HBVdb

Dataset for nucleotide sequence Genomes of genotype G

[Download (right click)] [Edit] [Sequences] [Repertoires]

40 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


EF464097_FT00000_P-G      ctccacccagttccaccaagctctacaaaatcccaaagtcaggggcctgt
EF464098_FT00000_P-G      ctccacccagttccaccaagctctacaaaatcccaaagtcaggggcctgt
JQ707677_FT00000_P-G      ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgt
JQ707678_FT00000_P-G      ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgt
JQ707679_FT00000_P-G      ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgt
JQ707671_FT00000_P-G      ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgt
JQ707680_FT00000_P-G      ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgt
JQ707673_FT00000_P-G      ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgt
JQ707666_FT00000_P-G      ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgt
JQ707660_FT00000_P-G      ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgt
JQ707657_FT00000_P-G      ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgt
JQ707668_FT00000_P-G      ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgt
AB056515_FT00000_P-G      ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgt
KF414679_FT00000_P-G      ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgt
KR230749_FT00000_P-G      ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgt
KM998716_FT00000_P-G      ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgt
AB064313_FT00000_C-G      ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgt
AB064311_FT00000_P-G      ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgt
EF634480_FT00000_P-G      ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgt
AB064312_FT00000_P-G      ctctacagcattccaccaagctctacaaaatcccacagtcaggggcctgt
HE981174_FT00000_P-G      ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgt
KY004111_FT00000_P-G      ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgt
HE981175_FT00000_P-G      ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgt
HE981176_FT00000_P-G      ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgt
GU563556_FT00000_P-G      ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgt
AB375165_FT00000_P-G      ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgt
AB064310_FT00000_P-G      ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgt
AB056513_FT00000_P-G      ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgt
AB375166_FT00000_P-G      ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgt
AB375167_FT00000_P-G      ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgt
AB375169_FT00000_P-G      ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgt
AB375170_FT00000_P-G      ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgt
AB375168_FT00000_P-G      ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgt
KJ194508_FT00000_P-G      ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgt
KF767450_FT00000_P-G      ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgt
AF405706_FT00000_P-G      ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgt
AF160501_FT00000_C-G      ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgt
KX264500_FT00000_P-G      ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgt
FJ023674_FT00000_P-G      ctccacaaccttccaccaagctcttcargatcccagagtcaggggcctgt
FR714503_FT00000_P-G      ctccaccaccttccaccaagctctacaagatcccagaatcaggggcctgt
                          *** **    ************** **  ****** * ************

EF464097_FT00000_P-G      attttcctgctggtggctccagttcagagacacagaaccctgttccgact
EF464098_FT00000_P-G      attttcctgctggtggctccagttcagagacagcagaacctgctccgact
JQ707677_FT00000_P-G      atcttcctgctggtggctccagttcagggatagtgaaccctgttccgact
JQ707678_FT00000_P-G      atcttcctgctggtggctccagttcagggatagtgaaccctgttccgact
JQ707679_FT00000_P-G      atcttcctgctggtggctccagttcagggatagtgaaccctgttccgact
JQ707671_FT00000_P-G      atcttcctgctggtggctccagttcagggatagtgaaccctgttccgact
JQ707680_FT00000_P-G      atcttcctgctggtggctccagttcagggatagtgaaccctgttccgact
JQ707673_FT00000_P-G      atcttcctgctggtggctccagttcagggatagtgaaccctgttccgact
JQ707666_FT00000_P-G      atcttcctgctggtggctccagttcagggatagtgaaccctgttccgact
JQ707660_FT00000_P-G      atcttcctgctggtggctccagttcagggatagtgaaccctgttccgact
JQ707657_FT00000_P-G      atcttcctgctggtggctccagttcagggatagtgaaccctgttccgact
JQ707668_FT00000_P-G      atcttcctgctggtggctccagttcagggatagtgaaccctgttccgact
AB056515_FT00000_P-G      attttcctgctggtggctccagttcagggatagtgaaccctgttccgact
KF414679_FT00000_P-G      atcttcctgctggtggctccagttcagggatagtgaaccctgttccgact
KR230749_FT00000_P-G      attttcctgctggtggctccagttcagggatagtgaaccctgttccgact
KM998716_FT00000_P-G      atcttcctgctggtggctccagttcagggatagtgaaccctgttccgact
AB064313_FT00000_C-G      attttcctgctggtggctccagttcagggatagtgaaccctgttccgact
AB064311_FT00000_P-G      attttcctgctggtggctccagttcagggatagtgaaccctgttccgact
EF634480_FT00000_P-G      attttcctgctggtggctccagttcagggatagtgaaccctgttccgact
AB064312_FT00000_P-G      atcttcctgctggtggctccagttcagggatagtgaaccctgttccgact
HE981174_FT00000_P-G      atcttcctgctggtggctccagttcagggatagtgaaccctgttccgact
KY004111_FT00000_P-G      attttcctgctggtggctccagttcagggatagtgaaccctgttccgact
HE981175_FT00000_P-G      attttcctgctggtggctccagttcagggatagtgaaccctgttccgact
HE981176_FT00000_P-G      attttcctgctggtggctccagttcagggatagtgaaccctgttccgact
GU563556_FT00000_P-G      attttcctgctggtggctccagttcagggatagtgaaccctgttccgact
AB375165_FT00000_P-G      attttcctgctggtggctccagttcagggatagtgaaccctgttccgact
AB064310_FT00000_P-G      attttcctgctggtggctccagttcagggatagtgaaccctgttccgact
AB056513_FT00000_P-G      attttcctgctggtggctccagttcagggatagtgaaccctgttccgact
AB375166_FT00000_P-G      attttcctgctggtggctccagttcagggatagtgaaccctgttccgact
AB375167_FT00000_P-G      attttcctgctggtggctccagttcagggatagtgaaccctgttccgact
AB375169_FT00000_P-G      attttcctgctggtggctccagttcagggatagtgaaccctgttccgact
AB375170_FT00000_P-G      attttcctgctggtggctccagttcagggatagtgaaccctgttccgact
AB375168_FT00000_P-G      attttcctgctggtggctccagttcagggatagtgaaccctgttccgact
KJ194508_FT00000_P-G      attttcctgctggtggctccagttcagggatagtgaaccctgttccgact
KF767450_FT00000_P-G      attttcctgctggtggctccagttcagggatagtgaaccctgttccgact
AF405706_FT00000_P-G      attttcctgctggtggctccagttcagggatagtgaaccctgttccgact
AF160501_FT00000_C-G      attttcctgctggtggctccagttcagggatagtgaaccctgttccgact
KX264500_FT00000_P-G      attttcctgctggtggctccagttcagggatagtgaaccctgttccgact
FJ023674_FT00000_P-G      attttcctgctggtggctccagttcaggaacagtaaaccctgttccgaat
FR714503_FT00000_P-G      atcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaat
                          ** ************************  * *    * **** ***** *

EF464097_FT00000_P-G      attgcctctctcacatcatcaatcttctcgaagactgggggccctgcacc
EF464098_FT00000_P-G      attgcctctctcacatcatcaatcttctcgaagactgggggccctgcacc
JQ707677_FT00000_P-G      attgcctctcacatctcgtcaatcttctccaggattggggaccctgcacc
JQ707678_FT00000_P-G      attgcctctcacatctcgtcaatcttctccaggattggggaccctgcacc
JQ707679_FT00000_P-G      attgcctctcacatctcgtcaatcttctccaggattggggaccctgcacc
JQ707671_FT00000_P-G      attgcctctcacatctcgtcaatcttctccaggattggggaccctgcacc
JQ707680_FT00000_P-G      attgcctctcacatctcgtcaatcttctccaggattggggaccctgcacc
JQ707673_FT00000_P-G      attgcctctcacatctcgtcaatcttctccaggattggggaccctgcacc
JQ707666_FT00000_P-G      attgcctctcacatctcgtcaatcttctccaggattggggaccctgcacc
JQ707660_FT00000_P-G      attgcctctcacatctcgtcaatcttctccaggattggggaccctgcacc
JQ707657_FT00000_P-G      attgcctctcacatctcgtcaatcttctccaggattggggaccctgcacc
JQ707668_FT00000_P-G      attgcctctcacatctcgtcaatcttctccaggattggggaccctgcacc
AB056515_FT00000_P-G      attgcctctcacatctcgtcaatcttctccaagattggggaccctgcacc
KF414679_FT00000_P-G      attgcctctcacatctcgtcaatcttctccaggattggggaccctgcacc
KR230749_FT00000_P-G      attgcctctcacatctcgtcaatcttctccaggattggggaccctgcacc
KM998716_FT00000_P-G      attgcctctcacatctcgtcaatcttctccaggattggggaccctgcacc
AB064313_FT00000_C-G      attgcctctcacatctcgtcaatcttctccaggattggggaccctgcacc
AB064311_FT00000_P-G      attgcctctcacatctcgtcaatcttctccaggattggggaccctgcacc
EF634480_FT00000_P-G      attgcctctcacatctcgtcaatcttctccaggattggggaccctgcacc
AB064312_FT00000_P-G      attgcctctcacatctcgtcaatcttctccaggattggggaccctgcacc
HE981174_FT00000_P-G      attgcctctcacatctcgtcaatcttctccaggattggggaccctgcacc
KY004111_FT00000_P-G      attgcctctcacatctcgtcaatcttctccaggattggggaccctgcacc
HE981175_FT00000_P-G      attgcctctcacatctcgtcaatcttctccaggattggggaccctgcacc
HE981176_FT00000_P-G      attgcctctcacatctcgtcaatcttctccaggattggggaccctgcacc
GU563556_FT00000_P-G      attgcctctcacatctcgtcaatcttctccaggattggggaccctgcacc
AB375165_FT00000_P-G      attgcctctcacatctcgtcaatcttctccaggattggggaccctgcacc
AB064310_FT00000_P-G      attgcctctcacatctcgtcaatcttctccaggattggggaccctgcacc
AB056513_FT00000_P-G      attgcctctcacatctcgtcaatcttctccaggattggggaccctgcacc
AB375166_FT00000_P-G      attgcctctcacatctcgtcaatcttctccaggattggggaccctgcacc
AB375167_FT00000_P-G      attgcctctcacatctcgtcaatcttctccaggattggggaccctgcacc
AB375169_FT00000_P-G      attgcctctcacatctcgtcaatcttctccaggattggggaccctgcacc
AB375170_FT00000_P-G      attgcctctcacatctcgtcaatcttctccaggattggggaccctgcacc
AB375168_FT00000_P-G      attgcctctcacatctcgtcaatcttctccaggattggggaccctgcacc
KJ194508_FT00000_P-G      attgcctctcacatctcgtcaatcttctccaggattggggaccctgcacc
KF767450_FT00000_P-G      attgcctctcacatctcgtcaatcttctccaggattggggaccctgcacc
AF405706_FT00000_P-G      attgcctctcacatctcgtcaatcttctccaggattggggaccctgcacc
AF160501_FT00000_C-G      attgcctctcacatctcgtcaatcttctccaggattggggaccctgcacc
KX264500_FT00000_P-G      attgcctctcacatctcgtcaatcttctccaggattggggaccctgcacc
FJ023674_FT00000_P-G      attgcctctcacatctcatcaatcttcgcaaggactggggaccttgcacc
FR714503_FT00000_P-G      attgcctctcacatctcatcaatcttcacgaggattggggaccctgcaac
                          ********** **  ** ********* * * ** ***** ** **** *

EF464097_FT00000_P-G      gaacatggagaacatcacatcaggactcctaggacccctgctcgtgttac
EF464098_FT00000_P-G      gaacatggagaacatcacatcaggactcctaggacccctgctcgtgttac
JQ707677_FT00000_P-G      gaacatggagaacatcacatcaggattcctaggacccctgctcgtgttac
JQ707678_FT00000_P-G      gaacatggagaacatcacatcaggattcctaggacccctgctcgtgttac
JQ707679_FT00000_P-G      gaacatggagaacatcacatcaggattcctaggacccctgctcgtgttac
JQ707671_FT00000_P-G      gaacatggagaacatcacatcaggattcctaggacccctgctcgtgttac
JQ707680_FT00000_P-G      gaacatggagaacatcacatcaggattcctaggacccctgctcgtgttac
JQ707673_FT00000_P-G      gaacatggagaacatcacatcaggattcctaggacccctgctcgtgttac
JQ707666_FT00000_P-G      gaacatggagaacatcacatcaggattcctaggacccctgctcgtgttac
JQ707660_FT00000_P-G      gaacatggagaacatcacatcaggattcctaggacccctgctcgtgttac
JQ707657_FT00000_P-G      gaacatggagaacatcacatcaggattcctaggacccctgctcgtgttac
JQ707668_FT00000_P-G      gaacatggagaacatcacatcaggattcctaggacccctgctcgtgttac
AB056515_FT00000_P-G      gaacatggagaacatcacatcaggattcctaggacccctgctcgtgttac
KF414679_FT00000_P-G      gaacatggagaacatcacatcaggattcctaggacccctgctcgtgttac
KR230749_FT00000_P-G      gaacatggagaacatcacatcaggattcctaggacccctgctcgtgttac
KM998716_FT00000_P-G      gaacatggagaacatcacatcaggattcctaggacccctgctcgtgttac
AB064313_FT00000_C-G      gaacatggagaacatcacatcaggattcctaggacccctgctcgtgttac
AB064311_FT00000_P-G      gaacatggagaacatcacatcaggattcctaggacccctgctcgtgttac
EF634480_FT00000_P-G      gaacatggagaacatcacatcaggattcctaggacccctgctcgtgttac
AB064312_FT00000_P-G      gaacatggagaacatcacatcaggattcctaggacccctgctcgtgttac
HE981174_FT00000_P-G      gaacatggagaacatcacatcaggattcctaggacccctgctcgtgttac
KY004111_FT00000_P-G      gaacatggagaacatcacatcaggattcctaggacccctgctcgtgttac
HE981175_FT00000_P-G      gaacatggagaacatcacatcaggattcctaggacccctgctcgtgttac
HE981176_FT00000_P-G      gaacatggagaacatcacatcaggattcctaggacccctgctcgtgttac
GU563556_FT00000_P-G      gaacatggagaacatcacatcaggattcctaggacccctgctcgtgttac
AB375165_FT00000_P-G      gaacatggagaacatcacatcaggattcctaggacccctgctcgtgttac
AB064310_FT00000_P-G      gaatatggagaacatcacatcaggattcctaggacccctgctcgtgttac
AB056513_FT00000_P-G      gaacatggagaatatcacatcaggattcctaggacccctgctcgtgttac
AB375166_FT00000_P-G      gaacatggagaacatcacatcaggattcctaggacccctgctcgtgttac
AB375167_FT00000_P-G      gaacatggagaacatcacatcaggattcctaggacccctgctcgtgttac
AB375169_FT00000_P-G      gaacatggagaacatcacatcaggattcctaggacccctgctcgtgttac
AB375170_FT00000_P-G      gaacatggagaacatcacatcaggattcctaggacccctgctcgtgttac
AB375168_FT00000_P-G      gaacatggagaacatcacatcaggattcctaggacccctgctcgtgttac
KJ194508_FT00000_P-G      gaacatggagaacatcacatcaggattcctaggacccctgctcgtgttac
KF767450_FT00000_P-G      gaacatggagaacatcacatcaggattcctaggacccctgctcgtgttac
AF405706_FT00000_P-G      gaacatggagaacatcacatcaggattcctaggacccctgctcgtgttac
AF160501_FT00000_C-G      gaacatggagaacatcacatcaggattcctaggacccctgctcgtgttac
KX264500_FT00000_P-G      gaacatggagaacatcacatcaggattcctaggacccctgctcgtgttac
FJ023674_FT00000_P-G      gaacatggagaacatcacatcaggattcctcggacccctgctcgtgttac
FR714503_FT00000_P-G      gaacatggagaacatcacatcaggattcctcggacccctgctcgtgttac
                          *** ******** ************ **** *******************

EF464097_FT00000_P-G      aggcggggtttttcttgttgacaagaatcctcacaataccgcagagtcta
EF464098_FT00000_P-G      aggcggtgtgtttcttgttgacaagaatcctcacaataccgcagagtcta
JQ707677_FT00000_P-G      aggcggggtttttcttgttgacaagaatcctcacaataccgcagagtcta
JQ707678_FT00000_P-G      aggcggggtttttcttgttgacaagaatcctcacaataccgcagagtcta
JQ707679_FT00000_P-G      aggcggggtttttcttgttgacaagaatcctcacaataccgcagagtcta
JQ707671_FT00000_P-G      aggcggggtttttcttgttgacaagaatcctcacaataccgcagagtcta
JQ707680_FT00000_P-G      aggcggggtttttcttgttgacaagaatcctcacaataccgcagagtcta
JQ707673_FT00000_P-G      aggcggggtttttcttgttgacaagaatcctcacaataccgcagagtcta
JQ707666_FT00000_P-G      aggcggggtttttcttgttgacaagaatcctcacaataccgcagagtcta
JQ707660_FT00000_P-G      aggcggggtttttcttgttgacaagaatcctcacaataccacagagtcta
JQ707657_FT00000_P-G      aggcggggtttttcttgttgacaagaatcctcacaataccgcagagtcta
JQ707668_FT00000_P-G      aggcggggtttttcttgttgacaagaatcctcacaataccgcagagtcta
AB056515_FT00000_P-G      aggcggggtttttcttgttgacaagaatcctcacaataccgcagagtcta
KF414679_FT00000_P-G      aggcggggtttttcttgttgacaagaatcctcacaataccgcagagtcta
KR230749_FT00000_P-G      aggcgggggttttcttgttgacaagaatcctcacaataccgcagagtcta
KM998716_FT00000_P-G      aggcggggtttttcttgttgacaagaatcctcacaataccgcagagtcta
AB064313_FT00000_C-G      aggcggggtttttcttgttgacaagaatcctcacaataccgcagagtcta
AB064311_FT00000_P-G      aggcggggtttttcttgttgacaagaatcctcacaataccgcagagtcta
EF634480_FT00000_P-G      aggcggggtttttcttgttgacaagaatcctcacaataccgcagagtcta
AB064312_FT00000_P-G      aggcggggtttttcttgttgacaagaatcctcacaataccgcagagtcta
HE981174_FT00000_P-G      aggcggggtttttcttgttgacaagaatcctcacaataccgcagagtcta
KY004111_FT00000_P-G      aggcggggtttttcttgttgacaagaatcctcacaataccgcagagtcta
HE981175_FT00000_P-G      aggcggggtttttcttgttgacaagaatcctcacaataccgcagagtcta
HE981176_FT00000_P-G      aggcggggtttttcttgttgacaagaatcctcacaataccgcagagtcta
GU563556_FT00000_P-G      aggcggggtttttcttgttgacaagaatcctcacaataccgcagagtcta
AB375165_FT00000_P-G      aggcggggtttttcttgttgacaagaatcctcacaataccgcagagtcta
AB064310_FT00000_P-G      aggcggggtttttcttgttgacaagaatcctcacaataccgcagagtcta
AB056513_FT00000_P-G      aggcggggtttttcttgttgacaagaatcctcacaataccgcagagtcta
AB375166_FT00000_P-G      aggcggggtttttcttgttgacaagaatcctcacaataccgcagagtcta
AB375167_FT00000_P-G      aggcggggtttttcttgttgacaagaatcctcacaataccgcagagtcta
AB375169_FT00000_P-G      aggcggggtttttcttgttgacaagaatcctcacaataccgcagagtcta
AB375170_FT00000_P-G      aggcggggtttttcttgttgacaagaatcctcacaataccgcagagtcta
AB375168_FT00000_P-G      aggcggggtttttcttgttgacaagaatcctcacaataccgcagagtcta
KJ194508_FT00000_P-G      aggcggggtttttcttgttgacaagaatcctcacaataccgcagagtcta
KF767450_FT00000_P-G      aggcggggtttttcttgttgacaagaatcctcacaataccgcagagtcta
AF405706_FT00000_P-G      aggcggggtttttcttgttgacaagaatcctcacaataccacagagtcta
AF160501_FT00000_C-G      aggcggggtttttcttgttgacaagaatcctcacaataccgcagagtcta
KX264500_FT00000_P-G      aggcggggtttttcttgttgacaagaatcctcacaataccgcagagtcta
FJ023674_FT00000_P-G      aggcgggatttttcttgttgacaaaaatcctcacaataccgcagagtcta
FR714503_FT00000_P-G      aggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtcta
                          ******    ************** *************** *********

EF464097_FT00000_P-G      gactcgtggtggacttctctcaattttctaggggaagtgcccgtgtgtcc
EF464098_FT00000_P-G      gactcgtggtggacttctctcaattttctaggggaagtgcccgtgtgtcc
JQ707677_FT00000_P-G      gactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcc
JQ707678_FT00000_P-G      gactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcc
JQ707679_FT00000_P-G      gactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcc
JQ707671_FT00000_P-G      gactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcc
JQ707680_FT00000_P-G      gactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcc
JQ707673_FT00000_P-G      gactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcc
JQ707666_FT00000_P-G      gactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcc
JQ707660_FT00000_P-G      gactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcc
JQ707657_FT00000_P-G      gactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcc
JQ707668_FT00000_P-G      gactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcc
AB056515_FT00000_P-G      gactcgtggtggacttctctcaattttctagggggagcgcccgtgtgtcc
KF414679_FT00000_P-G      gactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcc
KR230749_FT00000_P-G      gactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcc
KM998716_FT00000_P-G      gactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcc
AB064313_FT00000_C-G      gactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcc
AB064311_FT00000_P-G      gactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcc
EF634480_FT00000_P-G      gactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcc
AB064312_FT00000_P-G      gactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcc
HE981174_FT00000_P-G      gactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcc
KY004111_FT00000_P-G      gactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcc
HE981175_FT00000_P-G      gactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcc
HE981176_FT00000_P-G      gactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcc
GU563556_FT00000_P-G      gactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcc
AB375165_FT00000_P-G      gactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcc
AB064310_FT00000_P-G      gactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcc
AB056513_FT00000_P-G      gactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcc
AB375166_FT00000_P-G      gactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcc
AB375167_FT00000_P-G      gactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcc
AB375169_FT00000_P-G      gactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcc
AB375170_FT00000_P-G      gactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcc
AB375168_FT00000_P-G      gactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcc
KJ194508_FT00000_P-G      gactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcc
KF767450_FT00000_P-G      gactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcc
AF405706_FT00000_P-G      gactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcc
AF160501_FT00000_C-G      gactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcc
KX264500_FT00000_P-G      gactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcc
FJ023674_FT00000_P-G      gactcgtggtggacttctctcaattttctagggggaacaaccgtgtgtct
FR714503_FT00000_P-G      gactcgtggtggacttctctcaattttctagggggagcacccgtgtgtct
                          ********************************** *    ********* 

EF464097_FT00000_P-G      tggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtc
EF464098_FT00000_P-G      tggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtc
JQ707677_FT00000_P-G      tggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtc
JQ707678_FT00000_P-G      tggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtc
JQ707679_FT00000_P-G      tggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtc
JQ707671_FT00000_P-G      tggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtc
JQ707680_FT00000_P-G      tggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtc
JQ707673_FT00000_P-G      tggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtc
JQ707666_FT00000_P-G      tggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtc
JQ707660_FT00000_P-G      tggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtc
JQ707657_FT00000_P-G      tggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtc
JQ707668_FT00000_P-G      tggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtc
AB056515_FT00000_P-G      tggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtc
KF414679_FT00000_P-G      tggcctaaattcgcagtccccaacctccaatcactcactaatctcctgtc
KR230749_FT00000_P-G      tggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtc
KM998716_FT00000_P-G      tggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtc
AB064313_FT00000_C-G      tggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtc
AB064311_FT00000_P-G      tggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtc
EF634480_FT00000_P-G      tggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtc
AB064312_FT00000_P-G      tggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtc
HE981174_FT00000_P-G      tggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtc
KY004111_FT00000_P-G      tggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtc
HE981175_FT00000_P-G      tggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtc
HE981176_FT00000_P-G      tggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtc
GU563556_FT00000_P-G      tggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtc
AB375165_FT00000_P-G      tggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtc
AB064310_FT00000_P-G      tggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtc
AB056513_FT00000_P-G      tggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtc
AB375166_FT00000_P-G      tggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtc
AB375167_FT00000_P-G      tggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtc
AB375169_FT00000_P-G      tggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtc
AB375170_FT00000_P-G      tggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtc
AB375168_FT00000_P-G      tggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtc
KJ194508_FT00000_P-G      tggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtc
KF767450_FT00000_P-G      tggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtc
AF405706_FT00000_P-G      tggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtc
AF160501_FT00000_C-G      tggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtc
KX264500_FT00000_P-G      tggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtc
FJ023674_FT00000_P-G      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtc
FR714503_FT00000_P-G      tggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtc
                          ***** ******************************** ** ********

