HBVdb

Dataset for nucleotide sequence SP of genotype B

[Download (right click)] [Edit] [Sequences] [Repertoires]

2692 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


DQ993694_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
DQ993682_SP_P-B      aggccaatatcttatcaacacttccggaaaataccgctgttagacgaata
KX276776_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacaamga
KX276774_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagaccaaga
AB048705_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KU679959_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FJ386648_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagaccaaga
KC793189_SP_P-B      ---cccctatcttatcaacacttccggaaactactgttgttagacaaaga
KX276819_SP_P-B      atgcccctatcttatcawcacttccggagacttgtgttgttagacgacgr
FJ032344_SP_P-B      atgcccctatcttatcaacacttccggaacatactgttgttagacaaaga
EU579441_SP_P-B      atgcccctatcttatcaacacttccggaaaatactgttgttagaccaaga
EU589335_SP_P-B      atgcccctatcttatcaacacttccggaacatactgttgttagataaaga
EU570075_SP_P-B      atgcccctatcttatcaacacttccggaacatactgttgttagacaaaga
FJ386656_SP_P-B      atgcccctatcttatcaacacttccggaacatactgttgttagacaaaga
HM011477_SP_P-B      atgcccctatcttatcwacrcttccggaaactactgttrttagacaaaga
KX276795_SP_P-B      atgcccctatcttatcwacrcttccggaaactactgttrttagacaaaga
MN689122_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
HM011487_SP_P-B      atgcccctatcttatcaacgcttccggaaactactgttgttagacgacgc
GQ924641_SP_P-B      atgcccctatcttatcaacacttccggagtgtgctgttgttagtcgaagg
KX276811_SP_P-B      atgcccctatcttatcaactcttccggaaactactgttgttagacaacga
GQ924638_SP_P-B      atgcccctatcttatcaacgcttccggaaactactgttgttagaggacga
GQ924639_SP_P-B      atgcccctatcttatcaacacttccggaaattactgttgttagacgacga
MG571336_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacaacga
KX276821_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagaggacga
JQ341585_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
HM011499_SP_P-B      atgcccctatcttatcaacacttccggaaaytrctgttgttagacracga
KX276858_SP_P-B      atgcccctatcttatcaacacttccggaaaytrctgttrttagacracgr
GQ924635_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacaagga
KX276827_SP_P-B      atgcccctatcttatcaacacttccggaaactrctgttrttagacaacga
KX276820_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagaccacgr
KX276817_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagaggacga
JQ341556_SP_P-B      atgcccctatcttatcaacacttccggaaactrctgttgttagacaaaga
KX765854_SP_P-B      atgcccctatcctatcaacacttccggaaactactgttgttagacgacga
JQ341557_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881845_SP_P-B      atgcccctatcttatcaacacttccgaaaactactgttgttagacaaaga
KY881869_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacaaaga
KY881849_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacaaaga
KY881853_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacaaaga
KY881865_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacaaaga
GQ924626_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacaacga
HM011467_SP_P-B      atgcccctatcttatcaacacttccggaaaytactgttgttagaggac--
GQ924645_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgaaga
KX276824_SP_P-B      atgcccctatcttatcaacacttccggaaactastgttgttagacracga
MK534614_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KX276800_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttrttagaggaaga
JQ429079_SP_P-B      atgcccctatcytatcaacacttccggaaactactgttgttagacgacga
JQ341608_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgagaa
HM011496_SP_P-B      atgcccctatcttatccacacttccggaaactactgttattagacgaaga
HM011476_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagaggaaga
GQ924637_SP_P-B      atgcccctatcttatcaacgcttccggaaactgctgttgttagacgacga
KJ717813_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KJ803801_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
HM011482_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttrttagaggaaga
EU939674_SP_P-B      atgcccctatcttatcaacacttccggaaactactattgttagacgacga
FJ899790_SP_P-B      atgcccctatcttatcaacacttccggaaactactattgttagacgacga
FJ899791_SP_P-B      atgcccctatcttatcaacacttccggaaactactattgttagacgacga
DQ993680_SP_P-B      atgcccctatcttatgaagacttccggagactactgttgttagacgacga
AP011094_SP_P-B      atgcccctatcttatcaacacttccggagacttgtgttgttagacgacga
AB219427_SP_P-B      atgcccctatcttatccacacttccggaaactactgttattagacgaaga
MT757439_SP_P-B      atgcccctatcttatccacacttccggaaactactgttattagacgaaga
MT757451_SP_P-B      atgcccctatcttatccacacttccggaaactactgttattagacgaaga
MT757448_SP_P-B      atgcccctatcttatccacacttccggaaactactgttattagacgaaga
MT757453_SP_P-B      atgcccctatcttatccacacttccggaaactactgttattagacgaaga
MT757457_SP_P-B      atgcccctatcttatccacacttccggaaactactgttattagacgaaga
MT757440_SP_P-B      atgcccctatcttatccacacttccggaaactactgttgttagacgaaga
MT757441_SP_P-B      atgcccctatcttatccacacttccggaaactactgttgttagacgaaga
MT757446_SP_P-B      atgcccctatcttatccacacttccggaaactactgttgttagacgaaga
MT757456_SP_P-B      atgcccctatcttatccacacttccggaaactactgttgttagacgaaga
MT757443_SP_P-B      atgcccctatcttatccacacttccggaaactactgttgttagacgaaga
MT757455_SP_P-B      atgcccctatcttatccacacttccggagactactgttattagacgaaga
MT757454_SP_P-B      atgcccctatcttatccacacttccggaaactactgttattagacgaaga
MT757445_SP_P-B      atgcccctatcttatccacacttccggagactactgttattagacgaaga
MT757449_SP_P-B      atgcccctatcttatccacacttccggagactactgttattagacgaaga
MT757442_SP_P-B      atgcccctatcttatccacacttccggaaactactgttattagacgaaga
MT757452_SP_P-B      atgcccctatcttatccacacttccggaaactactgttattagacgaaga
MT757438_SP_P-B      atgcccctatcttatccacacttccggaaactactgttattagacgaaga
MT757436_SP_P-B      atgcccctatcttatccacacttccggaaactactgttattagacgaaga
MT757444_SP_P-B      atgcccctatcttatccacacttccggaaactactgttattagacgaaga
MT757437_SP_P-B      atgcccctatcttatccacacttccggaaactactgttattagacgaaga
MT757450_SP_P-B      atgcccctatcttatccacacttccggaaactactgttattagacgaaga
MT757447_SP_P-B      atgcccctatcttatccacacttccggaaactactgttgttagacgaaga
GQ924660_SP_P-B      atgcccctatcttatccacacttccggaaactactgttgttagacgaaga
GQ924640_SP_P-B      atgcccctatcttatccacacttccggaaactactgttgttagacgaaga
AB241116_SP_P-B      atgcccctatcttatccacacttccggaaactactgttattagacgaaga
AB241117_SP_P-B      atgcccctatcttatccacacttccggaaactactgttattagacgaaga
AB219428_SP_C-B      atgcccctatcttatccacacttccggaaactactgttgttagacgaaga
AB219426_SP_P-B      atgcccctatcttatccacacttccggaaactactgttattagacgaaga
AB219429_SP_P-B      atgcccctatcttatccacacttccggaaactactgttattagacgaaga
MK818222_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagaccaaga
MF674446_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
HM011469_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttrttagacgacga
KX276822_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MN689119_SP_P-B      atgcccctatcttatcaatgcttccggaaactactgttgttagacgacga
MT645018_SP_P-B      atgcccctatcttatcaactcttccggaaactactgttgttagacaacga
MF674505_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674440_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacaacga
KX276818_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148459_SP_P-B      atgcccctatcttaccaacacttccggaaactactgttgttagacgacga
KC792719_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacaacga
JQ341590_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JQ027311_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
GQ358137_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FJ023637_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB212626_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB033555_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JQ341597_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JQ341599_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
EU330989_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
EU330990_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MG826152_SP_P-B      atgcccctatcttatcaacacttccggagacttgtgttgttagacgacga
KX276830_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
KP148452_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148455_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148456_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148458_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148460_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148461_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148453_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674419_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
GQ924624_SP_P-B      atgcccctatcttatccactcttccggaaactactgttgttagacgaaga
KY629636_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KY629635_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KJ173401_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KJ173402_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KC774369_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KC774370_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
GQ924628_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KX276829_SP_P-B      atgcmcctatcttatcaacacttccggaaactactgttgttagacgacga
JQ429080_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AP011086_SP_P-B      atgcccctatcttatccacacttccggaaactactgttgttagacgaaga
AP011087_SP_P-B      atgcccctatcttatccacacttccggaaactactgttgttagacgaaga
MZ675799_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MZ675801_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MN689123_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MN689117_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MK534621_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674473_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674464_SP_P-B      atgcccctatcttatcaacacttccggaaattactgttgttagacgacga
MF674420_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MF674389_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674385_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacaacga
LC349871_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KY881957_SP_P-B      atgcccctatcttatcaacacttccggaaactactattgttagacgacga
KX765841_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MZ675802_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KX276828_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148438_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148391_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148373_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KJ717841_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgacga
KJ717798_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KF053191_SP_P-B      atgcccctatcttatcaacacttccggaaaatactgttgttagacgacga
KJ803786_SP_P-B      atgcccctatcttatcaacacttccggaaaatactgttgttagacgacga
KF053190_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KJ803784_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JX429901_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JQ707757_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JQ707741_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JQ027334_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
HQ700548_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
GQ924656_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
GQ358147_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
GQ358143_SP_P-B      atgcccctatcttatcaacacttccggaaactagtgttgttagacgacga
GQ358142_SP_P-B      atgcccctatcttatcgacacttccggaaactactgttgttagacgacga
GQ358136_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FJ023636_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
EU660230_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgacga
EU660231_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgacga
DQ993685_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
DQ361535_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB713528_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB205122_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB033554_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148457_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JQ707754_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KJ173341_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KJ173342_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
HM011490_SP_P-B      atgcccctatcttatcaacacttccggagattactgttgttagacgacga
LC349872_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
LC349877_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
LC349873_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
LC349870_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
LC349868_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KJ717807_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KJ803796_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KJ717792_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KJ803787_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JQ027316_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
HM011492_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
D00331_SP_C-B        atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB713527_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB713532_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB493835_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB493827_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB713531_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AP011085_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
GQ924625_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JQ429081_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JQ429082_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
LC349878_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
LC349879_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
LC416037_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674479_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MK534626_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB100695_SP_P-B      atgcccctatcttatccccccttccggaaactactgttgttagacgacga
KY881956_SP_P-B      atgcccctatcttatcaacacttccggaaactactattgttagacgacga
KY881949_SP_P-B      atgcccctatcttatcaacacttccggaaactactattgttagacgacga
KY881950_SP_P-B      atgcccctatcttatcaacacttccggaaactactattgttagacgacga
MF674433_SP_P-B      atgcccctatcttatcaacacttccggaaactactattgttagacgacga
KY881946_SP_P-B      atgcccctatcttatcaacacttccggaaactactattgttagacgacga
KY881945_SP_P-B      atgcccctatcttatcaacacttccggaaactactattgttagacgacga
KY881948_SP_P-B      atgcccctatcttatcaacacttccggaaactactattgttagacgacga
KY881951_SP_P-B      atgcccctatcttatcaacacttccggaaactactattgttagacgacga
KY881958_SP_P-B      atgcccctatcttatcaacacttccggaaactactattgttagacgacga
KY881947_SP_P-B      atgcccctatcttatcaacacttccggaaactactattgttagacgacga
JQ341580_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674499_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148437_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674414_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674396_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KY881955_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674434_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674445_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgacga
MF674448_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674466_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MK534680_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
DQ993683_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB073835_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
DQ993681_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
DQ993684_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB493833_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KX276815_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674476_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148420_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148416_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148415_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148405_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148406_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148409_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148411_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148413_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148414_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148421_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148423_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148425_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148430_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148435_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148439_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148429_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148418_SP_P-B      atgcccctatcttatcaacacttccggaaactattgttgttagacgacga
KP148407_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148433_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148410_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148424_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148432_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148440_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MK534659_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgacga
MN689120_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MN689121_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MK534692_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MK534611_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JQ341605_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MK534694_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GQ924651_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GQ924654_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC510654_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AY800391_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AY800392_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674456_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JQ707736_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JQ707748_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JQ707751_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JQ707752_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JQ707756_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JQ707761_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JQ707760_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MT426101_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgacga
MK534708_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MK534661_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MK534634_SP_P-B      atgcccctatcctatcaacacttccggaaactactgttgttagacgacga
MK534612_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674507_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674496_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674478_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674462_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674459_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674455_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674441_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674437_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674493_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674436_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674401_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674397_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674382_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KY881952_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KY881953_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KY881954_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KY881944_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KX276816_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagasgacga
KP148426_SP_P-B      atgcccctatctaatcaacacttccggaaactactgttgttagacgacga
KP148419_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148427_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148401_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148399_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
KP148394_SP_P-B      atgcccctatcttatcaacacttccggaagctactgttgttagacgacga
KP148387_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148398_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148377_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148374_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KC774418_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674392_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674409_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JQ341604_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JQ341554_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
GQ358150_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
GQ358148_SP_P-B      atgcccctattttatcaacacttccggaaactactgttgttagacgacga
GQ358145_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
GQ358144_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
GQ358141_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
GQ358140_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
GQ358138_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148367_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148368_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148369_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148370_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148371_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148372_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148375_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148376_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148378_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148379_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148380_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148382_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148383_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148384_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148385_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148386_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148388_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148389_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148390_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148392_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148395_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148396_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148397_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148400_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148402_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148403_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP148451_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MK534697_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FJ023634_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
EU330992_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
EF473976_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AP011093_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AP011095_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AP011096_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674515_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AP011092_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AP011088_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
AB368295_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB031266_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FJ023638_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674383_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674400_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674405_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674447_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674469_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674477_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674491_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674498_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674511_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB031267_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB115551_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AP011089_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AP011090_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AP011091_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
EU330994_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
EU330995_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
EU330996_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
EU330997_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
EU330998_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
EU330999_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
EU331000_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
EU331001_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
GQ358146_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
GQ358149_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
GQ358151_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
GQ358152_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
GQ924621_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
HQ700549_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KU234318_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674393_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674394_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674395_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674413_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674423_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674443_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674451_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674452_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674461_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674482_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674483_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674495_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674500_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674510_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MZ675796_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MZ675803_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FJ023632_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MG826153_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
HM011466_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgaaga
KJ717829_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgaaga
KJ803816_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgaaga
JQ040157_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ717836_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ803820_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MG571366_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EF494382_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacaaaga
MG571337_SP_P-B      gtgcccctatggtataaacacttcaggaaactaccgttgttagacgaaga
KX276814_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacaacga
KX276792_SP_P-B      atgcccctatcttatcaacacttccggaractactgttattagagsaaga
KJ717840_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttcgacaacgc
KJ803824_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttcgacaacgc
KC792947_SP_P-B      atgcccctatcctatcaacacttccggaaactactgttattagaggaaga
KX276797_SP_P-B      atgcccctatcttatcaacacttccggaractactgttattagacaaaga
GQ377644_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagaggaaga
MG571351_SP_P-B      atgcccctatcttatcaacacttccggaaacttgtgttgttagacaaaga
KJ717820_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacaaaga
KJ803808_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacaaaga
MN689118_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagaccacga
MG571352_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgaaga
KX276789_SP_P-B      atgcccctatcctatcaacgcttccggaaacttctgttattagacaaaga
JQ341561_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacaaaga
KC793199_SP_P-B      -----cctatcttatcaacgcttccggaractactgttgttagacaacga
HM011473_SP_P-B      atgcccctatcttatcaacacttccggaaactrctgttattagacmaaga
MK534710_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ717837_SP_P-B      atgcccctatcttatcaacgcttccggaaactgctgttgttagacacaga
KJ803821_SP_P-B      atgcccctatcttatcaacgcttccggaaactgctgttgttagacacaga
HM011478_SP_P-B      atgcccctatcttgtcaacacttccggaaactactgttgttagaggaaga
KX276823_SP_P-B      atgcccctatcttrtcaacacttccggaaactgctgttgttagacracga
FJ032342_SP_P-B      atgcccctatcttatcagcacttccggaaactactgttattagacgaaga
KX276798_SP_P-B      atgcccctatcttatcaacacttccggaarytrctgttgttagacgaaga
KX276791_SP_P-B      atgcccctatcttatcaacrcttcckgaractactgttattagacgaaga
GQ924617_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagaccacga
KC792777_SP_P-B      atgcccctatcttgtcaacacttccggaaactactgttgttagaggaagg
MG571339_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KC792748_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagaggaagg
JQ341607_SP_P-B      atgcccctatcttatcaacgcttccggaaactactgttgttagacgacga
EU522072_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacaaaga
EU522073_SP_P-B      atgcccctatcttatcaacacttccggaaactactattgttagacaaaga
EU522075_SP_P-B      atgcccctatcttatcaacacttccggaaactactattgttagacaaaga
MG571323_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
KM875426_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgtgagacgaaga
KJ717797_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC793141_SP_P-B      atgcccctatcttatcaacgcttccggaaactactgttattagacgaaga
KC792897_SP_P-B      atgcccctatcttatcaacgcttccggaaactgctgttgttagacaaaga
KC792843_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC792786_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgaaga
JQ341596_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacaacga
KY881794_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacaaaga
KX276813_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacaaaga
JQ341587_SP_P-B      atgcccctatcctatcaacacttccggaaactactgttgttagacgaaga
KC792973_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacaaaga
KC792801_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU939670_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaggg
MG571326_SP_P-B      atgcccctatcttatcaacgcttccggaaactactgttattagacaaaga
MG571329_SP_P-B      atgcccctatcttatcaacgcttccggaaactactgttattagacaaaga
MG571334_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KX276801_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagaggaaga
KX276784_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagaggaagg
KX276771_SP_P-B      atgcccctatcttatcaacacttccggagactactgttattagacgaaga
KC793180_SP_P-B      atgcccctatcttatcaacgcttccggaaactgctgttgttagacsaaga
KC792780_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagaggaaga
GQ924605_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
FJ562296_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagaggaaga
FJ518811_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
FJ386600_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacaaaga
EU939677_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AY206383_SP_P-B      atgcccctatcttatcaacgcttccggagactactgttgttagagcaaga
EF473974_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
FJ032349_SP_P-B      atgcccctatcctatcaacacttccggaaactactgttgttagacgaaga
FJ386675_SP_P-B      atgcccctatcctatcaacacttccggaaactactgttgttagacgaaga
DQ993700_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
DQ993701_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
