT:CDS AB287315_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alaska419). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaaccaccagcac
cggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB287316_SP_P-B Feature FT:CDS AB287316_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alaska427). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagtcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaaccaccagcac
cggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB287317_SP_P-B Feature FT:CDS AB287317_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alaska416). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaatacttccggaaactactgttgttagacgacgaggcaggtcccctggaagaagaactccctcg
cctcgcagacgaagatctaaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaaccaccagcac
cggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB287318_SP_P-B Feature FT:CDS AB287318_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alaska2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctggaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaaccaccagcac
cggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB287319_SP_P-B Feature FT:CDS AB287319_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate AlaskaG23). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
cggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB287320_SP_P-B Feature FT:CDS AB287320_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Greenland-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB287321_SP_P-B Feature FT:CDS AB287321_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Greenland-2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctattattagacgacgaggcaggagccctagaagaagaactccctcg
cctcgcagacccagatctcaatcaccgcgtcgcagaagatctcaatctcggggaccccaatgatcatcaaccaccagcac
gggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB287322_SP_P-B Feature FT:CDS AB287322_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Greenland-3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB287323_SP_P-B Feature FT:CDS AB287323_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Greenland-4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagaccaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB287324_SP_P-B Feature FT:CDS AB287324_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Greenland-5). Partial genome (Contains: HBc, HBx, MHBs, SHBs). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgatgcaggtccactggaagaagaactccctcg
cctcgcagaccaagatctaaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB287325_SP_P-B Feature FT:CDS AB287325_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Greenland-6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaagggacctctatgtttccctcatgttgttgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB287326_SP_P-B Feature FT:CDS AB287326_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate JPN Bj A44). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacatctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB287327_SP_P-B Feature FT:CDS AB287327_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate JPN Bj A53). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgcaggtctaaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctttgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB287328_SP_P-B Feature FT:CDS AB287328_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate JPN Ba 51). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccgtcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB287329_SP_P-B Feature FT:CDS AB287329_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate JPN Ba A55). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB300364_SP_P-B Feature FT:CDS AB300364_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB300370_SP_P-B Feature FT:CDS AB300370_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient12). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctagggaaccccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcacggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB300371_SP_P-B Feature FT:CDS AB300371_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient13). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaactcttccggaaactactgttgttagacaacgaggcaggtcctctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccgtcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB302095_SP_P-B Feature FT:CDS AB302095_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaaactcttcgattccctcatgttgctgtacaaaacctacggatg
gaaactgcacctgtattcccatcccatcgtcatgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB302942_SP_P-B Feature FT:CDS AB302942_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GRE3837NN). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcctctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaaccaccagcac
cggaacatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB302943_SP_P-B Feature FT:CDS AB302943_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GRE3639NN). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaaccaccagcac
cggaacatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB302944_SP_P-B Feature FT:CDS AB302944_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GRE3641NN). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcctctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaaccaccagcac
cggaacatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB302945_SP_P-B Feature FT:CDS AB302945_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GRE3643NN). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcctctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaaccaccagcac
cggaacatgcaaaacctgcacgactcctgttcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB362933_SP_P-B Feature FT:CDS AB362933_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccacaagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB365445_SP_P-B Feature FT:CDS AB365445_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate BOL1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
gggaccatgcaaaacctgcacaacgcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB368295_SP_P-B Feature FT:CDS AB368295_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB471854_SP_P-B Feature FT:CDS AB471854_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F5M-F). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB471855_SP_P-B Feature FT:CDS AB471855_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F5M-C). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB493827_SP_P-B Feature FT:CDS AB493827_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 25UC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB493833_SP_P-B Feature FT:CDS AB493833_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate P9). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB493835_SP_P-B Feature FT:CDS AB493835_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate P30). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtataaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB555498_SP_P-B Feature FT:CDS AB555498_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-TA41). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB555499_SP_P-B Feature FT:CDS AB555499_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-TA62). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaggaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcctaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB642093_SP_P-B Feature FT:CDS AB642093_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate BFJT1999-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttrttagacgacgagtcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
gggaccatgcaaaacmtgcacaactcctgctcaaggaacctctatgtttccctcatgctgytgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcrtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB642094_SP_P-B Feature FT:CDS AB642094_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate BFJT1999-2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacgaccagcac
cggaccatgcaaaacctgcacractactgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB642101_SP_P-B Feature FT:CDS AB642101_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate BFJT2009-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctagggaaccccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB675676_SP_P-B Feature FT:CDS AB675676_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 10A37). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB713527_SP_P-B Feature FT:CDS AB713527_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YOGHhbv30). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcatggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB713528_SP_P-B Feature FT:CDS AB713528_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YOGHhbv44). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcctgttgctgtacaaaacctatggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB713529_SP_P-B Feature FT:CDS AB713529_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YOGHhbv68). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaaactctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB713530_SP_P-B Feature FT:CDS AB713530_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YOGHhbv94). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaaactctatgtttccctcatggtgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
gggctcagtttactag
>gnl|hbvcds|AB713531_SP_P-B Feature FT:CDS AB713531_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YOGHhbv98). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB713532_SP_P-B Feature FT:CDS AB713532_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YOGHhbv132). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcatggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB828708_SP_P-B Feature FT:CDS AB828708_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HB12-0626). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcrccgcgtcgcagaagatctcaatctcgggactctcaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcctgggctttcgtaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB900095_SP_P-B Feature FT:CDS AB900095_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB900096_SP_P-B Feature FT:CDS AB900096_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttattagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcctaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB900097_SP_P-B Feature FT:CDS AB900097_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgccgacgcaggtctcaatcgccgcgtcgcagaagatctcaatctagggaaccccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctwtgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB900098_SP_P-B Feature FT:CDS AB900098_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgatcatcaaccaccagcac
cggaccatgcaagacctgcacagctcctgctcaaggaacctctatgtttccctcatgctgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB900102_SP_P-B Feature FT:CDS AB900102_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcctaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB900103_SP_P-B Feature FT:CDS AB900103_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggatg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB900104_SP_P-B Feature FT:CDS AB900104_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB900105_SP_P-B Feature FT:CDS AB900105_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggatg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB900106_SP_P-B Feature FT:CDS AB900106_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacaacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgatcctcaaccaccagcac
gggaccatgcaagacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|AB900107_SP_P-B Feature FT:CDS AB900107_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaaccaccagcac
cggaccctgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggatg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB900108_SP_P-B Feature FT:CDS AB900108_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttrttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccgatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB900110_SP_P-B Feature FT:CDS AB900110_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB900111_SP_P-B Feature FT:CDS AB900111_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=339 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaggacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggatcgatcccaatgatcatcraccaccag
cacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacgg
acggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttc
tcttggctcagtttactag
>gnl|hbvcds|AB900112_SP_P-B Feature FT:CDS AB900112_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacggggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB931168_SP_P-B Feature FT:CDS AB931168_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1P_HB11-1417). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctggaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB931169_SP_P-B Feature FT:CDS AB931169_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1S_HB11-1418). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctggaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggatg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AB976562_SP_P-B Feature FT:CDS AB976562_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate AK8). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacaacgaggcagggcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AF100308_SP_P-B Feature FT:CDS AF100308_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AF100309_SP_P-B Feature FT:CDS AF100309_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AF121243_SP_P-B Feature FT:CDS AF121243_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/14611). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AF121244_SP_P-B Feature FT:CDS AF121244_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/15122). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AF121245_SP_P-B Feature FT:CDS AF121245_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/16091). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AF121246_SP_P-B Feature FT:CDS AF121246_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/IK29902). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AF121247_SP_P-B Feature FT:CDS AF121247_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/719). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacrrctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgyaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AF121248_SP_P-B Feature FT:CDS AF121248_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/139-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagttcactag
>gnl|hbvcds|AF121249_SP_P-B Feature FT:CDS AF121249_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/4014). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AF121250_SP_P-B Feature FT:CDS AF121250_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/6395). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AF121251_SP_P-B Feature FT:CDS AF121251_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/9873). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AF282917_SP_P-B Feature FT:CDS AF282917_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-B1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacgaccagcac
tggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AF282918_SP_P-B Feature FT:CDS AF282918_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-B2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AF461360_SP_P-B Feature FT:CDS AF461360_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate FH14-2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacgaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagttcactag
>gnl|hbvcds|AF461362_SP_P-B Feature FT:CDS AF461362_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate FH10). Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcatcaacaaccagcac
tggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AF479684_SP_P-B Feature FT:CDS AF479684_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 3c). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacggagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
gggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AJ627225_SP_P-B Feature FT:CDS AJ627225_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 19749). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacagctcctgctcaaggcacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AP011084_SP_P-B Feature FT:CDS AP011084_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
gggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AP011085_SP_P-B Feature FT:CDS AP011085_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AP011086_SP_P-B Feature FT:CDS AP011086_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatatttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AP011087_SP_P-B Feature FT:CDS AP011087_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AP011088_SP_P-B Feature FT:CDS AP011088_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AP011089_SP_P-B Feature FT:CDS AP011089_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AP011090_SP_P-B Feature FT:CDS AP011090_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AP011091_SP_P-B Feature FT:CDS AP011091_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AP011092_SP_P-B Feature FT:CDS AP011092_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcctgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AP011093_SP_P-B Feature FT:CDS AP011093_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AP011094_SP_P-B Feature FT:CDS AP011094_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AP011095_SP_P-B Feature FT:CDS AP011095_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AP011096_SP_P-B Feature FT:CDS AP011096_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY033072_SP_P-B Feature FT:CDS AY033072_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctatggacg
gaaactgcacatgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY033073_SP_P-B Feature FT:CDS AY033073_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctatggacg
gaaactgcacatgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|AY163869_SP_P-B Feature FT:CDS AY163869_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate FMClx-1). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatgttaatgatcatcaacaaccagcac
gggaacatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtaccaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY163870_SP_P-B Feature FT:CDS AY163870_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate FMU001). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatgttaatgatcatcaacaaccagcac
gggaacatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtaccaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY167089_SP_P-B Feature FT:CDS AY167089_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ia). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttgtcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY167093_SP_P-B Feature FT:CDS AY167093_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate IIa). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaggaaggcgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY167094_SP_P-B Feature FT:CDS AY167094_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate IIb). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctnaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacanctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY167097_SP_P-B Feature FT:CDS AY167097_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate IIIb). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY167098_SP_P-B Feature FT:CDS AY167098_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate IVa). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacgaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY167100_SP_P-B Feature FT:CDS AY167100_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Va). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY167101_SP_P-B Feature FT:CDS AY167101_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Vb). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctggaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctccatctcggggatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY167102_SP_P-B Feature FT:CDS AY167102_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Vc). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgacgcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccattatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY206375_SP_P-B Feature FT:CDS AY206375_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaaccgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY206383_SP_P-B Feature FT:CDS AY206383_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggagactactgttgttagagcaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacgaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY206387_SP_P-B Feature FT:CDS AY206387_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacgcttccggaaactactgttgttagacggagatgcaggtcccctagaagaggaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcctaatgatcatcaacaaccagcac
cggagcatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
caaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY206390_SP_P-B Feature FT:CDS AY206390_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcatcaacaaccagcac
cggaccatgcaaaacatgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY206391_SP_P-B Feature FT:CDS AY206391_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacaacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggcacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY217355_SP_P-B Feature FT:CDS AY217355_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A6-2). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtataaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY217356_SP_P-B Feature FT:CDS AY217356_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A9-2). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY217357_SP_P-B Feature FT:CDS AY217357_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1r-4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcgacaaccagcac
cggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY217358_SP_P-B Feature FT:CDS AY217358_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B8r-4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcgacaaccagcac
cggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY217359_SP_P-B Feature FT:CDS AY217359_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Q6-5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgttcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY217360_SP_P-B Feature FT:CDS AY217360_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 6-4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcatcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcacggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY217361_SP_P-B Feature FT:CDS AY217361_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 582-2). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY217362_SP_P-B Feature FT:CDS AY217362_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 582-4). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcatcaacaaccagcac
cggaccatgcaagacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY217364_SP_P-B Feature FT:CDS AY217364_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 586). Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcatcaacgaccagcac
cggaccatgcaaaacctgcacgactcctgctcaatgaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY217368_SP_P-B Feature FT:CDS AY217368_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 21949). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|AY220697_SP_P-B Feature FT:CDS AY220697_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|AY220698_SP_P-B Feature FT:CDS AY220698_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY220703_SP_P-B Feature FT:CDS AY220703_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY220704_SP_P-B Feature FT:CDS AY220704_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY293309_SP_P-B Feature FT:CDS AY293309_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY518556_SP_P-B Feature FT:CDS AY518556_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 57-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaacgcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY596102_SP_P-B Feature FT:CDS AY596102_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ia-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY596103_SP_P-B Feature FT:CDS AY596103_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ia-2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggggtgggcctcagtccgtttctct
tggctcagttcactag
>gnl|hbvcds|AY596104_SP_P-B Feature FT:CDS AY596104_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ia-4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|AY596105_SP_P-B Feature FT:CDS AY596105_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ia-5). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY596106_SP_P-B Feature FT:CDS AY596106_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ia-6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggactcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY596109_SP_P-B Feature FT:CDS AY596109_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate II-1). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttgtcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaacttctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY596110_SP_P-B Feature FT:CDS AY596110_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate II-2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcgacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY596111_SP_P-B Feature FT:CDS AY596111_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ia-3). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttattagacaacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaacttctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY596112_SP_P-B Feature FT:CDS AY596112_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ia-7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcgacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY766463_SP_P-B Feature FT:CDS AY766463_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcaccttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY800389_SP_P-B Feature FT:CDS AY800389_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate ZY041024). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacccttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY800391_SP_P-B Feature FT:CDS AY800391_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate ZY041026). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgacgcctgctcaaggaaactctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|AY800392_SP_P-B Feature FT:CDS AY800392_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate ZY041027). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgacgcctgctcaaggaaactctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|D00329_SP_P-B Feature FT:CDS D00329_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctatggatg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|D00330_SP_P-B Feature FT:CDS D00330_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggatg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|D00331_SP_C-B Feature FT:CDS D00331_SP_C-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
aggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|D23678_SP_P-B Feature FT:CDS D23678_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-HBVYS2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|D23679_SP_P-B Feature FT:CDS D23679_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A3-HBVMS2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaaccaccagcac
ggggccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggatg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|D50521_SP_P-B Feature FT:CDS D50521_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcggtctagggaacctcaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcgaaacacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|D50522_SP_P-B Feature FT:CDS D50522_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcggtctagggaacctcaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcaaggcacctctatgtttccctcatgttgctgtacaaaacctacggatg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ361535_SP_P-B Feature FT:CDS DQ361535_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CRP-228). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaaactcttcgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ377158_SP_P-B Feature FT:CDS DQ377158_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WJT31). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ448619_SP_P-B Feature FT:CDS DQ448619_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-DYH). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ448620_SP_P-B Feature FT:CDS DQ448620_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-DYF). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ448621_SP_P-B Feature FT:CDS DQ448621_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-HQY). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ448622_SP_P-B Feature FT:CDS DQ448622_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-JSM). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgacggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ448623_SP_P-B Feature FT:CDS DQ448623_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-LMX). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ448624_SP_P-B Feature FT:CDS DQ448624_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-QSA). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgctgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ448625_SP_P-B Feature FT:CDS DQ448625_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-TXB). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ448626_SP_P-B Feature FT:CDS DQ448626_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-XLB). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ448627_SP_P-B Feature FT:CDS DQ448627_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-ZFL). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagtac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ448628_SP_P-B Feature FT:CDS DQ448628_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-ZX). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaagctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggatg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ463787_SP_P-B Feature FT:CDS DQ463787_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 928-9_1979). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcgggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
cggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ463788_SP_P-B Feature FT:CDS DQ463788_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 739-11_1979). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaaccaccagcac
cggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ463789_SP_P-B Feature FT:CDS DQ463789_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 650-15_1979). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgacgatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaaccaccagcac
cggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ463790_SP_P-B Feature FT:CDS DQ463790_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 621-14_1979). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcgggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaaccaccagcac
cggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ463791_SP_P-B Feature FT:CDS DQ463791_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 539-16_1979). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcgaccaccagcac
cggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ463792_SP_P-B Feature FT:CDS DQ463792_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 524-3_1979). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacaccgacgcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
cggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ463793_SP_P-B Feature FT:CDS DQ463793_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 462-4_1979). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatcctaatgatcatcaaccaccagcac
cggaccatgcaaaacttgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ463794_SP_P-B Feature FT:CDS DQ463794_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 234-6_1979). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcggggatcccaatgatcatcaaccaccagcac
cggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ463795_SP_P-B Feature FT:CDS DQ463795_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 928-9_2004). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcgggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
cggaccgtgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ463796_SP_P-B Feature FT:CDS DQ463796_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 739-11_2004). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
cggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ463797_SP_P-B Feature FT:CDS DQ463797_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 650-15_2004). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgacgatctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
cggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ463798_SP_P-B Feature FT:CDS DQ463798_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 621-14_2004). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcgggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaaccaccagcac
cggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ463799_SP_P-B Feature FT:CDS DQ463799_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 539-16_2004). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
cggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggcttccgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ463800_SP_P-B Feature FT:CDS DQ463800_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 524-3_2004). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagactccgacgcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
cggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ463801_SP_P-B Feature FT:CDS DQ463801_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 462-4_2004). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatctccgcgtcgcagaagatctcaatctcgggaatcctaatgatcatcaaccaccagcac
cggaccatgcaaaacttgcacgactcctgctcaaggaacctctatgtttccctcatgttgttgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ463802_SP_P-B Feature FT:CDS DQ463802_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 234-6_2004). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
cggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ904357_SP_P-B Feature FT:CDS DQ904357_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacgaagaggcaggtcccctagaagaagagctccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ975271_SP_P-B Feature FT:CDS DQ975271_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ993680_SP_P-B Feature FT:CDS DQ993680_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 268). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatgaagacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ993681_SP_P-B Feature FT:CDS DQ993681_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 290). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ993682_SP_P-B Feature FT:CDS DQ993682_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 479). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
aggccaatatcttatcaacacttccggaaaataccgctgttagacgaatatgcaggtcccctataagaagaactccctcg
cctcgcagactaagggctcattcgccgcgacggagaagatctcaatctcgggaagcttaatgatcatcaaccaccagcac
cggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ993683_SP_P-B Feature FT:CDS DQ993683_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 82). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaaccaccagcac
cggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ993684_SP_P-B Feature FT:CDS DQ993684_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 336). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ993685_SP_P-B Feature FT:CDS DQ993685_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 554). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctggggaatctcaatgatcatcaaccaccagcac
cggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ993686_SP_P-B Feature FT:CDS DQ993686_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 342). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
gggaccatgcaagacctgcacaactcctgctcgaaacccctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ993687_SP_P-B Feature FT:CDS DQ993687_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 700). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcgcatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactat
>gnl|hbvcds|DQ993694_SP_P-B Feature FT:CDS DQ993694_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 234). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccacctacac
cggaccatggagaacctgcatgactcctggtgaaggaacctctatgtttccctcatgttgctgtacaaaacctaccaacg
gaaactgcacctgtagtcccatctcatcatcatggactttcgcaaaatacctatggtagtgggccaccgtccgtttctct
aggctcagtttactag
>gnl|hbvcds|DQ993696_SP_P-B Feature FT:CDS DQ993696_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 452b1). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatggaatacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcgcctgtattcccgtcccatcatcttgggctttcccaaaatacctatgggagtgggcctcagttcgtttctct
tggctcggtttactag
>gnl|hbvcds|DQ993697_SP_P-B Feature FT:CDS DQ993697_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 940b1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgttcaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ993698_SP_P-B Feature FT:CDS DQ993698_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 6144-0327-ETCvs3TC-Naive). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcagaagctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|DQ993699_SP_P-B Feature FT:CDS DQ993699_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 6144-0226-ETCvs3TC-Break). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcagaagctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|DQ993700_SP_P-B Feature FT:CDS DQ993700_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate JMY-0725-ETC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgctgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|DQ993701_SP_P-B Feature FT:CDS DQ993701_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate JMY-0210-ETCvs3TC-Brack). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgctgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|DQ993702_SP_P-B Feature FT:CDS DQ993702_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate JMY-0919-ETCvs3TC-Naive). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgctgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|DQ993703_SP_P-B Feature FT:CDS DQ993703_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 236-0526-Nature1.2-Sero). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ993704_SP_P-B Feature FT:CDS DQ993704_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 239-1127-Nature3.1-unSero). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatattatcaacacttccggaaactactgttgttagacgaacaggcaggtcccctagaaaaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ993705_SP_P-B Feature FT:CDS DQ993705_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 239-0625-Nature3.4-unSero). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ993706_SP_P-B Feature FT:CDS DQ993706_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 239-0402-Nature3.3-unSero). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ993707_SP_P-B Feature FT:CDS DQ993707_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 239-O218-Nature3.2-unSero). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ993708_SP_P-B Feature FT:CDS DQ993708_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 6136-1228-Naive). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ993709_SP_P-B Feature FT:CDS DQ993709_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 6136-0127-ETCvs3TC-Break). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ993710_SP_P-B Feature FT:CDS DQ993710_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 6144-0718-ETC). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ993711_SP_P-B Feature FT:CDS DQ993711_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 221-1120-Nature1.1-unSero). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ995801_SP_P-B Feature FT:CDS DQ995801_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H60-6). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaagacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtgcaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ995802_SP_P-B Feature FT:CDS DQ995802_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H293-16). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacaaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggactctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacagctcctgctcaaggaatctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ995803_SP_P-B Feature FT:CDS DQ995803_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C265-15). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaccaagaggcaggtcccttagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ995804_SP_P-B Feature FT:CDS DQ995804_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1691-11). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaccaagagtcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagacgatctcaatctcgggaacctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|DQ995805_SP_P-B Feature FT:CDS DQ995805_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H60-2.5KB). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagatgcagaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatctcatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtctactag
>gnl|hbvcds|EF134945_SP_P-B Feature FT:CDS EF134945_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G247-B3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaagaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EF134946_SP_P-B Feature FT:CDS EF134946_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G247-B5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaagaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EF473971_SP_P-B Feature FT:CDS EF473971_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2059Java). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EF473972_SP_P-B Feature FT:CDS EF473972_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1839Java). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EF473973_SP_P-B Feature FT:CDS EF473973_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EIH45AChinese). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgcccggtcgcagacgatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EF473974_SP_P-B Feature FT:CDS EF473974_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EIH21AChinese). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgtcgggtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctttgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|EF473975_SP_P-B Feature FT:CDS EF473975_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2061Chinese). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|EF473976_SP_P-B Feature FT:CDS EF473976_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alr049East). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatccaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EF473977_SP_P-B Feature FT:CDS EF473977_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate KD048East). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacaactcctgctcaaggaatctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EF494380_SP_P-B Feature FT:CDS EF494380_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate TW836). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctagggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcgcctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EF494381_SP_P-B Feature FT:CDS EF494381_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate TW936). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
ggaactgcacctgtattcccatcccatcatcttgggctttcgtaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EF494382_SP_P-B Feature FT:CDS EF494382_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate TWD347). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacaaagaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctaaatcaccgcgtcgcaaaagatctcaatctcgggactctcaatgatcatcaacaaccggcac
gggaccatgcaaaacctgcacgagtcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU139543_SP_P-B Feature FT:CDS EU139543_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggggtgggcctcagtccgtttctct
tggctcagttcactag
>gnl|hbvcds|EU158262_SP_P-B Feature FT:CDS EU158262_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G116). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtaccaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU158263_SP_P-B Feature FT:CDS EU158263_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G108). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacagctcctgctcaaggcacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU305547_SP_P-B Feature FT:CDS EU305547_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M118-481). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcgacgaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtgcaaaacctacgaacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU305548_SP_P-B Feature FT:CDS EU305548_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M118-673). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcgacgaccagcat
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU306677_SP_P-B Feature FT:CDS EU306677_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacatctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU306678_SP_P-B Feature FT:CDS EU306678_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacatctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU306679_SP_P-B Feature FT:CDS EU306679_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU306680_SP_P-B Feature FT:CDS EU306680_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU306681_SP_P-B Feature FT:CDS EU306681_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacatctcctgctcaaggaacctctatgtttccctcatgctgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU306695_SP_P-B Feature FT:CDS EU306695_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU306696_SP_P-B Feature FT:CDS EU306696_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagagggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU306697_SP_P-B Feature FT:CDS EU306697_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU306698_SP_P-B Feature FT:CDS EU306698_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU306699_SP_P-B Feature FT:CDS EU306699_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcagaaccagcacaactcttgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcggtttactag
>gnl|hbvcds|EU306700_SP_P-B Feature FT:CDS EU306700_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU306701_SP_P-B Feature FT:CDS EU306701_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU306702_SP_P-B Feature FT:CDS EU306702_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU306703_SP_P-B Feature FT:CDS EU306703_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcggaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU306704_SP_P-B Feature FT:CDS EU306704_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatgcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU306705_SP_P-B Feature FT:CDS EU306705_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU306706_SP_P-B Feature FT:CDS EU306706_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU306707_SP_P-B Feature FT:CDS EU306707_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgccgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatgcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU306708_SP_P-B Feature FT:CDS EU306708_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU306709_SP_P-B Feature FT:CDS EU306709_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU306710_SP_P-B Feature FT:CDS EU306710_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU306711_SP_P-B Feature FT:CDS EU306711_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU306712_SP_P-B Feature FT:CDS EU306712_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU330989_SP_P-B Feature FT:CDS EU330989_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M84-74). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcagccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcgtgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaacacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU330990_SP_P-B Feature FT:CDS EU330990_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M84-146). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcagccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcgtgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaacacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU330992_SP_P-B Feature FT:CDS EU330992_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-6). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
ctgaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU330994_SP_P-B Feature FT:CDS EU330994_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-10). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU330995_SP_P-B Feature FT:CDS EU330995_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-80). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU330996_SP_P-B Feature FT:CDS EU330996_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-81). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU330997_SP_P-B Feature FT:CDS EU330997_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-216). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU330998_SP_P-B Feature FT:CDS EU330998_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-1043). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU330999_SP_P-B Feature FT:CDS EU330999_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-1044). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU331000_SP_P-B Feature FT:CDS EU331000_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-1045). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU331001_SP_P-B Feature FT:CDS EU331001_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-1046). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU350409_SP_P-B Feature FT:CDS EU350409_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate BTO5856). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU439018_SP_P-B Feature FT:CDS EU439018_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU439020_SP_P-B Feature FT:CDS EU439020_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU439021_SP_P-B Feature FT:CDS EU439021_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU439022_SP_P-B Feature FT:CDS EU439022_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaaccgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU439023_SP_P-B Feature FT:CDS EU439023_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaccatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU487256_SP_P-B Feature FT:CDS EU487256_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient12). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactactgctcaaggaacctctttgtttccctcatgttgctgtaccaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU487257_SP_P-B Feature FT:CDS EU487257_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient14). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctttgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU522066_SP_P-B Feature FT:CDS EU522066_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 4N). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU522067_SP_P-B Feature FT:CDS EU522067_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 4T). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU522072_SP_P-B Feature FT:CDS EU522072_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 8N). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacaaagaggcaggtccactagaagaagaactccctcg
cctcgcagacgaaggactcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU522073_SP_P-B Feature FT:CDS EU522073_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 8T). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactattgttagacaaagaggcaggtccactagaagaagaactccctcg
cctcgcagacgaaggactcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU522074_SP_P-B Feature FT:CDS EU522074_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 8T). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU522075_SP_P-B Feature FT:CDS EU522075_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 8T). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactattgttagacaaagaggcaggtccactagaagaagaactccctcg
cctcgcagacgaaggactcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU547563_SP_P-B Feature FT:CDS EU547563_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MC06). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagaccaagaggcaggtcccttagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcgaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU564822_SP_P-B Feature FT:CDS EU564822_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-10TA). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacaaagacgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatcccaatgatcatcaacgaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU564823_SP_P-B Feature FT:CDS EU564823_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-10TB). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacaaagacgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatcccaatgatcatcaacgaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU564824_SP_P-B Feature FT:CDS EU564824_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-10N). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacaaagacgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatcccaatgatcatcaacgaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU564825_SP_P-B Feature FT:CDS EU564825_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-11T). Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctggaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU564826_SP_P-B Feature FT:CDS EU564826_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-11N). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctggaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaaccctaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU570069_SP_P-B Feature FT:CDS EU570069_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1-B24). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttggacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcgacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
ggaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU570070_SP_P-B Feature FT:CDS EU570070_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2-B24). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcgacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU570071_SP_P-B Feature FT:CDS EU570071_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 4-B24). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcgacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU570075_SP_P-B Feature FT:CDS EU570075_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 11-S142). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaacatactgttgttagacaaagacgcaggtcccctggaagaagaactccctcg
cctcgcagaccaaggtctaaatcgccgcgtcgcagaagatctcggtctcgggaatctcaatgatcgtcgacaacgagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU579441_SP_P-B Feature FT:CDS EU579441_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 12). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaaatactgttgttagaccaagacgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcgtcgacaacgagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU589335_SP_P-B Feature FT:CDS EU589335_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S142-5). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaacatactgttgttagataaagacgcaggtcccctggaagaagaactccctcg
cctcgccgaccaaggtctaaatcgccgcgtcgcagaagatctcggtctcgggaatctcaatgatcgtcgacaacgagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU595031_SP_P-B Feature FT:CDS EU595031_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagtac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU660224_SP_P-B Feature FT:CDS EU660224_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-12N). Non-functional genomic sequence. [Hepadnaviridae] (length=333 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggccccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatcaaacagaaccagcaccgg
accatgcaaaacctgcacaactactgctcaaggaacctctttgtttccctcatgttgctgttccaaacctacggacggaa
actgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttgg
ctcagtttactag
>gnl|hbvcds|EU660230_SP_P-B Feature FT:CDS EU660230_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-16T-del1). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcgtcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctttgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU660231_SP_P-B Feature FT:CDS EU660231_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-16T-del2). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcgtcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctttgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU796066_SP_P-B Feature FT:CDS EU796066_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtaccaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU796067_SP_P-B Feature FT:CDS EU796067_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtaccaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU796068_SP_P-B Feature FT:CDS EU796068_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU796071_SP_P-B Feature FT:CDS EU796071_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtaccaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU881997_SP_P-B Feature FT:CDS EU881997_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient18). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaagacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU881998_SP_P-B Feature FT:CDS EU881998_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient18). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU882002_SP_P-B Feature FT:CDS EU882002_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient20). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagaggcaggtcccctggaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctatggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU882004_SP_P-B Feature FT:CDS EU882004_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient21). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaggcctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU919171_SP_P-B Feature FT:CDS EU919171_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient29). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggaaactactgttgttagacaacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcgatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU919172_SP_P-B Feature FT:CDS EU919172_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient30). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcacaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU919173_SP_P-B Feature FT:CDS EU919173_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient30). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU919175_SP_P-B Feature FT:CDS EU919175_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient34). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU919176_SP_P-B Feature FT:CDS EU919176_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient34). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcttcgacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU939559_SP_P-B Feature FT:CDS EU939559_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C67). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacaaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU939633_SP_P-B Feature FT:CDS EU939633_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C181). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactattgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU939634_SP_P-B Feature FT:CDS EU939634_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C19). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactattgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU939635_SP_P-B Feature FT:CDS EU939635_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B125). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
gggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU939636_SP_P-B Feature FT:CDS EU939636_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C11). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttattagacgaagaagcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatcccaatgatcatcaacgaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU939637_SP_P-B Feature FT:CDS EU939637_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C13). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggcaatctcaatgatcatcaacaaccagcac
cggaccatgcaaagtctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggcttccgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU939638_SP_P-B Feature FT:CDS EU939638_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C17). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaacctcaatgatcatcaacaaccagcac
cggaccatgcaagacctgcacaactcctgctcaaggaacctctatatttccctcatgttgctgtacaaaacctacggacg
gcaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU939639_SP_P-B Feature FT:CDS EU939639_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C28). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaacatcaacgaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU939660_SP_P-B Feature FT:CDS EU939660_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C34). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcacggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU939661_SP_P-B Feature FT:CDS EU939661_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C40). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgtagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagacgaactcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU939663_SP_P-B Feature FT:CDS EU939663_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C74). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU939664_SP_P-B Feature FT:CDS EU939664_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C85). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU939665_SP_P-B Feature FT:CDS EU939665_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C129). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaagaaggggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU939666_SP_P-B Feature FT:CDS EU939666_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C150). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU939667_SP_P-B Feature FT:CDS EU939667_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C171). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU939669_SP_P-B Feature FT:CDS EU939669_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C185). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcctgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU939670_SP_P-B Feature FT:CDS EU939670_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C189). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgagggggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgaacatcaacaaccagcac
gggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU939671_SP_P-B Feature FT:CDS EU939671_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C201). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctttgactccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU939672_SP_P-B Feature FT:CDS EU939672_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C215). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU939673_SP_P-B Feature FT:CDS EU939673_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C219). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaagacatgcacatctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU939674_SP_P-B Feature FT:CDS EU939674_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C232). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactattgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagttcactag
>gnl|hbvcds|EU939675_SP_P-B Feature FT:CDS EU939675_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C235). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagtgtactgttgttagacaacgacgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacgaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU939676_SP_P-B Feature FT:CDS EU939676_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D54). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaactaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctttgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU939677_SP_P-B Feature FT:CDS EU939677_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D95). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaagcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctccatctcggggatctcaatgatcatccacaaccagcac
gggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU939678_SP_P-B Feature FT:CDS EU939678_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D106). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
gggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|EU939679_SP_P-B Feature FT:CDS EU939679_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D134). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcggctcgtcgcagaagatctcaatctcgggaatctcaatgatcatcgaccaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgattccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ023631_SP_P-B Feature FT:CDS FJ023631_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2_C04-1213). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagatcaagagtcaggtcctctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacttgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ023632_SP_P-B Feature FT:CDS FJ023632_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B4_C04-0254). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ023633_SP_P-B Feature FT:CDS FJ023633_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B4_C04-0583). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatwcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ023634_SP_P-B Feature FT:CDS FJ023634_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B4_C04-1358). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctatggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ023635_SP_P-B Feature FT:CDS FJ023635_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B4_M04-0467). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ023636_SP_P-B Feature FT:CDS FJ023636_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B4_M04-0876). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaccaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatatttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ023637_SP_P-B Feature FT:CDS FJ023637_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B5_M04-0013). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaaggactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctmaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctttgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ023638_SP_P-B Feature FT:CDS FJ023638_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B5_M04-0465). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ032342_SP_P-B Feature FT:CDS FJ032342_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S659-2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcagcacttccggaaactactgttattagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaaactcttcgttaccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ032344_SP_P-B Feature FT:CDS FJ032344_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S659-5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaacatactgttgttagacaaagacgcaggtcccctggaagaagaactccctcg
cctcgcagaccaaggtctaaatcgccgcgtcgcagaagatctcggtctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaaactcttcgcttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ032349_SP_P-B Feature FT:CDS FJ032349_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S734-1). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaccaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcacgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|FJ032352_SP_P-B Feature FT:CDS FJ032352_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1026-3). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctacgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcgtcttgggctttcgcaaaatatctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ032353_SP_P-B Feature FT:CDS FJ032353_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1026-4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctacgcttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ032354_SP_P-B Feature FT:CDS FJ032354_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1026-7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctacgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ032357_SP_P-B Feature FT:CDS FJ032357_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1607-8). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagtac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ032358_SP_P-B Feature FT:CDS FJ032358_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1607-10). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagtac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcaatttactag
>gnl|hbvcds|FJ349236_SP_P-B Feature FT:CDS FJ349236_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C15). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ386582_SP_P-B Feature FT:CDS FJ386582_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1765). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ386583_SP_P-B Feature FT:CDS FJ386583_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1780). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ386584_SP_P-B Feature FT:CDS FJ386584_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1798). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ386600_SP_P-B Feature FT:CDS FJ386600_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1893). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacaaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctacgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagttcactag
>gnl|hbvcds|FJ386608_SP_P-B Feature FT:CDS FJ386608_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1998). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccaaatgatcatcgacaaccagcac
tggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcgtcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ386610_SP_P-B Feature FT:CDS FJ386610_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2000). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacgaccagcac
cggaccatgcaaaacctgcacaactcctgctcacggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ386615_SP_P-B Feature FT:CDS FJ386615_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2061). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ386634_SP_P-B Feature FT:CDS FJ386634_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2392). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaactaccagcac
cggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ386636_SP_P-B Feature FT:CDS FJ386636_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1813). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ386642_SP_P-B Feature FT:CDS FJ386642_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1829). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctatggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ386648_SP_P-B Feature FT:CDS FJ386648_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2419). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaccaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggattctcaatgaacatcaactaccagcac
gggaccctgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaacctacggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaagatacctatgggagtgggcctcaatccgtttctct
tcgctcaatttactag
>gnl|hbvcds|FJ386654_SP_P-B Feature FT:CDS FJ386654_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S51). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcgacaaccagcac
cgggccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ386655_SP_P-B Feature FT:CDS FJ386655_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S121). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggggtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ386656_SP_P-B Feature FT:CDS FJ386656_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S142). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaacatactgttgttagacaaagacgcaggtcccctggaagaagaactccctcg
cctcgccgaccaaggtctaaatcgccgcgtcgcagaagatctcggtctcgggaatctcaatgatcgtcgacaacgagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ386658_SP_P-B Feature FT:CDS FJ386658_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S185). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ386660_SP_P-B Feature FT:CDS FJ386660_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S221). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacaaagacgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ386666_SP_P-B Feature FT:CDS FJ386666_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S367). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatatttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ386668_SP_P-B Feature FT:CDS FJ386668_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S395). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ386669_SP_P-B Feature FT:CDS FJ386669_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S411). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcgaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ386675_SP_P-B Feature FT:CDS FJ386675_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S734). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaccaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|FJ386676_SP_P-B Feature FT:CDS FJ386676_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1055). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ386680_SP_P-B Feature FT:CDS FJ386680_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1244). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcgatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtataaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ386681_SP_P-B Feature FT:CDS FJ386681_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1336). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggttcagtttactag
>gnl|hbvcds|FJ386682_SP_P-B Feature FT:CDS FJ386682_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1416). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatcttaatgatcatcaacgaccagcac
cggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ386683_SP_P-B Feature FT:CDS FJ386683_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1450). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgaacatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ386684_SP_P-B Feature FT:CDS FJ386684_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1554). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ386688_SP_P-B Feature FT:CDS FJ386688_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1632). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ518811_SP_P-B Feature FT:CDS FJ518811_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcatcaacaaccagcac
cggaccatgcaaggcctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttcggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tgactcagtttactag
>gnl|hbvcds|FJ518812_SP_P-B Feature FT:CDS FJ518812_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tgtctcagtttactag
>gnl|hbvcds|FJ562219_SP_P-B Feature FT:CDS FJ562219_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctcttcgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ562222_SP_P-B Feature FT:CDS FJ562222_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I14). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgaaaaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ562224_SP_P-B Feature FT:CDS FJ562224_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I16). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagttcactag
>gnl|hbvcds|FJ562231_SP_P-B Feature FT:CDS FJ562231_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I44). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggaca
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ562234_SP_P-B Feature FT:CDS FJ562234_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I49). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcgaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ562236_SP_P-B Feature FT:CDS FJ562236_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I51). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ562237_SP_P-B Feature FT:CDS FJ562237_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I53). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaggcctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ562240_SP_P-B Feature FT:CDS FJ562240_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I65). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcgactaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtaccaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ562246_SP_P-B Feature FT:CDS FJ562246_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I74). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacgaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ562253_SP_P-B Feature FT:CDS FJ562253_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I86). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ562254_SP_P-B Feature FT:CDS FJ562254_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I87). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcgaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ562257_SP_P-B Feature FT:CDS FJ562257_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I96). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcat
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ562259_SP_P-B Feature FT:CDS FJ562259_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I106). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
gggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ562260_SP_P-B Feature FT:CDS FJ562260_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I107). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcatcaacaaccagcac
gggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ562262_SP_P-B Feature FT:CDS FJ562262_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I111). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ562289_SP_P-B Feature FT:CDS FJ562289_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I160). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ562296_SP_P-B Feature FT:CDS FJ562296_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I171). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagaggaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagtac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ562303_SP_P-B Feature FT:CDS FJ562303_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I189). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctttgtttccatcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ562311_SP_P-B Feature FT:CDS FJ562311_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I202). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagagggagacgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ562312_SP_P-B Feature FT:CDS FJ562312_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I203). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagaccaagaggcaggtcctctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
cggaccatgcaagacctgcacatctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccgtcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ562316_SP_P-B Feature FT:CDS FJ562316_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I208). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ562321_SP_P-B Feature FT:CDS FJ562321_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I214). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcatcaacgaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtataaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ562322_SP_P-B Feature FT:CDS FJ562322_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I216). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctatggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ787444_SP_P-B Feature FT:CDS FJ787444_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S208-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ787475_SP_P-B Feature FT:CDS FJ787475_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CX-2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaacgcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggtgtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ787476_SP_P-B Feature FT:CDS FJ787476_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CX-3). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcatcaacaaccagcgc
cggaccatgcaaaacctgcacgacgcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggtgtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ787477_SP_P-B Feature FT:CDS FJ787477_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate LWM-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaaggggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ899779_SP_P-B Feature FT:CDS FJ899779_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C185-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcctgttgctgtacaaaacctacggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ899784_SP_P-B Feature FT:CDS FJ899784_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C215-3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ899785_SP_P-B Feature FT:CDS FJ899785_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C215-5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ899786_SP_P-B Feature FT:CDS FJ899786_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C215-7). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ899787_SP_P-B Feature FT:CDS FJ899787_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C215-9). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgtcgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|FJ899790_SP_P-B Feature FT:CDS FJ899790_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C232-2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactattgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagttcactag
>gnl|hbvcds|FJ899791_SP_P-B Feature FT:CDS FJ899791_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C232-6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactattgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagttcactag
>gnl|hbvcds|GQ358136_SP_P-B Feature FT:CDS GQ358136_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EIHB134). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatccaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgttcccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ358137_SP_P-B Feature FT:CDS GQ358137_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate LBY001). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagaagaaggtatcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggatg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ358138_SP_P-B Feature FT:CDS GQ358138_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate LBY041). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ358139_SP_P-B Feature FT:CDS GQ358139_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate FLT032). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctaaatcaccgcgtcgcagaagatttcaatctcggtaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ358140_SP_P-B Feature FT:CDS GQ358140_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate FLT020). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggatcatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ358141_SP_P-B Feature FT:CDS GQ358141_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate LBY009). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GQ358142_SP_P-B Feature FT:CDS GQ358142_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate LAR070). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcgacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatccaccaccagcac
cggaccatgcagaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ358143_SP_P-B Feature FT:CDS GQ358143_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CBL027). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactagtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ358144_SP_P-B Feature FT:CDS GQ358144_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate KDI15). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctaagggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ358145_SP_P-B Feature FT:CDS GQ358145_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate KDI04). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagaggaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ358146_SP_P-B Feature FT:CDS GQ358146_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate KDI35). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ358147_SP_P-B Feature FT:CDS GQ358147_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate KDI43). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgcctcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcacggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ358148_SP_P-B Feature FT:CDS GQ358148_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate ALO36). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctattttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ358149_SP_P-B Feature FT:CDS GQ358149_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate PAN001). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ358150_SP_P-B Feature FT:CDS GQ358150_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate PAN009). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ358151_SP_P-B Feature FT:CDS GQ358151_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate PAN011). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ358152_SP_P-B Feature FT:CDS GQ358152_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate PAN037). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ377519_SP_P-B Feature FT:CDS GQ377519_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J16). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ377525_SP_P-B Feature FT:CDS GQ377525_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J24). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcgacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ377537_SP_P-B Feature FT:CDS GQ377537_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J48). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
gggctcagtttactag
>gnl|hbvcds|GQ377542_SP_P-B Feature FT:CDS GQ377542_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J61). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacgaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ377547_SP_P-B Feature FT:CDS GQ377547_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J78). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ377550_SP_P-B Feature FT:CDS GQ377550_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J81). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcatcaactaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ377558_SP_P-B Feature FT:CDS GQ377558_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J89). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
gggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ377561_SP_P-B Feature FT:CDS GQ377561_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J96). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
gggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ377566_SP_P-B Feature FT:CDS GQ377566_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J101). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactacagttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ377567_SP_P-B Feature FT:CDS GQ377567_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J102). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcatcaacaaccaccac
cggaccatgcaaaacctgcacagttcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaagatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ377568_SP_P-B Feature FT:CDS GQ377568_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J103). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactacagttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ377569_SP_P-B Feature FT:CDS GQ377569_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J105). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
gggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ377582_SP_P-B Feature FT:CDS GQ377582_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J131). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ377587_SP_P-B Feature FT:CDS GQ377587_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J138). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ377588_SP_P-B Feature FT:CDS GQ377588_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J141). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ377606_SP_P-B Feature FT:CDS GQ377606_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J171). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ377610_SP_P-B Feature FT:CDS GQ377610_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J177). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ377612_SP_P-B Feature FT:CDS GQ377612_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J180). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ377622_SP_P-B Feature FT:CDS GQ377622_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J207). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgacggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactactgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ377625_SP_P-B Feature FT:CDS GQ377625_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J222). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcaaaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ377629_SP_P-B Feature FT:CDS GQ377629_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J234). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cgggccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ377638_SP_P-B Feature FT:CDS GQ377638_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J250). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ377639_SP_P-B Feature FT:CDS GQ377639_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J251). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ377641_SP_P-B Feature FT:CDS GQ377641_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J254). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcgacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ377643_SP_P-B Feature FT:CDS GQ377643_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J258). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ377644_SP_P-B Feature FT:CDS GQ377644_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J294). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaggaagacgcaggtcccctagaagaagaactccatca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagttggcctcagcccgtttctct
tggctcagttcactag
>gnl|hbvcds|GQ475340_SP_P-B Feature FT:CDS GQ475340_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate KOR36HCC). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ924603_SP_P-B Feature FT:CDS GQ924603_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ924605_SP_P-B Feature FT:CDS GQ924605_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M11). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcn
cctcgcagrcgaaggtctcaatcgccgcgtggcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ924606_SP_P-B Feature FT:CDS GQ924606_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M12). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacgaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtataaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ924607_SP_P-B Feature FT:CDS GQ924607_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M13). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatggccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ924608_SP_P-B Feature FT:CDS GQ924608_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M15). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ924610_SP_P-B Feature FT:CDS GQ924610_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M19). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacgaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ924611_SP_P-B Feature FT:CDS GQ924611_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M28). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ924617_SP_P-B Feature FT:CDS GQ924617_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M34). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaccacgaagcaggtcccttagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctccatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgacgcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ924621_SP_P-B Feature FT:CDS GQ924621_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M39). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ924624_SP_P-B Feature FT:CDS GQ924624_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M42). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccactcttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggatcatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ924625_SP_P-B Feature FT:CDS GQ924625_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M43). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ924626_SP_P-B Feature FT:CDS GQ924626_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M47). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacaacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctaaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaacatgcagaacatgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ924627_SP_P-B Feature FT:CDS GQ924627_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M48). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ924628_SP_P-B Feature FT:CDS GQ924628_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M50). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaacctcaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ924630_SP_P-B Feature FT:CDS GQ924630_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M52). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctcgggaacctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtaccaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ924631_SP_P-B Feature FT:CDS GQ924631_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M53). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggcacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ924632_SP_P-B Feature FT:CDS GQ924632_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M54). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaccaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacgaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ924634_SP_P-B Feature FT:CDS GQ924634_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M57). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cgggccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ924635_SP_P-B Feature FT:CDS GQ924635_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M67). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacaaggaagcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatttcaatgtcgggaatgtcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ924637_SP_P-B Feature FT:CDS GQ924637_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M69). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggaaactgctgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggcaatctcaatgatcatcaaccaccagcac
cggaccctgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ924638_SP_P-B Feature FT:CDS GQ924638_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M70). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggaaactactgttgttagaggacgaggcaggtcccctagaagaagaactccctcg
cgtcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcacggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttcttt
tggctcagtttactag
>gnl|hbvcds|GQ924639_SP_P-B Feature FT:CDS GQ924639_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M71). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaattactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cgtcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcacggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttcttt
tggctcagtttactag
>gnl|hbvcds|GQ924640_SP_P-B Feature FT:CDS GQ924640_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M72). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ924641_SP_P-B Feature FT:CDS GQ924641_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M76). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagtgtgctgttgttagtcgaaggggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatgtagggaacctcaatgatcatcgaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaaactctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ924644_SP_P-B Feature FT:CDS GQ924644_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M79). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ924645_SP_P-B Feature FT:CDS GQ924645_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M82). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgaagaagcaggtcccttagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatccaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ924646_SP_P-B Feature FT:CDS GQ924646_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M83). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaggaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgacacctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ924647_SP_P-B Feature FT:CDS GQ924647_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M84). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggaaactactgttgttagaggaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ924648_SP_P-B Feature FT:CDS GQ924648_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ924651_SP_P-B Feature FT:CDS GQ924651_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M88). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ924653_SP_P-B Feature FT:CDS GQ924653_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M90). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ924654_SP_P-B Feature FT:CDS GQ924654_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M91). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ924656_SP_P-B Feature FT:CDS GQ924656_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M93). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
ccttgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GQ924660_SP_P-B Feature FT:CDS GQ924660_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M74). Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgacttctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU332695_SP_P-B Feature FT:CDS GU332695_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate FMD74). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaacatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|GU357842_SP_P-B Feature FT:CDS GU357842_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C4371). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaaactctacgtttccctcatgttgctgtataaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU434372_SP_P-B Feature FT:CDS GU434372_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 011-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcacggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU434373_SP_P-B Feature FT:CDS GU434373_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 209-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU451682_SP_P-B Feature FT:CDS GU451682_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate pLL-EGFP). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815548_SP_P-B Feature FT:CDS GU815548_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815549_SP_P-B Feature FT:CDS GU815549_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815550_SP_P-B Feature FT:CDS GU815550_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatcccgggaatctcaatgatcctcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815551_SP_P-B Feature FT:CDS GU815551_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815552_SP_P-B Feature FT:CDS GU815552_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815553_SP_P-B Feature FT:CDS GU815553_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815554_SP_P-B Feature FT:CDS GU815554_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgctgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815555_SP_P-B Feature FT:CDS GU815555_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-8). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815556_SP_P-B Feature FT:CDS GU815556_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-9). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815557_SP_P-B Feature FT:CDS GU815557_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-10). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815558_SP_P-B Feature FT:CDS GU815558_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-11). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815559_SP_P-B Feature FT:CDS GU815559_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-12). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815560_SP_P-B Feature FT:CDS GU815560_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815561_SP_P-B Feature FT:CDS GU815561_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815562_SP_P-B Feature FT:CDS GU815562_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815563_SP_P-B Feature FT:CDS GU815563_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815564_SP_P-B Feature FT:CDS GU815564_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815565_SP_P-B Feature FT:CDS GU815565_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815566_SP_P-B Feature FT:CDS GU815566_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815567_SP_P-B Feature FT:CDS GU815567_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-8). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815568_SP_P-B Feature FT:CDS GU815568_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-9). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815569_SP_P-B Feature FT:CDS GU815569_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-10). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815570_SP_P-B Feature FT:CDS GU815570_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-11). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815571_SP_P-B Feature FT:CDS GU815571_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-12). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|GU815572_SP_P-B Feature FT:CDS GU815572_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A3-1). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaagctactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcctcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815573_SP_P-B Feature FT:CDS GU815573_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A3-2). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaattatcctcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaagaaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815574_SP_P-B Feature FT:CDS GU815574_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A3-3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
cggaccatgcaagacctgcacaactcctgctcaaggaacctccatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815575_SP_P-B Feature FT:CDS GU815575_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A3-4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815576_SP_P-B Feature FT:CDS GU815576_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A3-5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815577_SP_P-B Feature FT:CDS GU815577_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A3-6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
cggaccatgcaagacctgcacaactcctgctcaaggaacctccatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815578_SP_P-B Feature FT:CDS GU815578_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A3-7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815579_SP_P-B Feature FT:CDS GU815579_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1-10). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815581_SP_P-B Feature FT:CDS GU815581_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1-12). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815583_SP_P-B Feature FT:CDS GU815583_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1-2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815584_SP_P-B Feature FT:CDS GU815584_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1-3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815585_SP_P-B Feature FT:CDS GU815585_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1-4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815586_SP_P-B Feature FT:CDS GU815586_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1-5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815587_SP_P-B Feature FT:CDS GU815587_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1-6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815588_SP_P-B Feature FT:CDS GU815588_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1-7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815589_SP_P-B Feature FT:CDS GU815589_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1-8). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815590_SP_P-B Feature FT:CDS GU815590_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1-9). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815591_SP_P-B Feature FT:CDS GU815591_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2-10). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815593_SP_P-B Feature FT:CDS GU815593_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2-12). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815594_SP_P-B Feature FT:CDS GU815594_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815595_SP_P-B Feature FT:CDS GU815595_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2-2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815596_SP_P-B Feature FT:CDS GU815596_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2-3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815597_SP_P-B Feature FT:CDS GU815597_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2-4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815598_SP_P-B Feature FT:CDS GU815598_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2-5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815599_SP_P-B Feature FT:CDS GU815599_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2-6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815600_SP_P-B Feature FT:CDS GU815600_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2-7). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815601_SP_P-B Feature FT:CDS GU815601_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2-8). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815602_SP_P-B Feature FT:CDS GU815602_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2-9). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggttcagtttactag
>gnl|hbvcds|GU815603_SP_P-B Feature FT:CDS GU815603_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-10). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815604_SP_P-B Feature FT:CDS GU815604_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-11). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815605_SP_P-B Feature FT:CDS GU815605_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-12). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcctctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815606_SP_P-B Feature FT:CDS GU815606_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815607_SP_P-B Feature FT:CDS GU815607_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaacacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815608_SP_P-B Feature FT:CDS GU815608_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815609_SP_P-B Feature FT:CDS GU815609_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815610_SP_P-B Feature FT:CDS GU815610_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815611_SP_P-B Feature FT:CDS GU815611_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-6). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815612_SP_P-B Feature FT:CDS GU815612_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815613_SP_P-B Feature FT:CDS GU815613_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-8). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815614_SP_P-B Feature FT:CDS GU815614_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-9). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815616_SP_P-B Feature FT:CDS GU815616_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1-11). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcgaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815617_SP_P-B Feature FT:CDS GU815617_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1-12). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815618_SP_P-B Feature FT:CDS GU815618_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815619_SP_P-B Feature FT:CDS GU815619_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1-2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815620_SP_P-B Feature FT:CDS GU815620_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1-3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815621_SP_P-B Feature FT:CDS GU815621_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1-4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815622_SP_P-B Feature FT:CDS GU815622_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1-5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815623_SP_P-B Feature FT:CDS GU815623_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1-6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815624_SP_P-B Feature FT:CDS GU815624_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1-7). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815625_SP_P-B Feature FT:CDS GU815625_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1-8). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcgaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtcagtttctct
tggctcagtttactag
>gnl|hbvcds|GU815626_SP_P-B Feature FT:CDS GU815626_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1-9). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815627_SP_P-B Feature FT:CDS GU815627_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C2-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcgaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815628_SP_P-B Feature FT:CDS GU815628_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C2-2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcgaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815629_SP_P-B Feature FT:CDS GU815629_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C2-3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcgaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815630_SP_P-B Feature FT:CDS GU815630_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C2-4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcgaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815631_SP_P-B Feature FT:CDS GU815631_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C2-5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcgaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815632_SP_P-B Feature FT:CDS GU815632_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C2-6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815633_SP_P-B Feature FT:CDS GU815633_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C2-7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815634_SP_P-B Feature FT:CDS GU815634_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-10). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcgaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815635_SP_P-B Feature FT:CDS GU815635_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-11). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcgaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815636_SP_P-B Feature FT:CDS GU815636_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-12). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcgaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815637_SP_P-B Feature FT:CDS GU815637_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcgaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815638_SP_P-B Feature FT:CDS GU815638_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcgaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815639_SP_P-B Feature FT:CDS GU815639_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815640_SP_P-B Feature FT:CDS GU815640_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcgaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815641_SP_P-B Feature FT:CDS GU815641_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaaggggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcgaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815642_SP_P-B Feature FT:CDS GU815642_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcgaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815643_SP_P-B Feature FT:CDS GU815643_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcgaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815644_SP_P-B Feature FT:CDS GU815644_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-8). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcgaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815645_SP_P-B Feature FT:CDS GU815645_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-9). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcgaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815646_SP_P-B Feature FT:CDS GU815646_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1.D1.5-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815647_SP_P-B Feature FT:CDS GU815647_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2.D1.5-2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815648_SP_P-B Feature FT:CDS GU815648_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 3.D1.5-3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815649_SP_P-B Feature FT:CDS GU815649_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 4.D1.5-4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815650_SP_P-B Feature FT:CDS GU815650_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 5.D1.5-5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaacgcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815651_SP_P-B Feature FT:CDS GU815651_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 6.D1.5-6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815652_SP_P-B Feature FT:CDS GU815652_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 7.D1.5-7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815653_SP_P-B Feature FT:CDS GU815653_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 8.D1.5-8). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815654_SP_P-B Feature FT:CDS GU815654_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 9.D1.5-9). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815656_SP_P-B Feature FT:CDS GU815656_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 11.D1.5-11). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815657_SP_P-B Feature FT:CDS GU815657_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 12.D1.5-12). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815658_SP_P-B Feature FT:CDS GU815658_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttccct
tggctcagtttactag
>gnl|hbvcds|GU815659_SP_P-B Feature FT:CDS GU815659_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2-2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815660_SP_P-B Feature FT:CDS GU815660_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2-3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815661_SP_P-B Feature FT:CDS GU815661_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2-4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815662_SP_P-B Feature FT:CDS GU815662_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2-5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcgatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815663_SP_P-B Feature FT:CDS GU815663_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2-6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815664_SP_P-B Feature FT:CDS GU815664_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2-7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815665_SP_P-B Feature FT:CDS GU815665_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2-8). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815666_SP_P-B Feature FT:CDS GU815666_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2-9). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815667_SP_P-B Feature FT:CDS GU815667_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3-10). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815668_SP_P-B Feature FT:CDS GU815668_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3-11). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815669_SP_P-B Feature FT:CDS GU815669_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3-12). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815670_SP_P-B Feature FT:CDS GU815670_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815672_SP_P-B Feature FT:CDS GU815672_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3-3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815673_SP_P-B Feature FT:CDS GU815673_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3-4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttaggcgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815674_SP_P-B Feature FT:CDS GU815674_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3-5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815675_SP_P-B Feature FT:CDS GU815675_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3-6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815676_SP_P-B Feature FT:CDS GU815676_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3-7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815677_SP_P-B Feature FT:CDS GU815677_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3-8). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815678_SP_P-B Feature FT:CDS GU815678_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3-9). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815679_SP_P-B Feature FT:CDS GU815679_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E1-10). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815680_SP_P-B Feature FT:CDS GU815680_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E1-11). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815681_SP_P-B Feature FT:CDS GU815681_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E1-12). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815683_SP_P-B Feature FT:CDS GU815683_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E1-2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815684_SP_P-B Feature FT:CDS GU815684_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E1-3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815685_SP_P-B Feature FT:CDS GU815685_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E1-4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815686_SP_P-B Feature FT:CDS GU815686_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E1-5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815687_SP_P-B Feature FT:CDS GU815687_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E1-6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815688_SP_P-B Feature FT:CDS GU815688_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E1-7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815689_SP_P-B Feature FT:CDS GU815689_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E1-8). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815691_SP_P-B Feature FT:CDS GU815691_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E2-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815692_SP_P-B Feature FT:CDS GU815692_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E2-2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815693_SP_P-B Feature FT:CDS GU815693_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E2-3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815694_SP_P-B Feature FT:CDS GU815694_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E2-4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815695_SP_P-B Feature FT:CDS GU815695_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E2-5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccgaaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815696_SP_P-B Feature FT:CDS GU815696_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E2-6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815697_SP_P-B Feature FT:CDS GU815697_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E2-7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815698_SP_P-B Feature FT:CDS GU815698_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E2-8). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815699_SP_P-B Feature FT:CDS GU815699_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-10). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815700_SP_P-B Feature FT:CDS GU815700_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-11). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815701_SP_P-B Feature FT:CDS GU815701_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-12). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815702_SP_P-B Feature FT:CDS GU815702_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815703_SP_P-B Feature FT:CDS GU815703_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815704_SP_P-B Feature FT:CDS GU815704_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815705_SP_P-B Feature FT:CDS GU815705_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815706_SP_P-B Feature FT:CDS GU815706_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815707_SP_P-B Feature FT:CDS GU815707_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815708_SP_P-B Feature FT:CDS GU815708_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815709_SP_P-B Feature FT:CDS GU815709_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-8). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaatctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815710_SP_P-B Feature FT:CDS GU815710_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-9). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815711_SP_P-B Feature FT:CDS GU815711_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-10). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815712_SP_P-B Feature FT:CDS GU815712_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-11). Complete genome. [Hepadnaviridae] (length=336 residues).
atacccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815713_SP_P-B Feature FT:CDS GU815713_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-12). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815715_SP_P-B Feature FT:CDS GU815715_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcacggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815716_SP_P-B Feature FT:CDS GU815716_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815717_SP_P-B Feature FT:CDS GU815717_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815718_SP_P-B Feature FT:CDS GU815718_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgaccatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815719_SP_P-B Feature FT:CDS GU815719_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815720_SP_P-B Feature FT:CDS GU815720_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgctgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815721_SP_P-B Feature FT:CDS GU815721_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-8). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815722_SP_P-B Feature FT:CDS GU815722_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-9). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcacggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815723_SP_P-B Feature FT:CDS GU815723_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-10). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaataatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcacggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815724_SP_P-B Feature FT:CDS GU815724_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-11). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815725_SP_P-B Feature FT:CDS GU815725_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-12). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815726_SP_P-B Feature FT:CDS GU815726_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcacggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815727_SP_P-B Feature FT:CDS GU815727_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggaatgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815728_SP_P-B Feature FT:CDS GU815728_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcacggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815729_SP_P-B Feature FT:CDS GU815729_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815730_SP_P-B Feature FT:CDS GU815730_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815731_SP_P-B Feature FT:CDS GU815731_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815732_SP_P-B Feature FT:CDS GU815732_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815733_SP_P-B Feature FT:CDS GU815733_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-8). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815734_SP_P-B Feature FT:CDS GU815734_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-9). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcacggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815735_SP_P-B Feature FT:CDS GU815735_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-10). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgacttctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815736_SP_P-B Feature FT:CDS GU815736_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-11). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcacggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815737_SP_P-B Feature FT:CDS GU815737_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-12). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815738_SP_P-B Feature FT:CDS GU815738_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcacggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815739_SP_P-B Feature FT:CDS GU815739_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815740_SP_P-B Feature FT:CDS GU815740_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815741_SP_P-B Feature FT:CDS GU815741_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-4). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcacggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttaggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815742_SP_P-B Feature FT:CDS GU815742_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815743_SP_P-B Feature FT:CDS GU815743_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcacggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggccttagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815744_SP_P-B Feature FT:CDS GU815744_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcacggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815745_SP_P-B Feature FT:CDS GU815745_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-8). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcacggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815746_SP_P-B Feature FT:CDS GU815746_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-9). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcacggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815747_SP_P-B Feature FT:CDS GU815747_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-10). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815748_SP_P-B Feature FT:CDS GU815748_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-11). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815749_SP_P-B Feature FT:CDS GU815749_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-12). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815750_SP_P-B Feature FT:CDS GU815750_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-14). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815751_SP_P-B Feature FT:CDS GU815751_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815752_SP_P-B Feature FT:CDS GU815752_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggcctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctgtgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815753_SP_P-B Feature FT:CDS GU815753_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815754_SP_P-B Feature FT:CDS GU815754_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815755_SP_P-B Feature FT:CDS GU815755_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815756_SP_P-B Feature FT:CDS GU815756_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815757_SP_P-B Feature FT:CDS GU815757_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815759_SP_P-B Feature FT:CDS GU815759_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-9). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815760_SP_P-B Feature FT:CDS GU815760_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-10). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccttcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815761_SP_P-B Feature FT:CDS GU815761_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-11). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgttgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815762_SP_P-B Feature FT:CDS GU815762_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-12). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815764_SP_P-B Feature FT:CDS GU815764_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgttgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815765_SP_P-B Feature FT:CDS GU815765_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaaccccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815766_SP_P-B Feature FT:CDS GU815766_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815767_SP_P-B Feature FT:CDS GU815767_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815768_SP_P-B Feature FT:CDS GU815768_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815769_SP_P-B Feature FT:CDS GU815769_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815770_SP_P-B Feature FT:CDS GU815770_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-8). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaagcctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815771_SP_P-B Feature FT:CDS GU815771_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-9). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815772_SP_P-B Feature FT:CDS GU815772_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-10). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggtctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815773_SP_P-B Feature FT:CDS GU815773_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-11). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815774_SP_P-B Feature FT:CDS GU815774_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-12). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacagctcctgctcaaggaatctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815775_SP_P-B Feature FT:CDS GU815775_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815776_SP_P-B Feature FT:CDS GU815776_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-21). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815777_SP_P-B Feature FT:CDS GU815777_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815778_SP_P-B Feature FT:CDS GU815778_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815779_SP_P-B Feature FT:CDS GU815779_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815780_SP_P-B Feature FT:CDS GU815780_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815781_SP_P-B Feature FT:CDS GU815781_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815782_SP_P-B Feature FT:CDS GU815782_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-8). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|GU815783_SP_P-B Feature FT:CDS GU815783_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-9). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|HM011466_SP_P-B Feature FT:CDS HM011466_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcgacaacaagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|HM011467_SP_P-B Feature FT:CDS HM011467_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=333 residues).
atgcccctatcttatcaacacttccggaaaytactgttgttagaggacgcaggtcccctagaagaagaactccctcgcct
cgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcatcaaccaccagcaccgg
accatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaa
actgcacctgtattcccatcccatcatcttgggytttcgcaaaatwcctatgggagtgggcctcagtccgtttctcttgg
ctcagtttactag
>gnl|hbvcds|HM011469_SP_P-B Feature FT:CDS HM011469_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttrttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggrayctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|HM011470_SP_P-B Feature FT:CDS HM011470_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaaactctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|HM011471_SP_P-B Feature FT:CDS HM011471_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttattagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcaccactcctgctcaaggcacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|HM011473_SP_P-B Feature FT:CDS HM011473_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactrctgttattagacmaagaggcaggwcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaayctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacmaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|HM011474_SP_P-B Feature FT:CDS HM011474_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaccaagaggcaggtcctctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagamgatctcartctcgggaatcycaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|HM011475_SP_P-B Feature FT:CDS HM011475_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaamtactgttrttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaayctcaatgatcatcgacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|HM011476_SP_P-B Feature FT:CDS HM011476_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagaggaagacgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacytgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaaytgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|HM011477_SP_P-B Feature FT:CDS HM011477_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcwacrcttccggaaactactgttrttagacaaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgttgcagaagatctcaatctcgggaacctcgatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|HM011478_SP_P-B Feature FT:CDS HM011478_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttgtcaacacttccggaaactactgttgttagaggaagacgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgatcatcaacaaccagcac
sggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcrtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|HM011480_SP_P-B Feature FT:CDS HM011480_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|HM011482_SP_P-B Feature FT:CDS HM011482_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttrttagaggaagacgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|HM011483_SP_P-B Feature FT:CDS HM011483_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagakgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|HM011484_SP_P-B Feature FT:CDS HM011484_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactrctgttrttagacgaagaagcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaayctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|HM011487_SP_P-B Feature FT:CDS HM011487_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggaaactactgttgttagacgacgcggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgccgaacctgcacgactcctgctcrmggaaactctacgtttccctcatgttgctgtacaaaacctacggacg
caaactgcacctgtattcccatcccaycatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|HM011490_SP_P-B Feature FT:CDS HM011490_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagattactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|HM011492_SP_P-B Feature FT:CDS HM011492_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|HM011494_SP_P-B Feature FT:CDS HM011494_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggwcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctmaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaracctgcacarctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|HM011496_SP_P-B Feature FT:CDS HM011496_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttattagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggactctcaatgatcatcaaccaccagcac
sggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|HM011499_SP_P-B Feature FT:CDS HM011499_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaaytrctgttgttagacracgaggcaggwcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggratccmamtgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|HM011503_SP_P-B Feature FT:CDS HM011503_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgtksttagacgaaggggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggamcctcaatgatcatcaacraccagcac
sggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|HM011504_SP_P-B Feature FT:CDS HM011504_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggaaacttgtgttgttagacaaagaggcaggtccactagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctyaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgyaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|HM153811_SP_P-B Feature FT:CDS HM153811_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 712005001256). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcatcaacgaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtataaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|HQ700546_SP_P-B Feature FT:CDS HQ700546_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate BC_NC_AM263). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatatcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|HQ700548_SP_P-B Feature FT:CDS HQ700548_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I_WA1031A). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctatggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggrgtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|HQ700549_SP_P-B Feature FT:CDS HQ700549_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I_WA1098A). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JF412801_SP_P-B Feature FT:CDS JF412801_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBVJSTZ3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctttgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JF436921_SP_P-B Feature FT:CDS JF436921_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SZ7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaatgcttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JF899335_SP_P-B Feature FT:CDS JF899335_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 10B1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JN406371_SP_P-B Feature FT:CDS JN406371_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WHUB1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JN792893_SP_P-B Feature FT:CDS JN792893_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MN2004). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatctccgcgtcgcagaagatctcaatctcgggaatcctaatgatcatcaaccaccagcac
cggaccatgcaaaacttgcacgactcctgctcaaggaacctctatgtttccctcatgttgttgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JN792894_SP_P-B Feature FT:CDS JN792894_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MN2009). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaggaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
cggaccatgcaagacttgcacgactcctgctcaaggaacctctatgtttccctcatgttgttgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JN792895_SP_P-B Feature FT:CDS JN792895_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate KM2004). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgacgatctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
cggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JN792896_SP_P-B Feature FT:CDS JN792896_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate KM2009). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgacgatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaaccaccagcac
cggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JN792897_SP_P-B Feature FT:CDS JN792897_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate IT2009). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagactccgacgcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
cggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JN792898_SP_P-B Feature FT:CDS JN792898_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate IT2004). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagactccgacgcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaaccaccagcac
cggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JN792899_SP_P-B Feature FT:CDS JN792899_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate AT2004). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcgggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaaccaccagcac
cggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JN792900_SP_P-B Feature FT:CDS JN792900_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate AT2009). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcgggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaaccaccagcac
cggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggcttccgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JN792901_SP_P-B Feature FT:CDS JN792901_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate AD2009). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaggaagaactccctcg
cctcgcagacgacgatctaaatctccgcgtcgcagaagatctcactctcgggaatcccaatgatcatcaaccaccagcac
cggaccatgcaagacctgcacgactcctgctcaaaacagctctacgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JN792902_SP_P-B Feature FT:CDS JN792902_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate AD2004). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctggaagaagaactccctcg
cctcgcagacgacgatctaaatctccgcgtcgcagaagatctcactctcgggaatcccaatgatcatcaaccaccagcac
cgsaccatgcaagacctgcacgactcctgctcaaggcaactctacgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JN827419_SP_P-B Feature FT:CDS JN827419_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2539). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcagaacctgcacaactcctgctcaagggacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ027311_SP_P-B Feature FT:CDS JQ027311_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagkcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcycaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggcttycgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ027312_SP_P-B Feature FT:CDS JQ027312_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacraagakgcaggtccyctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaayctcaatgatcatcaacaaccagcac
cggaccatgcaaracctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ027313_SP_P-B Feature FT:CDS JQ027313_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgacgatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctaygtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcrtcttgggcttycgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ027315_SP_P-B Feature FT:CDS JQ027315_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcatcaacgaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ027316_SP_P-B Feature FT:CDS JQ027316_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggaca
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ027325_SP_P-B Feature FT:CDS JQ027325_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcacggaacctctatgtttccctcatgttgctgtacgaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ027329_SP_P-B Feature FT:CDS JQ027329_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactrctgttgttagacgaagaagcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatcttgatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcraggracctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ027330_SP_P-B Feature FT:CDS JQ027330_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaccaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ027331_SP_P-B Feature FT:CDS JQ027331_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaccaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ027334_SP_P-B Feature FT:CDS JQ027334_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ040125_SP_P-B Feature FT:CDS JQ040125_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 8). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcatcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ040128_SP_P-B Feature FT:CDS JQ040128_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 69). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggratctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacracttctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ040138_SP_P-B Feature FT:CDS JQ040138_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 240). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ040147_SP_P-B Feature FT:CDS JQ040147_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 280). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtaccaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ040157_SP_P-B Feature FT:CDS JQ040157_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G187). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgawcatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggcacctctatgtttcmctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ040169_SP_P-B Feature FT:CDS JQ040169_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G237). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ040170_SP_P-B Feature FT:CDS JQ040170_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G238). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaawatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ040171_SP_P-B Feature FT:CDS JQ040171_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G239). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctckcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ040173_SP_P-B Feature FT:CDS JQ040173_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G244). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341549_SP_P-B Feature FT:CDS JQ341549_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno01). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacatgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341550_SP_P-B Feature FT:CDS JQ341550_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno02). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacarctmctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341551_SP_P-B Feature FT:CDS JQ341551_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno03). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctyaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacarctcctgctcaaggaamctctaygwttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatwcctatgggrgtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341552_SP_P-B Feature FT:CDS JQ341552_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno04). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgctgctgtacaaaacctacggatg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341553_SP_P-B Feature FT:CDS JQ341553_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno05). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagakgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacarctcctgctcaaggaacctctaygtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatwcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341554_SP_P-B Feature FT:CDS JQ341554_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno06). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaakctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341555_SP_P-B Feature FT:CDS JQ341555_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno07). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacatgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341556_SP_P-B Feature FT:CDS JQ341556_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno08). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactrctgttgttagacaaagacgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctaaatctcgggactctcaatgatcatcaacraccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgyaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341557_SP_P-B Feature FT:CDS JQ341557_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno09). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagakgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctyaatgatcatcaacaaccagcac
cggamcatgcaaracctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacr
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341558_SP_P-B Feature FT:CDS JQ341558_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno10). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcwgaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341559_SP_P-B Feature FT:CDS JQ341559_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno11). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
cggaccatgcaaracctgcacarctcctgctcaaggaacctctatgtttccctcatgttgctgtayaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341560_SP_P-B Feature FT:CDS JQ341560_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno12). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagaggaagaagcagggcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341561_SP_P-B Feature FT:CDS JQ341561_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno13). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacaaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggacccttaatgatcatcaacaaccagcac
gggaccatgcaaaacctgcacgactcctgctcrarrmacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatmcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341562_SP_P-B Feature FT:CDS JQ341562_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno14). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaatacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggactcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341563_SP_P-B Feature FT:CDS JQ341563_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno15). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaarcctgcacractcctgctcaaggaacctctatgtttccctcatgttgctgttcaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341564_SP_P-B Feature FT:CDS JQ341564_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno16). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341565_SP_P-B Feature FT:CDS JQ341565_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno17). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactrctgttgttagacgamgakgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggratctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341566_SP_P-B Feature FT:CDS JQ341566_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno18). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacgaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341567_SP_P-B Feature FT:CDS JQ341567_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno19). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctccatctcggggatctcaatgatcatcaacgaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctwtgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341568_SP_P-B Feature FT:CDS JQ341568_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno20). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctaaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactactgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341569_SP_P-B Feature FT:CDS JQ341569_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno21). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacaaagacgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341570_SP_P-B Feature FT:CDS JQ341570_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno22). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341571_SP_P-B Feature FT:CDS JQ341571_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno23). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcancacttccggaaactactgttgttagaggacggggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaycccaatgatcatcaaccaccagcac
gggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggatg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatwcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341572_SP_P-B Feature FT:CDS JQ341572_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno24). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcagtctcgggaacctcaatgatcatcaacgaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341573_SP_P-B Feature FT:CDS JQ341573_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno25). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341574_SP_P-B Feature FT:CDS JQ341574_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno26). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341575_SP_P-B Feature FT:CDS JQ341575_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno27). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
gggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341576_SP_P-B Feature FT:CDS JQ341576_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno28). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggagaatactgttgttagaccaagacgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacgtcaatgatcatcaacaaccagcac
tggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341577_SP_P-B Feature FT:CDS JQ341577_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno29). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgamgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacr
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341578_SP_P-B Feature FT:CDS JQ341578_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno30). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctyaatgatcatcaacaaccagcac
cggaccatgcaaaacttgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341579_SP_P-B Feature FT:CDS JQ341579_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno31). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggcacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341580_SP_P-B Feature FT:CDS JQ341580_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno32). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagarcctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341581_SP_P-B Feature FT:CDS JQ341581_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno33). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggactcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacgaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341582_SP_P-B Feature FT:CDS JQ341582_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno34). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctyaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactactgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcy
tggctcagtttactag
>gnl|hbvcds|JQ341583_SP_P-B Feature FT:CDS JQ341583_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno35). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcscagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341584_SP_P-B Feature FT:CDS JQ341584_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno36). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341585_SP_P-B Feature FT:CDS JQ341585_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno37). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctttgtttccctcatgctgctgtacaaaacctacggacg
gaaactgcacatgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagyccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341586_SP_P-B Feature FT:CDS JQ341586_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno38). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaygcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatwcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341587_SP_P-B Feature FT:CDS JQ341587_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno39). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaacatcaatgatcatcaacraccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341588_SP_P-B Feature FT:CDS JQ341588_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno40). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagaactcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341589_SP_P-B Feature FT:CDS JQ341589_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno41). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacaacgaggcaggtcccytagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcggggatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341590_SP_P-B Feature FT:CDS JQ341590_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno42). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgakgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcmgaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatwcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341591_SP_P-B Feature FT:CDS JQ341591_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno43). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341592_SP_P-B Feature FT:CDS JQ341592_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno44). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttrttagacaacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctccatctcgggaacatcaatgatcatcaacgaccagcac
gggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatccctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341593_SP_P-B Feature FT:CDS JQ341593_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno45). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341594_SP_P-B Feature FT:CDS JQ341594_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno46). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagasraagaggcaggwcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcartctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgttgtacaaaacctacggacg
gaaactgcacctgtattcccatcccrtcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341595_SP_P-B Feature FT:CDS JQ341595_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno47). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactrctgttgttagaccaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacgaccagcac
yggaccatgcaaaacctgcacractcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacytgtattcccatcccatcatcttgggcttycgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341596_SP_P-B Feature FT:CDS JQ341596_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno48). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacaacgaggcaggacccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgyaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341597_SP_P-B Feature FT:CDS JQ341597_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno49). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgakgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctyaatgatcatcaaccaccagcac
cggatcatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341598_SP_P-B Feature FT:CDS JQ341598_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno50). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacgaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341599_SP_P-B Feature FT:CDS JQ341599_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno51). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgakgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctyaatgatcatcaaccaccagcac
cggatcatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341600_SP_P-B Feature FT:CDS JQ341600_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno52). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaatgcttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcgacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaccctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341601_SP_P-B Feature FT:CDS JQ341601_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno53). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtayaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341603_SP_P-B Feature FT:CDS JQ341603_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno55). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341604_SP_P-B Feature FT:CDS JQ341604_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno56). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctwtgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341605_SP_P-B Feature FT:CDS JQ341605_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno57). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341606_SP_P-B Feature FT:CDS JQ341606_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno58). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcytatcaacgcttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggamyctcaatgatcatcaacaaccagcac
cggaccatgcaaaacmtgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341607_SP_P-B Feature FT:CDS JQ341607_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno59). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaagggccctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcrtcttgggctttcgcaaaatwcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341608_SP_P-B Feature FT:CDS JQ341608_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno60). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgagaaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcagtctcgggaacctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctwtgtttccctcatgttgctgtacaaaacctacggacr
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ341609_SP_P-B Feature FT:CDS JQ341609_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno61). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ429079_SP_P-B Feature FT:CDS JQ429079_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 08.10.002). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcytatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
gggaccatgcaaaccctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccgtcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ429080_SP_P-B Feature FT:CDS JQ429080_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 09.40.033). Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcyyaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtctccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ429081_SP_P-B Feature FT:CDS JQ429081_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 09.80.055). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ429082_SP_P-B Feature FT:CDS JQ429082_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 09.41.591). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ688405_SP_P-B Feature FT:CDS JQ688405_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBVB2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ707734_SP_P-B Feature FT:CDS JQ707734_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactactgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ707735_SP_P-B Feature FT:CDS JQ707735_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_10). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactactgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ707736_SP_P-B Feature FT:CDS JQ707736_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_11). Partial genome (Contains: HBx). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtataaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tgactcagtttactag
>gnl|hbvcds|JQ707737_SP_P-B Feature FT:CDS JQ707737_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_12). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactactgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ707738_SP_P-B Feature FT:CDS JQ707738_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_14). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactactgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ707739_SP_P-B Feature FT:CDS JQ707739_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_17). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactactgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ707740_SP_P-B Feature FT:CDS JQ707740_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_18). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaataatcatcaaccaccagcac
cggaccatgcagaacctgcacgactactgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcatcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|JQ707741_SP_P-B Feature FT:CDS JQ707741_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_19). Partial genome (Contains: HBx). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaggaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcatcaaccaccagcac
gggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtataaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tgactcagtttactag
>gnl|hbvcds|JQ707742_SP_P-B Feature FT:CDS JQ707742_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactactgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ707743_SP_P-B Feature FT:CDS JQ707743_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_20-3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactactgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ707744_SP_P-B Feature FT:CDS JQ707744_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_22). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactactgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ707745_SP_P-B Feature FT:CDS JQ707745_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_23). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
aggaccatgcagaacctgcacgactactgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ707746_SP_P-B Feature FT:CDS JQ707746_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_24-6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactactgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ707747_SP_P-B Feature FT:CDS JQ707747_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_25). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgaatactgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ707748_SP_P-B Feature FT:CDS JQ707748_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_26). Partial genome (Contains: HBx). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtataaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tgactcagtttactag
>gnl|hbvcds|JQ707749_SP_P-B Feature FT:CDS JQ707749_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_27). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactactgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ707750_SP_P-B Feature FT:CDS JQ707750_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_28). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatcgtcaaccaccagcac
cggaccatgcagaacctgcacgactactgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ707751_SP_P-B Feature FT:CDS JQ707751_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_30). Partial genome (Contains: HBx). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtataaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tgactcagtttactag
>gnl|hbvcds|JQ707752_SP_P-B Feature FT:CDS JQ707752_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_31). Partial genome (Contains: HBx). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtataaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tgactcagtttactag
>gnl|hbvcds|JQ707753_SP_P-B Feature FT:CDS JQ707753_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_32). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactactgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ707754_SP_P-B Feature FT:CDS JQ707754_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_33). Partial genome (Contains: HBx). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaacaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcagcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtataaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tgactcagtttactag
>gnl|hbvcds|JQ707755_SP_P-B Feature FT:CDS JQ707755_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_38). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactactgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ707756_SP_P-B Feature FT:CDS JQ707756_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_39). Partial genome (Contains: HBx). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtataaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tgactcagtttactag
>gnl|hbvcds|JQ707757_SP_P-B Feature FT:CDS JQ707757_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_40). Partial genome (Contains: HBx). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtataaaacttacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggccttagtccgtttctct
tgactcagtttactag
>gnl|hbvcds|JQ707758_SP_P-B Feature FT:CDS JQ707758_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_41). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactactgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ707759_SP_P-B Feature FT:CDS JQ707759_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_43). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactactgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ707760_SP_P-B Feature FT:CDS JQ707760_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_44). Partial genome (Contains: HBx). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtataaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ707761_SP_P-B Feature FT:CDS JQ707761_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_45). Partial genome (Contains: HBx). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtataaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tgactcagtttactag
>gnl|hbvcds|JQ707762_SP_P-B Feature FT:CDS JQ707762_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_46). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactactgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ707763_SP_P-B Feature FT:CDS JQ707763_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_47). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactactgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ707764_SP_P-B Feature FT:CDS JQ707764_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_48). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactactgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ707765_SP_P-B Feature FT:CDS JQ707765_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactactgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ707766_SP_P-B Feature FT:CDS JQ707766_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_8). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactactgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ707767_SP_P-B Feature FT:CDS JQ707767_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_9). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactactgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ801471_SP_P-B Feature FT:CDS JQ801471_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate AIDS7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctatggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ801474_SP_P-B Feature FT:CDS JQ801474_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate AIDS16). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaaggggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ801479_SP_P-B Feature FT:CDS JQ801479_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate AIDS22). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ801485_SP_P-B Feature FT:CDS JQ801485_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate AIDS32). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacaaagaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ801494_SP_P-B Feature FT:CDS JQ801494_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CONTROL1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacaaagacgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacgaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccgtcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ801506_SP_P-B Feature FT:CDS JQ801506_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CONTROL13). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagacgatctcaatctcgggaacctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ801507_SP_P-B Feature FT:CDS JQ801507_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CONTROL15). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ801512_SP_P-B Feature FT:CDS JQ801512_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CONTROL20). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcagaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ801514_SP_P-B Feature FT:CDS JQ801514_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CONTROL22). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ801516_SP_P-B Feature FT:CDS JQ801516_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CONTROL24). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacgaccagtac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JQ801524_SP_P-B Feature FT:CDS JQ801524_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CONTROL32). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JX026879_SP_P-B Feature FT:CDS JX026879_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WY-NJ-17). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gacactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JX026881_SP_P-B Feature FT:CDS JX026881_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WY-NJ-24). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaaggggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcatcaacgaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacacaacctacggaca
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JX026883_SP_P-B Feature FT:CDS JX026883_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WY-NJ-50). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcctaatgatcatcaacaaccagcac
cggaacatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JX026886_SP_P-B Feature FT:CDS JX026886_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WY-NJ-73). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgaacatcaactaccagcac
cggaccctgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JX429897_SP_P-B Feature FT:CDS JX429897_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WY-HZ-12). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaagacccgcacaactcctgctcaaagaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JX429899_SP_P-B Feature FT:CDS JX429899_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WY-HZ-20). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JX429900_SP_P-B Feature FT:CDS JX429900_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WY-HZ-24). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JX429901_SP_P-B Feature FT:CDS JX429901_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WY-HZ-33). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctca
tggctcagtttactag
>gnl|hbvcds|JX429902_SP_P-B Feature FT:CDS JX429902_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WY-HZ-34). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JX429908_SP_P-B Feature FT:CDS JX429908_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WY-HZ-58). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatttcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JX429910_SP_P-B Feature FT:CDS JX429910_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WY-HZ-67). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggattctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JX429911_SP_P-B Feature FT:CDS JX429911_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WY-NJ-45). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaattgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|JX504531_SP_P-B Feature FT:CDS JX504531_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WY-HZ-1). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaagacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JX504532_SP_P-B Feature FT:CDS JX504532_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WY-HZ-5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcacggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JX504533_SP_P-B Feature FT:CDS JX504533_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WY-HZ-16). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacaaagacgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JX504538_SP_P-B Feature FT:CDS JX504538_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WY-HZ-65). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacgaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JX504543_SP_P-B Feature FT:CDS JX504543_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WY-NNJ-19). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcgacacttccggaaactactgttattagacgaagaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcgtcatgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JX507210_SP_P-B Feature FT:CDS JX507210_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 16). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacgaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JX507213_SP_P-B Feature FT:CDS JX507213_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 82). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacgaccagcac
gggaccatgcaaaacctgcacaactcctgctcacggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatwcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JX507215_SP_P-B Feature FT:CDS JX507215_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 310). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaacgcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JX661470_SP_P-B Feature FT:CDS JX661470_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SH1221-B12). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JX661471_SP_P-B Feature FT:CDS JX661471_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SH1202-B1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctttgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JX661472_SP_P-B Feature FT:CDS JX661472_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SH1224-B13). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JX661473_SP_P-B Feature FT:CDS JX661473_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SH1220-B11). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cgggccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JX661474_SP_P-B Feature FT:CDS JX661474_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SH1229-B15). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JX661475_SP_P-B Feature FT:CDS JX661475_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SH1216-B9). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JX661476_SP_P-B Feature FT:CDS JX661476_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SH1227-B14). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgctgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JX661477_SP_P-B Feature FT:CDS JX661477_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SH1209-B5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JX661478_SP_P-B Feature FT:CDS JX661478_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SH1211-B7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JX661479_SP_P-B Feature FT:CDS JX661479_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SH1219-B10). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaacttctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JX661480_SP_P-B Feature FT:CDS JX661480_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SH1210-B6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JX661481_SP_P-B Feature FT:CDS JX661481_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SH1214-B8). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JX661482_SP_P-B Feature FT:CDS JX661482_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SH1204-B2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JX661483_SP_P-B Feature FT:CDS JX661483_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SH1205-B3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JX661484_SP_P-B Feature FT:CDS JX661484_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SH1206-B4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggatg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JX869998_SP_P-B Feature FT:CDS JX869998_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 317). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JX869999_SP_P-B Feature FT:CDS JX869999_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 14). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaaccccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcgacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JX870001_SP_P-B Feature FT:CDS JX870001_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 90). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactrctgttgttagacgaagaggcaggtcccctagaagaagaaccccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|JX978431_SP_P-B Feature FT:CDS JX978431_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate X02). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctttgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC492739_SP_P-B Feature FT:CDS KC492739_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MT). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaaggggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC492740_SP_P-B Feature FT:CDS KC492740_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Del). Partial genome (Contains: HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctggaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcatcaacaaccagcac
cggatcatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaagctgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC510641_SP_P-B Feature FT:CDS KC510641_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC510642_SP_P-B Feature FT:CDS KC510642_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC510643_SP_P-B Feature FT:CDS KC510643_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgacgcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC510644_SP_P-B Feature FT:CDS KC510644_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC510646_SP_P-B Feature FT:CDS KC510646_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
caaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC510647_SP_P-B Feature FT:CDS KC510647_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC510648_SP_P-B Feature FT:CDS KC510648_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC510649_SP_P-B Feature FT:CDS KC510649_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC510650_SP_P-B Feature FT:CDS KC510650_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactactgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC510651_SP_P-B Feature FT:CDS KC510651_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC510652_SP_P-B Feature FT:CDS KC510652_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC510653_SP_P-B Feature FT:CDS KC510653_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC510654_SP_P-B Feature FT:CDS KC510654_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC510655_SP_P-B Feature FT:CDS KC510655_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacgaccagcac
cggaccatgcaaaacctgcacaactactgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC510656_SP_P-B Feature FT:CDS KC510656_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC510657_SP_P-B Feature FT:CDS KC510657_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcacggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC510658_SP_P-B Feature FT:CDS KC510658_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacgaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC510659_SP_P-B Feature FT:CDS KC510659_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC510660_SP_P-B Feature FT:CDS KC510660_SP_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774362_SP_P-B Feature FT:CDS KC774362_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate blz1107). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactactgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774363_SP_P-B Feature FT:CDS KC774363_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate blz2022). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774365_SP_P-B Feature FT:CDS KC774365_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate blz2113). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774366_SP_P-B Feature FT:CDS KC774366_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate blz2116). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774367_SP_P-B Feature FT:CDS KC774367_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate blz2147). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774368_SP_P-B Feature FT:CDS KC774368_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bur1012). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaagacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774369_SP_P-B Feature FT:CDS KC774369_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bur1013). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccacaagcac
cgggccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774370_SP_P-B Feature FT:CDS KC774370_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bur1014). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcattctcgggaatctcaatgatcatcaaccacaagcac
cgggccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774371_SP_P-B Feature FT:CDS KC774371_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bur1036). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774372_SP_P-B Feature FT:CDS KC774372_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bur1040). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcacggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774373_SP_P-B Feature FT:CDS KC774373_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bur1044). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774374_SP_P-B Feature FT:CDS KC774374_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bur1053). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcgacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774375_SP_P-B Feature FT:CDS KC774375_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bur1055). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774376_SP_P-B Feature FT:CDS KC774376_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bur1056). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggatcatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774377_SP_P-B Feature FT:CDS KC774377_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bur1064). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774378_SP_P-B Feature FT:CDS KC774378_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bww1015). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774379_SP_P-B Feature FT:CDS KC774379_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bww1023). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcgacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774380_SP_P-B Feature FT:CDS KC774380_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bww1033). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcgacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
caaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774381_SP_P-B Feature FT:CDS KC774381_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bww1062). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774382_SP_P-B Feature FT:CDS KC774382_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bww1063). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcacctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774383_SP_P-B Feature FT:CDS KC774383_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bww1081). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacgaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774384_SP_P-B Feature FT:CDS KC774384_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bww1091). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774385_SP_P-B Feature FT:CDS KC774385_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bww1099). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774386_SP_P-B Feature FT:CDS KC774386_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bww1101). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774387_SP_P-B Feature FT:CDS KC774387_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bww1104). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774388_SP_P-B Feature FT:CDS KC774388_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bww1116). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcgacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774389_SP_P-B Feature FT:CDS KC774389_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bww1121). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacgaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774390_SP_P-B Feature FT:CDS KC774390_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bww2158). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcatcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774391_SP_P-B Feature FT:CDS KC774391_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bww2163). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774392_SP_P-B Feature FT:CDS KC774392_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bww2169). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774393_SP_P-B Feature FT:CDS KC774393_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bxa1068). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774394_SP_P-B Feature FT:CDS KC774394_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bxa1070). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
gggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774395_SP_P-B Feature FT:CDS KC774395_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bxa1073). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774396_SP_P-B Feature FT:CDS KC774396_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bxa1182). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaagacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774397_SP_P-B Feature FT:CDS KC774397_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bxa1185). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacgaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774398_SP_P-B Feature FT:CDS KC774398_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bxa1202). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
gggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774399_SP_P-B Feature FT:CDS KC774399_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bxa1556). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774400_SP_P-B Feature FT:CDS KC774400_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bxa1585). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaggcctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774401_SP_P-B Feature FT:CDS KC774401_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bxa1663). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
gggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774402_SP_P-B Feature FT:CDS KC774402_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bxa1670). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774403_SP_P-B Feature FT:CDS KC774403_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bxa2001). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774404_SP_P-B Feature FT:CDS KC774404_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bxa2004). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774405_SP_P-B Feature FT:CDS KC774405_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bxa2005). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774406_SP_P-B Feature FT:CDS KC774406_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bxa2009). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774407_SP_P-B Feature FT:CDS KC774407_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bxa2011). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtctcctagaagaagaactccctcg
cctcgcagacgacggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774408_SP_P-B Feature FT:CDS KC774408_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bxa2012). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774409_SP_P-B Feature FT:CDS KC774409_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bxa2013). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacgaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774410_SP_P-B Feature FT:CDS KC774410_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bxa2018). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatccacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcacggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774411_SP_P-B Feature FT:CDS KC774411_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bxa2025). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774412_SP_P-B Feature FT:CDS KC774412_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bxa2034). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggtgtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774413_SP_P-B Feature FT:CDS KC774413_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bxa2037). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactactgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774415_SP_P-B Feature FT:CDS KC774415_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bxa2064). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcagtctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactactgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774416_SP_P-B Feature FT:CDS KC774416_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bxn1016). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774417_SP_P-B Feature FT:CDS KC774417_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bxn1028). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggtccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774418_SP_P-B Feature FT:CDS KC774418_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bxn1055). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactactgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC774419_SP_P-B Feature FT:CDS KC774419_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bxn1083). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC792652_SP_P-B Feature FT:CDS KC792652_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0005). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagaccaagacgcacgtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacytgcacractcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagttyactag
>gnl|hbvcds|KC792663_SP_P-B Feature FT:CDS KC792663_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0016). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtaccaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC792667_SP_P-B Feature FT:CDS KC792667_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0020). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC792674_SP_P-B Feature FT:CDS KC792674_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0027). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacaaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatrcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC792701_SP_P-B Feature FT:CDS KC792701_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0054). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaaytgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC792712_SP_P-B Feature FT:CDS KC792712_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0065). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC792717_SP_P-B Feature FT:CDS KC792717_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0070). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggaaactactgttgttagacgaagaggcgggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC792719_SP_P-B Feature FT:CDS KC792719_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0072). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacaacgaggcaggtcctctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC792734_SP_P-B Feature FT:CDS KC792734_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0087). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggagactactgttattagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacraccagcac
cggaccatgcaaaacttgcacawctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC792742_SP_P-B Feature FT:CDS KC792742_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0095). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcagaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC792745_SP_P-B Feature FT:CDS KC792745_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0098). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagaccacgacgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcaacaacaaccagcac
gggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC792748_SP_P-B Feature FT:CDS KC792748_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0101). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaggaaggagcaggccccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaactgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgytgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC792756_SP_P-B Feature FT:CDS KC792756_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0109). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC792765_SP_P-B Feature FT:CDS KC792765_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0118). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactactgctcaaggaacctctacgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatctttggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC792767_SP_P-B Feature FT:CDS KC792767_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0120). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=332 residues).