EF464097_FT00000_P-G      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
EF464098_FT00000_P-G      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
JQ707677_FT00000_P-G      ctccaacttgtcctggatatcgctggatgtgtctgcggcgttttatcata
JQ707678_FT00000_P-G      ctccaacttgtcctggctatcgctggatgtgtttgcggcgttttatcata
JQ707679_FT00000_P-G      ctccaacttgtcctggctatcgctggatgtgtttgcggcgttttatcata
JQ707671_FT00000_P-G      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
JQ707680_FT00000_P-G      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
JQ707673_FT00000_P-G      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
JQ707666_FT00000_P-G      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
JQ707660_FT00000_P-G      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
JQ707657_FT00000_P-G      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
JQ707668_FT00000_P-G      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
AB056515_FT00000_P-G      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
KF414679_FT00000_P-G      ctccaacttgtcctggctatcgctggatgtggctgcggcgttttatcata
KR230749_FT00000_P-G      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
KM998716_FT00000_P-G      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
AB064313_FT00000_C-G      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
AB064311_FT00000_P-G      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
EF634480_FT00000_P-G      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
AB064312_FT00000_P-G      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
HE981174_FT00000_P-G      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
KY004111_FT00000_P-G      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
HE981175_FT00000_P-G      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
HE981176_FT00000_P-G      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
GU563556_FT00000_P-G      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
AB375165_FT00000_P-G      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
AB064310_FT00000_P-G      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
AB056513_FT00000_P-G      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
AB375166_FT00000_P-G      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
AB375167_FT00000_P-G      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
AB375169_FT00000_P-G      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
AB375170_FT00000_P-G      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
AB375168_FT00000_P-G      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
KJ194508_FT00000_P-G      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
KF767450_FT00000_P-G      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
AF405706_FT00000_P-G      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
AF160501_FT00000_C-G      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
KX264500_FT00000_P-G      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
FJ023674_FT00000_P-G      ctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
FR714503_FT00000_P-G      ctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
                          ****** ********* **************  **************** 

EF464097_FT00000_P-G      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
EF464098_FT00000_P-G      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
JQ707677_FT00000_P-G      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
JQ707678_FT00000_P-G      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
JQ707679_FT00000_P-G      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
JQ707671_FT00000_P-G      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
JQ707680_FT00000_P-G      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
JQ707673_FT00000_P-G      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
JQ707666_FT00000_P-G      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
JQ707660_FT00000_P-G      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
JQ707657_FT00000_P-G      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
JQ707668_FT00000_P-G      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AB056515_FT00000_P-G      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KF414679_FT00000_P-G      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KR230749_FT00000_P-G      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KM998716_FT00000_P-G      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AB064313_FT00000_C-G      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AB064311_FT00000_P-G      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
EF634480_FT00000_P-G      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AB064312_FT00000_P-G      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
HE981174_FT00000_P-G      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KY004111_FT00000_P-G      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
HE981175_FT00000_P-G      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
HE981176_FT00000_P-G      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
GU563556_FT00000_P-G      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AB375165_FT00000_P-G      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AB064310_FT00000_P-G      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AB056513_FT00000_P-G      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AB375166_FT00000_P-G      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AB375167_FT00000_P-G      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AB375169_FT00000_P-G      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AB375170_FT00000_P-G      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AB375168_FT00000_P-G      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KJ194508_FT00000_P-G      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KF767450_FT00000_P-G      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AF405706_FT00000_P-G      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
AF160501_FT00000_C-G      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
KX264500_FT00000_P-G      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
FJ023674_FT00000_P-G      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
FR714503_FT00000_P-G      ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgga
                          **************************************************

EF464097_FT00000_P-G      ctatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgacca
EF464098_FT00000_P-G      ctatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgacca
JQ707677_FT00000_P-G      ctatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgacca
JQ707678_FT00000_P-G      ctatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgacca
JQ707679_FT00000_P-G      ctatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgacca
JQ707671_FT00000_P-G      ctatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgacca
JQ707680_FT00000_P-G      ctatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgacca
JQ707673_FT00000_P-G      ctatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgacca
JQ707666_FT00000_P-G      ctatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgacca
JQ707660_FT00000_P-G      ctatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgacca
JQ707657_FT00000_P-G      ctatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgacca
JQ707668_FT00000_P-G      ctatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgacca
AB056515_FT00000_P-G      ctatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgacca
KF414679_FT00000_P-G      ctatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgacca
KR230749_FT00000_P-G      ctatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgacca
KM998716_FT00000_P-G      ctatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgacca
AB064313_FT00000_C-G      ctatcaaggtatgttgcccgtttgtcccctgattccaggatcctcgacca
AB064311_FT00000_P-G      ctatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgacca
EF634480_FT00000_P-G      ctatcaaggtatgttgcccgtttgtcctctgattccaggatcctccacca
AB064312_FT00000_P-G      ctatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgacca
HE981174_FT00000_P-G      ctatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgacca
KY004111_FT00000_P-G      ctatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgacca
HE981175_FT00000_P-G      ctatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgacca
HE981176_FT00000_P-G      ctatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgacca
GU563556_FT00000_P-G      ctatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgacca
AB375165_FT00000_P-G      ctatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgacca
AB064310_FT00000_P-G      ctatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgacca
AB056513_FT00000_P-G      ctatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgacca
AB375166_FT00000_P-G      ctatcaaggtatgttgcccgtttgtcctctgatttcaggatcctcgacca
AB375167_FT00000_P-G      ctatcaaggtatgttgcccgtttgtcctctgatttcaggatcctcgacca
AB375169_FT00000_P-G      ctatcaaggtatgttgcccgtttgtcctctgatttcaggatcctcgacca
AB375170_FT00000_P-G      ctatcaaggtatgttgcccgtttgtcctctgatttcaggatcctcgacca
AB375168_FT00000_P-G      ctatcaaggtatgttgcccgtttgtcctctgatttcaggatcctcgacca
KJ194508_FT00000_P-G      ctatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgacca
KF767450_FT00000_P-G      ctatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgacca
AF405706_FT00000_P-G      ctatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgacca
AF160501_FT00000_C-G      ctatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgacca
KX264500_FT00000_P-G      ctatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgacca
FJ023674_FT00000_P-G      ttatcarggtatgttgcccgtttgtcctctaattccaggatcctcgacca
FR714503_FT00000_P-G      ttatcaaggtatgttgcccgtttgtcctctaattccaggatcctcgacca
                           ***** ******************** ** *** ********** ****

EF464097_FT00000_P-G      ccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactct
EF464098_FT00000_P-G      ccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactct
JQ707677_FT00000_P-G      ccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactct
JQ707678_FT00000_P-G      ccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactct
JQ707679_FT00000_P-G      ccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactct
JQ707671_FT00000_P-G      ccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactct
JQ707680_FT00000_P-G      ccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactct
JQ707673_FT00000_P-G      ccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactct
JQ707666_FT00000_P-G      ccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactct
JQ707660_FT00000_P-G      ccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactct
JQ707657_FT00000_P-G      ccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactct
JQ707668_FT00000_P-G      ccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactct
AB056515_FT00000_P-G      ccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactct
KF414679_FT00000_P-G      ccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactct
KR230749_FT00000_P-G      ccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactct
KM998716_FT00000_P-G      ccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactct
AB064313_FT00000_C-G      ccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactct
AB064311_FT00000_P-G      ccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactct
EF634480_FT00000_P-G      ccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactct
AB064312_FT00000_P-G      ccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactct
HE981174_FT00000_P-G      ccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactct
KY004111_FT00000_P-G      ccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactct
HE981175_FT00000_P-G      ccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactct
HE981176_FT00000_P-G      ccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactct
GU563556_FT00000_P-G      ccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactct
AB375165_FT00000_P-G      ccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactct
AB064310_FT00000_P-G      ccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactct
AB056513_FT00000_P-G      ccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactct
AB375166_FT00000_P-G      ccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactct
AB375167_FT00000_P-G      ccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactct
AB375169_FT00000_P-G      ccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactct
AB375170_FT00000_P-G      ccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactct
AB375168_FT00000_P-G      ccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactct
KJ194508_FT00000_P-G      ccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactct
KF767450_FT00000_P-G      ccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactct
AF405706_FT00000_P-G      ccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactct
AF160501_FT00000_C-G      ccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactct
KX264500_FT00000_P-G      ccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactct
FJ023674_FT00000_P-G      ccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactct
FR714503_FT00000_P-G      ccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactct
                          **** ******** **** *******************************

EF464097_FT00000_P-G      atgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctg
EF464098_FT00000_P-G      atgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctg
JQ707677_FT00000_P-G      atgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctg
JQ707678_FT00000_P-G      atgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctg
JQ707679_FT00000_P-G      atgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctg
JQ707671_FT00000_P-G      atgtatccctcatgttgctgtacaaaactttcggacggaaattgcacctg
JQ707680_FT00000_P-G      atgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctg
JQ707673_FT00000_P-G      atgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctg
JQ707666_FT00000_P-G      atgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctg
JQ707660_FT00000_P-G      atgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctg
JQ707657_FT00000_P-G      atgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctg
JQ707668_FT00000_P-G      atgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctg
AB056515_FT00000_P-G      atgtatccctcatgttgctgtataaaaccttcggaaggaaattgcacctg
KF414679_FT00000_P-G      atgtatccctcatgttgctgtacaaaaccttcggacagaaattgcacctg
KR230749_FT00000_P-G      atgtatccctcatgttgctgtacaaaaccttcggacagaaattgcacctg
KM998716_FT00000_P-G      atgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctg
AB064313_FT00000_C-G      atgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctg
AB064311_FT00000_P-G      atgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctg
EF634480_FT00000_P-G      atgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctg
AB064312_FT00000_P-G      atgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctg
HE981174_FT00000_P-G      atgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctg
KY004111_FT00000_P-G      atgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctg
HE981175_FT00000_P-G      atgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctg
HE981176_FT00000_P-G      atgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctg
GU563556_FT00000_P-G      atgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctg
AB375165_FT00000_P-G      atgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctg
AB064310_FT00000_P-G      atgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctg
AB056513_FT00000_P-G      atgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctg
AB375166_FT00000_P-G      atgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctg
AB375167_FT00000_P-G      atgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctg
AB375169_FT00000_P-G      atgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctg
AB375170_FT00000_P-G      atgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctg
AB375168_FT00000_P-G      atgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctg
KJ194508_FT00000_P-G      atgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctg
KF767450_FT00000_P-G      atgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctg
AF405706_FT00000_P-G      atgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctg
AF160501_FT00000_C-G      atgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctg
KX264500_FT00000_P-G      atgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctg
FJ023674_FT00000_P-G      atgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctg
FR714503_FT00000_P-G      atgtatccctcatgttgctgtacaaaaccttcggacggaaattgcacctg
                          ********************** ***** ******  *************

EF464097_FT00000_P-G      tattcccatcccatcatcttgggctttcgcaaaatacctatgggagtggg
EF464098_FT00000_P-G      tattcccatcccatcatcttgggctttcgcaaaatacctatgggagtggg
JQ707677_FT00000_P-G      tattcccatcccatcatcttgggctttcgcaaaatacctatgggagtggg
JQ707678_FT00000_P-G      tattcccatcccatcatcttgggctttcgcaaaatacctatgggagtggg
JQ707679_FT00000_P-G      tattcccatcccatcatcttgggctttcgcaaaatacctatgggagtggg
JQ707671_FT00000_P-G      tattcccatcccatcatcttgggctttcgcaaaatacctatgggagtggg
JQ707680_FT00000_P-G      tattcccatcccatcatcttgggctttcgcaaaatacctatgggagtggg
JQ707673_FT00000_P-G      tattcccatcccatcatcttgggctttcgcaaaatacctatgggagtggg
JQ707666_FT00000_P-G      tattcccatcccatcatcttgggctttcgcaaaatacctatgggagtggg
JQ707660_FT00000_P-G      tattcccatcccatcatcttgggctttcgcaaaatacctatgggagtggg
JQ707657_FT00000_P-G      tattcccatcccatcatcttgggctttcgcaaaatacctatgggagtggg
JQ707668_FT00000_P-G      tattcccatcccatcatcttgggctttcgcaaaatacctatgggagtggg
AB056515_FT00000_P-G      tattcccatcccatcatcttgggctttcgcaaaatacctatgggagtggg
KF414679_FT00000_P-G      tattcccatcccatcatcttgggctttcgcaaaatacctatgggagtggg
KR230749_FT00000_P-G      tattcccatcccatcatcttgggctttcgcaaaatacctatgggagtggg
KM998716_FT00000_P-G      tattcccatcccatcatcttgggctttcgcaaaatacctatgggagtggg
AB064313_FT00000_C-G      tattcccatcccatcatcttgggctttcgcaaaatacctatgggagtggg
AB064311_FT00000_P-G      tattcccatcccatcatcttgggctttcgcaaaatacctatgggagtggg
EF634480_FT00000_P-G      tattcccatcccatcatcttgggctttcgcaaaatacctatgggagtggg
AB064312_FT00000_P-G      tattcccatcccatcatcttgggctttcgcaaaatacctatgggagtggg
HE981174_FT00000_P-G      tattcccatcccatcatcttgggctttcgcaaaatacctatgggagtggg
KY004111_FT00000_P-G      tattcccatcccatcatcttgggctttcgcaaaatacctatgggagtggg
HE981175_FT00000_P-G      tattcccatcccatcatcttgggctttcgcaaaatacctatgggagtggg
HE981176_FT00000_P-G      tattcccatcccatcatcttgggctttcgcaaaatacctatgggagtggg
GU563556_FT00000_P-G      tattcccatcccatcatcttgggctttcgcaaaatacctatgggagtggg
AB375165_FT00000_P-G      tattcccatcccatcatcttgggctttcgcaaaatacctatgggagtggg
AB064310_FT00000_P-G      tattcccatcccatcatcttgggctttcgcaaaatacctatgggagtggg
AB056513_FT00000_P-G      tattcccatcccatcatcttgggctttcgcaaaatacctatgggagtggg
AB375166_FT00000_P-G      tattcccatcccatcatcttgggctttcgcaaaatacctatgggagtggg
AB375167_FT00000_P-G      tattcccatcccatcatcttgggctttcgcaaaatacctatgggagtggg
AB375169_FT00000_P-G      tattcccatcccatcatcttgggctttcgcaaaatacctatgggagtggg
AB375170_FT00000_P-G      tattcccatcccatcatcttgggctttcgcaaaatacctatgggagtggg
AB375168_FT00000_P-G      tattcccatcccatcatcttgggctttcgcaaaatacctatgggagtggg
KJ194508_FT00000_P-G      tattcccatcccatcatcttgggctttcgcaaaatacctatgggagtggg
KF767450_FT00000_P-G      tattcccatcccatcatcttgggctttcgcaaaatacctatgggagtggg
AF405706_FT00000_P-G      tattcccatcccatcatcttgggctttcgcaaaatacctatgggagtggg
AF160501_FT00000_C-G      tattcccatcccatcatcttgggctttcgcaaaatacctatgggagtggg
KX264500_FT00000_P-G      tattcccatcccatcatcttgggctttcgcaaaatacctatgggagtggg
FJ023674_FT00000_P-G      tattcccatcccatcatcttgggctttcgcaaaatacctatgggagtggg
FR714503_FT00000_P-G      tattcccatcccatcatcttgggctttcgcaaaatacctatgggagtggg
                          **************************************************

EF464097_FT00000_P-G      cctcagtccgtttctcatggctcagtttactagtgccatttgttcagtgg
EF464098_FT00000_P-G      cctcagtccgtttctcatggctcagtttactagtgccatttgttcagtgg
JQ707677_FT00000_P-G      cctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgg
JQ707678_FT00000_P-G      cctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgg
JQ707679_FT00000_P-G      cctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgg
JQ707671_FT00000_P-G      cctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgg
JQ707680_FT00000_P-G      cctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgg
JQ707673_FT00000_P-G      cctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgg
JQ707666_FT00000_P-G      cctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgg
JQ707660_FT00000_P-G      cctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgg
JQ707657_FT00000_P-G      cctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgg
JQ707668_FT00000_P-G      cctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgg
AB056515_FT00000_P-G      cctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgg
KF414679_FT00000_P-G      cctcagtccgtttctcatggctcagtttactagtgccatttgttcagtgg
KR230749_FT00000_P-G      cctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgg
KM998716_FT00000_P-G      cctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgg
AB064313_FT00000_C-G      cctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgg
AB064311_FT00000_P-G      cctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgg
EF634480_FT00000_P-G      cctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgg
AB064312_FT00000_P-G      cctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgg
HE981174_FT00000_P-G      cctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgg
KY004111_FT00000_P-G      cctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgg
HE981175_FT00000_P-G      cctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgg
HE981176_FT00000_P-G      cctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgg
GU563556_FT00000_P-G      cctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgg
AB375165_FT00000_P-G      cctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgg
AB064310_FT00000_P-G      cctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgg
AB056513_FT00000_P-G      cctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgg
AB375166_FT00000_P-G      cctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgg
AB375167_FT00000_P-G      cctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgg
AB375169_FT00000_P-G      cctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgg
AB375170_FT00000_P-G      cctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgg
AB375168_FT00000_P-G      cctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgg
KJ194508_FT00000_P-G      cctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgg
KF767450_FT00000_P-G      cctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgg
AF405706_FT00000_P-G      cctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgg
AF160501_FT00000_C-G      cctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgg
KX264500_FT00000_P-G      cctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgg
FJ023674_FT00000_P-G      cctcagcccgtttctcctggctcagtttactagcgccatttgttcagtgg
FR714503_FT00000_P-G      cctcagcccgtttctcctggctcagtttactagtgccatttgttcagtgg
                          ****** ********* **************** ****************

EF464097_FT00000_P-G      ttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtg
EF464098_FT00000_P-G      ttcgtagggctttcccccactgtctggctttcagctatgtggatgatgtg
JQ707677_FT00000_P-G      ttcgtagggctttcccccactgtctggctttcagctatattgatgatgtg
JQ707678_FT00000_P-G      ttcgtagggctttcccccactgtctggctttcagctatatcgatgatgtg
JQ707679_FT00000_P-G      ttcgtagggctttcccccactgtctggctttcagctatattgatgatgtg
JQ707671_FT00000_P-G      ttcgtagggctttcccccactgtctggctttcagctatattgatgatgtg
JQ707680_FT00000_P-G      ttcgtagggctttcccccactgtctggctttcagctatattgatgatgtg
JQ707673_FT00000_P-G      ttcgtagggctttcccccactgtctggctttcagctatattgatgatgtg
JQ707666_FT00000_P-G      ttcgtagggctttcccccactgtctggctttcagctatattgatgatgtg
JQ707660_FT00000_P-G      ttcgtagggctttcccccactgtctggctttcagctatattgatgatgtg
JQ707657_FT00000_P-G      ttcgtagggctttcccccactgtctggctttcagctatattgatgatgtg
JQ707668_FT00000_P-G      ttcgtagggctttcccccactgtctggctttcagctatattgatgatgtg
AB056515_FT00000_P-G      ttcgtagggctttcccccactgtctggctttcagctatatggatgatgtg
KF414679_FT00000_P-G      ttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtg
KR230749_FT00000_P-G      ttcgtagggctttcccccactgtctggctttcagctatatggatgatgtg
KM998716_FT00000_P-G      ttcgtagggctttcccccactgtctggctttcagctatatggatgatgtg
AB064313_FT00000_C-G      ttcgtagggctttcccccactgtctggctttcagctatatggatgatgtg
AB064311_FT00000_P-G      ttcgtagggctttcccccactgtctggctttcagctatatggatgatgtg
EF634480_FT00000_P-G      ttcgtagggctttcccccactgtctggctttcagctatatggatgatgtg
AB064312_FT00000_P-G      ttcgtagggctttcccccactgtctggctttcagctatatggatgatgtg
HE981174_FT00000_P-G      ttcgtagggctttcccccactgtctggctttcagctatatggatgatgtg
KY004111_FT00000_P-G      ttcgtagggctttcccccactgtctggctttcagctatatggatgatgtg
HE981175_FT00000_P-G      ttcgtagggctttcccccactgtctggctttcagctatatggatgatgtg
HE981176_FT00000_P-G      ttcgtagggctttcccccactgtctggctttcagctatatggatgatgtg
GU563556_FT00000_P-G      ttcgtagggctttcccccactgtctggctttcagctatatggatgatgtg
AB375165_FT00000_P-G      ttcgtagggctttcccccactgtctggctttcagctatatggatgatgtg
AB064310_FT00000_P-G      ttcgtagggctttcccccactgtctggctttcagctatatggatgatgtg
AB056513_FT00000_P-G      ttcgtagggctttcccccactgtctggctttcagctatatggatgatgtg
AB375166_FT00000_P-G      ttcgtagggctttcccccactgtctggctttcagctatatggatgatgtg
AB375167_FT00000_P-G      ttcgtagggctttcccccactgtctggctttcagctatatggatgatgtg
AB375169_FT00000_P-G      ttcgtagggctttcccccactgtctggctttcagctatatggatgatgtg
AB375170_FT00000_P-G      ttcgtagggctttcccccactgtctggctttcagctatatggatgatgtg
AB375168_FT00000_P-G      ttcgtagggctttcccccactgtctggctttcagctatatggatgatgtg
KJ194508_FT00000_P-G      ttcgtagggctttcccccactgtctggctttcagctatatggatgatgtg
KF767450_FT00000_P-G      ttcgtagggctttcccccactgtctggctttcagctatatggatgatgtg
AF405706_FT00000_P-G      ttcgtagggctttcccccactgtctggctttcagctatatggatgatgtg
AF160501_FT00000_C-G      ttcgtagggctttcccccactgtctggctttcagctatatggatgatgtg
KX264500_FT00000_P-G      ttcgtagggctttcccccactgtctggctttcagctatatggatgatgtg
FJ023674_FT00000_P-G      ttcgtagggctttcccccactgtctggctttcagttatatggatgatgtg
FR714503_FT00000_P-G      ttcgtagggctttcccccactgtctggctttcagttatatggatgatgtg
                          *********************** ********** *** * *********

EF464097_FT00000_P-G      gtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
EF464098_FT00000_P-G      gtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
JQ707677_FT00000_P-G      gtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
JQ707678_FT00000_P-G      gtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
JQ707679_FT00000_P-G      gtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
JQ707671_FT00000_P-G      gtattgggggccaaatctgtacaacatcttgagtccctttttaccgctgt
JQ707680_FT00000_P-G      gtattgggggccaaatctgtacaacatcttgagtccctttttaccgctgt
JQ707673_FT00000_P-G      gtattgggggccaaatctgtacaacatcttgagtccctttttaccgctgt
JQ707666_FT00000_P-G      gtattgggggccaaatctgtacaacatcttgagtccctttttaccgctgt
JQ707660_FT00000_P-G      gtattgggggccaaatctgtacaacatcttgagtccctttttaccgctgt
JQ707657_FT00000_P-G      gtattgggggccaaatctgtacaacatcttgagtccctttttaccgctgt
JQ707668_FT00000_P-G      gtattgggggccaaatctgtacaacatcttgagtccctttttaccgctgt
AB056515_FT00000_P-G      gtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
KF414679_FT00000_P-G      gtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
KR230749_FT00000_P-G      gtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
KM998716_FT00000_P-G      gtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
AB064313_FT00000_C-G      gtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
AB064311_FT00000_P-G      gtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
EF634480_FT00000_P-G      gtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
AB064312_FT00000_P-G      gtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
HE981174_FT00000_P-G      gtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
KY004111_FT00000_P-G      gtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
HE981175_FT00000_P-G      gtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
HE981176_FT00000_P-G      gtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
GU563556_FT00000_P-G      gtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
AB375165_FT00000_P-G      gtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
AB064310_FT00000_P-G      gtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
AB056513_FT00000_P-G      gtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
AB375166_FT00000_P-G      gtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
AB375167_FT00000_P-G      gtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
AB375169_FT00000_P-G      gtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
AB375170_FT00000_P-G      gtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
AB375168_FT00000_P-G      gtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
KJ194508_FT00000_P-G      gtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
KF767450_FT00000_P-G      gtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
AF405706_FT00000_P-G      gtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
AF160501_FT00000_C-G      gtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
KX264500_FT00000_P-G      gtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
FJ023674_FT00000_P-G      gtattgggggccaaatctgtacamcaccttgagtccatttataccgctgt
FR714503_FT00000_P-G      gtattgggggccaagtctgtacaacatcttgaggccatttataccgctgt
                          ************** ******** ** ****** ** *** *********

