HBVdb

Dataset for nucleotide sequence SP of genotype B

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
       * *           ***   *   *                             *  *  *    *  * ** 
ATGCCCCTATCTTATCAACACTTCCGGAAACTACTGTTGTTAGACGAaGAGGCAGGTCCCCTAGAAGAAGAACTCCCTCG
           c    c  g        g   g     a     ga c gt     a           c          a
                                             c    c                             
                                                                                

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *              *       *            *                        *           **   
CCTCGCAGACGAAGGTCTCAATCGCCGCGTCGCAGAAGATCTCAATCTCGGGA---ATCTCAATGATCATCAACaACCAG
              a        a            c  a  a         g    c ct       c  g  c     
                                                                    g     t     
                                                                          g     

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
          *         ***        * *        **        *   *  * *   *     *   *    
CACCGGACCATGCAaAACCTGCACaACTCCTGCTCAAGGAACCTCTATGTTTCCCTCATGTTGCTGTACAAAACCTACGG
   g   t      gg  a     gg ga      gc         tc                  tc       t  
                            t                                                   
                                                                                

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
            *   ** ** * ** *     * *    **           * * **      *         *****
ACGGAAACTGCACCTGTATTCCCATCCCATCATCTTGGGCTTTCGCAAAATACCTATGGGAGTGGGCCTCAGTCCGTTTC
 t     t                          c          t     t                            
                                                                                
                                                                                

       330         
....:....|....:....
        *  *   *   
TCTTGGCTCAGTTTACTAG
  a          c     
                   
                   
© 1998-2022Legal notice