ccctatcttatcaacacttccggaaactrctgttgttagaccaagaggcaggtcccctagaagaagaactccctcgcctc
gcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcatcaacaaccagcaccgga
ccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaa
ctgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggc
tcagtttactag
>gnl|hbvcds|KC792777_SP_P-B Feature FT:CDS KC792777_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0130). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttgtcaacacttccggaaactactgttgttagaggaaggggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcggtctcgggactctcaatgatcaacaactaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggggtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC792779_SP_P-B Feature FT:CDS KC792779_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0132). Partial genome (Contains: HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcatcaacgaccagcac
cggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC792780_SP_P-B Feature FT:CDS KC792780_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0133). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaggaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcggtctcgggaatctcaatgatcatcaacaaccagcac
sggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC792786_SP_P-B Feature FT:CDS KC792786_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0139). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgaagagtcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggamtctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacractcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC792798_SP_P-B Feature FT:CDS KC792798_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0151). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC792800_SP_P-B Feature FT:CDS KC792800_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0153). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttattagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacgaccagcac
sggaccatgcaaaacctgcacractcctgctcaaggaacctctatgtttccctcatgttgctgtaccaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC792801_SP_P-B Feature FT:CDS KC792801_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0154). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcawcaacaaccagcac
cggaccatgcaarrcctgcacgactcctgctcaaggaacctctayatttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC792811_SP_P-B Feature FT:CDS KC792811_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0164). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgatcatcaacaaccagcac
gggaccatgcaaaacctgcacaactcctgctcaagggacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccgtcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC792843_SP_P-B Feature FT:CDS KC792843_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0196). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatcccaatgatcatcaacaaccagcac
cggaccatgcaaggcctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggatg
gaaactgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC792859_SP_P-B Feature FT:CDS KC792859_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0212). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=331 residues).
cctatcttatcaacacttccggaaactactgttgttagacaacgaggcaggtccactagaagaagaactccctcgcctcg
cagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacgaccagcaccggac
catgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaac
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactag
>gnl|hbvcds|KC792860_SP_P-B Feature FT:CDS KC792860_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0213). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaggaaggggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggactctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC792885_SP_P-B Feature FT:CDS KC792885_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0238). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaatacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC792889_SP_P-B Feature FT:CDS KC792889_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0242). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=332 residues).
ccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctc
gcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcacsgga
ccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaa
ctgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggc
tcagtttactag
>gnl|hbvcds|KC792896_SP_P-B Feature FT:CDS KC792896_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0249). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=332 residues).
ccctatcttatcaacacttccggaaactactgttgttagacgaagakgcaggtcccctagaagaagaactccctcgcctc
gcagacgaaggtctcaatcgccgcgtcgcagaagatctmaatctcgggaatctcaatgatcatcaacaaccagcaccgga
ccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaa
ctgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggc
tcagtttactag
>gnl|hbvcds|KC792897_SP_P-B Feature FT:CDS KC792897_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0250). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggaaactgctgttgttagacaaagatgcaggacccctagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctttgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC792901_SP_P-B Feature FT:CDS KC792901_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0254). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggaag
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC792904_SP_P-B Feature FT:CDS KC792904_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0257). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatcycaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacarctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC792920_SP_P-B Feature FT:CDS KC792920_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0273). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcycaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctwtgtttccctcatgttgctgtaccaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC792935_SP_P-B Feature FT:CDS KC792935_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0288). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=332 residues).
ccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctc
gcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacgaccagcaccgga
ccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaa
ctgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggwgtgggcctcagtccgtttctcttggc
tcagtttactag
>gnl|hbvcds|KC792936_SP_P-B Feature FT:CDS KC792936_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0289). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacaaagaggcaggtccactagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctccrtctcgggratctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacracwcctgctcaaggaacctctatgtttccctcatgttgytgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC792938_SP_P-B Feature FT:CDS KC792938_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0291). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaggaaggggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgatcatcaacgaccagcac
cggaccatgcaaaacctgcacaactactgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC792939_SP_P-B Feature FT:CDS KC792939_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0292). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=332 residues).
ccctatcttatcaacacttccggaaactgctgttgttagacaaagacgcaggtcccctagaagaagaactccctcgcctc
gcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcaccgga
ccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaa
ctgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggc
tcagtttactag
>gnl|hbvcds|KC792945_SP_P-B Feature FT:CDS KC792945_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0298). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacractmctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC792947_SP_P-B Feature FT:CDS KC792947_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0300). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcctatcaacacttccggaaactactgttattagaggaagacgcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacgaccagcac
cggaccatgcaaaacctgcacractcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggsttycgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC792948_SP_P-B Feature FT:CDS KC792948_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0301). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC792949_SP_P-B Feature FT:CDS KC792949_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0302). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=332 residues).
ccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctc
gcagacgaagrtctcaatcgccgcgtcgcagragaactcaatctcgggaatcycaatgakcatcaacaaccagcaccgga
ccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaa
ctgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggc
tcagtttactag
>gnl|hbvcds|KC792951_SP_P-B Feature FT:CDS KC792951_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0304). Partial genome (Contains: HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC792955_SP_P-B Feature FT:CDS KC792955_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0308). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacaaagacgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctccatctcgggaacctcaatgatcatcaacaaccagcac
sggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC792970_SP_P-B Feature FT:CDS KC792970_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0323). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=332 residues).
ccctatcttatcaacacttccggaaactactrttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctc
gcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacgaccagcaccgga
ccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaa
ctgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggc
tcagtttactag
>gnl|hbvcds|KC792973_SP_P-B Feature FT:CDS KC792973_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0326). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacaaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggactctcaatgatcatcaacaaccagcac
cggaccatgcaargcytgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC792974_SP_P-B Feature FT:CDS KC792974_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0327). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=332 residues).
ccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctc
gcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaayctcaatgatcatcaacaaccagcaccgga
ccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaa
ctgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggc
tcagtttactag
>gnl|hbvcds|KC792976_SP_P-B Feature FT:CDS KC792976_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0329). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacaaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctmagtctcgggamtctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggatg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC792982_SP_P-B Feature FT:CDS KC792982_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0335). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC792985_SP_P-B Feature FT:CDS KC792985_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0338). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagaccaagaggcaggtccactagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtagcagaagatctccatctcggggatctcaatgatcatcaacaaccagcac
gggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC792994_SP_P-B Feature FT:CDS KC792994_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0347). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=332 residues).
ccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctc
gcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcaccgga
ccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaa
ctgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggc
tcagtttactag
>gnl|hbvcds|KC793004_SP_P-B Feature FT:CDS KC793004_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0357). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=332 residues).
ccctatcttatcaacacttccggaaactrctgttattagacgaagaggcaggtcccctagaagaagaactccctcgcctc
gcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcatcaacaaccagcaccgga
ccatgcaaaacctgcacgactcctgctcaaggaacctctwtgtttccctcatgttgctgtacaaaacctacggacggaaa
ctgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggc
tcagtttactag
>gnl|hbvcds|KC793006_SP_P-B Feature FT:CDS KC793006_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0359). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagaccaagaggcaggtcctctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccctgcaaaacctgcacrwctcctgctcaaggaacctctatgtttccctcatgttgctgtayaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC793030_SP_P-B Feature FT:CDS KC793030_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0383). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacaattccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC793042_SP_P-B Feature FT:CDS KC793042_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0395). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=332 residues).
ccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctc
gcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcaccgga
ccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaa
ctgcacctgtattcccatcccatcatcttgggctttcgcaaaatmcctatgggagtgggcctcagtccgtttctcttggc
tcagtttactag
>gnl|hbvcds|KC793061_SP_P-B Feature FT:CDS KC793061_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0414). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=332 residues).
ccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctc
gcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccaaatgatcatcaacaaccagcaccgga
acatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtaccaaacctacggacggaaa
ctgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggc
tcagtttactag
>gnl|hbvcds|KC793064_SP_P-B Feature FT:CDS KC793064_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0417). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=332 residues).
ccctatcttatcaacacttccggaaactactgttgttagacaaagaggcaggacccctagaagaagaactccctcgcctc
gcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcaccgga
ccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaa
ctgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggc
tcagtttactag
>gnl|hbvcds|KC793069_SP_P-B Feature FT:CDS KC793069_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0422). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=332 residues).
ccctatcttatcaacacttccggaaactactgttgttagaggaagacgcaggtcccctagaagaagaactccctcgcctc
gcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcatcaactaccagcaccgga
ccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtaccaaacctacggacggaaa
ctgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggc
tcagtttactag
>gnl|hbvcds|KC793076_SP_P-B Feature FT:CDS KC793076_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0429). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaccaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagawctcaatcrccgcgtcgcaracgatctcamtctcgggaatctaaatgatcctcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC793125_SP_P-B Feature FT:CDS KC793125_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0478). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacaacgaggcaggtccactagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacgaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgttgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC793132_SP_P-B Feature FT:CDS KC793132_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0485). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacrrctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC793139_SP_P-B Feature FT:CDS KC793139_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0492). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=332 residues).
ccctatcttatcaacacttccggaaactactgttgttagacaaagacgcaggtcccctagaagaagaactccctcgcctc
gcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcacggga
ccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaa
ctgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggc
tcagtttactag
>gnl|hbvcds|KC793141_SP_P-B Feature FT:CDS KC793141_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0494). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggaaactactgttattagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaagacctgcacgactcctgctcaaggaacctctttgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC793168_SP_P-B Feature FT:CDS KC793168_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0521). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=331 residues).
cctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcg
cagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcaccggac
catgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactag
>gnl|hbvcds|KC793180_SP_P-B Feature FT:CDS KC793180_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0533). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggaaactgctgttgttagacsaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcatcaacgaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KC793189_SP_P-B Feature FT:CDS KC793189_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0542). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=333 residues).
cccctatcttatcaacacttccggaaactactgttgttagacaaagatgcaggacccctagaagaagaactccctcgcct
cgcagacgaaggtctaaatcaccgcgtcgcagaagatcttcatctcgggaatctcaatgatcatcgacaaccagcaccgg
accatgcaaaacctgcacaactcctgctcaaggaacctctatgtttcctgcatgttgctgtacaaaacctacggacggaa
actgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttgg
ctcagttcactag
>gnl|hbvcds|KC793199_SP_P-B Feature FT:CDS KC793199_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EP0552). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=331 residues).