EF464097_FT00000_P-G      taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaa
EF464098_FT00000_P-G      taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaa
JQ707677_FT00000_P-G      taccaattttcttttgtctttgggtatacatctaaaccataacaaaacaa
JQ707678_FT00000_P-G      taccaattttcttttgtctttgggtatacatctaaaccataacaaaacaa
JQ707679_FT00000_P-G      taccaattttcttttgtctttgggtatacatctaaaccataacaaaacaa
JQ707671_FT00000_P-G      taccaattttcttttgtctttgggtatacatctaaaccataacaaaacaa
JQ707680_FT00000_P-G      taccaattttcttttgtctttgggtatacatctaaaccataacaaaacaa
JQ707673_FT00000_P-G      taccaattttcttttgtctttgggtatacatctaaaccataacaaaacaa
JQ707666_FT00000_P-G      taccaattttcttttgtctttgggtatacatctaaaccataacaaaacaa
JQ707660_FT00000_P-G      taccaattttcttttgtctttgggtatacatctaaaccataacaaaacaa
JQ707657_FT00000_P-G      taccaattttcttttgtctttgggtatacatctaaaccataacaaaacaa
JQ707668_FT00000_P-G      taccaattttcttttgtctttgggtatacatctaaaccataacaaaacaa
AB056515_FT00000_P-G      taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaa
KF414679_FT00000_P-G      taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaa
KR230749_FT00000_P-G      taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaa
KM998716_FT00000_P-G      taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaa
AB064313_FT00000_C-G      taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaa
AB064311_FT00000_P-G      taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaa
EF634480_FT00000_P-G      taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaa
AB064312_FT00000_P-G      taccaattttcttttgtctttgggtatacatctaaaccctgacaaaacaa
HE981174_FT00000_P-G      taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaa
KY004111_FT00000_P-G      taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaa
HE981175_FT00000_P-G      taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaa
HE981176_FT00000_P-G      taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaa
GU563556_FT00000_P-G      taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaa
AB375165_FT00000_P-G      taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaa
AB064310_FT00000_P-G      taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaa
AB056513_FT00000_P-G      taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaa
AB375166_FT00000_P-G      taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaa
AB375167_FT00000_P-G      taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaa
AB375169_FT00000_P-G      taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaa
AB375170_FT00000_P-G      taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaa
AB375168_FT00000_P-G      taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaa
KJ194508_FT00000_P-G      taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaa
KF767450_FT00000_P-G      taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaa
AF405706_FT00000_P-G      taccaattttcttttgtctttgggtatacatctaaaccctaccaaaacaa
AF160501_FT00000_C-G      taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaa
KX264500_FT00000_P-G      taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaa
FJ023674_FT00000_P-G      taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacta
FR714503_FT00000_P-G      taccaattttcttttgtctttgggtatacatttaaattctaacaaaacta
                          ******************************* ****   *  ****** *

EF464097_FT00000_P-G      aaagatggggttattccttaaattttatgggatacgtaattggaagttgg
EF464098_FT00000_P-G      aaagatggggttattccttaaactttatgggatatgtaattggaagttgg
JQ707677_FT00000_P-G      aaagatggggttattccttaaattttatgggatatgtaattggaagttgg
JQ707678_FT00000_P-G      aaagatggggttattccttaaattttatgggatatgtaattggaagttgg
JQ707679_FT00000_P-G      aaagatggggttattccttaaattttatgggatatgtaattggaagttgg
JQ707671_FT00000_P-G      aaagatggggttattccttaaattttatgggatatgtaattggaagttgg
JQ707680_FT00000_P-G      aaagatggggttattccttaaattttatgggatatgtaattggaagttgg
JQ707673_FT00000_P-G      aaagatggggttattccttaaattttatgggatatgtaattggaagttgg
JQ707666_FT00000_P-G      aaagatggggttattccttaaattttatgggatatgtaattggaagttgg
JQ707660_FT00000_P-G      aaagatggggttattccttaaattttatgggatatgtaattggaagttgg
JQ707657_FT00000_P-G      aaagatggggttattccttaaattttatgggatatgtaattggaagttgg
JQ707668_FT00000_P-G      aaagatggggttattccttaaattttatgggatatgtaattggaagttgg
AB056515_FT00000_P-G      aaagatggggttattccttaaattttatgggatatgtaattggaagttgg
KF414679_FT00000_P-G      aaagatggggttattccttaaattttatgggatatgtaattggaagttgg
KR230749_FT00000_P-G      aaagatggggttattccttaaattttatgggatatgtaattggaagttgg
KM998716_FT00000_P-G      aaagatggggttattccttaaattttatgggatatgtaattggaagttgg
AB064313_FT00000_C-G      aaagatggggttattccttaaattttatgggatatgtaattggaagttgg
AB064311_FT00000_P-G      aaagatggggttattccttaaattttatgggatatgtaattggaagttgg
EF634480_FT00000_P-G      aaagatggggttattccttaaattttatgggatatgtaattggaagttgg
AB064312_FT00000_P-G      aaagatggggttattccttaaattttatgggatatgtaattggaagttgg
HE981174_FT00000_P-G      aaagatggggttattccttaaattttatgggatatgtaattggaagttgg
KY004111_FT00000_P-G      aaagatggggttattccttaaattttatgggatatgtaattggaagttgg
HE981175_FT00000_P-G      aaagatggggttattccttaaattttatgggatatgtaattggaagttgg
HE981176_FT00000_P-G      aaagatggggttattccttaaattttatgggatatgtaattggaagttgg
GU563556_FT00000_P-G      aaagatggggttattccttaaattttatgggatatgtaattggaagttgg
AB375165_FT00000_P-G      aaagatggggttattccttaarttttatgggatatgtaattggaagttgg
AB064310_FT00000_P-G      aaagatggggttattccttaaattttatgggatatgtaattggaagttgg
AB056513_FT00000_P-G      aaagatggggttattccttaaattttatgggatatgtaattggaagttgg
AB375166_FT00000_P-G      aaagatggggttattccttaaattttatgggatatgtaattggaagttgg
AB375167_FT00000_P-G      aaagatggggttattccttaaattttatgggatatgtaattggaagttgg
AB375169_FT00000_P-G      aaagatggggttattccttaaattttatgggatatgtaattggaagttgg
AB375170_FT00000_P-G      aaagatggggttattccttaaattttatgggatatgtaattggaagttgg
AB375168_FT00000_P-G      aaagatggggttattccttaaattttatgggatatgtaattggaagttgg
KJ194508_FT00000_P-G      aaagatggggttattccttaaattttatgggatatgtaattggaagttgg
KF767450_FT00000_P-G      aaagatggggttattccttaaattttatgggatatgtaattggaagttgg
AF405706_FT00000_P-G      aaagatggggttattccttaaattttatgggatatgtaattggaagttgg
AF160501_FT00000_C-G      aaagatggggttattccttaaattttatgggatatgtaattggaagttgg
KX264500_FT00000_P-G      aaagatggggttattccttaaattttatgggatatgtaattggaagttgg
FJ023674_FT00000_P-G      agcgatggggttattccttgaatttcatgggatacgtaattggaagttgg
FR714503_FT00000_P-G      agcgatggggttattccctaaacttcatgggatatgtaattggaagttgg
                          *  ************** * *  ** ******** ***************

EF464097_FT00000_P-G      ggtactttgccacaggaacacatcgcacagaaaattaagcaatgttttgg
EF464098_FT00000_P-G      ggtactttgccacaagaacacatcacacagaaaattaagcaatgttttcg
JQ707677_FT00000_P-G      ggtactttgccacaagaacacatcacacaaaaaattaagcaatgttttcg
JQ707678_FT00000_P-G      ggtactttgccacaagaacacatcacacaaaaaattaagcaatgttttcg
JQ707679_FT00000_P-G      ggtactttgccacaagaacacatcacacaaaaaattaagcaatgttttcg
JQ707671_FT00000_P-G      ggtactttgccacaagaacacatcacacaaaaaattaagcaatgttttcg
JQ707680_FT00000_P-G      ggtactttgccacaagaacacatcacacaaaaaattaagcaatgttttcg
JQ707673_FT00000_P-G      ggtactttgccacaagaacacatcacacaaaaaattaagcaatgttttcg
JQ707666_FT00000_P-G      ggtactttgccacaagaacacatcacacaaaaaattaagcaatgttttcg
JQ707660_FT00000_P-G      ggtactttgccacaagaacacatcacacaaaaaattaagcaatgttttcg
JQ707657_FT00000_P-G      ggtactttgccacaagaacacatcacacaaaaaattaagcaatgttttcg
JQ707668_FT00000_P-G      ggtactttgccacaagaacacatcacacaaaaaattaagcaatgttttcg
AB056515_FT00000_P-G      ggtactttgccacaagaacacatcacacagaaaattaagcaatgttttcg
KF414679_FT00000_P-G      ggtactttgccacaagaacacatcacacagaaaattaagcaatgttttcg
KR230749_FT00000_P-G      ggtactttgccacaagaacacatcacacagaaaattaagcaatgttttcg
KM998716_FT00000_P-G      ggtactttgccacaagaacacatcacacagaaaattaagcaatgttttcg
AB064313_FT00000_C-G      ggtactttgccacaagaacacatcacaaagaaaattaagcaatgttttcg
AB064311_FT00000_P-G      ggtactttgccacaagaacacatcacacagaaaattaagcaatgttttcg
EF634480_FT00000_P-G      ggtactttgccacaagaacacatcacacagaaaattaagcaatgttttcg
AB064312_FT00000_P-G      ggtactttgccacaagaacacatcacacagaaaattaagcaatgttttcg
HE981174_FT00000_P-G      ggtactttgccacaagaacacatcacacagaaaattaagcaatgttttcg
KY004111_FT00000_P-G      ggtactttgccacaagaacacatcacacagaaaattaagcaatgttttcg
HE981175_FT00000_P-G      ggtactttgccacaagaacacatcacacagaaaattaagcaatgttttcg
HE981176_FT00000_P-G      ggtactttgccacaagaacacatcacacagaaaattaagcaatgttttcg
GU563556_FT00000_P-G      ggtactttgccacaagaacacatcacacagaaaattaagcaatgttttcg
AB375165_FT00000_P-G      ggtactttgccacaagaacacatcacacagaaaattaagcratgttttcg
AB064310_FT00000_P-G      ggtactttgccacaagaacacatcacacagaaaattaagcaatgttttcg
AB056513_FT00000_P-G      ggtactttgccacaagaacacatcacacagaaaattaagcaatgttttcg
AB375166_FT00000_P-G      ggtactttgccacaagaacacatcacacagaaaattaagcaatgttttcg
AB375167_FT00000_P-G      ggtactttgccacaagaacacatcacacagaaaattaagcaatgttttcg
AB375169_FT00000_P-G      ggtactttgccacaagaacacatcacacagaaaattaagcaatgttttcg
AB375170_FT00000_P-G      ggtactttgccacaagaacacatcacacagaaaattaagcaatgttttcg
AB375168_FT00000_P-G      ggtactttgccacaagaacacatcacacagaaaattaagcaatgttttcg
KJ194508_FT00000_P-G      ggtactttgccacaagaacacatcacacagaaaattaagcaatgttttcg
KF767450_FT00000_P-G      ggtactttgccacaagaacacatcacacagaaaattaagcaatgttttcg
AF405706_FT00000_P-G      ggtactttgccacaagaacacatcacacagaaaattaagcaatgttttcg
AF160501_FT00000_C-G      ggtactttgccacaagaacacatcacacagaaaattaagcaatgttttcg
KX264500_FT00000_P-G      ggtactttgccacaagaacacatcacacagaaaattaagcaatgttttcg
FJ023674_FT00000_P-G      ggtaccttgccacaagatcatattatacagaaaatcagacaatgttttag
FR714503_FT00000_P-G      ggtaccttgccacaagatcatattatacagaaaatcaaacaatgttttag
                          ***** ******** ** ** **   * * ***** *  * ******* *

EF464097_FT00000_P-G      gaaactacctgttaacaggccaattgattggaaagtttgtcaaagaatag
EF464098_FT00000_P-G      gaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataa
JQ707677_FT00000_P-G      gaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataa
JQ707678_FT00000_P-G      gaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataa
JQ707679_FT00000_P-G      gaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataa
JQ707671_FT00000_P-G      gaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataa
JQ707680_FT00000_P-G      gaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataa
JQ707673_FT00000_P-G      gaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataa
JQ707666_FT00000_P-G      gaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataa
JQ707660_FT00000_P-G      gaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataa
JQ707657_FT00000_P-G      gaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataa
JQ707668_FT00000_P-G      gaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataa
AB056515_FT00000_P-G      gaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataa
KF414679_FT00000_P-G      gaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataa
KR230749_FT00000_P-G      gaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataa
KM998716_FT00000_P-G      gaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataa
AB064313_FT00000_C-G      gaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataa
AB064311_FT00000_P-G      gaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataa
EF634480_FT00000_P-G      gaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataa
AB064312_FT00000_P-G      gaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataa
HE981174_FT00000_P-G      gaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataa
KY004111_FT00000_P-G      gaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataa
HE981175_FT00000_P-G      gaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataa
HE981176_FT00000_P-G      gaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataa
GU563556_FT00000_P-G      gaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataa
AB375165_FT00000_P-G      gaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataa
AB064310_FT00000_P-G      gaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataa
AB056513_FT00000_P-G      gaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataa
AB375166_FT00000_P-G      gaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataa
AB375167_FT00000_P-G      gaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataa
AB375169_FT00000_P-G      gaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataa
AB375170_FT00000_P-G      gaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataa
AB375168_FT00000_P-G      gaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataa
KJ194508_FT00000_P-G      gaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataa
KF767450_FT00000_P-G      gaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataa
AF405706_FT00000_P-G      gaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataa
AF160501_FT00000_C-G      gaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataa
KX264500_FT00000_P-G      gaaactccctgttaacaggccaattgattggaaagtctgtcaacgaataa
FJ023674_FT00000_P-G      aaaactccctgttaataggcccgttgattggaaagtrtgtcaaagaattt
FR714503_FT00000_P-G      aaaactccctgttaacaggcccattgattggaaagtatgtcaaagaattt
                           ***** ******** *****  ************* ****** ****  

EF464097_FT00000_P-G      ttggtcttttgggattcgctgctccttttacccaatgtggttaccctgcc
EF464098_FT00000_P-G      ctggtctgttgggtttcgctgctccttttacccaatgtggttaccctgcc
JQ707677_FT00000_P-G      ctggtctgttgggtttcgctgctccttttacccaatgtggttaccctgcc
JQ707678_FT00000_P-G      ctggtctgttgggtttcgctgctccttttacccaatgtggttaccctgcc
JQ707679_FT00000_P-G      ctggtctgttgggtttcgctgctccttttacccaatgtggttaccctgcc
JQ707671_FT00000_P-G      ctggtctgttgggtttcgctgctccttttacccaatgtggttaccctgcc
JQ707680_FT00000_P-G      ctggtctgttgggtttcgctgctccttttacccaatgtggttaccctgcc
JQ707673_FT00000_P-G      ctggtctgttgggtttcgctgctccttttacccaatgtggttaccctgcc
JQ707666_FT00000_P-G      ctggtctgttgggtttcgctgctccttttacccaatgtggttaccctgcc
JQ707660_FT00000_P-G      ctggtctgttgggtttcgctgctccttttacccaatgtggttaccctgcc
JQ707657_FT00000_P-G      ctggtctgttgggtttcgctgctccttttacccaatgtggttaccctgcc
JQ707668_FT00000_P-G      ctggtctgttgggtttcgctgctccttttacccaatgtggttaccctgcc
AB056515_FT00000_P-G      ctggtctgttgggtttcgctgctccttttacccaatgtggttaccctgcc
KF414679_FT00000_P-G      ctggtctgttgggtttcgctgctccttttacccaatgtggttaccctgcc
KR230749_FT00000_P-G      ctggtctgttgggtttcgctgctccttttacccaatgtggttaccctgcc
KM998716_FT00000_P-G      ctggtctgttgggtttcgctgctccttttacccaatgtggttaccctgcc
AB064313_FT00000_C-G      ctggtctgttgggtttcgctgctccttttacccaatgtggttaccctgcc
AB064311_FT00000_P-G      ctggtctgttgggtttcgctgctcctttcacccaatgtggttaccctgcc
EF634480_FT00000_P-G      ctggtctgttgggtttcgctgctccttttacccaatgtggttaccctgcc
AB064312_FT00000_P-G      ctggtctgttgggtttcgctgctccttttacccaatgtggttaccctgcc
HE981174_FT00000_P-G      ctggtctgttgggtttcgctgctccttttacccaatgtggttaccctgcc
KY004111_FT00000_P-G      ctggtctgttgggtttcgctgctccttttacccaatgtggttaccctgcc
HE981175_FT00000_P-G      ctggtctgttgggtttcgctgctccttttacccaatgtggttaccctgcc
HE981176_FT00000_P-G      ctggtctgttgggtttcgctgctccttttacccaatgtggttaccctgcc
GU563556_FT00000_P-G      ctggtctgttgggtttcgctgctccttttacccaatgtggttaccctgcc
AB375165_FT00000_P-G      ctggtctgttgggtttcgctgctccttttacccaatgtggttaccctgcc
AB064310_FT00000_P-G      ctggtctgttgggtttcgctgctccttttacccaatgtggttaccctgcc
AB056513_FT00000_P-G      ctggtctgttgggtttcgctgctccttttacccaatgtggttaccctgcc
AB375166_FT00000_P-G      ctggtctgttgggtttcgctgctccttttacccaatgtggttaccctgcc
AB375167_FT00000_P-G      ctggtctgttgggtttcgctgctccttttacccaatgtggttaccctgcc
AB375169_FT00000_P-G      ctggtctgttgggtttcgctgctccttttacccaatgtggttaccctgcc
AB375170_FT00000_P-G      ctggtctgttgggtttcgctgctccttttacccaatgtggttaccctgcc
AB375168_FT00000_P-G      ctggtctgttgggtttcgctgctccttttacccaatgtggttaccctgcc
KJ194508_FT00000_P-G      ctggtctgttgggtttcgctgctccttttacccaatgtggttaccctgcc
KF767450_FT00000_P-G      ctggtctgttgggtttcgctgctccttttacccaatgtggttaccctgcc
AF405706_FT00000_P-G      ctggtctgttgggtttcgctgctccttttacccaatgtggttaccctgcc
AF160501_FT00000_C-G      ctggtctgttgggtttcgctgctcctttcacccaatgtggttaccctgcc
KX264500_FT00000_P-G      ctggtctgttgggtttcgctgctccttttacccaatgtggttaccctgcc
FJ023674_FT00000_P-G      cgggtctcctgggctttgctgctcccttcacacaatgtggttaccctgca
FR714503_FT00000_P-G      caggactcttgggctttgctgctccatttacacaatgtggttaccctgcg
                            ** **  **** ** ******** ** ** ***************** 

EF464097_FT00000_P-G      ttaatgcctttatatgcatgtatacaagttaagcaggcttttactttctc
EF464098_FT00000_P-G      ttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctc
JQ707677_FT00000_P-G      ttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctc
JQ707678_FT00000_P-G      ttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctc
JQ707679_FT00000_P-G      ttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctc
JQ707671_FT00000_P-G      ttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctc
JQ707680_FT00000_P-G      ttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctc
JQ707673_FT00000_P-G      ttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctc
JQ707666_FT00000_P-G      ttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctc
JQ707660_FT00000_P-G      ttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctc
JQ707657_FT00000_P-G      ttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctc
JQ707668_FT00000_P-G      ttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctc
AB056515_FT00000_P-G      ttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctc
KF414679_FT00000_P-G      ttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctc
KR230749_FT00000_P-G      ttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctc
KM998716_FT00000_P-G      ttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctc
AB064313_FT00000_C-G      ttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctc
AB064311_FT00000_P-G      ttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctc
EF634480_FT00000_P-G      ttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctc
AB064312_FT00000_P-G      ttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctc
HE981174_FT00000_P-G      ttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctc
KY004111_FT00000_P-G      ttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctc
HE981175_FT00000_P-G      ttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctc
HE981176_FT00000_P-G      ttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctc
GU563556_FT00000_P-G      ttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctc
AB375165_FT00000_P-G      ttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctc
AB064310_FT00000_P-G      ttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctc
AB056513_FT00000_P-G      ttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctc
AB375166_FT00000_P-G      ttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctc
AB375167_FT00000_P-G      ttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctc
AB375169_FT00000_P-G      ttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctc
AB375170_FT00000_P-G      ttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctc
AB375168_FT00000_P-G      ttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctc
KJ194508_FT00000_P-G      ttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctc
KF767450_FT00000_P-G      ttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctc
AF405706_FT00000_P-G      ttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctc
AF160501_FT00000_C-G      ttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctc
KX264500_FT00000_P-G      ttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctc
FJ023674_FT00000_P-G      ttaatgcctttatatgcmtgtatacaagccaaacaggctttcactttctc
FR714503_FT00000_P-G      ttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctc
                          *********** ***** **********  ** ******** ********

EF464097_FT00000_P-G      gccaacttataaggcctttctctgtaaacaatacatgaacctttaccccg
EF464098_FT00000_P-G      gccaacttataaggcctttctctgtaaacaatacatgaacctttaccccg
JQ707677_FT00000_P-G      gccaacttataaggcctttctctgtaaacaatacatgaacctttaccctg
JQ707678_FT00000_P-G      gccaacttataaggcctttctctgtaaacaatacatgaacctttaccctg
JQ707679_FT00000_P-G      gccaacttataaggcctttctctgtaaacaatacatgaacctttaccctg
JQ707671_FT00000_P-G      gccaacttataaggcctttctctgtaaacaatacatgaacctttaccctg
JQ707680_FT00000_P-G      gccaacttataaggcctttctctgtaaacaatacatgaacctttaccctg
JQ707673_FT00000_P-G      gccaacttataaggcctttctctgtaaacaatacatgaacctttaccctg
JQ707666_FT00000_P-G      gccaacttataaggcctttctctgtaaacaatacatgaacctttaccctg
JQ707660_FT00000_P-G      gccaacttataaggcctttctctgtaaacaatacatgaacctttaccctg
JQ707657_FT00000_P-G      gccaacttataaggcctttctctgtaaacaatacatgaacctttaccctg
JQ707668_FT00000_P-G      gccaacttataaggcctttctctgtaaacaatacatgaacctttaccctg
AB056515_FT00000_P-G      gccaacttataaggcctttctctgtaaacaatacctgaacctttaccccg
KF414679_FT00000_P-G      gccaacttataaggcctttctctgtaaacaatacatgaacctttaccccg
KR230749_FT00000_P-G      gccaacttataaggcctttctctgtaaacaatacaggaacctttaccccg
KM998716_FT00000_P-G      gccaacttataaggcctttctctgtaaacaatacatgaacctttaccccg
AB064313_FT00000_C-G      gccaacttataaggcctttctctgtaaacaatacatgaacctttaccccg
AB064311_FT00000_P-G      gccaacttataaggcctttctctgtaaacaatacatgaacctttaccccg
EF634480_FT00000_P-G      gccaacttataaggcctttctctgtaaacaatacatgaacctttaccccg
AB064312_FT00000_P-G      gccaacttataaggcctttctctgtaaacaatacatgaacctttaccccg
HE981174_FT00000_P-G      gccaacttataaggcctttctctgtaaacaatacatgaacctttaccccg
KY004111_FT00000_P-G      gccaacttataaggcctttctctgtaaacaatacatgaacctttaccccg
HE981175_FT00000_P-G      gccaacttataaggcctttctctgtaaacaatacatgaacctttaccccg
HE981176_FT00000_P-G      gccaacttataaggcctttctctgtaaacaatacatgaacctttaccccg
GU563556_FT00000_P-G      gccaacttataaggcctttctctgtaaacaatacatgaacctttaccccg
AB375165_FT00000_P-G      gccaacttataaggcctttctctgtaaacaatacatgaacctttaccccg
AB064310_FT00000_P-G      gccaacttataaggcctttctctgtaaacaatacatgaacctttaccccg
AB056513_FT00000_P-G      gccaacttataaggcctttctctgtaaacaatacatgaacctttaccccg
AB375166_FT00000_P-G      gccaacttataaggcctttctctgtaaacaatacatgaacctttaccccg
AB375167_FT00000_P-G      gccaacttataaggcctttctctgtaaacaatacatgaacctttaccccg
AB375169_FT00000_P-G      gccaacttataaggcctttctctgtaaacaatacatgaacctttaccccg
AB375170_FT00000_P-G      gccaacttataaggcctttctctgtaaacaatacatgaacctttaccccg
AB375168_FT00000_P-G      gccaacttataaggcctttctctgtaaacaatacatgaacctttaccccg
KJ194508_FT00000_P-G      gccaacttataaggcctttctctgtaaacaatacatgaacctttaccccg
KF767450_FT00000_P-G      gccaacttataaggcctttctctgtaaacaatacatgaacctttaccccg
AF405706_FT00000_P-G      gccaacttataaggcctttctctgtaaacaatacatgaacctttaccccg
AF160501_FT00000_C-G      gccaacttataaggcctttctctgtaaacaatacatgaacctttaccccg
KX264500_FT00000_P-G      gccaacttataaggcctttctctgtaaacaatacatgaacctttaccccg
FJ023674_FT00000_P-G      gccaacttacaaggcctttctatgtaaacaatatctgaacctttaccccg
FR714503_FT00000_P-G      gccaacttacaaggcctttctgtgtaaacaatatatgaacctttaccccg
                          ********* *********** ***********   ************ *