DQ993702_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JN827419_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
DQ993698_SP_P-B      atgcccctatcctatcaacacttccggaaactactgttgttagacgaaga
DQ993699_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MG571327_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU332695_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AY596104_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MG571328_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MG571344_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KM213036_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AB976562_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacaacga
KJ717835_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacaacga
KJ803819_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacaacga
KC792860_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagaggaagg
EF473977_SP_P-B      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
FJ562246_SP_P-B      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
EU939675_SP_P-B      atgcccctatcttatcaacacttccggagtgtactgttgttagacaacga
KM875420_SP_P-B      atgcccctatcttatcaacacttccggagactactgttgttagacaacga
MK534698_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MK534699_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KJ173298_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FJ386676_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KF053171_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ803764_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MK052965_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacaaaga
KC774419_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MK534702_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MW310263_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MG571340_SP_P-B      atgcccctatcttatcaactcttccggaaactactgttgttagacgacga
JX661482_SP_P-B      atgcccctatcctatcaacacttccggaaactactgttgttagacgacga
MK534709_SP_P-B      atgcccctatcctatcaacacttccggaaactactgttgttagacgacga
DQ993707_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
DQ448622_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MK534696_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
DQ993706_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KJ173297_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP406163_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MG571371_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MK534575_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MT427062_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgagga
MF674415_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacaacga
KF053162_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KF053165_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KJ803755_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KJ803758_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KC792939_SP_P-B      ----ccctatcttatcaacacttccggaaactgctgttgttagacaaaga
FJ562311_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagagggaga
MG372436_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacaaaga
KC793139_SP_P-B      ----ccctatcttatcaacacttccggaaactactgttgttagacaaaga
FJ386660_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacaaaga
JQ341569_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacaaaga
JX504533_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacaaaga
EU939661_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagatgtaga
AY217364_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AY206391_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacaacga
AB287320_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KU964257_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaagg
KU964259_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaagg
KU964260_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaagg
KU964261_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaagg
KU964262_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaagg
KU964263_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaagg
KU964264_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaagg
KU964266_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaagg
KU964268_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaagg
KU964269_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaagg
KU964270_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaagg
KU964265_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaagg
KU964267_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaagg
KU964271_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaagg
EF473971_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
GQ377606_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JQ801485_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacaaaga
KC793064_SP_P-B      ----ccctatcttatcaacacttccggaaactactgttgttagacaaaga
EF473973_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AF461360_SP_P-B      atgcccctatcttatcaacgcttccggaaactgctgttgttagacgaaga
FJ386688_SP_P-B      atgcccctatcttatcaacgcttccggaaactgctgttgttagacgaaga
AY167098_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
JX504538_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881808_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
KY881795_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
KY881787_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
KY881790_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
KY881789_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
KY881783_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgctagacgaaga
KY881780_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
KY881781_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
KY881784_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
KY881786_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
KY881791_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
KY881793_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
KY881797_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
KY881798_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
KY881799_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
KY881800_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
KY881801_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
KY881782_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
KC793004_SP_P-B      ----ccctatcttatcaacacttccggaaactrctgttattagacgaaga
KC792767_SP_P-B      ----ccctatcttatcaacacttccggaaactrctgttgttagaccaaga
MG571372_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
LC349874_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
KY881792_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
KM875427_SP_P-B      atgcccctatcttagcaacacttccggaaactactgttgttagacgaaga
KF053163_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagaccaaga
KJ803756_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagaccaaga
KC792674_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacaaaga
JX429911_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JX026886_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JX026879_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JQ801516_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JQ341552_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JQ040128_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JQ027325_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
HM011483_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
FJ562224_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
FJ386680_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU939633_SP_P-B      atgcccctatcttatcaacacttccggaaactactattgttagacgaaga
EU939634_SP_P-B      atgcccctatcttatcaacacttccggaaactactattgttagacgaaga
EU939559_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacaaaga
EF494381_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EF494380_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AY217360_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AB713530_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB212625_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaca
AY217359_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
FJ386683_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964120_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964109_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964110_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964112_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964114_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964116_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964118_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964119_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964121_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964122_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815641_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaagg
GU815625_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
FJ562254_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
FJ562234_SP_P-B      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
GU815616_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815627_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815628_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815629_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815630_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815631_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815634_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815635_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815636_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815637_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815638_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815640_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815642_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815643_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815644_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815645_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964108_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964111_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964113_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964115_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KX276810_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
M54923_SP_P-B        atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KM213032_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU882004_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
FJ562237_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC774400_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406261_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
FJ562303_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
FJ562219_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JX661471_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JX978431_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JQ341603_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MF674432_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815770_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964246_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP148317_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AY217368_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AY220697_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AB713529_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
EF473972_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KY881785_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881850_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MG571373_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MG571355_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MF674404_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
LC349869_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
KY881788_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881796_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964302_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964300_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964293_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964287_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964288_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964289_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964290_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964291_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964294_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964295_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964297_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964298_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964299_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964301_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964248_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964255_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964256_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964394_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964247_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964249_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964245_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964141_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406279_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406275_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406263_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964292_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964296_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT622522_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406256_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgaaga
KP406259_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgaaga
KC793030_SP_P-B      atgcccctatcttatcaacaattccggaaactactgttgttagacgaaga
KC774362_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC510650_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC510643_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JX869998_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JX661473_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173377_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815743_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815741_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815735_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963816_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815727_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815723_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815720_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JX661476_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP148326_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815709_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815695_SP_P-B      atgcccctatcttatcaacacttccgaaaactactgttgttagacgaaga
GU434372_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815715_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815722_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815726_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815728_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815734_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815736_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815738_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815744_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815745_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815746_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JX504532_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC510657_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MG571322_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GQ377625_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
FJ899787_SP_P-B      atgcccctatcttatcaacacttccggaaactactgtcgttagacgaaga
FJ518812_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
FJ386658_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgaaga
EU939660_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU595031_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
DQ448624_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AY766463_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AY220698_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AY206375_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AF121250_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU522066_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU939672_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
FJ899784_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
FJ899785_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
FJ899786_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964138_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964139_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964140_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964142_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964143_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964144_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964145_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964146_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964147_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964148_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964149_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964150_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964151_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964152_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881825_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881830_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AB219430_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AB287329_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AY596102_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
DQ448619_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
FJ386636_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GQ377582_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GQ377610_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815679_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815680_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815681_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815683_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815684_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815685_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815686_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815687_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815688_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815689_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815691_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815692_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815693_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815694_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815696_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815697_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815698_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815699_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815700_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815701_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815702_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815703_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815704_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815705_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815706_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815707_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815708_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815710_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815711_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815721_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815730_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815731_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815732_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815737_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815740_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815742_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815755_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JQ040138_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JQ341593_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JX661474_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC510644_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC510649_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC774363_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC774399_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC774403_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173422_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173423_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406262_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406266_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406272_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406273_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406318_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406319_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406320_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406321_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406322_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406323_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406324_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406325_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406326_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406327_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406328_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406329_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406330_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406332_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406333_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406334_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406335_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963828_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963829_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963830_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963831_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963832_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963833_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963834_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963835_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963836_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963837_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963838_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963839_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963840_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963841_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963855_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964244_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964251_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964253_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964254_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MK534627_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426100_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426104_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT645025_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MG571375_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttaaacgacga
AB642093_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttrttagacgacga
AB900106_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacaacga
JQ341571_SP_P-B      atgcccctatcttatcancacttccggaaactactgttgttagaggacgg
AB828708_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttattagacgacga
AB300371_SP_P-B      atgcccctatcttatcaactcttccggaaactactgttgttagacaacga
AB010292_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgacga
AB900096_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttattagacgacga
AB302095_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttattagacgacga
AB287327_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB073851_SP_P-B      atgcccctatcttatcaacacttccggagactactgttgttagacgacga
AB073842_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB900097_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB073858_SP_P-B      atgcccctatcttatcaacacttccggaaacttgtgttattagacgacga
AB073849_SP_P-B      atgcccctatcttatcaacacttccggaaacttstgttgttagacgacga
D50521_SP_P-B        atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
D50522_SP_P-B        atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB900098_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB117759_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
DQ993686_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB073838_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacaacga
LC461174_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
LC461175_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB073855_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB900111_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagaggacga
AB073856_SP_P-B      atgcccctatcttatcaatccttccggaaactactgttgttagacgacga
AB931168_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
AB931169_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
AB900105_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB900102_SP_P-B      atgcccctatcctatcaacacttccggaaactactgttattagacgacga
AB642101_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
D23679_SP_P-B        atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB900108_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttrttagacgacga
AB900107_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB900104_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB300370_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
AB246343_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB073857_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
AB073850_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AB010290_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB010291_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB900112_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacgg
AB900095_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB362933_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB287326_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB106884_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgacga
AB073847_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB073843_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB014366_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB073844_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB073845_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
D23678_SP_P-B        atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB900103_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
AB073852_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgaaga
AB073854_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
MW887648_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
LC603638_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
D00329_SP_P-B        atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB246341_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB073846_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB010289_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB073848_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB205121_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB246342_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
LC279268_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
LC279269_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
LC279270_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
LC279271_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
LC279272_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
LC279273_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MH932712_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MG571331_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JQ341592_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttrttagacaacga
KC792734_SP_P-B      atgcccctatcttatcaacgcttccggagactactgttattagacgaaga
MK818225_SP_P-B      atgcccctatcttatcaacrcttccggaractactgttgttagacgaaga
MG571358_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
KU964381_SP_P-B      atgcccctatcttatcaacacttccggaatgtactgttgttaggggaaga
KU964382_SP_P-B      atgcccctatcttatcaacacttccggaatgtactgttgttaggggaaga
KU964383_SP_P-B      atgcccctatcttatcaacacttccggaatgtactgttgttaggggaaga
KU964384_SP_P-B      atgcccctatcttatcaacacttccggaatgtactgttgttaggggaaga
KU964385_SP_P-B      atgcccctatcttatcaacacttccggaatgtactgttgttaggggaaga
KU964388_SP_P-B      atgcccctatcttatcaacacttccggaatgtactgttgttaggggaaga
KU964391_SP_P-B      atgcccctatcttatcaacacttccggaatgtactgttgttaggggaaga
KU964393_SP_P-B      atgcccctatcttatcaacacttccggaatgtactgttgttaggggaaga
KU964395_SP_P-B      atgcccctatcttatcaacacttccggaatgtactgttgttaggggaaga
KU964397_SP_P-B      atgcccctatcttatcaacacttccggaatgtactgttgttaggggaaga
HM011503_SP_P-B      atgcccctatcttatcaacacttccggaaactactgtksttagacgaagg
KU964386_SP_P-B      atgcccctatcttatcaacacttccggaaacttgtgttgttagaggaaga
KU964387_SP_P-B      atgcccctatcttatcaacacttccggaaacttgtgttgttagaggaaga
KU964389_SP_P-B      atgcccctatcttatcaacacttccggaaacttgtgttgttagaggaaga
KU964390_SP_P-B      atgcccctatcttatcaacacttccggaaacttgtgttgttagaggaaga
KU964392_SP_P-B      atgcccctatcttatcaacacttccggaaacttgtgttgttagaggaaga
KU964396_SP_P-B      atgcccctatcttatcaacacttccggaaacttgtgttgttagaggaaga
JX026881_SP_P-B      atgcccctatcttatcaacacttccggagactactgttgttagacgaagg
JQ341572_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
HM011484_SP_P-B      atgcccctatcttatcaacacttccggaaactrctgttrttagacgaaga
KC792955_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacaaaga
MK534727_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagaggaagg
MG571363_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaagg
MG571338_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU547563_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagaccaaga
DQ995804_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagaccaaga
AY167102_SP_P-B      atgcccctatcttatccacacttccggaaactactgttgttagacgaaga
KC492739_SP_P-B      atgcccctatcttatcaacacttccggagactactgttgttagacgaagg
JQ801494_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacaaaga
DQ995803_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagaccaaga
KJ717796_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
KX276793_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagascaagg
KX276805_SP_P-B      atgcccctatcttatcaacgcttccggaaactactgttgttagaccaaga
EU939671_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB073824_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagaccacga
MT426103_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MG571367_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KX276809_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaagg
KU964258_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaagg
KP406258_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ717843_SP_P-B      atgcccctatcttatcaacgcttccggaaactactgttgttagacgaagg