cctatcttatcaacgcttccggaractactgttgttagacaacgacgcaggtcccctagaagaagaactccctcgcctcg
cagacgaaggtctcaatcgccgcgtcgcagaagatctmaatctcgggaatctcaatgatcatcaacaaccagcaccggac
catgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtaccaaacctacggacggaaac
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactag
>gnl|hbvcds|KF053159_SP_P-B Feature FT:CDS KF053159_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY155693). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacaaaggactcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctttgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tgactcagtttactag
>gnl|hbvcds|KF053162_SP_P-B Feature FT:CDS KF053162_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY247131). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaagcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcatcgaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KF053163_SP_P-B Feature FT:CDS KF053163_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY727495). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaccaagaggcaggtccactagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgctgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KF053165_SP_P-B Feature FT:CDS KF053165_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY484998). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaagcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcatcgaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KF053171_SP_P-B Feature FT:CDS KF053171_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY43147). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacaaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KF053174_SP_P-B Feature FT:CDS KF053174_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY495063). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
gggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KF053180_SP_P-B Feature FT:CDS KF053180_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY727093). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggagactgctgttgttagaccaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggactcaatcgccgcgtcgcagaagatctcggtctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KF053182_SP_P-B Feature FT:CDS KF053182_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY741196). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactgctgttgttagaccaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggactcaatcgccgcgtcgcagaagatctcggtctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KF053189_SP_P-B Feature FT:CDS KF053189_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY266289). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggactcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctttgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KF053190_SP_P-B Feature FT:CDS KF053190_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY781114). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctttgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatctttggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KF053191_SP_P-B Feature FT:CDS KF053191_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY846440). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaaatactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtataaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KF053192_SP_P-B Feature FT:CDS KF053192_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY790800). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KF053194_SP_P-B Feature FT:CDS KF053194_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY799421). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggactcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctttgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173297_SP_P-B Feature FT:CDS KJ173297_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate FH008C(e46n)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173298_SP_P-B Feature FT:CDS KJ173298_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate FH008M(e47)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaccctctttgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173339_SP_P-B Feature FT:CDS KJ173339_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CX001C(e201)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173340_SP_P-B Feature FT:CDS KJ173340_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CX001M(e202)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173341_SP_P-B Feature FT:CDS KJ173341_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CX003C(e204)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173342_SP_P-B Feature FT:CDS KJ173342_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CX003M(e205)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173343_SP_P-B Feature FT:CDS KJ173343_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CX007C(e211)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173345_SP_P-B Feature FT:CDS KJ173345_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CX008C(e214)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173347_SP_P-B Feature FT:CDS KJ173347_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CX012C(e220)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173348_SP_P-B Feature FT:CDS KJ173348_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CX012M(e221)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173351_SP_P-B Feature FT:CDS KJ173351_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CX025C(e234)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173352_SP_P-B Feature FT:CDS KJ173352_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CX025M(e235n)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173353_SP_P-B Feature FT:CDS KJ173353_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CX027C(e237)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173354_SP_P-B Feature FT:CDS KJ173354_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CX027M(e235n)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173355_SP_P-B Feature FT:CDS KJ173355_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CX032C(e247n)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173356_SP_P-B Feature FT:CDS KJ173356_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CX032M(e248n)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173357_SP_P-B Feature FT:CDS KJ173357_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CX065C(e313)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173359_SP_P-B Feature FT:CDS KJ173359_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate NB161C(m162)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173360_SP_P-B Feature FT:CDS KJ173360_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate NB161M(m161)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccaatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173361_SP_P-B Feature FT:CDS KJ173361_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate NB041C(m42)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173362_SP_P-B Feature FT:CDS KJ173362_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate NB041M(m41)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacatgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173363_SP_P-B Feature FT:CDS KJ173363_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate P002-C(006)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaacgtctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173364_SP_P-B Feature FT:CDS KJ173364_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate P002-M(007)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaacgtctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173365_SP_P-B Feature FT:CDS KJ173365_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate P003-C(009)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173366_SP_P-B Feature FT:CDS KJ173366_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate P003-M(011)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173367_SP_P-B Feature FT:CDS KJ173367_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate P006-C(B1)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173368_SP_P-B Feature FT:CDS KJ173368_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate P006-M(B3)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173369_SP_P-B Feature FT:CDS KJ173369_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate P008-C(B37)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173370_SP_P-B Feature FT:CDS KJ173370_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate P008-M(B39)). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173371_SP_P-B Feature FT:CDS KJ173371_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate P009-C(B135)). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcatcaacaaccagcac
cgggccatgcaaaacctgcacaactcctgctcaaggaacctctttgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173372_SP_P-B Feature FT:CDS KJ173372_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate P009-M2(B137)). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcatcaacaaccagcac
cgggccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173373_SP_P-B Feature FT:CDS KJ173373_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate P010-C1(147a)). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173374_SP_P-B Feature FT:CDS KJ173374_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate P010-M(B149)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173375_SP_P-B Feature FT:CDS KJ173375_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YY004C(e107)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaaactctatgtttccctcatgttgctgtacaaaacctacggaca
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173376_SP_P-B Feature FT:CDS KJ173376_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YY004M(e108)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173377_SP_P-B Feature FT:CDS KJ173377_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YY014C(e115)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cgggccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173378_SP_P-B Feature FT:CDS KJ173378_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YY014M(e116)). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcaggaatcttaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173379_SP_P-B Feature FT:CDS KJ173379_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YY019C(e121)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtataaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173380_SP_P-B Feature FT:CDS KJ173380_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YY019M(e122)). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173381_SP_P-B Feature FT:CDS KJ173381_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N16-C(FY137Cn).fas). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173382_SP_P-B Feature FT:CDS KJ173382_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N16_M(FY137An).fas). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173383_SP_P-B Feature FT:CDS KJ173383_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YZ009C(e30)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactrctgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggccttagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173384_SP_P-B Feature FT:CDS KJ173384_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YZ009M(e31)). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggccttagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173385_SP_P-B Feature FT:CDS KJ173385_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Vac02-M(m603)). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcgcctatcttatcaacacttccggaaactactgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtaccaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173386_SP_P-B Feature FT:CDS KJ173386_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Vac02-C(m604)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtaccaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173387_SP_P-B Feature FT:CDS KJ173387_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Vac03-M(m607)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173388_SP_P-B Feature FT:CDS KJ173388_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Vac03-C(m608)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagcccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173389_SP_P-B Feature FT:CDS KJ173389_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Vac05-M(m617)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcacctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173390_SP_P-B Feature FT:CDS KJ173390_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Vac05-C(m618)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcacctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173397_SP_P-B Feature FT:CDS KJ173397_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N03-M(134A)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctatggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173398_SP_P-B Feature FT:CDS KJ173398_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N03-C(134B)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctatggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173399_SP_P-B Feature FT:CDS KJ173399_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N07-M(4161A)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgacggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173400_SP_P-B Feature FT:CDS KJ173400_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N07-C(4230B)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgacggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173401_SP_P-B Feature FT:CDS KJ173401_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N09-M(6720A)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccacaagcac
cgggccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173402_SP_P-B Feature FT:CDS KJ173402_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N09-C(3733B)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccacaagcac
cgggccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173403_SP_P-B Feature FT:CDS KJ173403_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N10-M(6641M)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
caaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173404_SP_P-B Feature FT:CDS KJ173404_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N10-C(3953B)). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
caaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173405_SP_P-B Feature FT:CDS KJ173405_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N11-M(6642A)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173406_SP_P-B Feature FT:CDS KJ173406_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N11-C(3965B)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173407_SP_P-B Feature FT:CDS KJ173407_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N13-M(6650A)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173408_SP_P-B Feature FT:CDS KJ173408_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N13-C(4198B)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173409_SP_P-B Feature FT:CDS KJ173409_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N14-M(6692A)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173410_SP_P-B Feature FT:CDS KJ173410_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N14-C(4171B)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173411_SP_P-B Feature FT:CDS KJ173411_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N15-M(6579A)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173412_SP_P-B Feature FT:CDS KJ173412_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N15-C(4159b)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173413_SP_P-B Feature FT:CDS KJ173413_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N16_M(FY137A)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173414_SP_P-B Feature FT:CDS KJ173414_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N16_C(FY137B)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173415_SP_P-B Feature FT:CDS KJ173415_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N16-V(FY137C)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173416_SP_P-B Feature FT:CDS KJ173416_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N201M(e401)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173417_SP_P-B Feature FT:CDS KJ173417_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N201C(e402)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173418_SP_P-B Feature FT:CDS KJ173418_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N202M(e403)). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaacttctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173419_SP_P-B Feature FT:CDS KJ173419_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N202C(e404)). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaacttctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173420_SP_P-B Feature FT:CDS KJ173420_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N203M(e405)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatctttggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173421_SP_P-B Feature FT:CDS KJ173421_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N203C(e406)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatctttggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173422_SP_P-B Feature FT:CDS KJ173422_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N204M(e407)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173423_SP_P-B Feature FT:CDS KJ173423_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N204C(e408)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173424_SP_P-B Feature FT:CDS KJ173424_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N205M(e409)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacgaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ173425_SP_P-B Feature FT:CDS KJ173425_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N205C(e410)). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacgaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ410490_SP_P-B Feature FT:CDS KJ410490_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HK_1329). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggcaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ410500_SP_P-B Feature FT:CDS KJ410500_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Occult_HK321). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttattagacaacgaggcaggtcctctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ410502_SP_P-B Feature FT:CDS KJ410502_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Occult_HK318). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgaagaagcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ410507_SP_P-B Feature FT:CDS KJ410507_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Occult_HK6840). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacgaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ410516_SP_P-B Feature FT:CDS KJ410516_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Occult_HK4777). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ410517_SP_P-B Feature FT:CDS KJ410517_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Occult_HK4901). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ717792_SP_P-B Feature FT:CDS KJ717792_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY853571). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcttcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ717795_SP_P-B Feature FT:CDS KJ717795_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY303852). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttattagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggcacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ717796_SP_P-B Feature FT:CDS KJ717796_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY298487). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ717797_SP_P-B Feature FT:CDS KJ717797_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY336660). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcctcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtataaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagttcactag
>gnl|hbvcds|KJ717798_SP_P-B Feature FT:CDS KJ717798_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY811794). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctccatctcggggatctcaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ717801_SP_P-B Feature FT:CDS KJ717801_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY717979). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggactcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cagaccatgcaaaacctgcacgactcctgctccaggaacctctttgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacccatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ717805_SP_P-B Feature FT:CDS KJ717805_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY493880). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggactcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctttgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ717806_SP_P-B Feature FT:CDS KJ717806_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY789421). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggactcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctttgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ717807_SP_P-B Feature FT:CDS KJ717807_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY711763). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ717808_SP_P-B Feature FT:CDS KJ717808_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY775775). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggactcaatcgccgcttcgcagacgatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctttgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ717813_SP_P-B Feature FT:CDS KJ717813_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY445015). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gcaactgcacctgtattcccatcccatcatctttggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ717817_SP_P-B Feature FT:CDS KJ717817_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY491666). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaacttgtgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgatcatcaacaaccagccc
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctacgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ717818_SP_P-B Feature FT:CDS KJ717818_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY081577). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggaaactgctgttgttagaccaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaaaatctccatctcggggatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ717820_SP_P-B Feature FT:CDS KJ717820_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY571290). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacaaagacgcaggtcccctagaagacgaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcactctcgggaatctcaatgaacatcaactaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctttgtttccctcatgttgctgtacaaaacctacggacg
gcaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ717829_SP_P-B Feature FT:CDS KJ717829_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY540630). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccgcttcgcagaagatctcaatctcgggaccctcaatgatcatcgacaacaagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ717830_SP_P-B Feature FT:CDS KJ717830_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY501356). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcttcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ717831_SP_P-B Feature FT:CDS KJ717831_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY241913). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
cggaccatgcaagacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ717835_SP_P-B Feature FT:CDS KJ717835_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY131767). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacaacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ717836_SP_P-B Feature FT:CDS KJ717836_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY081397). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ717837_SP_P-B Feature FT:CDS KJ717837_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY500621). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggaaactgctgttgttagacacagacgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacgaccagcac
cggaccgtgcaaaacctgcacgacgcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ717840_SP_P-B Feature FT:CDS KJ717840_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY502457). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttcgacaacgcagcaggtcccttagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctggatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctttgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ717841_SP_P-B Feature FT:CDS KJ717841_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY331455). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcttcgcagaagatctcaatctcgggaacctcaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ717842_SP_P-B Feature FT:CDS KJ717842_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY201308). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcttcgcagaagatctcaatctcggcaatctcaatgatcaccaacgaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ717843_SP_P-B Feature FT:CDS KJ717843_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY381508). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggaaactactgttgttagacgaaggggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ790200_SP_P-B Feature FT:CDS KJ790200_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H44). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccaaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtaccaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ803752_SP_P-B Feature FT:CDS KJ803752_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY155693). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacaaaggactcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctttgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ803755_SP_P-B Feature FT:CDS KJ803755_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY247131). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaagcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcatcgaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ803756_SP_P-B Feature FT:CDS KJ803756_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY727495). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaccaagaggcaggtccactagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgctgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ803758_SP_P-B Feature FT:CDS KJ803758_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY484998). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaagcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcatcgaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ803763_SP_P-B Feature FT:CDS KJ803763_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY790800). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ803764_SP_P-B Feature FT:CDS KJ803764_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY043147). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacaaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ803768_SP_P-B Feature FT:CDS KJ803768_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY495063). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
gggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ803773_SP_P-B Feature FT:CDS KJ803773_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY727093). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggagactgctgttgttagaccaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggactcaatcgccgcgtcgcagaagatctcggtctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ803775_SP_P-B Feature FT:CDS KJ803775_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY741196). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatccacacttccggaaactgctgttgttagaccaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggactcaatcgccgcgtcgcagaagatctcggtctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ803781_SP_P-B Feature FT:CDS KJ803781_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY799421). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggactcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctttgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ803783_SP_P-B Feature FT:CDS KJ803783_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY266289). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggactcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctttgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ803784_SP_P-B Feature FT:CDS KJ803784_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY781114). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctttgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatctttggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ803786_SP_P-B Feature FT:CDS KJ803786_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY846440). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaaatactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtataaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ803787_SP_P-B Feature FT:CDS KJ803787_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY853571). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcttcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ803789_SP_P-B Feature FT:CDS KJ803789_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY303852). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttattagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggcacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ803795_SP_P-B Feature FT:CDS KJ803795_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY789421). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggactcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctttgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ803796_SP_P-B Feature FT:CDS KJ803796_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY711763). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ803797_SP_P-B Feature FT:CDS KJ803797_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY775775). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggactcaatcgccgcttcgcagacgatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctttgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ803801_SP_P-B Feature FT:CDS KJ803801_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY035746). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gcaactgcacctgtattcccatcccatcatctttggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ803805_SP_P-B Feature FT:CDS KJ803805_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY491666). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaacttgtgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgatcatcaacaaccagccc
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctacgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ803808_SP_P-B Feature FT:CDS KJ803808_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY571290). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacaaagacgcaggtcccctagaagacgaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcactctcgggaatctcaatgaacatcaactaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctttgtttccctcatgttgctgtacaaaacctacggacg
gcaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ803816_SP_P-B Feature FT:CDS KJ803816_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY540630). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccgcttcgcagaagatctcaatctcgggaccctcaatgatcatcgacaacaagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ803817_SP_P-B Feature FT:CDS KJ803817_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY241913). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
cggaccatgcaagacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ803819_SP_P-B Feature FT:CDS KJ803819_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY131767). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacaacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ803820_SP_P-B Feature FT:CDS KJ803820_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY081397). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgaacatcaactaccagcac
gggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ803821_SP_P-B Feature FT:CDS KJ803821_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY500621). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggaaactgctgttgttagacacagacgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacgaccagcac
cggaccgtgcaaaacctgcacgacgcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ803824_SP_P-B Feature FT:CDS KJ803824_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY502457). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttcgacaacgcagcaggtcccttagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctggatgatcatcaaccaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctttgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ803825_SP_P-B Feature FT:CDS KJ803825_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY381508). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacgcttccggaaactactgttgttagacgaaggggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KJ843165_SP_P-B Feature FT:CDS KJ843165_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ag03). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcaacaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggggtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KM213032_SP_P-B Feature FT:CDS KM213032_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate LRF-k1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
cggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KM213034_SP_P-B Feature FT:CDS KM213034_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate LYG-k1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KM213035_SP_P-B Feature FT:CDS KM213035_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MRG-k1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccctgcaagacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KM213036_SP_P-B Feature FT:CDS KM213036_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CSW-k1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctca
tggctcagtttgctag
>gnl|hbvcds|KM359440_SP_P-B Feature FT:CDS KM359440_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate FF3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacgaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KM392072_SP_P-B Feature FT:CDS KM392072_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate V3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KM392083_SP_P-B Feature FT:CDS KM392083_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate V41). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KM392084_SP_P-B Feature FT:CDS KM392084_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate V42). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcakaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KM875416_SP_P-B Feature FT:CDS KM875416_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate pt9N). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KM875417_SP_P-B Feature FT:CDS KM875417_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate pt9T). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KM875420_SP_P-B Feature FT:CDS KM875420_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate pt11N). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacaacgacgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacgaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KM875421_SP_P-B Feature FT:CDS KM875421_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate pt11T). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KM875426_SP_P-B Feature FT:CDS KM875426_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate pt14N). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgtgagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcatcaacaaccagcac
cggaacatgcaaaacctgcacgactcctgctcaaggaacctctttgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KM875427_SP_P-B Feature FT:CDS KM875427_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate pt14T). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttagcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaacatgcaaaacctgcacgactcctgctcaaggaacctctttgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP036970_SP_P-B Feature FT:CDS KP036970_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-YA). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148314_SP_P-B Feature FT:CDS KP148314_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D243-3-18). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148317_SP_P-B Feature FT:CDS KP148317_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D243-8). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaagcctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcaccagtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148318_SP_P-B Feature FT:CDS KP148318_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D243-19). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148319_SP_P-B Feature FT:CDS KP148319_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D243-3-2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148320_SP_P-B Feature FT:CDS KP148320_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D243-3-4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148321_SP_P-B Feature FT:CDS KP148321_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D243-3-5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148322_SP_P-B Feature FT:CDS KP148322_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D243-3-11). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148323_SP_P-B Feature FT:CDS KP148323_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D243-3-12). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148324_SP_P-B Feature FT:CDS KP148324_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D243-3-20). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacagaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148325_SP_P-B Feature FT:CDS KP148325_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D243-3-25). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctttatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148326_SP_P-B Feature FT:CDS KP148326_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D243-3-27). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgctgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148327_SP_P-B Feature FT:CDS KP148327_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D243-3-41). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148328_SP_P-B Feature FT:CDS KP148328_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D243-3-94). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaatctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148329_SP_P-B Feature FT:CDS KP148329_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D243-3-99). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgctgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148330_SP_P-B Feature FT:CDS KP148330_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D243-3-104). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148331_SP_P-B Feature FT:CDS KP148331_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D243-3-109). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148332_SP_P-B Feature FT:CDS KP148332_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D243-3-122). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148333_SP_P-B Feature FT:CDS KP148333_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D243-3-124). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148334_SP_P-B Feature FT:CDS KP148334_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D243-3-126). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148335_SP_P-B Feature FT:CDS KP148335_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D243-3-130). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttctggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148336_SP_P-B Feature FT:CDS KP148336_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D282-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148338_SP_P-B Feature FT:CDS KP148338_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D282-3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148339_SP_P-B Feature FT:CDS KP148339_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D282-5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148340_SP_P-B Feature FT:CDS KP148340_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D282-6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148341_SP_P-B Feature FT:CDS KP148341_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D282-7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactaccgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148342_SP_P-B Feature FT:CDS KP148342_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D282-9). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaacttctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148343_SP_P-B Feature FT:CDS KP148343_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D282-10). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148344_SP_P-B Feature FT:CDS KP148344_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D282-14). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148345_SP_P-B Feature FT:CDS KP148345_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D282-20). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148346_SP_P-B Feature FT:CDS KP148346_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D282-22). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148347_SP_P-B Feature FT:CDS KP148347_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D282-24). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148348_SP_P-B Feature FT:CDS KP148348_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D282-25). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcaccttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148349_SP_P-B Feature FT:CDS KP148349_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D282-26). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148356_SP_P-B Feature FT:CDS KP148356_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D93-3-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatgcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148357_SP_P-B Feature FT:CDS KP148357_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D93-3-2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148359_SP_P-B Feature FT:CDS KP148359_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D93-3-30). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148360_SP_P-B Feature FT:CDS KP148360_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D93-3-36). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148361_SP_P-B Feature FT:CDS KP148361_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D93-3-42). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148362_SP_P-B Feature FT:CDS KP148362_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D93-3-73). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148363_SP_P-B Feature FT:CDS KP148363_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D93-3-86). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148364_SP_P-B Feature FT:CDS KP148364_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D93-3-101). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148365_SP_P-B Feature FT:CDS KP148365_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D93-3-106). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148366_SP_P-B Feature FT:CDS KP148366_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D93-3-110). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148367_SP_P-B Feature FT:CDS KP148367_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-1). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148368_SP_P-B Feature FT:CDS KP148368_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148369_SP_P-B Feature FT:CDS KP148369_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148370_SP_P-B Feature FT:CDS KP148370_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148371_SP_P-B Feature FT:CDS KP148371_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-7). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148372_SP_P-B Feature FT:CDS KP148372_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-9). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148373_SP_P-B Feature FT:CDS KP148373_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-11). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcaccttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcc
tggctcagtttactag
>gnl|hbvcds|KP148374_SP_P-B Feature FT:CDS KP148374_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-20). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgacccctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148375_SP_P-B Feature FT:CDS KP148375_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148376_SP_P-B Feature FT:CDS KP148376_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148377_SP_P-B Feature FT:CDS KP148377_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-12). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcgaccaccagcac
cggaccatgcagaacctgcacgacccctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148378_SP_P-B Feature FT:CDS KP148378_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-17). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148379_SP_P-B Feature FT:CDS KP148379_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-19). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148380_SP_P-B Feature FT:CDS KP148380_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-20). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148382_SP_P-B Feature FT:CDS KP148382_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-25). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148383_SP_P-B Feature FT:CDS KP148383_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-26). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148384_SP_P-B Feature FT:CDS KP148384_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-28). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148385_SP_P-B Feature FT:CDS KP148385_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-30). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148386_SP_P-B Feature FT:CDS KP148386_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-32). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148387_SP_P-B Feature FT:CDS KP148387_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-34). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcgaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148388_SP_P-B Feature FT:CDS KP148388_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-35). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148389_SP_P-B Feature FT:CDS KP148389_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-44). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148390_SP_P-B Feature FT:CDS KP148390_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-45). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148391_SP_P-B Feature FT:CDS KP148391_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-46). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
cagaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcgcctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148392_SP_P-B Feature FT:CDS KP148392_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-47). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148394_SP_P-B Feature FT:CDS KP148394_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-50). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaagctactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148395_SP_P-B Feature FT:CDS KP148395_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-51). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148396_SP_P-B Feature FT:CDS KP148396_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-58). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148397_SP_P-B Feature FT:CDS KP148397_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-59). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148398_SP_P-B Feature FT:CDS KP148398_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-60). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcgaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148399_SP_P-B Feature FT:CDS KP148399_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-61). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacggggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148400_SP_P-B Feature FT:CDS KP148400_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-65). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148401_SP_P-B Feature FT:CDS KP148401_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-67). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
ggaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148402_SP_P-B Feature FT:CDS KP148402_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-70). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148403_SP_P-B Feature FT:CDS KP148403_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-71). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148405_SP_P-B Feature FT:CDS KP148405_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H54-2-2). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccgatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148406_SP_P-B Feature FT:CDS KP148406_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H54-2-3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148407_SP_P-B Feature FT:CDS KP148407_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H54-2-4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148409_SP_P-B Feature FT:CDS KP148409_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H54-2-6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148410_SP_P-B Feature FT:CDS KP148410_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H54-2-29). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148411_SP_P-B Feature FT:CDS KP148411_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H54-2-31). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148413_SP_P-B Feature FT:CDS KP148413_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H54-2-38). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148414_SP_P-B Feature FT:CDS KP148414_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H54-2-42). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148415_SP_P-B Feature FT:CDS KP148415_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H54-2-48). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctggaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148416_SP_P-B Feature FT:CDS KP148416_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H54-2-54). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148418_SP_P-B Feature FT:CDS KP148418_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H54-2-58). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactattgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148419_SP_P-B Feature FT:CDS KP148419_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H54-2-65). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctttgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148420_SP_P-B Feature FT:CDS KP148420_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H54-2-66). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcgtgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148421_SP_P-B Feature FT:CDS KP148421_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H54-2-72). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148423_SP_P-B Feature FT:CDS KP148423_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H54-2-86). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148424_SP_P-B Feature FT:CDS KP148424_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H54-2-89). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148425_SP_P-B Feature FT:CDS KP148425_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H54-2-90). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148426_SP_P-B Feature FT:CDS KP148426_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H54-2-92). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatctaatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctttgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148427_SP_P-B Feature FT:CDS KP148427_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H54-2-94). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctttgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148429_SP_P-B Feature FT:CDS KP148429_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H54-2-104). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctcgatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148430_SP_P-B Feature FT:CDS KP148430_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H54-2-105). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148432_SP_P-B Feature FT:CDS KP148432_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H54-2-80). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148433_SP_P-B Feature FT:CDS KP148433_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H75-4). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148435_SP_P-B Feature FT:CDS KP148435_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H75-14). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148437_SP_P-B Feature FT:CDS KP148437_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H75-18). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctttgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148438_SP_P-B Feature FT:CDS KP148438_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H75-20). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatcacaatctcgggaatctcgatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148439_SP_P-B Feature FT:CDS KP148439_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H75-25). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148440_SP_P-B Feature FT:CDS KP148440_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H75-26). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148451_SP_P-B Feature FT:CDS KP148451_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Y147-5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcctcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148452_SP_P-B Feature FT:CDS KP148452_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Y167-5). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaacaccagcac
cggaccatgcagaacctgcacgactactgctcaaggaacctctttgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148453_SP_P-B Feature FT:CDS KP148453_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Y167-20). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtttcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaacaccagcac
cggaccatgcagaacctgcacgactactgctcaaggaacctctttgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148455_SP_P-B Feature FT:CDS KP148455_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Y167-3-10). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaacaccagcac
cggaccatgcagaacctgcacgactactgctcaaggaacctctttgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148456_SP_P-B Feature FT:CDS KP148456_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Y167-3-16). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaacaccagcac
cggaccatgcagaacctgcacgactactgctcaaggaacctctttgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148457_SP_P-B Feature FT:CDS KP148457_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Y167-3-24). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaccaccagcac
cggaccatgcagaacctgcacgactcctgctcaaggaacctctttgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcaccttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148458_SP_P-B Feature FT:CDS KP148458_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Y165-3-6). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaacaccagcac
cggaccatgcagaacctgcacgactactgctcaaggaacctctttgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148459_SP_P-B Feature FT:CDS KP148459_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Y165-3-40). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttaccaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaaaatctcaatctcgggaatctcaatgatcatcaaacaccagcac
cggaccatgcagaacctgcacgactactgctcaaggaacctctttgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148460_SP_P-B Feature FT:CDS KP148460_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Y165-3-20). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaacaccagcac
cggaccatgcagaacctgcacgactactgctcaaggaacctctttgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148461_SP_P-B Feature FT:CDS KP148461_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Y165-3-46). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaaacaccagcac
cggaccatgcagaacctgcacgactactgctcaaggaacctctttgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148579_SP_P-B Feature FT:CDS KP148579_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Y300-3). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148580_SP_P-B Feature FT:CDS KP148580_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Y300-4). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148581_SP_P-B Feature FT:CDS KP148581_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Y300-16). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatcttgggaatctcaatgatcatcaacaaccagcac
cggaccttgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148582_SP_P-B Feature FT:CDS KP148582_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Y300-18). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP148583_SP_P-B Feature FT:CDS KP148583_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Y300-24). Non-functional genomic sequence. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgcttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406162_SP_P-B Feature FT:CDS KP406162_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2_1_1). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406163_SP_P-B Feature FT:CDS KP406163_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2_1_2). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406164_SP_P-B Feature FT:CDS KP406164_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2_1_3). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacgaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggaag
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcattttactag
>gnl|hbvcds|KP406165_SP_P-B Feature FT:CDS KP406165_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2_1_4). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactattgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406166_SP_P-B Feature FT:CDS KP406166_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2_1_5). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406167_SP_P-B Feature FT:CDS KP406167_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2_2_1). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactattgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
gggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagttcgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406168_SP_P-B Feature FT:CDS KP406168_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2_2_2). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406169_SP_P-B Feature FT:CDS KP406169_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2_2_3). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406170_SP_P-B Feature FT:CDS KP406170_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2_2_4). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaaactctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgagcctcagtccgtttctct
tggctcagtttactaa
>gnl|hbvcds|KP406171_SP_P-B Feature FT:CDS KP406171_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2_2_5). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactattgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406172_SP_P-B Feature FT:CDS KP406172_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2_2_6). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcatcaacaaccagcac
gggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406173_SP_P-B Feature FT:CDS KP406173_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2_2_7). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactattgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406174_SP_P-B Feature FT:CDS KP406174_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2_2_8). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcatcaacgaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggaag
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406175_SP_P-B Feature FT:CDS KP406175_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2_2_9). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccgtcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406176_SP_P-B Feature FT:CDS KP406176_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3_1_1). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406177_SP_P-B Feature FT:CDS KP406177_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3_1_2). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406178_SP_P-B Feature FT:CDS KP406178_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3_1_3). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406179_SP_P-B Feature FT:CDS KP406179_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3_1_4). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406180_SP_P-B Feature FT:CDS KP406180_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3_1_5). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406181_SP_P-B Feature FT:CDS KP406181_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3_1_6). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406182_SP_P-B Feature FT:CDS KP406182_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3_1_7). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406183_SP_P-B Feature FT:CDS KP406183_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3_1_8). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406184_SP_P-B Feature FT:CDS KP406184_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3_1_9). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406185_SP_P-B Feature FT:CDS KP406185_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3_1_10). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406186_SP_P-B Feature FT:CDS KP406186_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3_2_1). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406187_SP_P-B Feature FT:CDS KP406187_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3_2_2). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406188_SP_P-B Feature FT:CDS KP406188_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3_2_3). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406189_SP_P-B Feature FT:CDS KP406189_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3_2_4). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406190_SP_P-B Feature FT:CDS KP406190_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3_2_5). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406191_SP_P-B Feature FT:CDS KP406191_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3_2_6). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406192_SP_P-B Feature FT:CDS KP406192_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3_2_7). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406193_SP_P-B Feature FT:CDS KP406193_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3_2_8). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406194_SP_P-B Feature FT:CDS KP406194_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3_2_9). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
cnnnnnatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406195_SP_P-B Feature FT:CDS KP406195_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3_2_10). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406196_SP_P-B Feature FT:CDS KP406196_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3_2_11). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406197_SP_P-B Feature FT:CDS KP406197_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3_2_12). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406198_SP_P-B Feature FT:CDS KP406198_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3_2_13). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406199_SP_P-B Feature FT:CDS KP406199_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3_2_14). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406200_SP_P-B Feature FT:CDS KP406200_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3_2_15). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406201_SP_P-B Feature FT:CDS KP406201_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3_2_16). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406202_SP_P-B Feature FT:CDS KP406202_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3_2_17). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406203_SP_P-B Feature FT:CDS KP406203_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3_2_18). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406204_SP_P-B Feature FT:CDS KP406204_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3_2_19). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406205_SP_P-B Feature FT:CDS KP406205_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3_2_20). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406206_SP_P-B Feature FT:CDS KP406206_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3_2_21). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406207_SP_P-B Feature FT:CDS KP406207_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3_2_22). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406208_SP_P-B Feature FT:CDS KP406208_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3_2_23). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406209_SP_P-B Feature FT:CDS KP406209_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3_2_24). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406210_SP_P-B Feature FT:CDS KP406210_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3_2_25). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406211_SP_P-B Feature FT:CDS KP406211_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3_2_26). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406212_SP_P-B Feature FT:CDS KP406212_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3_2_27). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406213_SP_P-B Feature FT:CDS KP406213_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3_2_28). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406214_SP_P-B Feature FT:CDS KP406214_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3_2_29). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406215_SP_P-B Feature FT:CDS KP406215_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3_2_30). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406216_SP_P-B Feature FT:CDS KP406216_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3_2_31). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
nnnnncatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406217_SP_P-B Feature FT:CDS KP406217_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3_2_32). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406218_SP_P-B Feature FT:CDS KP406218_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3_2_33). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406219_SP_P-B Feature FT:CDS KP406219_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3_2_34). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406220_SP_P-B Feature FT:CDS KP406220_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D1_1_1). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
gggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406221_SP_P-B Feature FT:CDS KP406221_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D1_1_2). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
gggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406222_SP_P-B Feature FT:CDS KP406222_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D1_1_3). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
gggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406223_SP_P-B Feature FT:CDS KP406223_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D1_1_4). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
gggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406224_SP_P-B Feature FT:CDS KP406224_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D1_1_5). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
gggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406225_SP_P-B Feature FT:CDS KP406225_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D1_1_6). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
gggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406226_SP_P-B Feature FT:CDS KP406226_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D1_1_7). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
gggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406227_SP_P-B Feature FT:CDS KP406227_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D1_1_8). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
gggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406228_SP_P-B Feature FT:CDS KP406228_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D1_1_9). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
gggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406229_SP_P-B Feature FT:CDS KP406229_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D1_1_10). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
gggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406230_SP_P-B Feature FT:CDS KP406230_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D1_1_11). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
gggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406231_SP_P-B Feature FT:CDS KP406231_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D1_1_12). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
gggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406232_SP_P-B Feature FT:CDS KP406232_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D1_2_1). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
gggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406233_SP_P-B Feature FT:CDS KP406233_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D1_2_2). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
gggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406234_SP_P-B Feature FT:CDS KP406234_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D1_2_3). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
gggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406235_SP_P-B Feature FT:CDS KP406235_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D1_2_4). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
gggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406236_SP_P-B Feature FT:CDS KP406236_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D1_2_5). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
gggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406237_SP_P-B Feature FT:CDS KP406237_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D1_2_6). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
gggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406238_SP_P-B Feature FT:CDS KP406238_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D1_2_7). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
gggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406239_SP_P-B Feature FT:CDS KP406239_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D1_2_8). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
gggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406240_SP_P-B Feature FT:CDS KP406240_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D1_2_9). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
gggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406241_SP_P-B Feature FT:CDS KP406241_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D1_2_10). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
gggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406242_SP_P-B Feature FT:CDS KP406242_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D1_2_11). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
gggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406243_SP_P-B Feature FT:CDS KP406243_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D1_2_12). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
gggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406244_SP_P-B Feature FT:CDS KP406244_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1_1). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaagacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406245_SP_P-B Feature FT:CDS KP406245_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1_2). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaagacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406246_SP_P-B Feature FT:CDS KP406246_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1_3). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaagacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406247_SP_P-B Feature FT:CDS KP406247_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1_4). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaagacctgcacagctcctgctcaaggaacctttatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406248_SP_P-B Feature FT:CDS KP406248_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1_5). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaagacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406249_SP_P-B Feature FT:CDS KP406249_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1_6). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaagacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406250_SP_P-B Feature FT:CDS KP406250_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1_7). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaagacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406251_SP_P-B Feature FT:CDS KP406251_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1_8). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaagacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406252_SP_P-B Feature FT:CDS KP406252_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1_9). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaagacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406253_SP_P-B Feature FT:CDS KP406253_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1_10). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaagacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406254_SP_P-B Feature FT:CDS KP406254_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1_11). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaagacctgcacagctcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406255_SP_P-B Feature FT:CDS KP406255_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S2_1). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaaaatccctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406256_SP_P-B Feature FT:CDS KP406256_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S2_2). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406257_SP_P-B Feature FT:CDS KP406257_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S2_3). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacatcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406258_SP_P-B Feature FT:CDS KP406258_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S2_4). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacgtcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaaaatccctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406259_SP_P-B Feature FT:CDS KP406259_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S2_5). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406260_SP_P-B Feature FT:CDS KP406260_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S2_6). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacatcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406261_SP_P-B Feature FT:CDS KP406261_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S2_7). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406262_SP_P-B Feature FT:CDS KP406262_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S2_8). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406263_SP_P-B Feature FT:CDS KP406263_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S2_9). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406264_SP_P-B Feature FT:CDS KP406264_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S2_10). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaaaatccctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406265_SP_P-B Feature FT:CDS KP406265_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S2_11). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacgaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaaaatccctatgggagttggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406266_SP_P-B Feature FT:CDS KP406266_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S2_12). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406267_SP_P-B Feature FT:CDS KP406267_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S2_13). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406268_SP_P-B Feature FT:CDS KP406268_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S2_14). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
aaaactgcacttgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406269_SP_P-B Feature FT:CDS KP406269_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S2_15). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406270_SP_P-B Feature FT:CDS KP406270_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S2_16). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaaaatccctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406271_SP_P-B Feature FT:CDS KP406271_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S2_17). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406272_SP_P-B Feature FT:CDS KP406272_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S2_18). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406273_SP_P-B Feature FT:CDS KP406273_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S2_19). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406274_SP_P-B Feature FT:CDS KP406274_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S2_20). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaaaatccctatgggagtgggcctcagtccgtttctct
tggcccagtttactag
>gnl|hbvcds|KP406275_SP_P-B Feature FT:CDS KP406275_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S2_21). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaacttcctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406276_SP_P-B Feature FT:CDS KP406276_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S2_22). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaacttcctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406277_SP_P-B Feature FT:CDS KP406277_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S2_23). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406278_SP_P-B Feature FT:CDS KP406278_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S2_24). Complete genome. [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaaaatccctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406279_SP_P-B Feature FT:CDS KP406279_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S2_25). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgattccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406280_SP_P-B Feature FT:CDS KP406280_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S2_26). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacatcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacttgtattcccatcccatcatcttgggctttcgcaaaatccctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406281_SP_P-B Feature FT:CDS KP406281_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GD2_1_1). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406282_SP_P-B Feature FT:CDS KP406282_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GD2_1_2). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406283_SP_P-B Feature FT:CDS KP406283_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GD2_1_3). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406284_SP_P-B Feature FT:CDS KP406284_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GD2_1_4). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406285_SP_P-B Feature FT:CDS KP406285_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GD2_1_5). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406286_SP_P-B Feature FT:CDS KP406286_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GD2_1_6). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406287_SP_P-B Feature FT:CDS KP406287_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GD2_1_7). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406288_SP_P-B Feature FT:CDS KP406288_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GD2_1_8). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406289_SP_P-B Feature FT:CDS KP406289_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GD2_1_9). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406290_SP_P-B Feature FT:CDS KP406290_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GD2_1_10). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406291_SP_P-B Feature FT:CDS KP406291_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GD2_1_11). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406292_SP_P-B Feature FT:CDS KP406292_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GD2_1_12). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406293_SP_P-B Feature FT:CDS KP406293_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GD2_1_13). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406294_SP_P-B Feature FT:CDS KP406294_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GD2_1_14). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406296_SP_P-B Feature FT:CDS KP406296_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GD2_2_2). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406297_SP_P-B Feature FT:CDS KP406297_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GD2_2_3). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcaacaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406298_SP_P-B Feature FT:CDS KP406298_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GD2_2_4). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgttaccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406299_SP_P-B Feature FT:CDS KP406299_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GD2_2_5). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406300_SP_P-B Feature FT:CDS KP406300_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GD2_2_6). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406301_SP_P-B Feature FT:CDS KP406301_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GD2_2_7). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406302_SP_P-B Feature FT:CDS KP406302_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GD2_2_8). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcaacgacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406303_SP_P-B Feature FT:CDS KP406303_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GD2_2_9). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406304_SP_P-B Feature FT:CDS KP406304_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GD2_3_1). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcgtcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406305_SP_P-B Feature FT:CDS KP406305_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GD2_3_2). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcgtcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406306_SP_P-B Feature FT:CDS KP406306_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GD2_3_3). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406307_SP_P-B Feature FT:CDS KP406307_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GD2_3_4). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406308_SP_P-B Feature FT:CDS KP406308_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GD2_3_5). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406309_SP_P-B Feature FT:CDS KP406309_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GD2_3_6). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406310_SP_P-B Feature FT:CDS KP406310_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GD2_3_7). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406311_SP_P-B Feature FT:CDS KP406311_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GD2_3_8). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406312_SP_P-B Feature FT:CDS KP406312_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GD2_3_9). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcgtcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406313_SP_P-B Feature FT:CDS KP406313_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GD2_3_10). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406314_SP_P-B Feature FT:CDS KP406314_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GD2_3_11). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcgtcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406315_SP_P-B Feature FT:CDS KP406315_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GD2_3_12). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406316_SP_P-B Feature FT:CDS KP406316_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GD2_3_13). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406317_SP_P-B Feature FT:CDS KP406317_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GD2_3_14). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406318_SP_P-B Feature FT:CDS KP406318_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GD3_1_1). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactag
>gnl|hbvcds|KP406319_SP_P-B Feature FT:CDS KP406319_SP_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GD3_1_2). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=336 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatcatcaacaaccagcac
cggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacg
gaaactgcacctgtattcccatccc