EF464097_FT00000_P-G      ttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
EF464098_FT00000_P-G      ttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
JQ707677_FT00000_P-G      ttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
JQ707678_FT00000_P-G      ttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
JQ707679_FT00000_P-G      ttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
JQ707671_FT00000_P-G      ttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
JQ707680_FT00000_P-G      ttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
JQ707673_FT00000_P-G      ttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
JQ707666_FT00000_P-G      ttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
JQ707660_FT00000_P-G      ttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
JQ707657_FT00000_P-G      ttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
JQ707668_FT00000_P-G      ttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
AB056515_FT00000_P-G      ttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
KF414679_FT00000_P-G      ttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
KR230749_FT00000_P-G      ttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
KM998716_FT00000_P-G      ttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
AB064313_FT00000_C-G      ttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
AB064311_FT00000_P-G      ttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
EF634480_FT00000_P-G      ttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
AB064312_FT00000_P-G      ttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
HE981174_FT00000_P-G      ttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
KY004111_FT00000_P-G      ttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
HE981175_FT00000_P-G      ttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
HE981176_FT00000_P-G      ttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
GU563556_FT00000_P-G      ttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
AB375165_FT00000_P-G      ttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
AB064310_FT00000_P-G      ttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
AB056513_FT00000_P-G      ttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
AB375166_FT00000_P-G      ttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
AB375167_FT00000_P-G      ttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
AB375169_FT00000_P-G      ttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
AB375170_FT00000_P-G      ttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
AB375168_FT00000_P-G      ttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
KJ194508_FT00000_P-G      ttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
KF767450_FT00000_P-G      ttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
AF405706_FT00000_P-G      ttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
AF160501_FT00000_C-G      ttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
KX264500_FT00000_P-G      ttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
FJ023674_FT00000_P-G      ttgtcaggcaacggcccggtctgtgccaagtgtttgctgatgcaaccccc
FR714503_FT00000_P-G      ttgcccggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
                          ***   ********************************** *********

EF464097_FT00000_P-G      actggttgggggttggccatcggccatcagcgcatgcgtggaacctttgt
EF464098_FT00000_P-G      actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgt
JQ707677_FT00000_P-G      actggttggggcttggccatcggacatcagcgcatgcgtggaacctttgt
JQ707678_FT00000_P-G      actggttggggcttggccatcggacatcagcgcatgcgtggaacctttgt
JQ707679_FT00000_P-G      actggttggggcttggccatcggacatcagcgcatgcgtggaacctttgt
JQ707671_FT00000_P-G      actggttggggcttggccatcggacatcagcgcatgcgtggaacctttgt
JQ707680_FT00000_P-G      actggttggggcttggccatcggacatcagcgcatgcgtggaacctttgt
JQ707673_FT00000_P-G      actggttggggcttggccatcggacatcagcgcatgcgtggaacctttgt
JQ707666_FT00000_P-G      actggttggggcttggccatcggacatcagcgcatgcgtggaacctttgt
JQ707660_FT00000_P-G      actggttggggcttggccatcggacatcagcgcatgcgtggaacctttgt
JQ707657_FT00000_P-G      actggttggggcttggccatcggacatcagcgcatgcgtggaacctttgt
JQ707668_FT00000_P-G      actggttggggcttggccatcggacatcagcgcatgcgtggaacctttgt
AB056515_FT00000_P-G      actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgt
KF414679_FT00000_P-G      actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgt
KR230749_FT00000_P-G      actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgt
KM998716_FT00000_P-G      actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgt
AB064313_FT00000_C-G      actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgt
AB064311_FT00000_P-G      actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgt
EF634480_FT00000_P-G      actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgt
AB064312_FT00000_P-G      actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgt
HE981174_FT00000_P-G      actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgt
KY004111_FT00000_P-G      actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgt
HE981175_FT00000_P-G      actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgt
HE981176_FT00000_P-G      actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgt
GU563556_FT00000_P-G      actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgt
AB375165_FT00000_P-G      actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgt
AB064310_FT00000_P-G      actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgt
AB056513_FT00000_P-G      actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgt
AB375166_FT00000_P-G      actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgt
AB375167_FT00000_P-G      actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgt
AB375169_FT00000_P-G      actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgt
AB375170_FT00000_P-G      actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgt
AB375168_FT00000_P-G      actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgt
KJ194508_FT00000_P-G      actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgt
KF767450_FT00000_P-G      actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgt
AF405706_FT00000_P-G      actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgt
AF160501_FT00000_C-G      actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgt
KX264500_FT00000_P-G      actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgt
FJ023674_FT00000_P-G      actggctggggcttggccatgggccatcagcgcatgcgtggaacctttgt
FR714503_FT00000_P-G      actggctggggcttggccataggccatcagcgcatgcgtggaacctttgt
                          ***** ***** ******** ** **************************

EF464097_FT00000_P-G      ggctcctctgccgatccatactgcggaactcctagctgcttgttttgctc
EF464098_FT00000_P-G      ggctcctctgccgatccatactgcggaactcatagctgcttgttttgctc
JQ707677_FT00000_P-G      ggctcctctgccgatccatactgcggaactcctagctgcttgttttgctc
JQ707678_FT00000_P-G      ggctcctctgccgatccatactgcggaactcctagctgcttgttttgctc
JQ707679_FT00000_P-G      ggctcctctgccgatccatactgcggaactcctagctgcttgttttgctc
JQ707671_FT00000_P-G      ggctcctctgccgatccatactgcggaactcctagctgcttgttttgctc
JQ707680_FT00000_P-G      ggctcctctgccgatccatactgcggaactcctagctgcttgttttgctc
JQ707673_FT00000_P-G      ggctcctctgccgatccatactgcggaactcctagctgcttgttttgctc
JQ707666_FT00000_P-G      ggctcctctgccgatccatactgcggaactcctagctgcttgttttgctc
JQ707660_FT00000_P-G      ggctcctctgccgatccatactgcggaactcctagctgcttgttttgctc
JQ707657_FT00000_P-G      ggctcctctgccgatccatactgcggaactcctagctgcttgttttgctc
JQ707668_FT00000_P-G      ggctcctctgccgatccatactgcggaactcctagctgcttgttttgctc
AB056515_FT00000_P-G      ggctcctctgccgatccatactgcggaactcctagctgcttgttttgctc
KF414679_FT00000_P-G      ggctcctctgccgatccatactgcggaactcctagctgcttgttttgctc
KR230749_FT00000_P-G      ggctcctctgccgatccatactgcggaactcctagctgcttgttttgctc
KM998716_FT00000_P-G      ggctcctctgccgatccatactgcggaactcctagctgcttgttttgctc
AB064313_FT00000_C-G      ggctcctctgccgatccatactgcggaactcctcgctgcttgttttgctc
AB064311_FT00000_P-G      ggctcctctgccgatccatactgcggaactcctcgctgcttgttttgctc
EF634480_FT00000_P-G      ggctcctctgccgatccatactgcggaactcctagctgcttgttttgctc
AB064312_FT00000_P-G      ggctcctctgccgatccatactgcggaactcctagctgcttgttttgctc
HE981174_FT00000_P-G      ggctcctctgccgatccatactgcggaactcctagctgcttgttttgctc
KY004111_FT00000_P-G      ggctcctctgccgatccatactgcggaactcctagctgcttgttttgctc
HE981175_FT00000_P-G      ggctcctctgccgatccatactgcggaactcctagctgcttgttttgctc
HE981176_FT00000_P-G      ggctcctctgccgatccatactgcggaactcctagctgcttgttttgctc
GU563556_FT00000_P-G      ggctcctctgccgatccatactgcggaactcctagctgcttgttttgctc
AB375165_FT00000_P-G      ggctcctctgccgatccatactgcggaactcctagctgcttgttttgctc
AB064310_FT00000_P-G      ggctcctctgccgatccatactgcggaactcctagctgcttgttttgctc
AB056513_FT00000_P-G      ggctcctctgccgatccatactgcggaactcctagctgcttgttttgctc
AB375166_FT00000_P-G      ggctcctctgccgatccatactgcggaactcctagctgcttgttttgctc
AB375167_FT00000_P-G      ggctcctctgccgatccatactgcggaactcctagctgcttgttttgctc
AB375169_FT00000_P-G      ggctcctctgccgatccatactgcggaactcctagctgcttgttttgctc
AB375170_FT00000_P-G      ggctcctctgccgatccatactgcggaactcctagctgcttgttttgctc
AB375168_FT00000_P-G      ggctcctctgccgatccatactgcggaactcctagctgcttgttttgctc
KJ194508_FT00000_P-G      ggctcctctgccgatccatactgcggaactcctagctgcttgttttgctc
KF767450_FT00000_P-G      ggctcctctgccgatccatactgcggaactcctagctgcttgttttgctc
AF405706_FT00000_P-G      ggctcctctgccgatccatactgcggaactcctagctgcttgttttgctc
AF160501_FT00000_C-G      ggctcctctgccgatccatactgcggaactcctagctgcttgttttgctc
KX264500_FT00000_P-G      ggctcctctgccgatccatactgcggaactcctagctgcttgttttgctc
FJ023674_FT00000_P-G      ggctcctctgccgatccatactgcggaactcctagctgcctgttttgctc
FR714503_FT00000_P-G      ggctcctctgccgatccatactgcggaactgctagctgcctgttttgctc
                          ******************************  * ***** **********

EF464097_FT00000_P-G      gcagccggtctggagcaaaactcattggaactgacaattctgtcgtcctc
EF464098_FT00000_P-G      gcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctt
JQ707677_FT00000_P-G      gcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctt
JQ707678_FT00000_P-G      gcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctt
JQ707679_FT00000_P-G      gcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctt
JQ707671_FT00000_P-G      gcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctt
JQ707680_FT00000_P-G      gcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctt
JQ707673_FT00000_P-G      gcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctt
JQ707666_FT00000_P-G      gcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctt
JQ707660_FT00000_P-G      gcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctt
JQ707657_FT00000_P-G      gcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctt
JQ707668_FT00000_P-G      gcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctt
AB056515_FT00000_P-G      gcagccggtctggagcaacactcattgggactgacaattctgtcgtcctt
KF414679_FT00000_P-G      gcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctt
KR230749_FT00000_P-G      gcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctt
KM998716_FT00000_P-G      gcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctt
AB064313_FT00000_C-G      gcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctt
AB064311_FT00000_P-G      gcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctt
EF634480_FT00000_P-G      gcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctt
AB064312_FT00000_P-G      gcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctt
HE981174_FT00000_P-G      gcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctt
KY004111_FT00000_P-G      gcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctt
HE981175_FT00000_P-G      gcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctt
HE981176_FT00000_P-G      gcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctt
GU563556_FT00000_P-G      gcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctt
AB375165_FT00000_P-G      gcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctt
AB064310_FT00000_P-G      gcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctt
AB056513_FT00000_P-G      gcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctt
AB375166_FT00000_P-G      gcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctt
AB375167_FT00000_P-G      gcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctt
AB375169_FT00000_P-G      gcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctt
AB375170_FT00000_P-G      gcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctt
AB375168_FT00000_P-G      gcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctt
KJ194508_FT00000_P-G      gcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctt
KF767450_FT00000_P-G      gcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctt
AF405706_FT00000_P-G      gcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctt
AF160501_FT00000_C-G      gcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctt
KX264500_FT00000_P-G      gcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctt
FJ023674_FT00000_P-G      gcagccggtctggagcaaacatcatcgggactgataattctgtcgtcctt
FR714503_FT00000_P-G      gcagcaggtctggagcaaaacttatcgggactgataattctgtcgtcctt
                          ***** ************   * ** ** ***** ************** 

EF464097_FT00000_P-G      tctcggaaatatacctcctttccatggctgctaggctgtgctgccatatc
EF464098_FT00000_P-G      tctcggaaatatacctcctttccatggcagctaggctgtgctgccaactg
JQ707677_FT00000_P-G      tctcggaaatatacatcctttccatggctgctaggctgtgctgccaactg
JQ707678_FT00000_P-G      tctcggaaatatacatcctttccatggctgctaggctgtgctgccaactg
JQ707679_FT00000_P-G      tctcggaaatatacatcctttccatggctgctaggctgtgctgccaactg
JQ707671_FT00000_P-G      tctcggaaatatacatcctttccatggctgctaggctgtgctgccaactg
JQ707680_FT00000_P-G      tctcggaaatatacatcctttccatggctgctaggctgtgctgccaactg
JQ707673_FT00000_P-G      tctcggaaatatacatcctttccatggctgctaggctgtgctgccaactg
JQ707666_FT00000_P-G      tctcggaaatatacatcctttccatggctgctaggctgtgctgccacctg
JQ707660_FT00000_P-G      tctcggaaatatacatcctttccatggctgctaggctgtgctgccaactg
JQ707657_FT00000_P-G      tctcggaaatatacatcctttccatggctgctaggctgtgctgccaactg
JQ707668_FT00000_P-G      tctcggaaatatacatcctttccatggctgctaggctgtgctgccaactg
AB056515_FT00000_P-G      tctcggaaatatacatcctttccatggctgctaggctgtgctgccaactg
KF414679_FT00000_P-G      tctcggaaatatacatcctttccatggctgctaggctgtgctgccaactg
KR230749_FT00000_P-G      tctcggaaatatacatcctttccatggctgctaggctgtgctgccaactg
KM998716_FT00000_P-G      tctcggaaatatacatcctttccatggctgctaggctgtgctgccaactg
AB064313_FT00000_C-G      tctcggaaatatacatcctttccatggctgctaggctgtgccgccaactg
AB064311_FT00000_P-G      tctcggaaatatacatcctttccatggctgctaggctgtgccgccaactg
EF634480_FT00000_P-G      tctcggaaatatacatcctttccatggctgctaggctgtgctgccaactg
AB064312_FT00000_P-G      tctcggaaatatacatcctttccatggctgctaggctgtgctgccaactg
HE981174_FT00000_P-G      tctcggaaatatacatcctttccatggctgctaggctgtgctgccaactg
KY004111_FT00000_P-G      tctcggaaatatacatcctttccatggctgctaggctgtgctgccaactg
HE981175_FT00000_P-G      tctcggaaatatacatcctttccatggctgctaggctgtgctgccaactg
HE981176_FT00000_P-G      tctcggaaatatacatcctttccatggctgctaggctgtgctgccaactg
GU563556_FT00000_P-G      tctcggaaatatacatcctttccatggctgctaggctgtgctgccaactg
AB375165_FT00000_P-G      tctcggaaatatacatcctttccatggctgctaggctgtgctgccaactg
AB064310_FT00000_P-G      tctcggaaatatacatcctttccatggctgctaggctgtgctgccaactg
AB056513_FT00000_P-G      tctcggaaatatacatcctttccatggctgctaggctgtgctgccaactg
AB375166_FT00000_P-G      tctcggaaatatacatcctttccatggctgctaggctgtgctgccaactg
AB375167_FT00000_P-G      tctcggaaatatacatcctttccatggctgctaggctgtgctgccaactg
AB375169_FT00000_P-G      tctcggaaatatacatcctttccatggctgctaggctgtgctgccaactg
AB375170_FT00000_P-G      tctcggaaatatacatcctttccatggctgctaggctgtgctgccaactg
AB375168_FT00000_P-G      tctcggaaatatacatcctttccatggctgctaggctgtgctgccaactg
KJ194508_FT00000_P-G      tctcggaaatatacatcctttccctggctgctaggctgtgctgccaactg
KF767450_FT00000_P-G      tctcggaaatatacatcctttccatggctgctaggctgtgctgccaactg
AF405706_FT00000_P-G      tctcggaaatatacatcctttccatggctgctaggctgtgctgccaactg
AF160501_FT00000_C-G      tctcggaaatatacatcctttccatggctgctaggctgtgctgccaactg
KX264500_FT00000_P-G      tctcggaaatatacatcctttccatggctgctaggctgtgctgccaactg
FJ023674_FT00000_P-G      tcccggaaatatacmtcatttccatggctgctaggctgtgctgccaactg
FR714503_FT00000_P-G      tcgcggaaatatacatcatttccatggctgctaggctgtgctgccaactg
                          ** *********** ** ***** **** ************ ****  * 

EF464097_FT00000_P-G      gaccctttcagggacgtcctttgtttacgtcccgtcagcgttgaatccag
EF464098_FT00000_P-G      gatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccag
JQ707677_FT00000_P-G      gatccttcgcgggacgtcctttgtttacgtcccgacagcgctgaatccag
JQ707678_FT00000_P-G      gatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccag
JQ707679_FT00000_P-G      gatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccag
JQ707671_FT00000_P-G      gatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccag
JQ707680_FT00000_P-G      gatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccag
JQ707673_FT00000_P-G      gatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccag
JQ707666_FT00000_P-G      gatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccag
JQ707660_FT00000_P-G      gatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccag
JQ707657_FT00000_P-G      gatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccag
JQ707668_FT00000_P-G      gatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccag
AB056515_FT00000_P-G      gatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccag
KF414679_FT00000_P-G      gatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccag
KR230749_FT00000_P-G      gatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccag
KM998716_FT00000_P-G      gatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccag
AB064313_FT00000_C-G      gatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccag
AB064311_FT00000_P-G      gatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccag
EF634480_FT00000_P-G      gatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccag
AB064312_FT00000_P-G      gatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccag
HE981174_FT00000_P-G      gatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccag
KY004111_FT00000_P-G      gatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccag
HE981175_FT00000_P-G      gatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccag
HE981176_FT00000_P-G      gatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccag
GU563556_FT00000_P-G      gatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccag
AB375165_FT00000_P-G      gatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccag
AB064310_FT00000_P-G      gatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccag
AB056513_FT00000_P-G      gatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccag
AB375166_FT00000_P-G      gatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccag
AB375167_FT00000_P-G      gatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccag
AB375169_FT00000_P-G      gatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccag
AB375170_FT00000_P-G      gatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccag
AB375168_FT00000_P-G      gatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccag
KJ194508_FT00000_P-G      gatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccag
KF767450_FT00000_P-G      gatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccag
AF405706_FT00000_P-G      gatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccag
AF160501_FT00000_C-G      gatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccag
KX264500_FT00000_P-G      gatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatccag
FJ023674_FT00000_P-G      gatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatccag
FR714503_FT00000_P-G      gatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctg
                          ** ***    ************** ********* * *** ******* *

EF464097_FT00000_P-G      cggacgacccctcctggggtcgtttggggatctgtcgcccccttctccgt
EF464098_FT00000_P-G      cggacgacccctcccggggccgtttggggctctgtcgcccccttctccgt
JQ707677_FT00000_P-G      cggacgacccctcccggggccgtttggggctctgtcgcccccttctccgt
JQ707678_FT00000_P-G      cggacgacccctcccggggccgtttggggctctgtcgcccccttctccgt
JQ707679_FT00000_P-G      cggacgacccctcccggggccgtttggggctctgtcgcccccttctccgt
JQ707671_FT00000_P-G      cggacgacccctcccggggccgtttggggctctgtcgcccccttctccgt
JQ707680_FT00000_P-G      cggacgacccctcccggggccgtttggggctctgtcgcccccttctccgt
JQ707673_FT00000_P-G      cggacgacccctcccggggccgtttggggctctgtcgcccccttctccgt
JQ707666_FT00000_P-G      cggacgacccctcccggggccgtttggggctctgtcgcccccttctccgt
JQ707660_FT00000_P-G      cggacgacccctcccggggccgtttggggctctgtcgcccccttctccgt
JQ707657_FT00000_P-G      cggacgacccctcccggggccgtttggggctctgtcgcccccttctccgt
JQ707668_FT00000_P-G      cggacgacccctcccggggccgtttggggctctgtcgcccccttctccgt
AB056515_FT00000_P-G      cggacgacccctcccggggccgtttggggctctgtcgcccccttctccgt
KF414679_FT00000_P-G      cggacgacccctcccggggccgtttggggctctgtcgcccccttctccgt
KR230749_FT00000_P-G      cggacgacccctcccggggccgtttggggctctgtcgcccccttctccgt
KM998716_FT00000_P-G      cggacgacccctcccggggccgtttggggctctgtcgcccccttctccgt
AB064313_FT00000_C-G      cggacgacccctcccggggccgtttggggctctgtcgcccccttctccgt
AB064311_FT00000_P-G      cggacgacccctcccggggccgtttggggctctgtcgcccccttctccgt
EF634480_FT00000_P-G      cggacgacccctcccggggccgtttggggctctgtcgcccccttctccgt
AB064312_FT00000_P-G      cggacgacccctcccggggccgtttggggctctgtcgcccccttctccgt
HE981174_FT00000_P-G      cggacgacccctcccggggccgtttggggctctgtcgcccccttctccgt
KY004111_FT00000_P-G      cggacgacccctcccggggccgtttggggctctgtcgcccccttctccgt
HE981175_FT00000_P-G      cggacgacccctcccggggccgtttggggctctgtcgcccccttctccgt
HE981176_FT00000_P-G      cggacgacccctcccggggccgtttggggctctgtcgcccccttctccgt
GU563556_FT00000_P-G      cggacgacccctcccggggccgtttggggctctgtcgcccccttctccgt
AB375165_FT00000_P-G      cggacgacccctcccggggccgtttggggctctgtcgcccccttctccgt
AB064310_FT00000_P-G      cggacgacccctcccggggccgtttggggctctgtcgcccccttctccgt
AB056513_FT00000_P-G      cggacgacccctcccggggccgtttggggctctgtcgcccccttctccgt
AB375166_FT00000_P-G      cggacgacccctcccggggccgtttggggctctgtcgcccccttctccgt
AB375167_FT00000_P-G      cggacgacccctcccggggccgtttggggctctgtcgcccccttctccgt
AB375169_FT00000_P-G      cggacgacccctcccggggccgtttggggctctgtcgcccccttctccgt
AB375170_FT00000_P-G      cggacgacccctcccggggccgtttggggctctgtcgcccccttctccgt
AB375168_FT00000_P-G      cggacgacccctcccggggccgtttggggctctgtcgcccccttctccgt
KJ194508_FT00000_P-G      cggacgacccctcccggggccgtttggggctctgtcgcccccttctccgt
KF767450_FT00000_P-G      cggacgacccctcccggggccgtttggggctctatcgcccccttctccgt
AF405706_FT00000_P-G      cggacgacccctcccggggccgtttggggctctgtcgcccccttctccgt
AF160501_FT00000_C-G      cggacgacccctcccggggccgtttggggctctgtcgcccccttctccgt
KX264500_FT00000_P-G      cggacgacccctcccggggccgtttggggctctgtcgcccccttctccgt
FJ023674_FT00000_P-G      cggacgacccctctcggggccggttggggatctaccgtccccttctccgt
FR714503_FT00000_P-G      cggacgacccctctcggggccgcttggggatctaccgtcctcttcttcat
                          *************  **** ** ****** ***  ** ** ***** * *

EF464097_FT00000_P-G      ctgccgttcctgccgaccacggggcgcacctctctttacgcggtctcccg
EF464098_FT00000_P-G      ctgccgttcctgccgaccacggggcgcacctctctttacgcggtctcccc
JQ707677_FT00000_P-G      ctgccgttcctgccgaccacggggcgcacctctctttacgcggtctcccc
JQ707678_FT00000_P-G      ctgccgttcctgccgaccacggggcgcacctctctttacgcggtctcccc
JQ707679_FT00000_P-G      ctgccgttcctgccgaccacggggcgcacctctctttacgcggtctcccc
JQ707671_FT00000_P-G      ctgccgttcctgccgaccacggggcgcacctctctttacgcggtctcccc
JQ707680_FT00000_P-G      ctgccgttcctgccgcccacggggcgcacctctctttacgcggtctcccc
JQ707673_FT00000_P-G      ctgccgttcctgccgaccacggggcgcacctctctttacgcggtctcccc
JQ707666_FT00000_P-G      ctgccgttcctgccgaccacggggcgcacctctctttacgcggtctcccc
JQ707660_FT00000_P-G      ctgccgttcctgccgaccacggggcgcacctctctttacgcggtctcccc
JQ707657_FT00000_P-G      ctgccgttcctgccgaccacggggcgcacctctctttacgcggtctcccc
JQ707668_FT00000_P-G      ctgccgttcctgccgaccacggggcgcacctctctttacgcggtctcccc
AB056515_FT00000_P-G      ctgccgttcctgccgaccacggggcgcacctctctttacgcggtctcccc
KF414679_FT00000_P-G      ctgccgttcctgccgaccacggggcgcacctctctttacgcggtctcccc
KR230749_FT00000_P-G      ctgccgttcctgccgaccacggggcgcacctctctttacgcggtctcccc
KM998716_FT00000_P-G      ctgccgttcctgccgaccacggggcgcacctctctttacgcggtctcccc
AB064313_FT00000_C-G      ctgccgttcctgccgaccacggggcgcacctctctttacgcggtctcccc
AB064311_FT00000_P-G      ctgccgttcctgccgaccacggggcgcacctctctttacgcggtctcccc
EF634480_FT00000_P-G      ctgtcgttcctgccgaccacggggcgcacctctctttacgcggtctcccc
AB064312_FT00000_P-G      ctgccgttcctgccgaccacggggcgcacctctctttacgcggtctcccc
HE981174_FT00000_P-G      ctgtcgttcctgccgaccacggggcgcacctctatttacgcggtctcccc
KY004111_FT00000_P-G      ctgccgttcctgccgaccacggggcgcacctctctttacgcggtctcccc
HE981175_FT00000_P-G      ctgccgttcctgccgaccacggggcgcacctctctttacgcggtctcccc
HE981176_FT00000_P-G      ctgccgttcctgccgaccacggggcgcacctctctttacgcggtctcccc
GU563556_FT00000_P-G      ctgccgttcctgccgaccacggggcgcacctctctttacgcggtctcccc
AB375165_FT00000_P-G      ctgccgttcctgccgaccacggggcgcacctctctttacgcggtctcccc
AB064310_FT00000_P-G      ctgccgttcctgccgaccacggggcgcacctctctttacgcggtctcccc
AB056513_FT00000_P-G      ctgccgttcctgccgaccacggggcgcacctctctttacgcggtctcccc
AB375166_FT00000_P-G      ctgccgttcctgccgaccacggggcgcacctctctttacgcggtctcccc
AB375167_FT00000_P-G      ctgccgttcctgccgaccacggggcgcacctctctttacgcggtctcccc
AB375169_FT00000_P-G      ctgccgttcctgccgaccacggggcgcacctctctttacgcggtctcccc
AB375170_FT00000_P-G      ctgccgttcctgccgaccacggggcgcacctctctttacgcggtctcccc
AB375168_FT00000_P-G      ctgccgttcctgccgaccacggggcgcacctctctttacgcggtctcccc
KJ194508_FT00000_P-G      ctgccgttcctgccgaccacggggcgcacctctctttacgcggtctcccc
KF767450_FT00000_P-G      ctgccgttcctgccgaccacggggcgcacctctctttacgcggtctcccc
AF405706_FT00000_P-G      ctgccgttcctgccgaccacggggcgcacctctctttacgcggtctcccc
AF160501_FT00000_C-G      ctgccgttcctgccgaccacggggcgcacctctctttacgcggtctcccc
KX264500_FT00000_P-G      ctgccgttcctgccgaccacggggcgcacctctctttacgcggtctcccc
FJ023674_FT00000_P-G      ctgccgtaccggccgwccacggggcgcacctctctttacgcggactcccc
FR714503_FT00000_P-G      ctgccgtaccgaccgtccacggggcgcacctctctttacgcggtctcccc
                          *** *** **  *** ***************** ********* ***** 