KJ803825_SP_P-B      atgcccctatcttatcaacgcttccggaaactactgttgttagacgaagg
GU815572_SP_P-B      atgcccctatcttatcaacacttccggaagctactgttgttagacgaaga
GQ924646_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagaggaaga
GQ924632_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagaccaaga
AY167101_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AB073841_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB073832_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagaggaaga
AB073823_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC792901_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC792742_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU939665_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagaagaagg
KP406304_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406305_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406312_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406314_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406302_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406298_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406288_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406296_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406299_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406300_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406301_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406303_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406311_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406297_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU564826_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MG571324_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406292_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406306_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406307_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406308_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406309_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406310_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406313_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406315_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406316_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406317_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
FJ787477_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaagg
EU564825_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AF121251_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AY167097_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JQ341573_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC792667_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MK534676_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AB073836_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AB246340_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406257_SP_P-B      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
KP406260_SP_P-B      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
KP406269_SP_P-B      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
KP406271_SP_P-B      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
AB302945_SP_P-B      atgcctctatcttatcaacacttccggaaactactgttgttagacgaaga
AB302942_SP_P-B      atgcctctatcttatcaacacttccggaaactactgttgttagacgaaga
AB302944_SP_P-B      atgcctctatcttatcaacacttccggaaactactgttgttagacgaaga
AB302943_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MG571364_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MG571341_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JQ801506_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU919176_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU919175_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AB555498_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
FJ386615_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JQ341584_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
LC349875_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JQ027313_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
KX276794_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
KJ717801_SP_P-B      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
KJ717808_SP_P-B      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
KJ803797_SP_P-B      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
KF053159_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
KJ803752_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
KF053189_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
KF053194_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
KJ803781_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
KJ803783_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
KJ717805_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
KJ717806_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
KJ803795_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
JQ341595_SP_P-B      atgcccctatcttatcaacacttccggaaactrctgttgttagaccaaga
AY596111_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttattagacaacga
KJ410500_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttattagacaacga
KY881837_SP_P-B      atgcccctgtcttatcaacacttccgaaaactactgttgttagacaaaga
FJ023631_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagatcaaga
KC792800_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttattagacgaaga
JQ027329_SP_P-B      atgcccctatcttatcaacacttccggaaactrctgttgttagacgaaga
KC793006_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagaccaaga
EU939679_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427009_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU305547_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JQ341600_SP_P-B      atgcccctatcttatcaatgcttccggaaactactgttgttagacgaaga
MK534691_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426970_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MK534673_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963946_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
FJ386654_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU570069_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttggacgaaga
EU305548_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426956_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963949_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963951_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963948_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963955_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC774380_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC774379_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JX869999_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GQ377641_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AY217357_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AY217358_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AY596110_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AY596112_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU570070_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU570071_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC774374_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC774388_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963945_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963947_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963950_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963952_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963953_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963954_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963956_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963957_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963958_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963959_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427015_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427003_SP_P-B      atgcccctatcttatcaacacttccgaaaactactgttgttagacgaaga
MT427001_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426976_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426974_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426973_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426965_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426951_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427002_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426942_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426940_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426939_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426988_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426936_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426909_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426911_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426912_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426917_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426959_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426960_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426995_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426906_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426916_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426931_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426938_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426947_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426950_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426967_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426981_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426996_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427010_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427011_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426907_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426908_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426910_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426913_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426914_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426915_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426918_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426919_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426920_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426921_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426922_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426923_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426924_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426925_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426926_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426927_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426928_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426929_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426930_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426932_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426933_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426934_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426937_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426941_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426943_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426944_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426945_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426946_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426948_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426949_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426952_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426953_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426954_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426955_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426957_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426958_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426961_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426962_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426963_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426964_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426966_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426968_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426969_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426971_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426972_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426975_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426977_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426978_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426979_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426980_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426982_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426983_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426984_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426985_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426986_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426987_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426989_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426990_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426991_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426992_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426993_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426994_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426997_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426998_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426999_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427000_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427004_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427005_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427006_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427007_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427008_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427012_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427013_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427014_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426935_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC793069_SP_P-B      ----ccctatcttatcaacacttccggaaactactgttgttagaggaaga
KX276812_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacaacga
EU939636_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttattagacgaaga
KY881822_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AB073839_SP_P-B      atgcccctatcttatcaacacttccggagactactgttattagacgaaga
KJ410502_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgaaga
KY881838_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgaaga
KY881843_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881841_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881834_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881831_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgaaga
KY881827_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgaaga
KY881828_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgaaga
KY881824_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GQ377622_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881823_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881829_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881836_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881839_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881842_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964079_SP_P-B      atgcccctatcctatcaacacttccggaaactactgttgttagacgaaga
KU964081_SP_P-B      atgcccctatcctatcaacacttccggaaactactgttgttagacgaaga
KU964083_SP_P-B      atgcccctatcctatcaacacttccggaaactactgttgttagacgaaga
KU964084_SP_P-B      atgcccctatcctatcaacacttccggaaactactgttgttagacgaaga
KU964085_SP_P-B      atgcccctatcctatcaacacttccggaaactactgttgttagacgaaga
KU964086_SP_P-B      atgcccctatcctatcaacacttccggaaactactgttgttagacgaaga
KU964087_SP_P-B      atgcccctatcctatcaacacttccggaaactactgttgttagacgaaga
KU964088_SP_P-B      atgcccctatcctatcaacacttccggaaactactgttgttagacgaaga
KU964089_SP_P-B      atgcccctatcctatcaacacttccggaaactactgttgttagacgaaga
KU964090_SP_P-B      atgcccctatcctatcaacacttccggaaactactgttgttagacgaaga
KU964091_SP_P-B      atgcccctatcctatcaacacttccggaaactactgttgttagacgaaga
KU964092_SP_P-B      atgcccctatcctatcaacacttccggaaactactgttgttagacgaaga
KU964080_SP_P-B      atgcccctatcctatcaacacttccggaaactactgttgttagacgaaga
KU964082_SP_P-B      atgcccctatcctatcaacacttccggaaactactgttgttagacgaaga
KX276781_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagaccaaga
EU564822_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacaaaga
EU564823_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacaaaga
EU564824_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacaaaga
KC792935_SP_P-B      ----ccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC792938_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagaggaagg
MG571370_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881851_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC792920_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JX507213_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
FJ787476_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
FJ562240_SP_P-B      atgcccctatcttatcaacgcttccggaaactactgttgttagacgaaga
GQ924630_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AB642094_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC510655_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC792970_SP_P-B      ----ccctatcttatcaacacttccggaaactactrttgttagacgaaga
KU963799_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963800_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963801_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963802_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963803_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963804_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963805_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963806_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963807_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963808_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963809_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963810_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963811_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963812_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963813_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC774410_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC774397_SP_P-B      atgcccctatcttatcaacacttccggaaaatactgttgttagacgaaga
KC774372_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963842_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963843_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963844_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963845_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963846_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963847_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963848_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963849_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963850_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963851_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963852_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963853_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
FJ386610_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU939639_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GQ377542_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GQ924610_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JQ341566_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JQ341598_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JX507210_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC510658_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC774383_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC774389_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173424_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173425_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ410507_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KM359440_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MF674449_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MZ671236_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MZ671239_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MZ675786_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KR152339_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC792663_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU796071_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU796066_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU796067_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MG571346_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MK534603_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427080_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881820_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881821_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
HM153811_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
FJ562321_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GQ924606_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881835_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JQ341549_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JQ341555_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173362_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881721_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881722_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881723_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881724_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881725_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881726_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881727_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881728_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881729_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881730_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881731_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881732_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881733_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881734_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881735_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881740_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881741_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881745_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881746_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881747_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881752_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881753_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881756_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881757_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881759_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881760_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881761_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881778_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881779_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
FJ787475_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964124_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964127_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964128_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964129_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964131_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964134_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964136_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964137_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881913_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881899_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881862_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881861_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881854_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881846_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406284_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406286_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406294_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
FJ386669_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP036970_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406281_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406285_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406287_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406289_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406293_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881826_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881844_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881847_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881848_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881852_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881855_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881856_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881857_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881858_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881859_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881860_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881863_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881866_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881868_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881893_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881894_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881895_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881896_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881897_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881898_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881900_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881901_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881902_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881903_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881904_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881905_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881906_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881907_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881908_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881909_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881910_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881911_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881912_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881914_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT645005_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttattagacgaaga
HM011471_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttattagacgaaga
KJ717795_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttattagacgaaga
KJ803789_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttattagacgaaga
AY206387_SP_P-B      atgcccctatcctatcaacgcttccggaaactactgttgttagacggaga
KX276770_SP_P-B      atgcccctatcttatcaacgcttccggaaactactgttgttagacaaaga
KX276783_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagaagcagg
KX276796_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacaacga
KC792936_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacaaaga
KC793076_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagaccaaga
KC792652_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagaccaaga
DQ993696_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KX276779_SP_P-B      atgcccctatcttatcaacacttccggaaactrctgttrttagaysaaga
KX276772_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacaaaga
JQ341576_SP_P-B      atgcccctatcttatccacacttccggagaatactgttgttagaccaaga
DQ995805_SP_P-B      atgcccctatcttatcaacacttccggagactactgttgttagatgcaga
EU660224_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426102_SP_P-B      atgcccctatcttatcaacacttccggagacttgtgttgttagatccaga
JQ341594_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagasraaga
HM011504_SP_P-B      atgcccctatcttatcaacgcttccggaaacttgtgttgttagacaaaga
JQ341567_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgaaga
KT749820_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgaaga
KX276802_SP_P-B      atgcccctatcttatcaacgcttcctgaaactactgttgttagaccaaga
KX276787_SP_P-B      atgcccctatcttatcaacgcttccggaaactactgttrttagacaacga
KC792985_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagaccaaga
FJ562312_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagaccaaga
FJ386608_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
EU939638_SP_P-B      atgcccctatcttatcaacgcttccggaaactactgttgttagacgaaga
MG571354_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacaacga
MG571321_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacaacga
KX276782_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ717842_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JQ027312_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacraaga
KX276806_SP_P-B      atgcccctatcttatcaactcttccggaaactactgttgttagacmamga
KJ717818_SP_P-B      atgcccctatcttatcaacgcttccggaaactgctgttgttagaccaaga
KC792976_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacaaaga
MK534608_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgacga
KC792745_SP_P-B      atgcccctatcctatcaacacttccggaaactactgttgttagaccacga
JX504543_SP_P-B      atgcccctatcttatcgacacttccggaaactactgttattagacgaaga
X98077_SP_P-B        atgcccctatcttatcaacacttccggaaactactgttgttagacaaaga
KX276790_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
KX276786_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JQ341551_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KF053180_SP_P-B      atgcccctatcttatccacacttccggagactgctgttgttagaccaaga
KJ803773_SP_P-B      atgcccctatcttatccacacttccggagactgctgttgttagaccaaga
KF053182_SP_P-B      atgcccctatcttatccacacttccggaaactgctgttgttagaccaaga
KJ803775_SP_P-B      atgcccctatcttatccacacttccggaaactgctgttgttagaccaaga
KC792949_SP_P-B      ----ccctatcttatcaacacttccggaaactactgttgttagacgaaga
KX276804_SP_P-B      atgcccctatcttatcaacgcttccggaaactactgttgttagasvaaga
KX276799_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KX276785_SP_P-B      atgcccctatcttrtcaacacttccggaaactrctgttgttagacgaaga
KC792811_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
KC492740_SP_P-B      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
HM011475_SP_P-B      atgcccctatcttatcaacacttccggaaamtactgttrttagacgaaga
HM011474_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagaccaaga
KY417926_SP_P-B      atgcccctatcttatcaacgcttccggaaactactgttgttagaggaaga
KX276775_SP_P-B      atgcccctatcttatcaacgcttccggagactrctgttrttagacgaaga
JQ341606_SP_P-B      atgcccctatcytatcaacgcttccggaaactactgttgttagacgaaga
JQ341565_SP_P-B      atgcccctatcttatcaacacttccggaaactrctgttgttagacgamga
AB073825_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KC792859_SP_P-B      -----cctatcttatcaacacttccggaaactactgttgttagacaacga
KC793125_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacaacga
X97850_SP_P-B        atgcccctatcttatcaacacttccggaaaatgctgttgttagacgaaga
KX276807_SP_P-B      atgcccctatcctatcmacrcttccggaaactgctgttgttagacgaaga
AY163869_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AY163870_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC793061_SP_P-B      ----ccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU158262_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ790200_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ717817_SP_P-B      atgcccctatcttatcaacacttccggaaacttgtgttgttagacgaaga