EF464097_FT00000_P-G      gtctgttccttctcatctgccggaccgtgtgcactttgcttcacctctgc
EF464098_FT00000_P-G      gtctgttccttctcatctgccggaccgtgtgcactttgcttcacctctgc
JQ707677_FT00000_P-G      gtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
JQ707678_FT00000_P-G      gtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
JQ707679_FT00000_P-G      gtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
JQ707671_FT00000_P-G      gtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
JQ707680_FT00000_P-G      gtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
JQ707673_FT00000_P-G      gtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
JQ707666_FT00000_P-G      gtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
JQ707660_FT00000_P-G      gtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
JQ707657_FT00000_P-G      gtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
JQ707668_FT00000_P-G      gtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
AB056515_FT00000_P-G      gtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
KF414679_FT00000_P-G      gtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
KR230749_FT00000_P-G      gtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
KM998716_FT00000_P-G      gtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
AB064313_FT00000_C-G      gtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
AB064311_FT00000_P-G      gtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
EF634480_FT00000_P-G      gtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
AB064312_FT00000_P-G      gtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
HE981174_FT00000_P-G      gtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
KY004111_FT00000_P-G      gtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
HE981175_FT00000_P-G      gtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
HE981176_FT00000_P-G      gtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
GU563556_FT00000_P-G      gtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
AB375165_FT00000_P-G      gtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
AB064310_FT00000_P-G      gtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
AB056513_FT00000_P-G      gtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
AB375166_FT00000_P-G      gtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
AB375167_FT00000_P-G      gtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
AB375169_FT00000_P-G      gtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
AB375170_FT00000_P-G      gtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
AB375168_FT00000_P-G      gtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
KJ194508_FT00000_P-G      gtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
KF767450_FT00000_P-G      gtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
AF405706_FT00000_P-G      gtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
AF160501_FT00000_C-G      gtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
KX264500_FT00000_P-G      gtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
FJ023674_FT00000_P-G      gagtgtgccttttcatctgccggaccgtgtgcacttcgcttcacctctgc
FR714503_FT00000_P-G      gtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
                          *  *** **** ************************ *************

EF464097_FT00000_P-G      acgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagt
EF464098_FT00000_P-G      acgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagt
JQ707677_FT00000_P-G      acgttacatggaaaccgccatgaacacctctcatcatctgccaaagcagt
JQ707678_FT00000_P-G      acgttacatggaaaccgccatgaacacctctcatcatctgccaaagcagt
JQ707679_FT00000_P-G      acgttacatggaaaccgccatgaacacctctcatcatctgccaaagcagt
JQ707671_FT00000_P-G      acgttacatggaaaccgccatgaacacctctcatcatctgccaaagcagt
JQ707680_FT00000_P-G      acgttacatggaaaccgccatgaacacctctcatcatctgccaaagcagt
JQ707673_FT00000_P-G      acgttacatggaaaccgccatgaacacctctcatcatctgccaaagcagt
JQ707666_FT00000_P-G      acgttacatggaaaccgccatgaacacctctcatcatctgccaaagcagt
JQ707660_FT00000_P-G      acgttacatggaaaccgccatgaacacctctcatcatctgccaaagcagt
JQ707657_FT00000_P-G      acgttacatggaaaccgccatgaacacctctcatcatctgccaaagcagt
JQ707668_FT00000_P-G      acgttacatggaaaccgccatgaacacctctcatcatctgccaaagcagt
AB056515_FT00000_P-G      acgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagt
KF414679_FT00000_P-G      acgttacatggaaaccgccatgaacacctctcatcctctgccaaggcagt
KR230749_FT00000_P-G      acgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagt
KM998716_FT00000_P-G      acgttacatggaaaccgccatgaacacctctcatcctctgccaaagcagt
AB064313_FT00000_C-G      acgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagt
AB064311_FT00000_P-G      acgttacatggaaaccgccatgaacacctatcatcatctgccaaggcagt
EF634480_FT00000_P-G      acgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagt
AB064312_FT00000_P-G      acgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagt
HE981174_FT00000_P-G      acgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagt
KY004111_FT00000_P-G      acgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagt
HE981175_FT00000_P-G      acgttacatggaaaccgccatgaacacctctcatcatctaccaaggcagt
HE981176_FT00000_P-G      acgttacatggaaaccgccatgaacacctctcatcatctaccaaggcagt
GU563556_FT00000_P-G      acgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagt
AB375165_FT00000_P-G      acgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagt
AB064310_FT00000_P-G      acgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagt
AB056513_FT00000_P-G      acgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagt
AB375166_FT00000_P-G      acgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagt
AB375167_FT00000_P-G      acgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagt
AB375169_FT00000_P-G      acgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagt
AB375170_FT00000_P-G      acgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagt
AB375168_FT00000_P-G      acgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagt
KJ194508_FT00000_P-G      acgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagt
KF767450_FT00000_P-G      acgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagt
AF405706_FT00000_P-G      acgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagt
AF160501_FT00000_C-G      acgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagt
KX264500_FT00000_P-G      acgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagt
FJ023674_FT00000_P-G      acgtcgcatggaaaccaccgtgaacgcccacctggtattgcccaaggtat
FR714503_FT00000_P-G      acgtcgcatggagaccaccgtgaacgcccacttgagcttgcccaaggtat
                          ****  ****** *** ** ***** **          * ** * *   *

EF464097_FT00000_P-G      tatataagaggactcttggactgtttgttatgtcaacaaccggggtggag
EF464098_FT00000_P-G      tatataagaggactcttggactgtttgttatgtcaacaaccggggtggag
JQ707677_FT00000_P-G      tatataagaggactcttggactgtttgttatgtcaacaaccggggtggag
JQ707678_FT00000_P-G      tatataagaggactcttggactgtttgttatgtcaacaaccggggtggag
JQ707679_FT00000_P-G      tatataagaggactcttggactgtttgttatgtcaacaaccggggtggag
JQ707671_FT00000_P-G      tatataagaggactcttggactgtttgttatgtcaacaaccggggtggag
JQ707680_FT00000_P-G      tatataagaggactcttggactgtttgttatgtcaacaaccggggtggag
JQ707673_FT00000_P-G      tatataagaggactcttggactgtttgttatgtcaacaaccggggtggag
JQ707666_FT00000_P-G      tatataagaggactcttggactgtttgttatgtcaacaaccggggtggag
JQ707660_FT00000_P-G      tatataagaggactcttggactgtttgttatgtcaacaaccggggtggag
JQ707657_FT00000_P-G      tatataagaggactcttggactgtttgttatgtcaacaaccggggtggag
JQ707668_FT00000_P-G      tatataagaggactcttggactgtttgttatgtcaacaaccggggtggag
AB056515_FT00000_P-G      tatataagaggactcttggactgtttgttatgtcaacaaccggggtggag
KF414679_FT00000_P-G      tatataagaggactcttggactgtttgttatgtcaacaaccggggtggag
KR230749_FT00000_P-G      tatataagaggactcttggactgtttgttatgtcaacaaccggggtggag
KM998716_FT00000_P-G      tatataagaggactcttggactgtttgttatgtcaacaaccggggtggag
AB064313_FT00000_C-G      tatataagaggactcttggactgtttgttatgtcaacaaccggggtggag
AB064311_FT00000_P-G      tatataagaggactcttggactgtttgttatgtcaacaaccggggtggag
EF634480_FT00000_P-G      tatataagaggactcttggactgtttgttatgtcaacaaccggggtggag
AB064312_FT00000_P-G      tatataagaggactcttggactgtttgttatgtcaacaaccggggtggag
HE981174_FT00000_P-G      tatataagaggactcttggactgtttgttatgtcaacaaccgggatggag
KY004111_FT00000_P-G      tatataagaggactcttggactgtttgttatgtcaacaaccggggtggag
HE981175_FT00000_P-G      tatataagaggactcttggactgtttgttatgtcaacaaccgggatggag
HE981176_FT00000_P-G      tatataagaggactcttggactgtttgttatgtcaacaaccgggatggag
GU563556_FT00000_P-G      tatataagaggactcttggactgtttgttatgtcaacaaccggggtggag
AB375165_FT00000_P-G      tatataagaggactcttggactgtttgttatgtcaacaaccggggtggag
AB064310_FT00000_P-G      tatataagaggactcttggactgtttgttatgtcaacaaccggggtggag
AB056513_FT00000_P-G      tatataagaggactcttggactgtttgttatgtcaacaaccggggtggag
AB375166_FT00000_P-G      tatataagaggactcttggactgtttgttatgtcaacaaccggggtggag
AB375167_FT00000_P-G      tatataagaggactcttggactgtttgttatgtcaacaaccggggtggag
AB375169_FT00000_P-G      tatataagaggactcttggactgtttgttatgtcaacaaccggggtggag
AB375170_FT00000_P-G      tatataagaggactcttggactgtttgttatgtcaacaaccggggtggag
AB375168_FT00000_P-G      tatataagaggactcttggactgtttgttatgtcaacaaccggggtggag
KJ194508_FT00000_P-G      tatataagaggactcttggactgtttgttatgtcaacaaccgggatggag
KF767450_FT00000_P-G      tatataagaggactcttggactgtttgttatgtcaacaaccggggtggag
AF405706_FT00000_P-G      tatataagaggactcttggactgtttgttatgtcaacaaccggggtggag
AF160501_FT00000_C-G      tatataagtggactcttggactgtttgttatgtcaacaaccggggtggag
KX264500_FT00000_P-G      tatataagaggactcttggactgtttgttatgtcaacaaccggggtggag
FJ023674_FT00000_P-G      tgcataagaggactcttggactctctgcaatgtcaacgaccgaccttgag
FR714503_FT00000_P-G      tgcataagcggactcttggactctcagcaatgtcaacgaccgaccttgag
                          *  ***** ************* *  *  ******** ****   * ***

EF464097_FT00000_P-G      aaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatga
EF464098_FT00000_P-G      aaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatga
JQ707677_FT00000_P-G      aaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatga
JQ707678_FT00000_P-G      aaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatga
JQ707679_FT00000_P-G      aaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatga
JQ707671_FT00000_P-G      aaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatga
JQ707680_FT00000_P-G      aaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatga
JQ707673_FT00000_P-G      aaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatga
JQ707666_FT00000_P-G      aaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatga
JQ707660_FT00000_P-G      aaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatga
JQ707657_FT00000_P-G      aaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatga
JQ707668_FT00000_P-G      aaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatga
AB056515_FT00000_P-G      aaatacttcaaggactgtgtgtttgctgagtgggaagaattaggcaatga
KF414679_FT00000_P-G      aaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatga
KR230749_FT00000_P-G      aaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatga
KM998716_FT00000_P-G      aaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatga
AB064313_FT00000_C-G      aaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatga
AB064311_FT00000_P-G      aaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatga
EF634480_FT00000_P-G      aaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatga
AB064312_FT00000_P-G      aaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatga
HE981174_FT00000_P-G      aaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatga
KY004111_FT00000_P-G      aaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatga
HE981175_FT00000_P-G      aaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatga
HE981176_FT00000_P-G      aaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatga
GU563556_FT00000_P-G      aaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatga
AB375165_FT00000_P-G      aaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatga
AB064310_FT00000_P-G      aaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatga
AB056513_FT00000_P-G      aaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatga
AB375166_FT00000_P-G      aaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatga
AB375167_FT00000_P-G      aaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatga
AB375169_FT00000_P-G      aaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatga
AB375170_FT00000_P-G      aaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatga
AB375168_FT00000_P-G      aaatacttgaaggactgtgtttttgctgagtgggaagaattaggcaatga
KJ194508_FT00000_P-G      aaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatga
KF767450_FT00000_P-G      aaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatga
AF405706_FT00000_P-G      aaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatga
AF160501_FT00000_C-G      aaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatga
KX264500_FT00000_P-G      aaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatga
FJ023674_FT00000_P-G      gcatacttcaaagactgtgtatttaaagactgggaggagttgggggagga
FR714503_FT00000_P-G      gcatacttcaaagactgtgtgtttaaagactgggaggagttgggggagga
                            ****** ** ******** ***   ** ***** ** ** **  * **

EF464097_FT00000_P-G      gtccaggttaatgacctttgtattaggaggctgtaggcataaattggtct
EF464098_FT00000_P-G      gtccaggttaatgacctttgtattaggaggctgtaggcataaattggtct
JQ707677_FT00000_P-G      gtccaggttaatgacctttgtattaggaggctgtaggcataaattggtct
JQ707678_FT00000_P-G      gtccaggttaatgacctttgtattaggaggctgtaggcataaattggtct
JQ707679_FT00000_P-G      gtccaggttaatgacctttgtattaggaggctgtaggcataaattggtct
JQ707671_FT00000_P-G      gtccaggttaatgacctttgtattaggaggctgtaggcataaattggtct
JQ707680_FT00000_P-G      gtccaggttaatgacctttgtattaggaggctgtaggcataaattggtct
JQ707673_FT00000_P-G      gtccaggttaatgacctttgtattaggaggctgtaggcataaattggtct
JQ707666_FT00000_P-G      gtccaggttaatgacctttgtattaggaggctgtaggcataaattggtct
JQ707660_FT00000_P-G      gtccaggttaatgacctttgtattaggaggctgtaggcataaattggtct
JQ707657_FT00000_P-G      gtccaggttaatgacctttgtattaggaggctgtaggcataaattggtct
JQ707668_FT00000_P-G      gtccaggttaatgacctttgtattaggaggctgtaggcataaattggtct
AB056515_FT00000_P-G      gtccaggttaatgacctttgtattaggaggctgtaggcataaattggtct
KF414679_FT00000_P-G      gtccaggttaatgacctttgtattaggaggctgtaggcataaattggtct
KR230749_FT00000_P-G      gtccaggttaatgacctttgtattaggaggctgtaggcataaattggtct
KM998716_FT00000_P-G      gtccaggttaatgatctatgtattaggaggctgtaggcataaattggtct
AB064313_FT00000_C-G      gtccaggttaatgacctttgtattaggaggctgcaggcataaattggtct
AB064311_FT00000_P-G      gtccaggttaatgacctttgtattaggaggctgtaggcataaattggtct
EF634480_FT00000_P-G      gtccaggttaatgacctttgtattaggaggctgtaggcataaattggtct
AB064312_FT00000_P-G      gtccaggttaatgacctttgtattaggaggctgtaggcataaattggtct
HE981174_FT00000_P-G      gtccaggttaatgacctttgtattaggaggctgtaggcataaattggtct
KY004111_FT00000_P-G      gtccaggttaatgacctttgtattaggaggctgtaggcataaattggtct
HE981175_FT00000_P-G      gtccaggttaatgacctttgtattaggaggctgtaggcataaattggtct
HE981176_FT00000_P-G      gtccaggttaatgacctttgtattaggaggctgtaggcataaattggtct
GU563556_FT00000_P-G      gtccaggttaatgacctttgtattaggaggctgtaggcataaatgggtct
AB375165_FT00000_P-G      gtccaggttaatgacctttgtattaggaggctgtaggcataaattggtct
AB064310_FT00000_P-G      gtccaggttaatgacctttgtattaggaggctgtaggcataaattggtct
AB056513_FT00000_P-G      gtccaggttaatgacctttgtattaggaggctgtaggcataaattggtct
AB375166_FT00000_P-G      gtccaggttaatgacctttgtattaggaggctgtaggcataaattggtct
AB375167_FT00000_P-G      gtccaggttaatgacctttgtattaggaggctgtaggcataaattggtct
AB375169_FT00000_P-G      gtccaggttaatgacctttgtattaggaggctgtaggcataaattggtct
AB375170_FT00000_P-G      gtccaggttaatgacctttgtattaggaggctgtaggcataaattggtct
AB375168_FT00000_P-G      gtccaggttaatgacctttgtattaggaggctgtaggcataaattggtct
KJ194508_FT00000_P-G      gtccaggttaatgacctttgtattaggaggctgtaggcataaattggtct
KF767450_FT00000_P-G      gtccaggttaatgacctttgtattaggaggctgtaggcataaattggtct
AF405706_FT00000_P-G      gtccaggttaatgacctttgtattaggaggctgtaggcataaattggtct
AF160501_FT00000_C-G      gtccaggttaatgacctttgtattaggaggctgtaggcataaattggtct
KX264500_FT00000_P-G      gtccaggttaatgacctttgtattaggaggctgtaggcataaattggtct
FJ023674_FT00000_P-G      gattaggttaaaggtctttgtactgggaggctgtaggcataaattggtct
FR714503_FT00000_P-G      gattaggttaatgatctttgtactaggaggctgtaggcataaattggtct
                          *   ******* *  ** **** * ******** ********** *****

EF464097_FT00000_P-G      gcgcaccagcaccatgtaactttttcacctctgcctaatcatctcttgtt
EF464098_FT00000_P-G      gcgcaccagcaccatgtaactttttcacctctgcctaatcatctcttgtt
JQ707677_FT00000_P-G      gttcaccagcaccatgcaactttttcacctctgcctaatcatctcttgtt
JQ707678_FT00000_P-G      gttcaccagcaccatgcaactttttcacctctgcctaatcatctcttgtt
JQ707679_FT00000_P-G      gttcaccagcaccatgcaactttttcacctctgcctaatcatctcttgtt
JQ707671_FT00000_P-G      gttcaccagcaccatgcaactttttcacctctgcctaatcatctcttgtt
JQ707680_FT00000_P-G      gttcaccagcaccatgcaactttttcacctctgcctaatcatctcttgtt
JQ707673_FT00000_P-G      gttcaccagcaccatgcaactttttcacctctgcctaatcatctcttgtt
JQ707666_FT00000_P-G      gttcaccagcaccatgcaactttttcacctctgcctaatcatctcttgtt
JQ707660_FT00000_P-G      gttcaccagcaccatgcaactttttcacctctgcctaatcatctcttgtt
JQ707657_FT00000_P-G      gttcaccagcaccatgcaactttttcacctctgcctaatcatctcttgtt
JQ707668_FT00000_P-G      gttcaccagcaccatgcaactttttcacctctgcctaatcatctcttgtt
AB056515_FT00000_P-G      gcgcaccagcaccatgtaactttttcacctctgcctaatcatctcttgtt
KF414679_FT00000_P-G      gcgcaccagcaccatgcaactttttcacctctgcctaatcatctcttgtt
KR230749_FT00000_P-G      gcgcaccagcaccatgcaactttttcacctctgcctaatcatctcttgtt
KM998716_FT00000_P-G      gcgcaccagcaccatgtaactttttcacctctgcctaatcatctcttgtt
AB064313_FT00000_C-G      gcgcaccagcaccatgtaactttttcacctctgcctaatcatctcttgtt
AB064311_FT00000_P-G      gcgcaccagcaccatgtaactttttcacctctgcctaatcatctcttgtt
EF634480_FT00000_P-G      gcgcaccagcaccatgtaactttttcacctctgcctaatcatctcttgtt
AB064312_FT00000_P-G      gcgcaccagcaccatgtaactttttcacctctgcctaatcatctcttgtt
HE981174_FT00000_P-G      gcgcaccagcaccatgtaactttttcacctctgcctaatcatctcttgtt
KY004111_FT00000_P-G      gcgcaccagcaccatgtaactttttcacctctgcctaatcatctcttgtt
HE981175_FT00000_P-G      gcgcaccagcaccatgtaactttttcacctctgcctaatcatctcttgtt
HE981176_FT00000_P-G      gcgcaccagcaccatgtaactttttcacctctgcctaatcatctcttgtt
GU563556_FT00000_P-G      gcgcaccagcaccatgcaactttttcacctctgcctaatcatctcttgtt
AB375165_FT00000_P-G      gcgcaccagcaccatgtaactttttcacctctgcctaatcatctcttgtt
AB064310_FT00000_P-G      gcgcaccagcaccatgtaactttttcacctctgcctaatcatctcttgtt
AB056513_FT00000_P-G      gcgcaccagcaccatgtaactttttcacctctgcctaatcatctcttgtt
AB375166_FT00000_P-G      gcgcaccagcaccatgtaactttttcacctctgcctaatcatctcttgtt
AB375167_FT00000_P-G      gcgcaccagcaccatgtaactttttcacctctgcctaatcatctcttgtt
AB375169_FT00000_P-G      gcgcaccagcaccatgtaactttttcacctctgcctaatcatctcttgtt
AB375170_FT00000_P-G      gcgcaccagcaccatgtaactttttcacctctgcctaatcatctcttgtt
AB375168_FT00000_P-G      gcgcaccagcaccatgtaactttttcacctctgcctaatcatctcttgtt
KJ194508_FT00000_P-G      gcgcaccagcaccatgtaactttttcacctctgcctaatcatctcttgtt
KF767450_FT00000_P-G      gcgcaccagcaccatgtaactttttcacctctgcctaatcatctcttgtt
AF405706_FT00000_P-G      gcgcaccagcaccatgtaactttttcacctctgcctaatcatctcttgtt
AF160501_FT00000_C-G      gcgcaccagcaccatgtaactttttcacctctgcctaatcatctcttgtt
KX264500_FT00000_P-G      gcgcaccagcaccatgtaactttttcacctctgcctaatcatctcttgtt
FJ023674_FT00000_P-G      gttcaccaacaccatgcaactttttcacctctgcctaatcatctcatgtt
FR714503_FT00000_P-G      gttcaccagcaccatgcaactttttcacctctgcctaatcatctcatgtt
                          *  ***** ******* **************************** ****

EF464097_FT00000_P-G      catgtcctactgttcaagcctccaagctgtgccttgggtggctttagggc
EF464098_FT00000_P-G      catgtcctactgttcaagcctccaagctgtgccttgggtggctttagggc
JQ707677_FT00000_P-G      catgtcccactgttcaagcctccaagctgtgccttgggtggctttagggc
JQ707678_FT00000_P-G      catgtcccactgttcaagcctccaagctgtgccttgggtggctttagggc
JQ707679_FT00000_P-G      catgtcccactgttcaagcctccaagctgtgccttgggtggctttagggc
JQ707671_FT00000_P-G      catgtcccactgttcaagcctccaagctgtgccttgggtggctttagggc
JQ707680_FT00000_P-G      catgtcccactgttcaagcctccaagctgtgccttgggtggctttagggc
JQ707673_FT00000_P-G      catgtcccactgttcaagcctccaagctgtgccttgggtggctttagggc
JQ707666_FT00000_P-G      catgtcccactgttcaagcctccaagctgtgccttgggtggctttagggc
JQ707660_FT00000_P-G      catgtcccactgttcaagcctccaagctgtgccttgggtggctttagggc
JQ707657_FT00000_P-G      catgtcccactgttcaagcctccaagctgtgccttgggtggctttagggc
JQ707668_FT00000_P-G      catgtcccactgttcaagcctccaagctgtgccttgggtggctttagggc
AB056515_FT00000_P-G      catgtcctactgttcaagcctccaagctgtgccttgggtggctttagggc
KF414679_FT00000_P-G      catgtcctactgttcaagcctccaagctgtgccttgggtggctttagggc
KR230749_FT00000_P-G      catgtcctactgttcaagcctccaagctgtgccttgggtggctttagggc
KM998716_FT00000_P-G      catgtcctactgttcaagcctccaagctgtgccttgggtggctttagggc
AB064313_FT00000_C-G      catgtcctactgttcaagcctccaagctgtgccttgggtggctttagggc
AB064311_FT00000_P-G      catgtcctactgttcaagcctccaagctgtgccttgggtggctttagggc
EF634480_FT00000_P-G      catgtcctactgttcaagcctccaagctgtgccttgggtggctttagggc
AB064312_FT00000_P-G      catgtcctactgttcaagcctccaagctgtgccttgggtggctttagggc
HE981174_FT00000_P-G      catgtcctactgttcaagcctccaagctgtgccttgggtggctttagggc
KY004111_FT00000_P-G      catgtcctactgttcaagcctccaagctgtgccttgggtggctttagggc
HE981175_FT00000_P-G      catgtcctactgttcaagcctccaagctgtgccttgggtggctttagggc
HE981176_FT00000_P-G      catgtcctactgttcaagcctccaagctgtgccttgggtggctttagggc
GU563556_FT00000_P-G      catgtcctactgttcaagcctccaagctgtgccttgggtggctttagggc
AB375165_FT00000_P-G      catgtcctactgttcaagcctccaagctgtgccttgggtggctttagggc
AB064310_FT00000_P-G      catgtcctactgttcaagcctccaagctgtgccttgggtggctttagggc
AB056513_FT00000_P-G      catgtcctactgttcaagcctccaagctgtgccttgggtggctttagggc
AB375166_FT00000_P-G      catgtcctactgttcaagcctccaagctgtgccttgggtggctttagggc
AB375167_FT00000_P-G      catgtcctactgttcaagcctccaagctgtgccttgggtggctttagggc
AB375169_FT00000_P-G      catgtcctactgttcaagcctccaagctgtgccttgggtggctttagggc
AB375170_FT00000_P-G      catgtcctactgttcaagcctccaagctgtgccttgggtggctttagggc
AB375168_FT00000_P-G      catgtcctactgttcaagcctccaagctgtgccttgggtggctttagggc
KJ194508_FT00000_P-G      catgtcctactgttcaagcctccaagctgtgccttgggtggctttagggc
KF767450_FT00000_P-G      catgtcctactgttcaagcctccaagctgtgccttgggtggctttagggc
AF405706_FT00000_P-G      catgtcctactgttcaagcctccaagctgtgccttgggtggctttagggc
AF160501_FT00000_C-G      catgtcctactgttcaagcctccaagctgtgccttgggtggctttagggc
KX264500_FT00000_P-G      catgtcctactgttcaagcctccaagctgtgccttgggtggctttagggc
FJ023674_FT00000_P-G      catgtcctactgttcaagcctccaagctgtgccttgggtggctttggggc
FR714503_FT00000_P-G      catgtcctactgttcaagcctccaagctgtgccttgggtggctttaggac
                          ******* ************************************* ** *

EF464097_FT00000_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
EF464098_FT00000_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
JQ707677_FT00000_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
JQ707678_FT00000_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
JQ707679_FT00000_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
JQ707671_FT00000_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
JQ707680_FT00000_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
JQ707673_FT00000_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
JQ707666_FT00000_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
JQ707660_FT00000_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
JQ707657_FT00000_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
JQ707668_FT00000_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
AB056515_FT00000_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
KF414679_FT00000_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
KR230749_FT00000_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
KM998716_FT00000_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
AB064313_FT00000_C-G      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
AB064311_FT00000_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
EF634480_FT00000_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
AB064312_FT00000_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
HE981174_FT00000_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
KY004111_FT00000_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
HE981175_FT00000_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
HE981176_FT00000_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
GU563556_FT00000_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
AB375165_FT00000_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
AB064310_FT00000_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
AB056513_FT00000_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
AB375166_FT00000_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
AB375167_FT00000_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
AB375169_FT00000_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
AB375170_FT00000_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
AB375168_FT00000_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
KJ194508_FT00000_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
KF767450_FT00000_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
AF405706_FT00000_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
AF160501_FT00000_C-G      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
KX264500_FT00000_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgaccc
FJ023674_FT00000_P-G      atg------------------------------------gacattgaccc
FR714503_FT00000_P-G      atg------------------------------------gacattgaccc
                          ***                                    ***********

EF464097_FT00000_P-G      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
EF464098_FT00000_P-G      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
JQ707677_FT00000_P-G      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
JQ707678_FT00000_P-G      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
JQ707679_FT00000_P-G      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
JQ707671_FT00000_P-G      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
JQ707680_FT00000_P-G      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
JQ707673_FT00000_P-G      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
JQ707666_FT00000_P-G      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
JQ707660_FT00000_P-G      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
JQ707657_FT00000_P-G      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
JQ707668_FT00000_P-G      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
AB056515_FT00000_P-G      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
KF414679_FT00000_P-G      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
KR230749_FT00000_P-G      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
KM998716_FT00000_P-G      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
AB064313_FT00000_C-G      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
AB064311_FT00000_P-G      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
EF634480_FT00000_P-G      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
AB064312_FT00000_P-G      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
HE981174_FT00000_P-G      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
KY004111_FT00000_P-G      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
HE981175_FT00000_P-G      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
HE981176_FT00000_P-G      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
GU563556_FT00000_P-G      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
AB375165_FT00000_P-G      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
AB064310_FT00000_P-G      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
AB056513_FT00000_P-G      ttataaagaatttggagctactgtggagttactctcgtttttgccttctg
AB375166_FT00000_P-G      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
AB375167_FT00000_P-G      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
AB375169_FT00000_P-G      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
AB375170_FT00000_P-G      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
AB375168_FT00000_P-G      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
KJ194508_FT00000_P-G      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
KF767450_FT00000_P-G      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
AF405706_FT00000_P-G      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
AF160501_FT00000_C-G      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
KX264500_FT00000_P-G      ttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
FJ023674_FT00000_P-G      gtataaagaatttggagcttctgtggagttactctcttttttgccttctg
FR714503_FT00000_P-G      ttataaagaatttggagcttctgtggagttactctcttttttgcctactg
                           ****************** ********** ***** ********* ***

EF464097_FT00000_P-G      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
EF464098_FT00000_P-G      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
JQ707677_FT00000_P-G      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
JQ707678_FT00000_P-G      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
JQ707679_FT00000_P-G      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
JQ707671_FT00000_P-G      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
JQ707680_FT00000_P-G      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
JQ707673_FT00000_P-G      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
JQ707666_FT00000_P-G      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
JQ707660_FT00000_P-G      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
JQ707657_FT00000_P-G      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
JQ707668_FT00000_P-G      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
AB056515_FT00000_P-G      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
KF414679_FT00000_P-G      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
KR230749_FT00000_P-G      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
KM998716_FT00000_P-G      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
AB064313_FT00000_C-G      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
AB064311_FT00000_P-G      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
EF634480_FT00000_P-G      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
AB064312_FT00000_P-G      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
HE981174_FT00000_P-G      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
KY004111_FT00000_P-G      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
HE981175_FT00000_P-G      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
HE981176_FT00000_P-G      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
GU563556_FT00000_P-G      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
AB375165_FT00000_P-G      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
AB064310_FT00000_P-G      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
AB056513_FT00000_P-G      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
AB375166_FT00000_P-G      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
AB375167_FT00000_P-G      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
AB375169_FT00000_P-G      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
AB375170_FT00000_P-G      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
AB375168_FT00000_P-G      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
KJ194508_FT00000_P-G      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
KF767450_FT00000_P-G      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
AF405706_FT00000_P-G      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
AF160501_FT00000_C-G      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
KX264500_FT00000_P-G      actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtac
FJ023674_FT00000_P-G      acttctttccgtctattcgggatctcctcgacaccgcctctgctctgtat
FR714503_FT00000_P-G      atttctttccgtctattcgggaccttctcgacaccgcatcagctctgtat
                          * ** ** ****** **** ** ** *********** ** *** **** 

EF464097_FT00000_P-G      cgggaatccttagagtcctctgatcattgttcgcctcaccatacagcact
EF464098_FT00000_P-G      cgggaatccttagagtcctctgatcattgttcgcctcaccatacagcact
JQ707677_FT00000_P-G      cgggaatccttagagtcctctgatcattgttcgcctcaccatacagcact
JQ707678_FT00000_P-G      cgggaatccttagagtcctctgatcattgttcgcctcaccatacagcact
JQ707679_FT00000_P-G      cgggaatccttagagtcctctgatcattgttcgcctcaccatacagcact
JQ707671_FT00000_P-G      cgggaatccttagagtcctctgatcattgttcgcctcaccatacagcact
JQ707680_FT00000_P-G      cgggaatccttagagtcctctgatcattgttcgcctcaccatacagcact
JQ707673_FT00000_P-G      cgggaatccttagagtcctctgatcattgttcgcctcaccatacagcact
JQ707666_FT00000_P-G      cgggaatccttagagtcctctgatcattgttcgcctcaccatacagcact
JQ707660_FT00000_P-G      cgggaatccttagagtcctctgatcattgttcgcctcaccatacagcact
JQ707657_FT00000_P-G      cgggaatccttagagtcctctgatcattgttcgcctcaccatacagcact
JQ707668_FT00000_P-G      cgggaatccttagagtcctctgatcattgttcgcctcaccatacagcact
AB056515_FT00000_P-G      cgggaatccttagagtcctctgttcattgttcgcctcaccatacagcact
KF414679_FT00000_P-G      cgggaatccttagagtcctctgatcattgttcgcctcaccatacagcact
KR230749_FT00000_P-G      cgggaatccttagagtcctctgatcattgttcgcctcaccatacagcact
KM998716_FT00000_P-G      cgggaatccttagagtcctctgatcattgttcgcctcaccatacagcact
AB064313_FT00000_C-G      cgggaatccttagagtcctctgatcattgttcgcctcaccatacagcact
AB064311_FT00000_P-G      cgggaatccttagagtcctctgatcattgttcgcctcaccatacagcact
EF634480_FT00000_P-G      cgggaatccttagagtcctctgatcattgttcgcctcaccatacagcact
AB064312_FT00000_P-G      cgggaatccttagagtcctctgatcattgttcgcctcaccatgcagcact
HE981174_FT00000_P-G      cgggaatccttagagtcctctgatcattgttcgcctcaccatacagcact
KY004111_FT00000_P-G      cgggaagccttagagtcctttgatcattgttcgcctcaccatacagcact
HE981175_FT00000_P-G      cgggaatccttagagtcctctgatcattgttcgcctcaccatacagcact
HE981176_FT00000_P-G      cgggaatccttagagtcctctgatcattgttcgcctcaccatacagcact
GU563556_FT00000_P-G      cgggaatccttagagtcctctgagcattgttcgcctcaccatacagcact
AB375165_FT00000_P-G      cgggaatccttagagtcctctgatcattgttcgcctcaccatacagcact
AB064310_FT00000_P-G      cgggaatccttagagtcctctgatcattgttcgcctcaccatacagcact
AB056513_FT00000_P-G      cgggaatccttagagtcctctgatcattgttcgcctcaccatacagcact
AB375166_FT00000_P-G      cgggaatccttagagtcctctgatcattgttcgcctcaccatacagcact
AB375167_FT00000_P-G      cgggaatccttagagtcctctgatcattgttcgcctcaccatacagcact
AB375169_FT00000_P-G      cgggaatccttagagtcctctgatcattgttcgcctcaccatacagcact
AB375170_FT00000_P-G      cgggaatccttagagtcctctgatcattgttcgcctcaccatacagcact
AB375168_FT00000_P-G      cgggaatccttagagtcctctgatcattgttcgcctcaccatacagcact
KJ194508_FT00000_P-G      cgggaatccttagagtcctctgatcattgttcgcctcaccatacagcact
KF767450_FT00000_P-G      cgggaatccttagagtcctctgatcattcttcgcctcaccatacagcact
AF405706_FT00000_P-G      cgggaatccttagagtcctctgatcattgttcgcctcaccatacagcact
AF160501_FT00000_C-G      cgggaatccttagagtcctctgatcattgttcgcctcaccatacagcact
KX264500_FT00000_P-G      cgggaatccttagagtcctctgatcattgttcgcctcaccatacagcact
FJ023674_FT00000_P-G      cgggaggccttagagtctccggaacattgttcacctcaccatacagcact
FR714503_FT00000_P-G      cgagaggccttagagtctccagaacattgttcacctcaccatacagcaat
                          ** **  **********    *  **** *** ********* ***** *

EF464097_FT00000_P-G      caggcaagcaatcctgtgctggggtgagttgatgactctagctacctggg
EF464098_FT00000_P-G      caggcaagcaatcctgtgctggggtgagttgatgactctagctacctggg
JQ707677_FT00000_P-G      caggcaagcaatcctgtgctggggtgagttgatgactctagctacctggg
JQ707678_FT00000_P-G      caggcaagcaatcctgtgctggggtgagttgatgactctagctacctggg
JQ707679_FT00000_P-G      caggcaagcaatcctgtgctggggtgagttgatgactctagctacctggg
JQ707671_FT00000_P-G      caggcaagcaatcctgtgctggggtgagttgatgactctagctacctggg
JQ707680_FT00000_P-G      caggcaagcaatcctgtgctggggtgagttgatgactctagctacctggg
JQ707673_FT00000_P-G      caggcaagcaatcctgtgctggggtgagttgatgactctagctacctggg
JQ707666_FT00000_P-G      caggcaagcaatcctgtgctggggtgagttgatgactctagctacctggg
JQ707660_FT00000_P-G      caggcaagcaatcctgtgctggggtgagttgatgactctagctacctggg
JQ707657_FT00000_P-G      caggcaagcaatcctgtgctggggtgagttgatgactctagctacctggg
JQ707668_FT00000_P-G      caggcaagcaatcctgtgctggggtgagttgatgactctagctacctggg
AB056515_FT00000_P-G      caggcaagcaatcctgtgctggggtgagttgatgactctagctacctggg
KF414679_FT00000_P-G      caggcaagcaatcctgtgctggggtgagttgatgactctagctacctggg
KR230749_FT00000_P-G      caggcaagcaatcctgtgctggggtgagttgatgactctagctacctggg
KM998716_FT00000_P-G      caggcaagcaatcctgtgctggggtgagttgatgactctagccacctggg
AB064313_FT00000_C-G      caggcaagcaatcctgtgctggggtgagttgatgactctagccacctggg
AB064311_FT00000_P-G      caggcaagcaatcctgtgctggggtgagttgatgactctagctacctggg
EF634480_FT00000_P-G      caggcaagcaatcctgtgctggggtgagttgatgactctagctacctggg
AB064312_FT00000_P-G      caggcaagcaatcctgtgctggggtgagttgatgactctagctacctggg
HE981174_FT00000_P-G      caggcaagcaattctgtgctggggtgagttgatgactctagctacctggg
KY004111_FT00000_P-G      caggcaagcaatcctgtgctggggtgagttgatgactctagccacctggg
HE981175_FT00000_P-G      caggcaagcaattctgtgctggggtgagttgatgactctagctacctggg
HE981176_FT00000_P-G      caggcaagcaattctgtgctggggtgagttgatgactctagctacctggg
GU563556_FT00000_P-G      caggcaagcaatcctgtgctggggtgagttgatgactctagctacctggg
AB375165_FT00000_P-G      caggcaagcaatcctgtgctggggtgagttgatgactctagccacctggg
AB064310_FT00000_P-G      caggcaagcaatcctgtgctggggtgagttgatgactctagccacctggg
AB056513_FT00000_P-G      caggcaagcaatcctgtgctggggtgagttgatgactctagctacctggg
AB375166_FT00000_P-G      caggcaagcaatcctgtgctggggtgagttgatgactctagccacctggg
AB375167_FT00000_P-G      caggcaagcaatcctgtgctggggtgagttgatgactctagccacctggg
AB375169_FT00000_P-G      caggcaagcaatcctgtgctggggtgagttgatgactctagccacctggg
AB375170_FT00000_P-G      caggcaagcaatcctgtgctggggtgagttgatgactctagccacctggg
AB375168_FT00000_P-G      caggcaagcaatcctgtgctggggtgagttgatgactctagccacctggg
KJ194508_FT00000_P-G      caggcaagcaattctgtgctggggtgagttgatgactctagctacctggg
KF767450_FT00000_P-G      caggcaagcaatcctgtgctggggtgagttgatgactctagccacctggg
AF405706_FT00000_P-G      caggcaagcaatcctgtgctggggtgagttgatgactctagctacctggg
AF160501_FT00000_C-G      caggcaagcaatcctgtgctggggtgagttgatgactctagctacctggg
KX264500_FT00000_P-G      caggcaagcaatcctgtgctggggtgagttgatgactctagctacctggg
FJ023674_FT00000_P-G      aaggcaagctattctgtgttggggtgagttgatgaatctggccacctggg
FR714503_FT00000_P-G      caggcaagcagttttgtgttggggtgagttgatgactctagctacctggg
                           ********  *  **** **************** *** ** *******

EF464097_FT00000_P-G      tgggtaataatttggaagatccagcatccagagatttggtggtcaattat
EF464098_FT00000_P-G      tgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JQ707677_FT00000_P-G      tgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JQ707678_FT00000_P-G      tgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JQ707679_FT00000_P-G      tgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JQ707671_FT00000_P-G      tgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JQ707680_FT00000_P-G      tgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JQ707673_FT00000_P-G      tgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JQ707666_FT00000_P-G      tgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JQ707660_FT00000_P-G      tgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JQ707657_FT00000_P-G      tgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JQ707668_FT00000_P-G      tgggtaataatttggaagatccagcatccagagatttggtggtcaattat
AB056515_FT00000_P-G      tgggtaataatttggaagatccagcatccagagatttggtggtcaattat
KF414679_FT00000_P-G      tgggtaataatttggaagatccagcatccagagatttggtggtcaattat
KR230749_FT00000_P-G      tgggtaataatttggaagatccagcatccagagatttggtggtcaattat
KM998716_FT00000_P-G      tgggtaataatttggaagatccagcatccagagatttggtggtcaattat
AB064313_FT00000_C-G      tgggtaataatttggaagatccagcatccagagatttggtggtcaattat
AB064311_FT00000_P-G      tgggtaataatttggaagatccagcatccagagatttggtggtcaattat
EF634480_FT00000_P-G      tgggtaataatttggaagatccagcatccagagatttggtggtcaattat
AB064312_FT00000_P-G      tgggtaataatttggaagatccagcatccagagatttggtggtcaattat
HE981174_FT00000_P-G      tgggtaataatttggaagatccagcatccagagatttggtggtcaattat
KY004111_FT00000_P-G      tgggtaataatttggaagatccagcatccagagatttggtggtcaattat
HE981175_FT00000_P-G      tgggtaataatttggaagatccagcatccagagatttggtggtcaattat
HE981176_FT00000_P-G      tgggtaataatttggaagatccagcatccagagatttggtggtcaattat
GU563556_FT00000_P-G      tgggtaataatttggaagatccagcatccagagatttggtggtcaattat
AB375165_FT00000_P-G      tgggtaataatttggaagatccagcatccagagatttggtggtcaattat
AB064310_FT00000_P-G      tgggtaataatttggaagatccagcatccagagatttggtggtcaattat
AB056513_FT00000_P-G      tgggtaataatttggaagatccagcatccagagatttggtggtcaattat
AB375166_FT00000_P-G      tgggtaataatttggaagatccagcatccagagatttggtggtcaattat
AB375167_FT00000_P-G      tgggtaataatttggaagatccagcatccagagatttggtggtcaattat
AB375169_FT00000_P-G      tgggtaataatttggaagatccagcatccagagatttggtggtcaattat
AB375170_FT00000_P-G      tgggtaataatttggaagatccagcatccagagatttggtggtcaattat
AB375168_FT00000_P-G      tgggtaataatttggaagatccagcatccagagatttggtggtcaattat
KJ194508_FT00000_P-G      tgggtaataatttggaagatccagcatccagagatttggtggtcaattat
KF767450_FT00000_P-G      tgggtaataatttggaagatccagcatccagagatttggtggtcaattat
AF405706_FT00000_P-G      tgggtaataatttggaagatccagcatccagagatttggtggtcaattat
AF160501_FT00000_C-G      tgggtaataatttggaagatccagcatccagagatttggtggtcaattat
KX264500_FT00000_P-G      tgggtaataatttggaagatccagcatccagagatttggtggtcaattat
FJ023674_FT00000_P-G      tgggaagtaatttggaagacccagcatccagggaattagtagtaagctat
FR714503_FT00000_P-G      tgggaagtaatttggacgaccctgcctccagggatttggtagtcagctat
                          **** * ********* ** ** ** ***** ** ** ** ** *  ***

EF464097_FT00000_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacat
EF464098_FT00000_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacat
JQ707677_FT00000_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacat
JQ707678_FT00000_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacat
JQ707679_FT00000_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacat
JQ707671_FT00000_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacat
JQ707680_FT00000_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacat
JQ707673_FT00000_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacat
JQ707666_FT00000_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacat
JQ707660_FT00000_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacat
JQ707657_FT00000_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacat
JQ707668_FT00000_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacat
AB056515_FT00000_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacat
KF414679_FT00000_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacat
KR230749_FT00000_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacat
KM998716_FT00000_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacat
AB064313_FT00000_C-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacat
AB064311_FT00000_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacat
EF634480_FT00000_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacat
AB064312_FT00000_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacat
HE981174_FT00000_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacat
KY004111_FT00000_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacat
HE981175_FT00000_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacat
HE981176_FT00000_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacat
GU563556_FT00000_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacat
AB375165_FT00000_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacat
AB064310_FT00000_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacat
AB056513_FT00000_P-G      gttaatactaatttgggtttaaaaatcaggcaactattgtggtttcacat
AB375166_FT00000_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacat
AB375167_FT00000_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacat
AB375169_FT00000_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacat
AB375170_FT00000_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacat
AB375168_FT00000_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacat
KJ194508_FT00000_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacat
KF767450_FT00000_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacat
AF405706_FT00000_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacat
AF160501_FT00000_C-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacat
KX264500_FT00000_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacat
FJ023674_FT00000_P-G      gtcaatgttaacatgggcctaaaaatcagacaactattgtggtttcacat
FR714503_FT00000_P-G      gtcaatgttaatatgggcctaaaaattagacaaatattatggtttcacat
                          ** ***  ***  ****  ******* ** *** **** ***********

EF464097_FT00000_P-G      ttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
EF464098_FT00000_P-G      ttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
JQ707677_FT00000_P-G      ttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
JQ707678_FT00000_P-G      ttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
JQ707679_FT00000_P-G      ttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
JQ707671_FT00000_P-G      ttcctgtcttacttttggaagagaaaccgttcttgagtatttggtgtctt
JQ707680_FT00000_P-G      ttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
JQ707673_FT00000_P-G      ttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
JQ707666_FT00000_P-G      ttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
JQ707660_FT00000_P-G      ttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
JQ707657_FT00000_P-G      ttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
JQ707668_FT00000_P-G      ttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
AB056515_FT00000_P-G      ttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
KF414679_FT00000_P-G      ttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
KR230749_FT00000_P-G      ttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
KM998716_FT00000_P-G      ttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
AB064313_FT00000_C-G      ttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
AB064311_FT00000_P-G      ttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
EF634480_FT00000_P-G      ttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
AB064312_FT00000_P-G      ttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
HE981174_FT00000_P-G      ttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
KY004111_FT00000_P-G      ttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
HE981175_FT00000_P-G      ttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
HE981176_FT00000_P-G      ttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
GU563556_FT00000_P-G      ttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
AB375165_FT00000_P-G      ttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
AB064310_FT00000_P-G      ttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
AB056513_FT00000_P-G      ttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
AB375166_FT00000_P-G      ttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
AB375167_FT00000_P-G      ttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
AB375169_FT00000_P-G      ttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
AB375170_FT00000_P-G      ttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
AB375168_FT00000_P-G      ttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
KJ194508_FT00000_P-G      ttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
KF767450_FT00000_P-G      ttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
AF405706_FT00000_P-G      ttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
AF160501_FT00000_C-G      ttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
KX264500_FT00000_P-G      ttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtctt
FJ023674_FT00000_P-G      ttcctgtcttacttttggaagagaaactgttctagagtatttggtgtctt
FR714503_FT00000_P-G      ttcctgtcttatgtttggaagagacactgttcttgagtatttggtgtctt
                          ***********  ***** ***** ** ***** ****************

EF464097_FT00000_P-G      ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccct
EF464098_FT00000_P-G      ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccct
JQ707677_FT00000_P-G      ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccct
JQ707678_FT00000_P-G      ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccct
JQ707679_FT00000_P-G      ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccct
JQ707671_FT00000_P-G      ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccct
JQ707680_FT00000_P-G      ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccct
JQ707673_FT00000_P-G      ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccct
JQ707666_FT00000_P-G      ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccct
JQ707660_FT00000_P-G      ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccct
JQ707657_FT00000_P-G      ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccct
JQ707668_FT00000_P-G      ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccct
AB056515_FT00000_P-G      ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccct
KF414679_FT00000_P-G      ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccct
KR230749_FT00000_P-G      ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccct
KM998716_FT00000_P-G      ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccct
AB064313_FT00000_C-G      ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccct
AB064311_FT00000_P-G      ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccct
EF634480_FT00000_P-G      ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccct
AB064312_FT00000_P-G      ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccct
HE981174_FT00000_P-G      ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccct
KY004111_FT00000_P-G      ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccct
HE981175_FT00000_P-G      ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccct
HE981176_FT00000_P-G      ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccct
GU563556_FT00000_P-G      ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccct
AB375165_FT00000_P-G      ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccct
AB064310_FT00000_P-G      ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccct
AB056513_FT00000_P-G      ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccct
AB375166_FT00000_P-G      ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccct
AB375167_FT00000_P-G      ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccct
AB375169_FT00000_P-G      ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccct
AB375170_FT00000_P-G      ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccct
AB375168_FT00000_P-G      ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccct
KJ194508_FT00000_P-G      ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccct
KF767450_FT00000_P-G      ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccct
AF405706_FT00000_P-G      ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccct
AF160501_FT00000_C-G      ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccct
KX264500_FT00000_P-G      ttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccct
FJ023674_FT00000_P-G      ttggagtgtggattcgcactcctcccgcgtacagaccaccaaatgcccct
FR714503_FT00000_P-G      tcggagtgtggattcgcactcctcccgcatatagaccaccaaatgcccct
                          * *********************** ** ** ******************