KJ803805_SP_P-B      atgcccctatcttatcaacacttccggaaacttgtgttgttagacgaaga
JQ341560_SP_P-B      atgcccctatcttatcaacacttccggagactactgttgttagaggaaga
MG571368_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MG571360_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacaaaga
MG571325_SP_P-B      atgcccctatcttatcaacgcttccggaaactactgttgttagacaaaga
KC792904_SP_P-B      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
JX026883_SP_P-B      atgcccctatcttatcaacgcttccggaaactactgttgttagacgaaga
JQ341582_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JQ341581_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JQ341559_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JQ341553_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
HM011494_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GQ377567_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
FJ386682_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU919171_SP_P-B      atgcccctatcttatcaacgcttccggaaactactgttgttagacaacga
EU306699_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
DQ995802_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacaaaga
DQ995801_SP_P-B      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
DQ993704_SP_P-B      atgcccctatattatcaacacttccggaaactactgttgttagacgaaca
AF121248_SP_P-B      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
AB555499_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagaggaaga
AB073830_SP_P-B      atgcccctatcttatcaacrcttccggaaactactgttgttagacgaaga
FJ562316_SP_P-B      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
KJ173378_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MG571353_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagaggaaga
MG571376_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagaggaaga
KY881864_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagatgccga
KX276803_SP_P-B      atgcccctatcttatcaacgcttccggaaactactgttgttagacaaaga
KJ173385_SP_P-B      atgcgcctatcttatcaacacttccggaaactactgttgttagacgaaga
DQ904357_SP_P-B      atgcccctatcttatcaacacttccggagacttgtgttgttagacgaaga
EU487256_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT645016_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaagg
MK818223_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgaaga
MG571333_SP_P-B      atgcccctatcttatcaacgcttccggaaactactgttgttagaccacga
KX276778_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacmamga
KU963815_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JQ027330_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagaccaaga
JQ027331_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagaccaaga
KP406216_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406194_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406176_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406177_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406178_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406179_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406180_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406181_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406182_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406183_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406184_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406185_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406186_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406187_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406188_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406189_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406190_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406191_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406192_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406193_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406195_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406196_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406197_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406198_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406199_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406200_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406201_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406202_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406203_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406204_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406205_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406206_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406207_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406208_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406209_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406210_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406211_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406212_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406213_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406214_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406215_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406217_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406218_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406219_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MF674465_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406280_SP_P-B      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
KP406170_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC792717_SP_P-B      atgcccctatcttatcaacgcttccggaaactactgttgttagacgaaga
EU939637_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC792896_SP_P-B      ----ccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427097_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426890_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MG571374_SP_P-B      atgcccctatcttatcgacacttccggaaactactgttgttagacgaaga
MG571361_SP_P-B      atgcccctatcttatcaacgcttccggaaactgctgttgttagacgaaga
MG571357_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MG571349_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MG571348_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881833_SP_P-B      atgcccctatcttatcaacgcttccggaaactactgttgttagacgaaga
KX276777_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacaaaga
KU964098_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406331_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406268_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406267_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgaaga
KP406265_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406167_SP_P-B      atgcccctatcttatcaacacttccggaaactactattgttagacgaaga
KP406164_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP148581_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173384_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
KJ173383_SP_P-B      atgcccctatcttatcaacacttccggaaactrctgttgttagacgaaga
KJ173379_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173375_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KF053174_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ803768_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC792779_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
KC792765_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC774415_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
JX429910_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JQ341578_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JQ341577_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgamga
JQ341568_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JQ341564_SP_P-B      atgcccctatcttatcaacgcttccggaaactactgttgttagacgaaga
JQ341563_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815752_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815574_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
GU815577_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
GU815573_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU357842_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GQ924647_SP_P-B      atgcccctatcttatcaacgcttccggaaactactgttgttagaggaaga
FJ562262_SP_P-B      atgcccctatcttatcaacacttccggagactactgttgttagacgaaga
FJ562257_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
FJ386681_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
FJ032352_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU939678_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU882002_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
EU881997_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU158263_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
EF473975_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AY800389_SP_P-B      atgcccctatcttatcaacccttccggaaactgctgttgttagacgaaga
AY217362_SP_P-B      atgcccctatcttatcaacgcttccggaaactactgttgttagacgaaga
AY217361_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
AY206390_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AY167094_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AY167093_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagaggaagg
AF282917_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AB365445_SP_P-B      atgcccctatcctatcaacacttccggaaactactgttgttagacgaaga
AB073821_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagaygaaga
KP406174_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC792712_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
DQ993711_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AY596109_SP_P-B      atgcccctatcttgtcaacacttccggaaactactgttgttagacgaaga
AF479684_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacggaga
KP406247_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
KP406244_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
KP406245_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
KP406246_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
KP406248_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
KP406249_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
KP406250_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
KP406251_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
KP406252_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
KP406253_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
KP406254_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
GU815578_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
GQ924648_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
EU306681_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
AY167100_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
EU306679_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
EU306680_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
MF674506_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
EU306677_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
EU306678_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
KJ173371_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173372_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AY217355_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AY217356_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU939664_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AY596105_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
KP406283_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
KP406291_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406290_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406282_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GQ377550_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AF461362_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JX429900_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC792951_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427042_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
OK106254_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JQ341550_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AF121247_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC793132_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC792945_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KX276808_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MG571350_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AY596103_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU139543_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC774407_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JX429897_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
FJ562222_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagatgaaaa
KC792889_SP_P-B      ----ccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU939635_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgaaga
FJ562259_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406220_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406221_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406222_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406223_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406224_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406225_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406226_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406227_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406228_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406229_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406230_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406231_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406232_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406233_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406234_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406235_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406236_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406237_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406238_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406239_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406240_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406241_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406242_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406243_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
FJ562260_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC774398_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC774394_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC774401_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AB195934_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AB195935_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AB195933_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AP011084_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GQ377561_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JQ341575_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GQ377558_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GQ377569_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MF674503_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KM875416_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KM875417_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KM392084_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KM213035_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ717831_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ803817_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173360_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC774368_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JX504531_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC774396_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963962_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963963_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963968_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964153_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815774_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815772_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
FJ386634_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AJ627225_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GQ475340_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815773_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815775_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815776_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815777_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815778_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815779_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815780_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815781_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815782_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815783_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC774367_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MK534683_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AB246339_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AB287328_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AF121243_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AF121244_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AF121245_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AF121246_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AB073837_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AB205120_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JQ341586_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC793042_SP_P-B      ----ccctatcttatcaacacttccggaaactactgttgttagacgaaga
DQ448628_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AB073826_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
D00330_SP_P-B        atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MF674426_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JX661484_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JF436921_SP_P-B      atgcccctatcttatcaatgcttccggaaactactgttgttagacgaaga
MT426893_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426859_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426860_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426861_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426862_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426867_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426868_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426869_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426871_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426872_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426873_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426874_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426875_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426876_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426877_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426879_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426880_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426881_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426883_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426884_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426885_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426886_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426887_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426888_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426892_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426894_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426895_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426898_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426899_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426900_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426901_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426902_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426903_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426904_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426905_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426863_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426864_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426865_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426866_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426870_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426878_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426882_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426889_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426896_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426897_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427105_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427070_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427106_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427109_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427071_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406255_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406264_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406270_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406278_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406274_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JQ341562_SP_P-B      atgcccctatcttatcaatacttccggaaactactgttgttagacgaaga
KC792885_SP_P-B      atgcccctatcttatcaatacttccggaaactactgttgttagacgaaga
EU939673_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964157_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964156_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964161_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964166_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964168_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406165_SP_P-B      atgcccctatcttatcaacacttccggaaactactattgttagacgaaga
KP406171_SP_P-B      atgcccctatcttatcaacacttccggaaactactattgttagacgaaga
KP406173_SP_P-B      atgcccctatcttatcaacacttccggaaactactattgttagacgaaga
KP406162_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406166_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173420_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173421_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JQ341609_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP148314_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP148323_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP148334_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MF674450_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JQ040171_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JQ341583_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815761_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815764_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
FJ032353_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
FJ032354_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC792974_SP_P-B      ----ccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT645057_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427107_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427090_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427073_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427067_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427064_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427063_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427056_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427019_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MK534703_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MK534571_SP_P-B      atgcccctatcttatcaacacttccggaaactaccgttgttagacgaaga
MH061283_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MG571369_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MG571347_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MF674422_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY881867_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY470962_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KX276788_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964165_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964155_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964162_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964167_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964154_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964135_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964125_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964126_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964130_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964132_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964133_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964101_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964096_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964094_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963854_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963814_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963817_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963818_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963819_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963820_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963821_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963822_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963823_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963824_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963825_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963826_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963827_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406276_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406175_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406172_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406168_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406169_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP148583_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP148348_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP148342_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP148341_SP_P-B      atgcccctatcttatcaacacttccggaaactaccgttgttagacgaaga
MK534704_SP_P-B      atgcccctatcttatcaacacttccggaaactaccgttgttagacgaaga
KP148335_SP_P-B      atgcccctatcttatcaacacttctggaaactactgttgttagacgaaga
KP148329_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP148328_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP148325_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP148324_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KM213034_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ843165_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ717830_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ410490_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173418_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173419_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173411_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173412_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MG571362_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173403_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173404_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173399_SP_P-B      atgcccctatcttatccacacttccggaaactactgttgttagacgaaga
KJ173400_SP_P-B      atgcccctatcttatccacacttccggaaactactgttgttagacgaaga
KJ173397_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173398_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173363_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173364_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC792948_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgaaga
KC792701_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC774417_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC774413_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC774412_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC774409_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC774390_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC774376_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC510646_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JX870001_SP_P-B      atgcccctatcttatcaacacttccggaaactrctgttgttagacgaaga
JX661479_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JX429908_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JQ801512_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JQ801474_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaagg
JQ341558_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JQ040170_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JQ040147_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173386_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JQ040125_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JQ027315_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
HM011470_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815765_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815760_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815673_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttaggcgaaga
GU815662_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815658_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815607_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815602_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815571_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815554_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815550_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815548_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815549_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815551_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815552_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815553_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815555_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815556_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815557_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815558_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815559_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815560_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815561_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815562_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815563_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815564_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815565_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815566_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815567_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815568_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815569_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815570_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815575_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815576_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JX661475_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC774408_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GQ924631_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JQ341579_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KX276773_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GQ924608_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC510642_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC510648_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC510659_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KM392072_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963960_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963961_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963964_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963965_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963966_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963967_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963969_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963970_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963971_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963972_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963973_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963974_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963975_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964158_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964159_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964160_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964163_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964164_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GQ924607_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GQ377629_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GQ924634_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MK534658_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GQ377587_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815756_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173387_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173388_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GQ377566_SP_P-B      atgcccctatcttatcaacacttccggaaactacagttgttagacgaaga
GQ377568_SP_P-B      atgcccctatcttatcaacacttccggaaactacagttgttagacgaaga
GQ377537_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GQ377525_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
FJ899779_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
FJ562322_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
FJ562231_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
FJ386666_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MK534554_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
FJ386655_SP_P-B      atgcccctatcttatcaacgcttccggaaactactgttgttagacgaaga
FJ386642_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JQ801471_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
FJ032358_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU939676_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU939669_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU939667_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU919172_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU881998_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC793168_SP_P-B      -----cctatcttatcaacacttccggaaactactgttgttagacgaaga
KP148336_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP148338_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP148339_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP148340_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP148343_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP148344_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP148345_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP148346_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP148347_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP148349_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY470830_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY470832_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY470833_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY470834_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY470835_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY470836_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY470837_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY470838_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY470839_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY470840_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY470841_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MK534570_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MK534578_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MK534581_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MK534591_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MK534629_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MK534705_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MK534707_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU487257_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JF412801_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MG571365_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU439023_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815718_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU439022_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU306707_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU306704_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP148356_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU306703_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU306696_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EF134945_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EF134946_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
DQ975271_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173343_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
DQ448627_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
FJ032357_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
DQ377158_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU306695_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU306697_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU306698_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AY596106_SP_P-B      atgcccctatcttatccacacttccggaaactactgttgttagacgaaga
AY518556_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815650_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JX507215_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964123_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AY220704_SP_P-B      atgcccctatcctatcaacacttccggaaactactgttgttagacgaaga
AY220703_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU919173_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JQ040169_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JQ801524_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JX661478_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC510651_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173347_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173348_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MF674391_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MH663473_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MZ671237_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MZ671238_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AY167089_SP_P-B      atgcccctatcttgtcaacacttccggaaactactgttgttagacgaaga
AB900110_SP_P-B      atgcccctatcttatccacacttccggaaactactgttgttagacgaaga
AB073828_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
DQ993697_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT111595_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AB073822_SP_P-B      atgcccctatcttatcaacgcttccggaaactactgttgttagacgaaga
FJ386582_SP_P-B      atgcccctatcttatcaacgcttccggaaactactgttgttagacgaaga
FJ562236_SP_P-B      atgcccctatcttatcaacgcttccggaaactactgttgttagacgaaga
GQ924611_SP_P-B      atgcccctatcttatcaacgcttccggaaactactgttgttagacgaaga
JX661480_SP_P-B      atgcccctatcttatcaacgcttccggaaactactgttgttagacgaaga
KC792798_SP_P-B      atgcccctatcttatcaacgcttccggaaactactgttgttagacgaaga
MW310261_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MZ675785_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815605_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427081_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC774382_SP_P-B      atgcacctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173389_SP_P-B      atgcacctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173390_SP_P-B      atgcacctatcttatcaacacttccggaaactactgttgttagacgaaga
EU306711_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815712_SP_P-B      atacccctatcttatcaacacttccggaaactactgttgttagacgaaga
AB073827_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AB073829_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AB073831_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AB073833_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AB073834_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AB073840_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AB205119_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AB300364_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AB471854_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AB471855_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AB675676_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AF100308_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AF100309_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AF121249_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AF282918_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
AY293309_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
DQ448620_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
DQ448621_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
DQ448623_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
DQ448625_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
DQ448626_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
DQ993703_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
DQ993705_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
DQ993708_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
DQ993709_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
DQ993710_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU306700_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU306701_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU306702_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU306705_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU306706_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU306708_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU306709_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU306710_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU306712_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU350409_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU439018_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU439020_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU439021_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU522067_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU522074_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU796068_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU939663_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
EU939666_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
FJ386583_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
FJ386584_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
FJ386668_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
FJ386684_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
FJ562253_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
FJ562289_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
FJ787444_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GQ377519_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GQ377547_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GQ377588_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GQ377612_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GQ377638_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GQ377639_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GQ377643_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GQ924603_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GQ924627_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GQ924644_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GQ924653_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU434373_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU451682_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815579_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815581_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815583_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815584_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815585_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815586_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815587_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815588_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815589_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815590_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815591_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815593_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815594_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815595_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815596_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815597_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815598_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815599_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815600_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815601_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815603_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815604_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815606_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815608_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815609_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815610_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815611_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815612_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815613_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815614_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815617_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815618_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815619_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815620_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815621_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815622_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815623_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815624_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815626_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815632_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815633_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815639_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815646_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815647_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815648_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815649_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815651_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815652_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815653_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815654_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815656_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815657_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815659_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815660_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815661_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815663_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815664_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815665_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815666_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815667_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815668_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815669_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815670_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815672_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815674_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815675_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815676_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815677_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815678_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815713_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815716_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815717_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815719_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815724_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815725_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815729_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815733_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815739_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815747_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815748_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815749_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815750_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815751_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815753_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815754_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815757_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815759_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815762_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815766_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815767_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815768_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815769_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
GU815771_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
HM011480_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JF899335_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JN406371_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JQ040173_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JQ341570_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JQ341574_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JQ341591_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JQ688405_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JQ801479_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JQ801507_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JQ801514_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JX429899_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JX429902_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JX661470_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JX661472_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JX661477_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JX661481_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JX661483_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC510641_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC510647_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC510652_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC510653_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC510656_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC510660_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC774365_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC774366_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC774371_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC774373_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC774375_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC774377_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC774378_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC774381_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC774384_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC774385_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC774386_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC774387_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC774391_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC774392_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC774393_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC774395_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC774402_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC774404_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC774405_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC774406_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC774411_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC774416_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC792756_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC792982_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KC792994_SP_P-B      ----ccctatcttatcaacacttccggaaactactgttgttagacgaaga
KF053192_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173339_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173340_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173345_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173351_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173352_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173353_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173354_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173355_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173356_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173357_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173359_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173361_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173365_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173366_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173367_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173368_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173369_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173370_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173373_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173374_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173376_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173380_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173381_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173382_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173405_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173406_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173407_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173408_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173409_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173410_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173413_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173414_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173415_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173416_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ173417_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ410516_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ410517_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KJ803763_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KM392083_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KM875421_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP148318_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP148319_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP148320_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP148321_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP148322_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP148327_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP148330_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP148331_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP148332_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP148333_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP148357_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP148359_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP148360_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP148361_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP148362_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP148363_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP148364_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP148365_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP148366_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP148579_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP148580_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP148582_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KP406277_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KR232337_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963976_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963977_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963978_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963979_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963980_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963981_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963982_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963983_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963984_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963985_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963986_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963987_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963988_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU963989_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964093_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964095_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964097_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964099_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964100_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964102_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964103_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964104_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964105_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964106_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964107_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KU964117_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KX765856_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY470953_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY470954_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY470956_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY470960_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
KY470961_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MF674427_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MF674480_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MF674485_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MF674512_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MG571342_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MG571356_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MK052962_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MK052964_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MK075117_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MK534572_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MK534573_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MK534576_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MK534599_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MK534600_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MK534601_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MK534602_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MK534693_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MK534711_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MK534732_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MK534733_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT426891_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427016_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427017_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427018_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427020_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427021_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427022_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427023_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427024_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427025_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427026_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427027_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427028_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427029_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427030_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427031_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427032_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427033_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427034_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427035_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427036_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427037_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427038_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427039_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427040_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427041_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427043_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427044_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427045_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427046_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427047_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427048_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427049_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427050_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427051_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427052_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427053_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427054_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427055_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427057_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427058_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427059_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427060_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427061_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427065_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427066_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427068_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427069_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427072_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427074_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427075_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427076_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427077_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427078_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427079_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427082_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427083_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427084_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427085_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427086_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427087_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427088_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427089_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427091_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427092_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427093_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427094_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427095_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427096_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427098_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427099_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427100_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427101_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427102_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427103_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427104_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT427108_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT645041_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MT645058_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MW310262_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