EF464097_FT00000_P-G      atcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
EF464098_FT00000_P-G      atcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
JQ707677_FT00000_P-G      atcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
JQ707678_FT00000_P-G      atcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
JQ707679_FT00000_P-G      atcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
JQ707671_FT00000_P-G      atcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
JQ707680_FT00000_P-G      atcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
JQ707673_FT00000_P-G      atcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
JQ707666_FT00000_P-G      atcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
JQ707660_FT00000_P-G      atcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
JQ707657_FT00000_P-G      atcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
JQ707668_FT00000_P-G      atcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
AB056515_FT00000_P-G      atcctatcaacacttccggagactactgttgttagacgaagagacaggtc
KF414679_FT00000_P-G      atcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
KR230749_FT00000_P-G      atcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
KM998716_FT00000_P-G      atcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
AB064313_FT00000_C-G      atcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
AB064311_FT00000_P-G      atcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
EF634480_FT00000_P-G      atcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
AB064312_FT00000_P-G      atcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
HE981174_FT00000_P-G      atcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
KY004111_FT00000_P-G      atcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
HE981175_FT00000_P-G      atcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
HE981176_FT00000_P-G      atcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
GU563556_FT00000_P-G      atcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
AB375165_FT00000_P-G      atcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
AB064310_FT00000_P-G      atcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
AB056513_FT00000_P-G      atcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
AB375166_FT00000_P-G      atcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
AB375167_FT00000_P-G      atcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
AB375169_FT00000_P-G      atcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
AB375170_FT00000_P-G      atcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
AB375168_FT00000_P-G      atcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
KJ194508_FT00000_P-G      atcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
KF767450_FT00000_P-G      atcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
AF405706_FT00000_P-G      atcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
AF160501_FT00000_C-G      atcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
KX264500_FT00000_P-G      atcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
FJ023674_FT00000_P-G      atcttatcaacacttccggaaactactgttgttagacgacgaggcaggtc
FR714503_FT00000_P-G      atcttatcaacacttccggaaactactgttgttagacgacgaggcaggtc
                          *** **************** ****************** *** ******

EF464097_FT00000_P-G      ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgc
EF464098_FT00000_P-G      ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgc
JQ707677_FT00000_P-G      ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgc
JQ707678_FT00000_P-G      ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgc
JQ707679_FT00000_P-G      ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgc
JQ707671_FT00000_P-G      ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgc
JQ707680_FT00000_P-G      ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgc
JQ707673_FT00000_P-G      ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgc
JQ707666_FT00000_P-G      ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgc
JQ707660_FT00000_P-G      ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgc
JQ707657_FT00000_P-G      ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgc
JQ707668_FT00000_P-G      ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgc
AB056515_FT00000_P-G      ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgc
KF414679_FT00000_P-G      ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgc
KR230749_FT00000_P-G      ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgc
KM998716_FT00000_P-G      ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgc
AB064313_FT00000_C-G      ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgc
AB064311_FT00000_P-G      ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgc
EF634480_FT00000_P-G      ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgc
AB064312_FT00000_P-G      ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgc
HE981174_FT00000_P-G      ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgc
KY004111_FT00000_P-G      ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgc
HE981175_FT00000_P-G      ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgc
HE981176_FT00000_P-G      ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgc
GU563556_FT00000_P-G      ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgc
AB375165_FT00000_P-G      ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgc
AB064310_FT00000_P-G      ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgc
AB056513_FT00000_P-G      ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgc
AB375166_FT00000_P-G      ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgc
AB375167_FT00000_P-G      ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgc
AB375169_FT00000_P-G      ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgc
AB375170_FT00000_P-G      ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgc
AB375168_FT00000_P-G      ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgc
KJ194508_FT00000_P-G      ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgc
KF767450_FT00000_P-G      ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgc
AF405706_FT00000_P-G      ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgc
AF160501_FT00000_C-G      ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgc
KX264500_FT00000_P-G      ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgc
FJ023674_FT00000_P-G      ccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgc
FR714503_FT00000_P-G      ccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgc
                          **** ******************************* *************

EF464097_FT00000_P-G      gtcgcagaagatctgcatctccagcttcccaatgttagtattccttggac
EF464098_FT00000_P-G      gtcgcagaagatctgcatctccagcttcccaatgttagtattccttggac
JQ707677_FT00000_P-G      gtcgcagaagatctgcatctccagcttcccaatgttagtattccttggac
JQ707678_FT00000_P-G      gtcgcagaagatctgcatctccagcttcccaatgttagtattccttggac
JQ707679_FT00000_P-G      gtcgcagaagatctgcatctccagcttcccaatgttagtattccttggac
JQ707671_FT00000_P-G      gtcgcagaagatctgcatctccagcttcccaatgttagtattccttggac
JQ707680_FT00000_P-G      gtcgcagaagatctgcatctccagcttcccaatgttagtattccttggac
JQ707673_FT00000_P-G      gtcgcggaagatctgcatctccagcttcccaatgttagtattccttggac
JQ707666_FT00000_P-G      gtcgcagaagatctgcatctccagcttcccaatgttagtattccttggac
JQ707660_FT00000_P-G      gtcgcagaagatctgcatctccagcttcccaatgttagtattccttggac
JQ707657_FT00000_P-G      gtcgcagaagatctgcatctcaagcttcccaatgttagtattccttggac
JQ707668_FT00000_P-G      gtcgcagaagatctgcatctccagcttcccaatgttagtattccttggac
AB056515_FT00000_P-G      gtcgcagaagatctgcatctccagcttcccaatgttagtattccttggac
KF414679_FT00000_P-G      gtcgcagaagatctgcatctccagcttcccaatgttagtattccttggac
KR230749_FT00000_P-G      gtcgcagaagatctgcatctccagcttcccaatgttagtattccttggac
KM998716_FT00000_P-G      gtcgccgaagatctgcatctccagcttcccaatgttagtattccttggac
AB064313_FT00000_C-G      gtcgcagaagatctgcatctccagcttcccaatgttagtattccttggac
AB064311_FT00000_P-G      gtcgcagaagatctgcatctccagcttcccaatgttagtattccttggac
EF634480_FT00000_P-G      gtcgcagaagatctgcatctccagcttcccaatgttagtattccttggac
AB064312_FT00000_P-G      gtcgcagaagatctgcatctccagcttcccaatgttagtattccttggac
HE981174_FT00000_P-G      gtcgcagaagatctgcatctccagcttcccaatgttagtattccttggac
KY004111_FT00000_P-G      gtcgcagaagatctacatctccagcttcccaatgttagtattccttggac
HE981175_FT00000_P-G      gtcgcagaagatctgcatctccagcttcccaatgttagtattccttggac
HE981176_FT00000_P-G      gtcgcagaagatctgcatctccagcttcccaatgttagtattccttggac
GU563556_FT00000_P-G      gtcgcagaagatctgcatctccagcttcccaatgttagtattccttggac
AB375165_FT00000_P-G      gtcgcagaagatctgcatctccagcttcccaatgttagtattccttggac
AB064310_FT00000_P-G      gtcgcagaagatctgcatctccagcttcccaatgttagtattccttggac
AB056513_FT00000_P-G      gtcgcagaagatctgcatctccagcttcccaatgttagtattccttggac
AB375166_FT00000_P-G      gtcgcagaagatctgcatctccagcttcccaatgttagtattccttggac
AB375167_FT00000_P-G      gtcgcagaagatctgcatctccagcttcccaatgttagtattccttggac
AB375169_FT00000_P-G      gtcgcagaagatctgcatctccagcttcccaatgttagtattccttggac
AB375170_FT00000_P-G      gtcgcagaagatctgcatctccagcttcccaatgttagtattccttggac
AB375168_FT00000_P-G      gtcgcagaagatctgcatctccagcttcccaatgttagtattccttggac
KJ194508_FT00000_P-G      gtcgcagaagatctgcatctccagcttcccaatgttagtattccttggac
KF767450_FT00000_P-G      gtcgcagaagatctgcatctccagcttcccaatgttagtattccttggac
AF405706_FT00000_P-G      gtcgcagaagatctgcatctccagcttcccaatgttagtattccttggac
AF160501_FT00000_C-G      gtcgcagaagatctgcatctccagcttcccaatgttagtattccttggac
KX264500_FT00000_P-G      gtcgcagaagatctgcatctccagcttcccaatgttagtattccttggac
FJ023674_FT00000_P-G      gtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggac
FR714503_FT00000_P-G      gtcgcagaagatctcaatctcgggaaccccaatgttagtattccttggac
                          ***** ********  *****  *   * ************ ********

EF464097_FT00000_P-G      tcacaaggtgggaaactttacggggctgtattcttctactatacctgtct
EF464098_FT00000_P-G      tcacaaggtgggaaactttacggggctgtattcttctactatacctgtct
JQ707677_FT00000_P-G      tcacaaggtgggaaactttacggggctgtattcttctactatacctgtct
JQ707678_FT00000_P-G      tcacaaggtgggaaactttacggggctgtattcttctactatacctgtct
JQ707679_FT00000_P-G      tcacaaggtgggaaactttacggggctgtattcttctactatacctgtct
JQ707671_FT00000_P-G      tcacaaggtgggaaactttacggggctgtattcttctactatacctgtct
JQ707680_FT00000_P-G      tcacaaggtgggaaactttacggggctgtattcttctactatacctgtct
JQ707673_FT00000_P-G      tcacaaggtgggaaactttacggggctgtattcttctactatacctgtct
JQ707666_FT00000_P-G      tcacaaggtgggaaactttacggggctgtattcttctactatacctgtct
JQ707660_FT00000_P-G      tcacaaggtgggaaactttacggggctgtattcttctactatacctgtct
JQ707657_FT00000_P-G      tcacaaggtgggaaactttacggggctgtattcttctactatacctgtct
JQ707668_FT00000_P-G      tcacaaggtgggaaactttacggggctgtattcttctactatacctgtct
AB056515_FT00000_P-G      tcacaaggtgggaaactttacggggctgtattcttctactatacctgtct
KF414679_FT00000_P-G      tcacaaggtgggaaactttacggggctgtattcttctactatacctgtct
KR230749_FT00000_P-G      tcacaaggtgggaaactttacggggctgtattcttctactatacctgtct
KM998716_FT00000_P-G      tcacaaggtgggaaactttacggggctgtattcttctactatacctgtct
AB064313_FT00000_C-G      tcacaaggtgggaaactttacggggctgtattcttctactatacctgtct
AB064311_FT00000_P-G      tcacaaggtgggaaactttacggggctgtattcttctactatacctgtct
EF634480_FT00000_P-G      tcacaaggtgggaaactttacggggctgtattcttctactatacctgtct
AB064312_FT00000_P-G      tcacaaggtgggaaactttacggggctgtattcttctactatacctgtct
HE981174_FT00000_P-G      tcacaaggtgggaaactttacggggctgtattcttctactatacctgtct
KY004111_FT00000_P-G      tcacaaggtgggaaactttacggggctgtattcttctactatacctgtct
HE981175_FT00000_P-G      tcacaaggtgggaaactttacggggctgtattcttctactatacctgtct
HE981176_FT00000_P-G      tcacaaggtgggaaactttacggggctgtattcttctactatacctgtct
GU563556_FT00000_P-G      tcacaaggtgggaaactttacggggctgtattcttctactatacctgtct
AB375165_FT00000_P-G      tcacaaggtgggaaactttacggggctgtattcttctactatacctgtct
AB064310_FT00000_P-G      tcacaaggtgggaaactttacggggctgtattcttctactatacctgtct
AB056513_FT00000_P-G      tcacaaggtgggaaactttacggggctgtattcttctactatacctgtct
AB375166_FT00000_P-G      tcacaaggtgggaaactttacggggctgtattcttctactatacctgtct
AB375167_FT00000_P-G      tcacaaggtgggaaactttacggggctgtattcttctactatacctgtct
AB375169_FT00000_P-G      tcacaaggtgggaaactttacggggctgtattcttctactatacctgtct
AB375170_FT00000_P-G      tcacaaggtgggaaactttacggggctgtattcttctactatacctgtct
AB375168_FT00000_P-G      tcacaaggtgggaaactttacggggctgtattcttctactatacctgtct
KJ194508_FT00000_P-G      tcacaaggtgggaaactttacggggctgtattcttctactatacctgtct
KF767450_FT00000_P-G      tcacaaggtgggaaactttacggggctgtattcttctactatacctgtct
AF405706_FT00000_P-G      tcacaaggtgggaaactttacggggctgtattcttctactatacctgtct
AF160501_FT00000_C-G      tcacaaggtgggaaactttacggggctgtattcttctactatacctgtct
KX264500_FT00000_P-G      tcacaaggtgggaaactttacggggctgtattcttctactatacctgtct
FJ023674_FT00000_P-G      tcataaggtgggaaactttactgggctttattcttctactgtacctgtct
FR714503_FT00000_P-G      tcataaggtgggaaactttaccgggctttattcttctactgtacctgtct
                          *** ***************** ***** ************ *********

EF464097_FT00000_P-G      ttaatcctgattggcaaactccttcttttccaaatatccatttgcatcaa
EF464098_FT00000_P-G      ttaatcctgattggcaaactccttcttttccaaatatccatttgcatcaa
JQ707677_FT00000_P-G      ttaatcctgattggcaaactccttcttttccaaatatccatttgcatcaa
JQ707678_FT00000_P-G      ttaatcctgattggcaaactccttcttttccaaatatccatttgcatcaa
JQ707679_FT00000_P-G      ttaatcctgattggcaaactccttcttttccaaatatccatttgcatcaa
JQ707671_FT00000_P-G      ttaatcctgattggcaaactccttcttttccaaatatccatttgcatcaa
JQ707680_FT00000_P-G      ttaatcctgattggcaaactccttcttttccaaatatccatttgcatcaa
JQ707673_FT00000_P-G      ttaatcctgattggcaaactccttcttttccaaatatccatttgcatcaa
JQ707666_FT00000_P-G      ttaatcctgattggcaaactccttcttttccaaatatccatttgcatcaa
JQ707660_FT00000_P-G      ttaatcctgattggcaaactccttcttttccaaatatccatttgcatcaa
JQ707657_FT00000_P-G      ttaatcctgattggcaaactccttcttttccaaatatccatttgcatcaa
JQ707668_FT00000_P-G      ttaatcctgattggcaaactccttcttttccaaatatccatttgcatcaa
AB056515_FT00000_P-G      ttaatcctgattggcaaactccttcttttccaaatatccatttgcatcaa
KF414679_FT00000_P-G      ttaatcctgattggcaaactccttcttttccaaatatccatttgcatcaa
KR230749_FT00000_P-G      ttaatcctgattggcaaactccttcttttccaaatatccatttgcatcaa
KM998716_FT00000_P-G      ttaatcctgattggcaaactccttcttttccaaatatccatttgcatcaa
AB064313_FT00000_C-G      ttaatcctgattggcaaactccttcttttccaaatatccatttgcatcaa
AB064311_FT00000_P-G      ttaatcctgattggcaaactccttcttttccaaatatccatttgcatcaa
EF634480_FT00000_P-G      ttaatcctgattggcaaactccttcttttccaaatatccatttgcatcaa
AB064312_FT00000_P-G      ttaatcctgattggcaaactccttcttttccaaatatccatttgcatcaa
HE981174_FT00000_P-G      ttaatcctgattggcaaactccttcttttccaaatatccatttgcatcaa
KY004111_FT00000_P-G      ttaatcctgattggcaaactccttcttttccaaatatccatttgcatcaa
HE981175_FT00000_P-G      ttaatcctgattggcaaactccttcttttccaaatatccatttgcatcaa
HE981176_FT00000_P-G      ttaatcctgattggcaaactccttcttttccaaatatccatttgcatcaa
GU563556_FT00000_P-G      ttaatcctgattggcaaactccttcttttccaaatatccatttgcatcaa
AB375165_FT00000_P-G      ttaatcctgattggcaaactccttcttttccaaatatccatttgcatcaa
AB064310_FT00000_P-G      ttaatccggattggcaaactccttcttttccaaatatccatttgcatcaa
AB056513_FT00000_P-G      ttaatcctgattggcaaactccttcttttccaaatatccatttgcatcaa
AB375166_FT00000_P-G      ttaatcctgattggcaaactccttcttttccaaatatccatttgcatcaa
AB375167_FT00000_P-G      ttaatcctgattggcaaactccttcttttccaaatatccatttgcatcaa
AB375169_FT00000_P-G      ttaatcctgattggcaaactccttcttttccaaatatccatttgcatcaa
AB375170_FT00000_P-G      ttaatcctgattggcaaactccttcttttccaaatatccatttgcatcaa
AB375168_FT00000_P-G      ttaatcctgattggcaaactccttcttttccaaatatccatttgcatcaa
KJ194508_FT00000_P-G      ttaatcctgattggcaaactccttcttttccaaatatccatttgcatcaa
KF767450_FT00000_P-G      ttaatcctgattggcaaactccttcttttccaaatatccatttgcatcaa
AF405706_FT00000_P-G      ttaatcctgattggcaaactccttcttttccaaatatccatttgcatcaa
AF160501_FT00000_C-G      ttaatcctgattggcaaactccttcttttccaaatatccatttgcatcaa
KX264500_FT00000_P-G      ttaatcctgattggcaaactccttcttttccaaatatccatttgcatcaa
FJ023674_FT00000_P-G      ttaatcctgactggcaaactccctcttttcctaacattcatttgcatgag
FR714503_FT00000_P-G      ttaatcctgagtggcaaactccctcttttcctaacattcatttgcatgag
                          ******* ** *********** ******** ** ** ********* * 

EF464097_FT00000_P-G      gacattataactaaatgtgaacaatttgtgggccctctcacagtaaatga
EF464098_FT00000_P-G      gacattataactaaatgtgaacaatttgtgggccctctcacagtaaatga
JQ707677_FT00000_P-G      gacattataactaaatgtgaacaatttgtgggccctctcacagtaaatga
JQ707678_FT00000_P-G      gacattataactaaatgtgaacaatttgtgggccctctcacagtaaatga
JQ707679_FT00000_P-G      gacattataactaaatgtgaacaatttgtgggccctctcacagtaaatga
JQ707671_FT00000_P-G      gacattataactaaatgtgaacaatttgtgggccctctcacagtaaatga
JQ707680_FT00000_P-G      gacattataactaaatgtgaacaatttgtgggccctctcacagtaaatga
JQ707673_FT00000_P-G      gacattataactaaatgtgaacaatttgtgggccctctcacagtaaatga
JQ707666_FT00000_P-G      gacattataactaaatgtgaacaatttgtgggccctctcacagtaaatga
JQ707660_FT00000_P-G      gacattataactaaatgtgaacaatttgtgggccctctcacagtaaatga
JQ707657_FT00000_P-G      gacattataactaaatgtgaacaatttgtgggccctctcacagtaaatga
JQ707668_FT00000_P-G      gacattataactaaatgtgaacaatttgtgggccctctcacagtaaatga
AB056515_FT00000_P-G      gacattataactaaatgtgaacaatttgtgggccctctcacagtaaatga
KF414679_FT00000_P-G      gacattataactaaatgtgaacaatttgtgggccctctcacagtaaatga
KR230749_FT00000_P-G      gacattataactaaatgtgaacaatttgtgggccctctcacagtaaatga
KM998716_FT00000_P-G      gacattataactaaatgtgaacaatttgtgggccctctcacagtaaatga
AB064313_FT00000_C-G      gacattataactaaatgtgaacaatttgtgggccctctcacagtaaatga
AB064311_FT00000_P-G      gacattataactaaatgtgaacaatttgtgggccctctcacagtaaatga
EF634480_FT00000_P-G      gacattataactaaatgtgaacaatttgtgggccctctcacagtaaatga
AB064312_FT00000_P-G      gacattataactaaatgtgaacaatttgtgggccctctcacagtaaatga
HE981174_FT00000_P-G      gacattataactaaatgtgaacaatttgtgggccctctcacagtaaatga
KY004111_FT00000_P-G      gacattataactaaatgtgaacaatttgtgggccctctcacagtaaatga
HE981175_FT00000_P-G      gacattataactaaatgtgaacaatttgtgggccctctcacagtaaatga
HE981176_FT00000_P-G      gacattataactaaatgtgaacaatttgtgggccctctcacagtaaatga
GU563556_FT00000_P-G      gacattataactaaatgtgaacaatttgtgggccctctcacagtaaatga
AB375165_FT00000_P-G      gacattataactaaatgtgaacaatttgtgggccctctcacagtaaatga
AB064310_FT00000_P-G      gacattataactaaatgtgaacaatttgtgggccctctcacagtaaatga
AB056513_FT00000_P-G      gacattataactaaatgtgaacaatttgtgggccctctcacagtaaatga
AB375166_FT00000_P-G      gacattataactaaatgtgagcaatttgtgggccctctcacagtaaatga
AB375167_FT00000_P-G      gacattataactaaatgtgagcaatttgtgggccctctcacagtaaatga
AB375169_FT00000_P-G      gacattataactaaatgtgagcaatttgtgggccctctcacagtaaatga
AB375170_FT00000_P-G      gacattataactaaatgtgagcaatttgtgggccctctcacagtaaatga
AB375168_FT00000_P-G      gacattataactaaatgtgagcaatttgtgggccctctcacagtaaatga
KJ194508_FT00000_P-G      gacattataactaaatgtgaacaatttgtgggccctctcacagtaaatga
KF767450_FT00000_P-G      gacattataactaaatgtgaacaatttgtgggccctctcacagtaaatga
AF405706_FT00000_P-G      gacattataactaaatgtgaacaatttgtgggccctctcacagtaaatga
AF160501_FT00000_C-G      gacattataactaaatgtgaacaatttgtgggccctctcacagtaaatga
KX264500_FT00000_P-G      gacattataactaaatgtgaacaatttgtgggccctctcacagtaaatga
FJ023674_FT00000_P-G      gacattatcgataggtgtcaacagtttgtgggccctttgacagtgaatga
FR714503_FT00000_P-G      gacattatcaataggtgtcaacaatttgtgggccctcttacagttaatga
                          ********   **  *** * ** ************ * ***** *****