MW310264_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
X97851_SP_P-B        atgcccctatcttatcaacacttccggaaactactgttgttagacgaaga
JN792901_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
JN792902_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
AB287324_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
AB287321_SP_P-B      atgcccctatcttatcaacacttccggaaactgctattattagacgacga
KP659245_SP_P-B      atgcccctatcctatcaacacttccggaaactrctattattagacgacga
MF674407_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacaacga
MF674439_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674492_SP_P-B      atgcccctatcttatcaacgcttccggaaactactgttgttagaccacga
MT645001_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KX276825_SP_P-B      atgcccctatcttatcaatgcttccggaaactactgttgttagacgacga
MZ439546_SP_P-B      atgcccctatcttatcaacacttccggaaactactattattagacgacga
MZ439533_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttattagacgacga
MZ439541_SP_P-B      atgcccctatcttatcaacacttccggaaaatactgttattagacgacga
MZ439547_SP_P-B      atgcccctatcttatcaacacttccggaaaatactgttattagacgacga
MZ439538_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
MZ439539_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
MZ439540_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
MZ439544_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
MZ439548_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
MZ439535_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
MZ439532_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
MZ439531_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
MZ439525_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
MZ439526_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
MZ439528_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
MZ439534_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
MZ439517_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
MZ439518_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
MZ439519_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
MZ439521_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
MZ439522_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
MZ439523_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
MZ439524_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
MZ439527_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
MZ439529_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
MZ439530_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
MZ439536_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
MZ439537_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
MZ439542_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
MZ439543_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
MZ439545_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
MZ439549_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
MZ439550_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
MZ439551_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
MZ439520_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
LT992442_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JQ707740_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JQ341589_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacaacga
GQ358139_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF621878_SP_P-B      atgcccctatcctatcaacacttccggaaactactgttgttagacgacga
DQ993687_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674508_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgacga
MF674460_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674406_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JQ341601_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MZ675798_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MZ675804_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674513_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AY033072_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AY033073_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB231909_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MZ675800_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MZ675794_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MZ675795_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MZ675797_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MZ675805_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MZ675806_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MZ675807_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674488_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674481_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674387_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JQ707750_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JQ707747_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JQ707745_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JQ707734_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JQ707735_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JQ707737_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JQ707738_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JQ707739_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JQ707742_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JQ707743_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JQ707744_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JQ707746_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JQ707749_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JQ707753_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JQ707755_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JQ707758_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JQ707759_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JQ707762_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JQ707763_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JQ707764_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JQ707765_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JQ707766_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JQ707767_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JQ341588_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
HQ700546_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FJ023633_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FJ023635_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
FJ349236_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674384_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674410_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674416_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674421_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674424_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674431_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674438_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674453_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674470_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674487_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674490_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674497_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
MF674509_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP659255_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
KP659234_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP659239_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
DQ463793_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
DQ463801_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
JN792893_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
KP659250_SP_P-B      atgcccctatcttatcaatgcttccggaaactrctgttgttagacgacgt
KP659253_SP_P-B      atgcccctatcttatcaatgcttccggaaactgctgttattagacgacga
KP659221_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JN792894_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
AB287323_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
AB073853_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
AB287325_SP_P-B      atgcccctatcttatcaacacttccggaaactgctgttgttagacgacga
KP659235_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP659249_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
DQ463799_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
DQ463791_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
AB287322_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB287317_SP_P-B      atgcccctatcttatcaatacttccggaaactactgttgttagacgacga
DQ463792_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacaccga
DQ463800_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagactccga
JN792897_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagactccga
JN792898_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagactccga
KP659246_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
DQ463797_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JN792895_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
DQ463796_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
DQ463794_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
DQ463789_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JN792896_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
DQ463788_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB287318_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP659219_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB287314_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB287315_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP659237_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP659247_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB287316_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP659240_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JN792900_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
DQ463795_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
DQ463787_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
DQ463790_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
DQ463798_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
JN792899_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP659254_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP659252_SP_P-B      atgcccctatcttatcaatacttccggaaactactgttattagacgacga
KP659251_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP659244_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP659223_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
KP659220_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
AB287319_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
KP659248_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttattagacgacga
DQ463802_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
KP659224_SP_P-B      atgcccctatcttatcaacacttccggaaactactgttgttagacgacga
                            * *           ***   *   *                  

DQ993694_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
DQ993682_SP_P-B      tgcaggtcccctataagaagaactccctcgcctcgcagactaagggctca
KX276776_SP_P-B      cgcaggtcccctagaagaagaactccctcgcctcgcagacgaagrtctma
KX276774_SP_P-B      ggcaggtccattagaagaagaactccctcgcctcgcagacgaaggactca
AB048705_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU679959_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ386648_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC793189_SP_P-B      tgcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctaa
KX276819_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ032344_SP_P-B      cgcaggtcccctggaagaagaactccctcgcctcgcagaccaaggtctaa
EU579441_SP_P-B      cgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctaa
EU589335_SP_P-B      cgcaggtcccctggaagaagaactccctcgcctcgccgaccaaggtctaa
EU570075_SP_P-B      cgcaggtcccctggaagaagaactccctcgcctcgcagaccaaggtctaa
FJ386656_SP_P-B      cgcaggtcccctggaagaagaactccctcgcctcgccgaccaaggtctaa
HM011477_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX276795_SP_P-B      rgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MN689122_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtttcc
HM011487_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ924641_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX276811_SP_P-B      ggcaggtcccttagaagaagaactccctcgcctcgcagacgaagrtctca
GQ924638_SP_P-B      ggcaggtcccctagaagaagaactccctcgcgtcgcagacgaaggtctca
GQ924639_SP_P-B      ggcaggtcccctagaagaagaactccctcgcgtcgcagacgaaggtctca
MG571336_SP_P-B      tgcaggacccctagaaaaagaactccctcgcctcgcaaacgaaggtctca
KX276821_SP_P-B      agcagggtccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ341585_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgccgacgaaggtctca
HM011499_SP_P-B      ggcaggwcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX276858_SP_P-B      sgcaggwcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ924635_SP_P-B      agcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX276827_SP_P-B      ggcaggwcccytagaagaagaactccctcgcctcgcagacgaaggtctca
KX276820_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX276817_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ341556_SP_P-B      cgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctaa
KX765854_SP_P-B      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ341557_SP_P-B      kgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY881845_SP_P-B      cgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY881869_SP_P-B      cgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY881849_SP_P-B      cgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY881853_SP_P-B      cgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY881865_SP_P-B      cgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ924626_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctaa
HM011467_SP_P-B      -gcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ924645_SP_P-B      agcaggtcccttagaagaagaactccctcgcctcgcagacgaaggtctca
KX276824_SP_P-B      ggcaggtyccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK534614_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX276800_SP_P-B      cgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ429079_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ341608_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HM011496_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HM011476_SP_P-B      cgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctaa
GQ924637_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KJ717813_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KJ803801_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HM011482_SP_P-B      cgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU939674_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ899790_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ899791_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
DQ993680_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AP011094_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB219427_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT757439_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT757451_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT757448_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT757453_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT757457_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT757440_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT757441_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT757446_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT757456_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT757443_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT757455_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT757454_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT757445_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT757449_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT757442_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT757452_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT757438_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT757436_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT757444_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT757437_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT757450_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT757447_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ924660_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ924640_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB241116_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB241117_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB219428_SP_C-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB219426_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB219429_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK818222_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MF674446_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HM011469_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX276822_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MN689119_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT645018_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MF674505_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MF674440_SP_P-B      tgcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX276818_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148459_SP_P-B      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
KC792719_SP_P-B      ggcaggtcctctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ341590_SP_P-B      kgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ027311_SP_P-B      gkcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ358137_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagaagaaggtatca
FJ023637_SP_P-B      ggcaggtcccctagaagaaggactccctcgcctcgcagacgaaggtctca
AB212626_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB033555_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ341597_SP_P-B      kgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ341599_SP_P-B      kgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU330989_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU330990_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MG826152_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX276830_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148452_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148455_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148456_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148458_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148460_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148461_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148453_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtttca
MF674419_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ924624_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY629636_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY629635_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KJ173401_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KJ173402_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC774369_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC774370_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ924628_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX276829_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ429080_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AP011086_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AP011087_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MZ675799_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MZ675801_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MN689123_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MN689117_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK534621_SP_P-B      agcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
MF674473_SP_P-B      tgcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
MF674464_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MF674420_SP_P-B      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
MF674389_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MF674385_SP_P-B      tgcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
LC349871_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY881957_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX765841_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MZ675802_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX276828_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148438_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148391_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148373_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KJ717841_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KJ717798_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF053191_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KJ803786_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF053190_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KJ803784_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JX429901_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707757_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707741_SP_P-B      ggcaggtcccctagaggaagaactccctcgcctcgcagacgaaggtctca
JQ027334_SP_P-B      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
HQ700548_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ924656_SP_P-B      ggcaggtcccctagaagaagaactccctcgccttgcagacgaaggtctca
GQ358147_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ358143_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ358142_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ358136_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ023636_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU660230_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU660231_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
DQ993685_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
DQ361535_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB713528_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB205122_SP_P-B      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB033554_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148457_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707754_SP_P-B      ggcaggtcccctagaagaacaactccctcgcctcgcagacgaaggtctca
KJ173341_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KJ173342_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HM011490_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
LC349872_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
LC349877_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
LC349873_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
LC349870_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
LC349868_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KJ717807_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KJ803796_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KJ717792_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KJ803787_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ027316_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HM011492_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
D00331_SP_C-B        ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB713527_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB713532_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB493835_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB493827_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB713531_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AP011085_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ924625_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ429081_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ429082_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
LC349878_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
LC349879_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
LC416037_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MF674479_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK534626_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB100695_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY881956_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY881949_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY881950_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MF674433_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY881946_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY881945_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY881948_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY881951_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY881958_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY881947_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ341580_SP_P-B      tgcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
MF674499_SP_P-B      tgcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
KP148437_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MF674414_SP_P-B      tgcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
MF674396_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY881955_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MF674434_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MF674445_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MF674448_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MF674466_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK534680_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
DQ993683_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB073835_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
DQ993681_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
DQ993684_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB493833_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX276815_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MF674476_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148420_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148416_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148415_SP_P-B      ggcaggtcccctggaagaagaactccctcgcctcgcagacgaaggtctca
KP148405_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148406_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148409_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148411_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148413_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148414_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148421_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148423_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148425_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148430_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148435_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148439_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148429_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148418_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148407_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148433_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148410_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148424_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148432_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148440_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK534659_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MN689120_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MN689121_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK534692_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK534611_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ341605_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK534694_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ924651_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ924654_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC510654_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AY800391_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AY800392_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MF674456_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707736_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707748_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707751_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707752_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707756_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707761_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ707760_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426101_SP_P-B      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
MK534708_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK534661_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK534634_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK534612_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MF674507_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MF674496_SP_P-B      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
MF674478_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MF674462_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MF674459_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MF674455_SP_P-B      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaagtctca
MF674441_SP_P-B      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
MF674437_SP_P-B      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
MF674493_SP_P-B      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
MF674436_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MF674401_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MF674397_SP_P-B      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
MF674382_SP_P-B      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
KY881952_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY881953_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY881954_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY881944_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX276816_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148426_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148419_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148427_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148401_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148399_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148394_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148387_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148398_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148377_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148374_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC774418_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MF674392_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MF674409_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ341604_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ341554_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ358150_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ358148_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ358145_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagaggaaggtctca
GQ358144_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ358141_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ358140_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ358138_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148367_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148368_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148369_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148370_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148371_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148372_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148375_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148376_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148378_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148379_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148380_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148382_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148383_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148384_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148385_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148386_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148388_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148389_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148390_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148392_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148395_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148396_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148397_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148400_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148402_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148403_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148451_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK534697_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ023634_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU330992_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EF473976_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AP011093_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AP011095_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AP011096_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MF674515_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AP011092_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AP011088_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB368295_SP_P-B      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
AB031266_SP_P-B      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
FJ023638_SP_P-B      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
MF674383_SP_P-B      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
MF674400_SP_P-B      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
MF674405_SP_P-B      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
MF674447_SP_P-B      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
MF674469_SP_P-B      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
MF674477_SP_P-B      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
MF674491_SP_P-B      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
MF674498_SP_P-B      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
MF674511_SP_P-B      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
AB031267_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB115551_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AP011089_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AP011090_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AP011091_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU330994_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU330995_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU330996_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU330997_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU330998_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU330999_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU331000_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU331001_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ358146_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ358149_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ358151_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ358152_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ924621_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HQ700549_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU234318_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MF674393_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MF674394_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MF674395_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MF674413_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MF674423_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MF674443_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MF674451_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MF674452_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MF674461_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MF674482_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MF674483_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MF674495_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MF674500_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MF674510_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MZ675796_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MZ675803_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ023632_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MG826153_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HM011466_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgccgacgaaggtctca
KJ717829_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgccgacgaaggtctca
KJ803816_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgccgacgaaggtctca
JQ040157_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KJ717836_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KJ803820_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MG571366_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EF494382_SP_P-B      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctaa
MG571337_SP_P-B      ggctggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX276814_SP_P-B      agcaggccccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX276792_SP_P-B      cgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KJ717840_SP_P-B      agcaggtcccttagaagaagaactccctcgcctcgcagacgaaggtctca
KJ803824_SP_P-B      agcaggtcccttagaagaagaactccctcgcctcgcagacgaaggtctca
KC792947_SP_P-B      cgcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KX276797_SP_P-B      cgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ377644_SP_P-B      cgcaggtcccctagaagaagaactccatcacctcgcagacgaaggtctca
MG571351_SP_P-B      ggcaggtccactaaaagaagaactccctcgcctcgcagacgaaggtctca
KJ717820_SP_P-B      cgcaggtcccctagaagacgaactccctcgcctcgcagacgaaggtctca
KJ803808_SP_P-B      cgcaggtcccctagaagacgaactccctcgcctcgcagacgaaggtctca
MN689118_SP_P-B      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctaa
MG571352_SP_P-B      agcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX276789_SP_P-B      cgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ341561_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC793199_SP_P-B      cgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HM011473_SP_P-B      ggcaggwcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK534710_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KJ717837_SP_P-B      cgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KJ803821_SP_P-B      cgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HM011478_SP_P-B      cgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX276823_SP_P-B      tgcaggkcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ032342_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX276798_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX276791_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ924617_SP_P-B      agcaggtcccttagaagaagaactccctcgcctcgcagacgaaggtctca
KC792777_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MG571339_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC792748_SP_P-B      agcaggccccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ341607_SP_P-B      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
EU522072_SP_P-B      ggcaggtccactagaagaagaactccctcgcctcgcagacgaaggactca
EU522073_SP_P-B      ggcaggtccactagaagaagaactccctcgcctcgcagacgaaggactca
EU522075_SP_P-B      ggcaggtccactagaagaagaactccctcgcctcgcagacgaaggactca
MG571323_SP_P-B      tgcaggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctca
KM875426_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgccgacgaaggtctca
KJ717797_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC793141_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC792897_SP_P-B      tgcaggacccctagaagaagaactccctcgcctcgccgacgaaggtctca
KC792843_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC792786_SP_P-B      gtcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ341596_SP_P-B      ggcaggacccctagaagaagaactccctcacctcgcagacgaaggtctca
KY881794_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX276813_SP_P-B      cgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ341587_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC792973_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC792801_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU939670_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MG571326_SP_P-B      cgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MG571329_SP_P-B      cgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MG571334_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX276801_SP_P-B      cgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX276784_SP_P-B      agcagggcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX276771_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC793180_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC792780_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ924605_SP_P-B      ggcaggtcccctagaagaagaactccctcncctcgcagrcgaaggtctca
FJ562296_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ518811_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ386600_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU939677_SP_P-B      agcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AY206383_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EF473974_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ032349_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ386675_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
DQ993700_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
DQ993701_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
DQ993702_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JN827419_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
DQ993698_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
DQ993699_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MG571327_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU332695_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AY596104_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MG571328_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MG571344_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KM213036_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB976562_SP_P-B      ggcagggcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KJ717835_SP_P-B      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
KJ803819_SP_P-B      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC792860_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EF473977_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ562246_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU939675_SP_P-B      cgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KM875420_SP_P-B      cgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK534698_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK534699_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KJ173298_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ386676_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF053171_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacaaaggtctca
KJ803764_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacaaaggtctca
MK052965_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC774419_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK534702_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MW310263_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MG571340_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JX661482_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK534709_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
DQ993707_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
DQ448622_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgacggtctca
MK534696_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgacggtctca
DQ993706_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KJ173297_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP406163_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MG571371_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK534575_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT427062_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MF674415_SP_P-B      agcaggccccctagaagaagaactccctcacctcgcagacgaaggtctca
KF053162_SP_P-B      agcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF053165_SP_P-B      agcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KJ803755_SP_P-B      agcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KJ803758_SP_P-B      agcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC792939_SP_P-B      cgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ562311_SP_P-B      cgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MG372436_SP_P-B      cgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC793139_SP_P-B      cgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ386660_SP_P-B      cgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ341569_SP_P-B      cgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JX504533_SP_P-B      cgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU939661_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AY217364_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AY206391_SP_P-B      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB287320_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KU964257_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964259_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964260_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964261_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964262_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964263_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964264_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964266_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964268_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964269_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964270_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964265_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964267_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964271_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EF473971_SP_P-B      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ377606_SP_P-B      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ801485_SP_P-B      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC793064_SP_P-B      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
EF473973_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AF461360_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ386688_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AY167098_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JX504538_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY881808_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY881795_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY881787_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY881790_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY881789_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY881783_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY881780_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY881781_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY881784_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY881786_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY881791_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY881793_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY881797_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY881798_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY881799_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY881800_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY881801_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY881782_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC793004_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC792767_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MG571372_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
LC349874_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY881792_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KM875427_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KF053163_SP_P-B      ggcaggtccactagaagaagaactccctcgcctcgcagacgaaggtctca
KJ803756_SP_P-B      ggcaggtccactagaagaagaactccctcgcctcgcagacgaaggtctca
KC792674_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JX429911_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JX026886_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JX026879_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ801516_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ341552_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ040128_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ027325_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
HM011483_SP_P-B      kgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ562224_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ386680_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU939633_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU939634_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU939559_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EF494381_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EF494380_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AY217360_SP_P-B      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
AB713530_SP_P-B      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
AB212625_SP_P-B      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
AY217359_SP_P-B      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
FJ386683_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964120_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964109_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964110_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964112_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964114_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964116_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964118_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964119_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964121_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964122_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815641_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815625_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ562254_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ562234_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815616_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815627_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815628_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815629_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815630_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815631_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815634_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815635_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815636_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815637_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815638_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815640_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815642_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815643_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815644_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815645_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964108_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964111_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964113_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964115_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX276810_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
M54923_SP_P-B        ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
KM213032_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU882004_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ562237_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC774400_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP406261_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ562303_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ562219_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JX661471_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JX978431_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ341603_SP_P-B      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
MF674432_SP_P-B      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
GU815770_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964246_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148317_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AY217368_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AY220697_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB713529_SP_P-B      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
EF473972_SP_P-B      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
KY881785_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY881850_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MG571373_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MG571355_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MF674404_SP_P-B      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
LC349869_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY881788_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY881796_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964302_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964300_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964293_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964287_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964288_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964289_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964290_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964291_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964294_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964295_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964297_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964298_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964299_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964301_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964248_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964255_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964256_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964394_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964247_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964249_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964245_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964141_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP406279_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP406275_SP_P-B      ggcaggtcccctagaagaagaacttcctcgcctcgcagacgaaggtctca
KP406263_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964292_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964296_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT622522_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP406256_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP406259_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC793030_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC774362_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC510650_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC510643_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JX869998_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JX661473_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KJ173377_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815743_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815741_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815735_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU963816_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815727_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815723_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815720_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JX661476_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP148326_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815709_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815695_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU434372_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815715_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815722_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815726_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815728_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815734_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815736_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815738_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815744_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815745_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815746_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JX504532_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC510657_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MG571322_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ377625_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ899787_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ518812_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ386658_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU939660_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU595031_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
DQ448624_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AY766463_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AY220698_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AY206375_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AF121250_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU522066_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU939672_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ899784_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ899785_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ899786_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964138_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964139_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964140_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964142_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964143_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964144_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964145_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964146_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964147_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964148_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964149_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964150_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964151_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964152_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY881825_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY881830_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB219430_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB287329_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AY596102_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
DQ448619_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ386636_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ377582_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ377610_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815679_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815680_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815681_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815683_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815684_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815685_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815686_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815687_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815688_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815689_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815691_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815692_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815693_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815694_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815696_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815697_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815698_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815699_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815700_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815701_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815702_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815703_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815704_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815705_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815706_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815707_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815708_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815710_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815711_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815721_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815730_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815731_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815732_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815737_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815740_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815742_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815755_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ040138_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ341593_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JX661474_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC510644_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC510649_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC774363_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC774399_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC774403_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KJ173422_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KJ173423_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP406262_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP406266_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP406272_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP406273_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP406318_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP406319_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP406320_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP406321_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP406322_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP406323_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP406324_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP406325_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP406326_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP406327_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP406328_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP406329_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP406330_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP406332_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP406333_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP406334_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP406335_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU963828_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU963829_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU963830_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU963831_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU963832_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU963833_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU963834_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU963835_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU963836_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU963837_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU963838_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU963839_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU963840_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU963841_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU963855_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964244_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964251_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964253_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964254_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK534627_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426100_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426104_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT645025_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MG571375_SP_P-B      tgcacgtcccctaaaacaagaactccctcgcctcgcggacgaaggtctca
AB642093_SP_P-B      gtcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB900106_SP_P-B      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ341571_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB828708_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB300371_SP_P-B      ggcaggtcctctagaagaagaactccctcgcctcgcagacgaaggtctca
AB010292_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB900096_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB302095_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB287327_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgcaggtctaa
AB073851_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB073842_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB900097_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgccgacgcaggtctca
AB073858_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB073849_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
D50521_SP_P-B        ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
D50522_SP_P-B        ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB900098_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB117759_SP_P-B      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
DQ993686_SP_P-B      ggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
AB073838_SP_P-B      ygcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctaa
LC461174_SP_P-B      grcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
LC461175_SP_P-B      grcaggtcccctagaagaagaactccctcgcctcgcagacgaargtctca
AB073855_SP_P-B      cgcaggtcccctagaagaagaactccctcgcctcgcagacgagggtctca
AB900111_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB073856_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB931168_SP_P-B      ggcaggtcccctggaagaagaactccctcgcctcgcagacgaaggtctca
AB931169_SP_P-B      ggcaggtcccctggaagaagaactccctcgcctcgcagacgaaggtctca
AB900105_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB900102_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB642101_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
D23679_SP_P-B        tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB900108_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB900107_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB900104_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB300370_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB246343_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB073857_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB073850_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB010290_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB010291_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB900112_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB900095_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB362933_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB287326_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB106884_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB073847_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB073843_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB014366_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB073844_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB073845_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
D23678_SP_P-B        ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB900103_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB073852_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB073854_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MW887648_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
LC603638_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
D00329_SP_P-B        ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB246341_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB073846_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB010289_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB073848_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB205121_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB246342_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
LC279268_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
LC279269_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
LC279270_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
LC279271_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
LC279272_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
LC279273_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MH932712_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MG571331_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ341592_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC792734_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK818225_SP_P-B      ggcaggtcccctrgaagaagaactccctcgcctcgcagacgaaggtctca
MG571358_SP_P-B      agcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964381_SP_P-B      cgcaggtcccctagaagaagaactccctcgcctagcagacgaaggtctca
KU964382_SP_P-B      cgcaggtcccctagaagaagaactccctcgcctagcagacgaaggtctca
KU964383_SP_P-B      cgcaggtcccctagaagaagaactccctcgcctagcagacgaaggtctca
KU964384_SP_P-B      cgcaggtcccctagaagaagaactccctcgcctagcagacgaaggtctca
KU964385_SP_P-B      cgcaggtcccctagaagaagaactccctcgcctagcagacgaaggtctca
KU964388_SP_P-B      cgcaggtcccctagaagaagaactccctcgcctagcagacgaaggtctca
KU964391_SP_P-B      cgcaggtcccctagaagaagaactccctcgcctagcagacgaaggtctca
KU964393_SP_P-B      cgcaggtcccctagaagaagaactccctcgcctagcagacgaaggtctca
KU964395_SP_P-B      cgcaggtcccctagaagaagaactccctcgcctagcagacgaaggtctca
KU964397_SP_P-B      cgcaggtcccctagaagaagaactccctcgcctagcagacgaaggtctca
HM011503_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964386_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964387_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964389_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964390_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964392_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964396_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JX026881_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ341572_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgccgacgaaggtctca
HM011484_SP_P-B      agcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC792955_SP_P-B      cgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK534727_SP_P-B      cgcaggtcccttagaagaagaactccctcgcctcgcagacgaaggtctca
MG571363_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MG571338_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU547563_SP_P-B      ggcaggtcccttagaagaagaactccctcgcctcgcagacgaaggtctca
DQ995804_SP_P-B      gtcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AY167102_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC492739_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ801494_SP_P-B      cgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
DQ995803_SP_P-B      ggcaggtcccttagaagaagaactccctcgcctcgcagacgaaggtctca
KJ717796_SP_P-B      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX276793_SP_P-B      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX276805_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU939671_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB073824_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426103_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MG571367_SP_P-B      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX276809_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964258_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP406258_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KJ717843_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KJ803825_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GU815572_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ924646_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ924632_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AY167101_SP_P-B      ggcaggtcccctggaagaagaactccctcgcctcgcagacgaaggtctca
AB073841_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB073832_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB073823_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC792901_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC792742_SP_P-B      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU939665_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP406304_SP_P-B      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP406305_SP_P-B      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP406312_SP_P-B      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP406314_SP_P-B      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP406302_SP_P-B      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP406298_SP_P-B      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP406288_SP_P-B      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP406296_SP_P-B      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP406299_SP_P-B      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP406300_SP_P-B      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP406301_SP_P-B      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP406303_SP_P-B      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP406311_SP_P-B      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP406297_SP_P-B      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU564826_SP_P-B      ggcaggtcccctggaagaagaactccctcgcctcgcagacgaaggtctca
MG571324_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP406292_SP_P-B      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP406306_SP_P-B      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP406307_SP_P-B      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP406308_SP_P-B      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP406309_SP_P-B      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP406310_SP_P-B      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP406313_SP_P-B      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP406315_SP_P-B      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP406316_SP_P-B      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP406317_SP_P-B      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ787477_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU564825_SP_P-B      ggcaggtcccctggaagaagaactccctcgcctcgcagacgaaggtctca
AF121251_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AY167097_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ341573_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC792667_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK534676_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB073836_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB246340_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP406257_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP406260_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP406269_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KP406271_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB302945_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB302942_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB302944_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB302943_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MG571364_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MG571341_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ801506_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU919176_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU919175_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB555498_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ386615_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ341584_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
LC349875_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ027313_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgacgatctca
KX276794_SP_P-B      gkcaggtcccctagaagaagaactccctcgcctcgcagacgacgatctca
KJ717801_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggactca
KJ717808_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggactca
KJ803797_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggactca
KF053159_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacaaaggactca
KJ803752_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacaaaggactca
KF053189_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggactca
KF053194_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggactca
KJ803781_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggactca
KJ803783_SP_P-B      tgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggactca
KJ717805_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggactca
KJ717806_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggactca
KJ803795_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggactca
JQ341595_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AY596111_SP_P-B      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
KJ410500_SP_P-B      ggcaggtcctctagaagaagaactccctcgcctcgcagacgaaggtctca
KY881837_SP_P-B      ggcaggtcccctagaagaaaaactccctcgcctcgcagacgaaggtctca
FJ023631_SP_P-B      gtcaggtcctctagaagaagaactccctcgcctcgcagacgaaggtctca
KC792800_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ027329_SP_P-B      agcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC793006_SP_P-B      ggcaggtcctctagaagaagaactccctcgcctcgcagacgaaggtctca
EU939679_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT427009_SP_P-B      ggcaggtcccctagaagaagaactccctcgccttgcagacgaaggtctca
EU305547_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JQ341600_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK534691_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426970_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MK534673_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU963946_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ386654_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU570069_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU305548_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426956_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU963949_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU963951_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU963948_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU963955_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC774380_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC774379_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JX869999_SP_P-B      ggcaggtcccctagaagaagaaccccctcgcctcgcagacgaaggtctca
GQ377641_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AY217357_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AY217358_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AY596110_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AY596112_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU570070_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU570071_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC774374_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC774388_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU963945_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU963947_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU963950_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU963952_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU963953_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU963954_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU963956_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU963957_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU963958_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU963959_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT427015_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT427003_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT427001_SP_P-B      ggcaggtcccctagaagaagaactacctcgcctcgcagacgaaggtctca
MT426976_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426974_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426973_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426965_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426951_SP_P-B      ggcaggtcccctagaagaagaactccctcggatcgcagacgaaggtctca
MT427002_SP_P-B      ggcaggtcccctagaagaagaactccctcggatcgcagacgaaggtctca
MT426942_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426940_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426939_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426988_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426936_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426909_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426911_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426912_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426917_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426959_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426960_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426995_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426906_SP_P-B      ggcaggtcccctagaagaagaactccctcggctcgcagacgaaggtctca
MT426916_SP_P-B      ggcaggtcccctagaagaagaactccctcggctcgcagacgaaggtctca
MT426931_SP_P-B      ggcaggtcccctagaagaagaactccctcggctcgcagacgaaggtctca
MT426938_SP_P-B      ggcaggtcccctagaagaagaactccctcggctcgcagacgaaggtctca
MT426947_SP_P-B      ggcaggtcccctagaagaagaactccctcggctcgcagacgaaggtctca
MT426950_SP_P-B      ggcaggtcccctagaagaagaactccctcggctcgcagacgaaggtctca
MT426967_SP_P-B      ggcaggtcccctagaagaagaactccctcggctcgcagacgaaggtctca
MT426981_SP_P-B      ggcaggtcccctagaagaagaactccctcggctcgcagacgaaggtctca
MT426996_SP_P-B      ggcaggtcccctagaagaagaactccctcggctcgcagacgaaggtctca
MT427010_SP_P-B      ggcaggtcccctagaagaagaactccctcggctcgcagacgaaggtctca
MT427011_SP_P-B      ggcaggtcccctagaagaagaactccctcggctcgcagacgaaggtctca
MT426907_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426908_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426910_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426913_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426914_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426915_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426918_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426919_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426920_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426921_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426922_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426923_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426924_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426925_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426926_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426927_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426928_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426929_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426930_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426932_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426933_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426934_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426937_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426941_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426943_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426944_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426945_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426946_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426948_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426949_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426952_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426953_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426954_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426955_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426957_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426958_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426961_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426962_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426963_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426964_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426966_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426968_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426969_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426971_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426972_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426975_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426977_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426978_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426979_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426980_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426982_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426983_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426984_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426985_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426986_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426987_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426989_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426990_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426991_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426992_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426993_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426994_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426997_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426998_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426999_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT427000_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT427004_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT427005_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT427006_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT427007_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT427008_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT427012_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT427013_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT427014_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MT426935_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC793069_SP_P-B      cgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX276812_SP_P-B      rtcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU939636_SP_P-B      agcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY881822_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
AB073839_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KJ410502_SP_P-B      agcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY881838_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY881843_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY881841_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY881834_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY881831_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY881827_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY881828_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY881824_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ377622_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgacggtctca
KY881823_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY881829_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY881836_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY881839_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KY881842_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964079_SP_P-B      ggcaggccccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964081_SP_P-B      ggcaggccccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964083_SP_P-B      ggcaggccccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964084_SP_P-B      ggcaggccccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964085_SP_P-B      ggcaggccccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964086_SP_P-B      ggcaggccccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964087_SP_P-B      ggcaggccccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964088_SP_P-B      ggcaggccccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964089_SP_P-B      ggcaggccccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964090_SP_P-B      ggcaggccccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964091_SP_P-B      ggcaggccccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964092_SP_P-B      ggcaggccccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964080_SP_P-B      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU964082_SP_P-B      ggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
KX276781_SP_P-B      ggcaggtcctctagaagaagaactccctcgcctcgcagacgaaggtctca
EU564822_SP_P-B      cgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU564823_SP_P-B      cgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU564824_SP_P-B      cgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC792935_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
KC792938_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
MG571370_SP_P-B      ggcaggtcccctagaaaaagaactccctcgcctcgcagacgaaggtctca
KY881851_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC792920_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
JX507213_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ787476_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ562240_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ924630_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
AB642094_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC510655_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC792970_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU963799_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU963800_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU963801_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU963802_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU963803_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU963804_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU963805_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU963806_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU963807_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU963808_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU963809_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU963810_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU963811_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU963812_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU963813_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC774410_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC774397_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KC774372_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU963842_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU963843_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU963844_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU963845_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU963846_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU963847_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU963848_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU963849_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU963850_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU963851_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU963852_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
KU963853_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
FJ386610_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
EU939639_SP_P-B      ggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
GQ377542_SP_P-B      ggcaggtcccctag