EF464097_FT00000_P-G      gaaacgaagattaaaactagttatgcctgccagatttttcccaaactcta
EF464098_FT00000_P-G      gaaacgaagattaaaactagttatgcctgccagatttttcccaaactcta
JQ707677_FT00000_P-G      gaaacgaagattaaaactagttatgcctgccagatttttcccaaactcta
JQ707678_FT00000_P-G      gaaacgaagattaaaactagttatgcctgccagatttttcccaaactcta
JQ707679_FT00000_P-G      gaaacgaagattaaaactagttatgcctgccagatttttcccaaactcta
JQ707671_FT00000_P-G      gaaacgaagattaaaactagttatgcctgccagatttttcccaaactcta
JQ707680_FT00000_P-G      gaaacgaagattaaaactagttatgcctgccagatttttcccaaactcta
JQ707673_FT00000_P-G      gaaacgaagattaaaactagttatgcctgccagatttttcccaaactcta
JQ707666_FT00000_P-G      gaaacgaagattaaaactagttatgcctgccagatttttcccaaactcta
JQ707660_FT00000_P-G      gaaacgaagattaaaactagttatgcctgccagatttttcccaaactcta
JQ707657_FT00000_P-G      gaaacgaagattaaaactagttatgcctgccagatttttcccaaactcta
JQ707668_FT00000_P-G      gaaacgaagattaaaactagttatgcctgccagatttttcccaaactcta
AB056515_FT00000_P-G      gaaacgaagattaaaactagttatgcctgccagatttttcccaaactcta
KF414679_FT00000_P-G      gaaacgaagattaaaactagttatgcctgccagatttttcccaaactcta
KR230749_FT00000_P-G      gaaac---------aactagttatgcctgccagatttttcccaaactcta
KM998716_FT00000_P-G      gaaacgaagattaaaactagttatgcctgccagatttttcccaaactcta
AB064313_FT00000_C-G      gaaacgaagattaaaactagttatgcctgccagatttttcccaaactcta
AB064311_FT00000_P-G      gaaacgaagattaaaactagttatgcctgccagatttttcccaaactcta
EF634480_FT00000_P-G      gaaacgaagattaaaactagttatgcctgccagatttttcccaaactcta
AB064312_FT00000_P-G      gaaacgaagattaaaactagttatgcctgccagatttttcccaaactcta
HE981174_FT00000_P-G      gaaacgaagattaaaactagttatgcctgccagatttttcccaaactcta
KY004111_FT00000_P-G      gaaacgaagattaaaactagttatgcctgccagatttttcccaaactcta
HE981175_FT00000_P-G      gaaacgaagattaaaactagttatgcctgccagatttttcccaaactcta
HE981176_FT00000_P-G      gaaacgaagattaaaactagttatgcctgccagatttttcccaaactcta
GU563556_FT00000_P-G      gaaacgaagattaaaactagttatgcctgccagatttttcccaaactcta
AB375165_FT00000_P-G      gaagcgaagattaaaactagttatgcctgccagatttttcccaaactcta
AB064310_FT00000_P-G      gaaacgaagattaaaactagttatgcctgccagatttttcccaaactcta
AB056513_FT00000_P-G      gaaacgaagattaaaactagttatgcctgccagatttttcccaaactcta
AB375166_FT00000_P-G      gaaacgaagattaaaactagttatgcctgccagatttttcccaaactcta
AB375167_FT00000_P-G      gaaacgaagattaaaactagttatgcctgccagatttttcccaaactcta
AB375169_FT00000_P-G      gaaacgaagattaaaactagttatgcctgccagatttttcccaaactcta
AB375170_FT00000_P-G      gaaacgaagattaaaactagttatgcctgccagatttttcccaaactcta
AB375168_FT00000_P-G      gaaacgaagattaaaactagttatgcctgccagatttttcccaaactcta
KJ194508_FT00000_P-G      gaaacgaagattaaaactagttatgcctgccagatttttcccaaactcta
KF767450_FT00000_P-G      gaaacgaagattaaaactagttatgcctgccagatttttcccaaactcta
AF405706_FT00000_P-G      gaaacgaagattaaaactagttatgcctgccagatttttcccaaactcta
AF160501_FT00000_C-G      gaaacgaagattaaaactagttatgcctgccagatttttcccaaactcta
KX264500_FT00000_P-G      gaaacgaagattaaaactagttatgcctgccagatttttcccaaactcta
FJ023674_FT00000_P-G      aaaaaggagactaaaattaattatgcctgctaggttttatcctaacagta
FR714503_FT00000_P-G      aaaaagaagattaaacttaattatgcctgctaggttctatcctaaccgta
                           **           *  ** ********** ** ** *  ** ***  **

EF464097_FT00000_P-G      ctaaatatttaccattagacaaaggtatcaaaccgtattatccagaaaat
EF464098_FT00000_P-G      ctaaatatttaccattagacaaaggtatcaaaccgtattatccagaaaat
JQ707677_FT00000_P-G      ctaaatatttaccattagacaaaggtatcaaaccgtattatccagaaaat
JQ707678_FT00000_P-G      ctaaatatttaccattagacaaaggtatcaaaccgtattatccagaaaat
JQ707679_FT00000_P-G      ctaaatatttaccattagacaaaggtatcaaaccgtattatccagaaaat
JQ707671_FT00000_P-G      ctaaatatttaccattagacaaaggtatcaaaccgtattatccagaaaat
JQ707680_FT00000_P-G      ctaaatatttaccattagacaaaggtatcaaaccgtattatccagaaaat
JQ707673_FT00000_P-G      ctaaatatttaccattagacaaaggtatcaaaccgtattatccagaaaat
JQ707666_FT00000_P-G      ctaaatatttaccattagacaaaggtatcaaaccgtattatccagaaaat
JQ707660_FT00000_P-G      ctaaatatttaccattagacaaaggtatcaaaccgtattatccagaaaat
JQ707657_FT00000_P-G      ctaaatatttaccattagacaaaggtatcaaaccgtattatccagaaaat
JQ707668_FT00000_P-G      ctaaatatttaccattagacaaaggtatcaaaccgtattatccagaaaat
AB056515_FT00000_P-G      ctaaatatttaccattagacaaaggtatcaaaccgtattatccagaaaat
KF414679_FT00000_P-G      ctaaatatttaccattagacaaaggtatcaaaccgtattatccagaaaat
KR230749_FT00000_P-G      ctaaatatttaccattagacaaaggtatcaa---gtattacccagaaaat
KM998716_FT00000_P-G      ctaaatatttaccattagacaaaggtatcaaaccgtattatccagaaaat
AB064313_FT00000_C-G      ctaaatatttaccattagacaaaggtatcaaaccgtattatccagaaaat
AB064311_FT00000_P-G      ctaaatatttaccattagacaaaggtatcaaaccgtattatccagaaaat
EF634480_FT00000_P-G      ctaaatatttaccattagacaaaggtatcaaaccgtattatccagaaaat
AB064312_FT00000_P-G      ctaaatatttaccattagacaaaggtatcaaaccgtattatccagaaaat
HE981174_FT00000_P-G      ctaaatatttaccattagacaaaggtatcaaaccgtattatccagaaaat
KY004111_FT00000_P-G      ctaaatatttaccattagacaaaggtatcaaaccgtattatccagaaaat
HE981175_FT00000_P-G      ctaaatatttaccattagacaaaggtatcaaaccgtattatccagaaaat
HE981176_FT00000_P-G      ctaaatatttaccattagacaaaggtatcaaaccgtattatccagaaaat
GU563556_FT00000_P-G      ctaaatatttaccattagacaaaggtatcaaaccgtattatccagaaaat
AB375165_FT00000_P-G      ctaaatatttaccattagacaaaggtatcaaaccgtattatccagaaaat
AB064310_FT00000_P-G      ctaaatatttaccattagacaaaggtatcaaaccgtattatccagaaaat
AB056513_FT00000_P-G      ctaaatatttaccattagacaaaggtatcaaaccgtattatccagaaaat
AB375166_FT00000_P-G      ctaaatatttaccattagacaaaggtatcaaaccgtattatccagaaaat
AB375167_FT00000_P-G      ctaaatatttaccattagacaaaggtatcaaaccgtattatccagaaaat
AB375169_FT00000_P-G      ctaaatatttaccattagacaaaggtatcaaaccgtattatccagaaaat
AB375170_FT00000_P-G      ctaaatatttaccattagacaaaggtatcaaaccgtattatccagaaaat
AB375168_FT00000_P-G      ctaaatatttaccattagacaaaggtatcaaaccgtattatccagaaaat
KJ194508_FT00000_P-G      ctaaatatttaccattagacaaaggtatcaaaccgtattatccagaaaat
KF767450_FT00000_P-G      ctaaatatttaccattagacaaaggtatcaaaccgtattatccagaaaat
AF405706_FT00000_P-G      ctaaatatttaccattagacaaaggtatcaaaccgtattatccagaaaat
AF160501_FT00000_C-G      ctaaatatttaccattagacaaaggtatcaaaccgtattatccagaaaat
KX264500_FT00000_P-G      ctaaatatttaccattagacaaaggtatcaaaccgtattatccagaaaat
FJ023674_FT00000_P-G      ccaagtatttgcccttagataaaggtattaaaccttattatcctgaacat
FR714503_FT00000_P-G      ctaagtatttgcccttagataaaggcataaaaccttattatcctgagcag
                          * ** ***** ** ***** ***** ** **    ***** ** **  * 

EF464097_FT00000_P-G      gtagttaatcattacttccagaccagacattatttacataccctttggaa
EF464098_FT00000_P-G      gtagttaatcattacttccagaccagacattatttacataccctttggaa
JQ707677_FT00000_P-G      gtagttaatcattacttccagaccagacattatttacataccctttggaa
JQ707678_FT00000_P-G      gtagttaatcattacttccagaccagacattatttacataccctttggaa
JQ707679_FT00000_P-G      gtagttaatcattacttccagaccagacattatttacataccctttggaa
JQ707671_FT00000_P-G      gtagttaatcattacttccagaccagacattatttacataccctttggaa
JQ707680_FT00000_P-G      gtagttaatcattacttccagaccagacattatttacataccctttggaa
JQ707673_FT00000_P-G      gtagttaatcattacttccagaccagacattatttacataccctttggaa
JQ707666_FT00000_P-G      gtagttaatcattacttccagaccagacattatttacataccctttggaa
JQ707660_FT00000_P-G      gtagttaatcattacttccagaccagacattatttacataccctttggaa
JQ707657_FT00000_P-G      gtagttaatcattacttccagaccagacattatttacataccctttggaa
JQ707668_FT00000_P-G      gtagttaatcattacttccagaccagacattatttacataccctttggaa
AB056515_FT00000_P-G      gtagttaatcattacttccagaccagacattatttacataccctttggaa
KF414679_FT00000_P-G      gtagttaatcattacttccagaccagacattatttacataccctttggaa
KR230749_FT00000_P-G      gtagttaatcattacttccagaccagacattatttacataccctttggaa
KM998716_FT00000_P-G      gtagttaatcattacttccagaccagacattatttacataccctttggaa
AB064313_FT00000_C-G      gtagttaatcattacttccagaccagacattatttacataccctttggaa
AB064311_FT00000_P-G      gtagttaatcattacttccagaccagacattatttacataccctttggaa
EF634480_FT00000_P-G      gtagttaatcattacttccagaccagacattatttacataccctttggaa
AB064312_FT00000_P-G      gtagttaatcattacttccagaccagacattatttacataccctttggaa
HE981174_FT00000_P-G      gtagttaatcattacttccagaccagacattatttacataccctttggaa
KY004111_FT00000_P-G      gtagttaatcattacttccagaccagacattatttacataccctttggaa
HE981175_FT00000_P-G      gtagttaatcattacttccagaccagacattatttacataccctttggaa
HE981176_FT00000_P-G      gtagttaatcattacttccagaccagacattatttacataccctttggaa
GU563556_FT00000_P-G      gtagttaatcattacttccagaccagacattatttacataccctttggaa
AB375165_FT00000_P-G      gtagttaatcattacttccagaccagacattatttacataccctttggaa
AB064310_FT00000_P-G      gtagttaatcattacttccagaccagacattatttacataccctttggaa
AB056513_FT00000_P-G      gtagttaatcattacttccagaccagacattatttacataccctttggaa
AB375166_FT00000_P-G      gtagttaatcattacttccagaccagacattatttacataccctttggaa
AB375167_FT00000_P-G      gtagttaatcattacttccagaccagacattatttacataccctttggaa
AB375169_FT00000_P-G      gtagttaatcattacttccagaccagacattatttacataccctttggaa
AB375170_FT00000_P-G      gtagttaatcattacttccagaccagacattatttacataccctttggaa
AB375168_FT00000_P-G      gtagttaatcattacttccagaccagacattatttacataccctttggaa
KJ194508_FT00000_P-G      gtagttaatcattacttccagaccagacattatttacataccctttggaa
KF767450_FT00000_P-G      gtagttaatcattacttccagaccagacattatttacataccctttggaa
AF405706_FT00000_P-G      gtagttaatcattacttccagaccagacattatttacataccctttggaa
AF160501_FT00000_C-G      gtagttaatcattacttccagaccagacattatttacataccctttggaa
KX264500_FT00000_P-G      gtagttaatcattacttccagaccagacattatttacataccctttggaa
FJ023674_FT00000_P-G      gcagttaatcattacttcaaagccaggcattatttacatactctgtggaa
FR714503_FT00000_P-G      gccgttaatcattatttcaaaactaggcattatttacatactctgtggaa
                          *  *********** *** *  * ** ************** ** *****

EF464097_FT00000_P-G      ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtg
EF464098_FT00000_P-G      ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtg
JQ707677_FT00000_P-G      ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtg
JQ707678_FT00000_P-G      ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtg
JQ707679_FT00000_P-G      ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtg
JQ707671_FT00000_P-G      ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtg
JQ707680_FT00000_P-G      ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtg
JQ707673_FT00000_P-G      ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtg
JQ707666_FT00000_P-G      ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtg
JQ707660_FT00000_P-G      ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtg
JQ707657_FT00000_P-G      ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtg
JQ707668_FT00000_P-G      ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtg
AB056515_FT00000_P-G      ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtg
KF414679_FT00000_P-G      ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtg
KR230749_FT00000_P-G      ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtg
KM998716_FT00000_P-G      ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtg
AB064313_FT00000_C-G      ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtg
AB064311_FT00000_P-G      ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtg
EF634480_FT00000_P-G      ggcgggtattctatataagagagaaacatcacgtagcgcttcattttgtg
AB064312_FT00000_P-G      ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtg
HE981174_FT00000_P-G      ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtg
KY004111_FT00000_P-G      ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtg
HE981175_FT00000_P-G      ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtg
HE981176_FT00000_P-G      ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtg
GU563556_FT00000_P-G      ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtg
AB375165_FT00000_P-G      ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtg
AB064310_FT00000_P-G      ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtg
AB056513_FT00000_P-G      ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtg
AB375166_FT00000_P-G      ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtg
AB375167_FT00000_P-G      ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtg
AB375169_FT00000_P-G      ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtg
AB375170_FT00000_P-G      ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtg
AB375168_FT00000_P-G      ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtg
KJ194508_FT00000_P-G      ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtg
KF767450_FT00000_P-G      ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtg
AF405706_FT00000_P-G      ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtg
AF160501_FT00000_C-G      ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtg
KX264500_FT00000_P-G      ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtg
FJ023674_FT00000_P-G      agctggcattctatataagagagaaactacacgcagcgcctcattttgtg
FR714503_FT00000_P-G      agctggcattctatataagagagaaacaacacgcagcgcatcattttgtg
                           ** ** ********************  * ** ***** **********

EF464097_FT00000_P-G      ggtcaccatatacttgggaacaagatctacagcatggggctttcttggac
EF464098_FT00000_P-G      ggtcaccatatacttgggaacaagatctacagcatggggctttcttggac
JQ707677_FT00000_P-G      ggtcaccatatacttgggaacaagatctacagcatggggctttcttggac
JQ707678_FT00000_P-G      ggtcaccatatacttgggaacaagatctacagcatggggctttcttggac
JQ707679_FT00000_P-G      ggtcaccatatacttgggaacaagatctacagcatggggctttcttggac
JQ707671_FT00000_P-G      ggtcaccatatacttgggaacaagatctacagcatggggctttcttggac
JQ707680_FT00000_P-G      ggtcaccatatacttgggaacaagatctacagcatggggctttcttggac
JQ707673_FT00000_P-G      ggtcaccatatacttgggaacaagatctacagcatggggctttcttggac
JQ707666_FT00000_P-G      ggtcaccatatacttgggaacaagatctacagcatggggctttcttggac
JQ707660_FT00000_P-G      ggtcaccatatacttgggaacaagatctacagcatggggctttcttggac
JQ707657_FT00000_P-G      ggtcaccatatacttgggaacaagatctacagcatggggctttcttggac
JQ707668_FT00000_P-G      ggtcaccatatacttgggaacaagatctacagcatggggctttcttggac
AB056515_FT00000_P-G      ggtcaccatatacttgggaacaagatctacagcatggggctttcttggac
KF414679_FT00000_P-G      ggtcaccatatacttgggaacaagatctacagcatggggctttcttggac
KR230749_FT00000_P-G      ggtcaccatatacttgggaacaagatctacagcatggggctttcttggac
KM998716_FT00000_P-G      ggtcaccatatacttgggaacaagatctacagcatggggctttcttggac
AB064313_FT00000_C-G      ggtcaccatatacttgggaacaagatctacagcatggggctttcttggac
AB064311_FT00000_P-G      ggtcaccatatacttgggaacaagatctacagcatggggctttcttggac
EF634480_FT00000_P-G      ggtcaccatatacttgggaacaagatctacagcatggggctttcttggac
AB064312_FT00000_P-G      ggtcaccatatacttgggaacaagatctacagcatggggctttcttggac
HE981174_FT00000_P-G      ggtcaccatatacttgggaacaagatctacagcatggggctttcttggac
KY004111_FT00000_P-G      ggtcaccatatacttgggaacaagatctacagcatggggctttcttggac
HE981175_FT00000_P-G      ggtcaccatatacttgggaacaagatctacagcatggggctttcttggac
HE981176_FT00000_P-G      ggtcaccatatacttgggaacaagatctacagcatggggctttcttggac
GU563556_FT00000_P-G      ggtcaccatatacttgggaacaagatctacagcatggggctttcttggac
AB375165_FT00000_P-G      ggtcaccatatacttgggaacaagatctacagcatggggctttcttggac
AB064310_FT00000_P-G      ggtcaccatatacttgggaacaagatctacagcatggggctttcttggac
AB056513_FT00000_P-G      ggtcaccatatacttgggaacaagatctacagcatggggctttcttggac
AB375166_FT00000_P-G      ggtcaccatatacttgggaacaagatctacagcatggggctttcttggac
AB375167_FT00000_P-G      ggtcaccatatacttgggaacaagatctacagcatggggctttcttggac
AB375169_FT00000_P-G      ggtcaccatatacttgggaacaagatctacagcatggggctttcttggac
AB375170_FT00000_P-G      ggtcaccatatacttgggaacaagatctacagcatggggctttcttggac
AB375168_FT00000_P-G      ggtcaccatatacttgggaacaagatctacagcatggggctttcttggac
KJ194508_FT00000_P-G      ggtcaccatatacttgggaacaagatctacagcatggggctttcttggac
KF767450_FT00000_P-G      ggtcaccatatacttgggaacaagatctacagcatggggctttcttggac
AF405706_FT00000_P-G      ggtcaccatatacttgggaacaagatctacagcatggggctttcttggac
AF160501_FT00000_C-G      ggtcaccatatacttgggaacaagatctacagcatggggctttcttggac
KX264500_FT00000_P-G      ggtcaccatatacttgggaacaagatctacagcatggggctttcttggac
FJ023674_FT00000_P-G      ggtcaccatattcttgggaacaagagctacagcatggga-------gggt
FR714503_FT00000_P-G      ggtcaccatattatagggaacaagagccacagcatggga-------ggtt
                          ***********  * ********** * **********        **  

EF464097_FT00000_P-G      ggtc-----cctctcgagtg-----gggaaagaacctttccaccagcaat
EF464098_FT00000_P-G      ggtc-----cctctcgagtg-----gggaaagaacctttccaccagcaat
JQ707677_FT00000_P-G      ggtc-----cctctcgagtg-----gggaaagaacctttccaccagcaat
JQ707678_FT00000_P-G      ggtc-----cctctcgagtg-----gggaaagaacctttccaccagcaat
JQ707679_FT00000_P-G      ggtc-----cctctcgagtg-----gggaaagaacctttccaccagcaat
JQ707671_FT00000_P-G      ggtc-----cctctcgagtg-----gggaaagaacctttccaccagcaat
JQ707680_FT00000_P-G      ggtc-----cctctcgagtg-----gggaaagaacctttccaccagcaat
JQ707673_FT00000_P-G      ggtc-----cctctcgagtg-----gggaaagaacctttccaccagcaat
JQ707666_FT00000_P-G      ggtc-----cctctcgagtg-----gggaaagaacctttccaccagcaat
JQ707660_FT00000_P-G      ggtc-----cctctcgagtg-----gggaaagaacctttccaccagcaat
JQ707657_FT00000_P-G      ggtc-----cctctcgagtg-----gggaaagaacctttccaccagcaat
JQ707668_FT00000_P-G      ggtc-----cctctcgagtg-----gggaaagaacctttccaccagcaat
AB056515_FT00000_P-G      ggtc-----cctctcgagtg-----gggaaagaacctttccaccagcaat
KF414679_FT00000_P-G      ggtc-----cctctcgagtg-----gggaaagaacctttccaccagcaat
KR230749_FT00000_P-G      ggtc-----cctctcgagtg-----gggaaagaacctttccaccagcaat
KM998716_FT00000_P-G      ggtc-----cctctcgagtg-----gggaaagaacctttccaccagcaat
AB064313_FT00000_C-G      ggtc-----cctctcgagtg-----gggaaagaacctttccaccagcaat
AB064311_FT00000_P-G      ggtc-----cctctcgagtg-----gggaaagaacctttccaccagcaat
EF634480_FT00000_P-G      ggtc-----cctctcgagtg-----gggaaagaacctttccaccagcaat
AB064312_FT00000_P-G      ggtc-----cctctcgagtg-----gggaaggaacctttccaccagcaat
HE981174_FT00000_P-G      ggtc-----cctctcgagtg-----gggaaagaacctttccaccagcaat
KY004111_FT00000_P-G      ggtc-----cctctcgagtg-----gggaaagaacctttccaccagcaat
HE981175_FT00000_P-G      ggtc-----cctctcgagtg-----gggaaagaacctttccaccagcaat
HE981176_FT00000_P-G      ggtc-----cctctcgagtg-----gggaaagaacctttccaccagcaat
GU563556_FT00000_P-G      ggtc-----cctctcgagtg-----gggaaagaacctttccaccagcaat
AB375165_FT00000_P-G      ggtc-----cctctcgagtg-----gggaaagaacctttccaccagcaat
AB064310_FT00000_P-G      ggtc-----cctctcgagtg-----gggaaagaacctttccaccagcaat
AB056513_FT00000_P-G      ggtc-----cctctcgagtg-----gggaaagaacctttccaccagcaat
AB375166_FT00000_P-G      ggtc-----cctctcgagtg-----gggaaagaacctttccaccagcaat
AB375167_FT00000_P-G      ggtc-----cctctcgagtg-----gggaaagaacctttccaccagcaat
AB375169_FT00000_P-G      ggtc-----cctctcgagtg-----gggaaagaacctttccaccagcaat
AB375170_FT00000_P-G      ggtc-----cctctcgagtg-----gggaaagaacctttccaccagcaat
AB375168_FT00000_P-G      ggtc-----cctctcgagtg-----gggaaagaacctttccaccagcaat
KJ194508_FT00000_P-G      ggtc-----cctctcgagtg-----gggaaagaacctttccaccagcaat
KF767450_FT00000_P-G      ggtc-----cctctcgagtg-----gggaaagaacctttccaccagcaat
AF405706_FT00000_P-G      ggtc-----cctctcgagtg-----gggaaagaacctttccaccagcaat
AF160501_FT00000_C-G      ggtc-----cctctcgagtg-----gggaaagaacctttccgccagcaat
KX264500_FT00000_P-G      ggtc-----cctctcgagtg-----gggaaagaacctttccaccagcaat
FJ023674_FT00000_P-G      ggacatccacccctcggaaaggcatggggacgaatctttctgtacccaat
FR714503_FT00000_P-G      ggtcttccaaacctcgaaaaggcatggggacgaatctttctgttcccaat
                          ** *        ****         *** * *** *****      ****

EF464097_FT00000_P-G      cctctaggattccttcccgatcaccagttggacccagcattcagagcaaa
EF464098_FT00000_P-G      cctctaggattccttcccgatcaccagttggacccagcattcagagcaaa
JQ707677_FT00000_P-G      cctctaggattccttcccgatcaccagttggacccagcattcagagcaaa
JQ707678_FT00000_P-G      cctctaggattccttcccgatcaccagttggacccagcattcagagcaaa
JQ707679_FT00000_P-G      cctctaggattccttcccgatcaccagttggacccagcattcagagcaaa
JQ707671_FT00000_P-G      cctctaggattccttcccgatcaccagttggacccagcattcagagcaaa
JQ707680_FT00000_P-G      cctctaggattccttcccgatcaccagttggacccagcattcagagcaaa
JQ707673_FT00000_P-G      cctctaggattccttcccgatcaccagttggacccagcattcagagcaaa
JQ707666_FT00000_P-G      cctctaggattccttcccgatcaccagttggacccagcattcagagcaaa
JQ707660_FT00000_P-G      cctctaggattccttcccgatcaccagttggacccagcattcagagcaaa
JQ707657_FT00000_P-G      cctctaggattccttcccgatcaccagttggacccagcattcagagcaaa
JQ707668_FT00000_P-G      cctctaggattccttcccgatcaccagttggacccagcattcagagcaaa
AB056515_FT00000_P-G      cctctaggattccttcccgatcaccagttggacccagcattcagagcaaa
KF414679_FT00000_P-G      cctctaggattccttcccgatcaccagttggacccagcattcagagcaaa
KR230749_FT00000_P-G      cctctaggattccttcccgatcaccagttggacccagcattcagagcaaa
KM998716_FT00000_P-G      cctctaggattccttcccgatcaccagttggacccagcattcagagcaaa
AB064313_FT00000_C-G      cctctaggattccttcccgatcaccagttggacccagcattcagagcaaa
AB064311_FT00000_P-G      cctctaggattccttcccgatcaccagttggacccagcattcagagcaaa
EF634480_FT00000_P-G      cctctaggattccttcccgatcaccagttggacccagcattcagagcaaa
AB064312_FT00000_P-G      cctctaggattccttcccgatcaccagttggacccagcattcagagcaaa
HE981174_FT00000_P-G      cctctaggattccttcccgatcaccagttggacccagcattcagagcaaa
KY004111_FT00000_P-G      cctctaggattccttcccgatcaccagttggacccagcattcagagcaaa
HE981175_FT00000_P-G      cctctaggattccttcccgatcaccagttggacccagcattcagagcaaa
HE981176_FT00000_P-G      cctctaggattccttcccgatcaccagttggacccagcattcagagcaaa
GU563556_FT00000_P-G      cctctaggattccttcccgatcaccagttggacccagcattcagagcaaa
AB375165_FT00000_P-G      cctctaggattccttcccgatcaccagttggacccagcattcagagcaaa
AB064310_FT00000_P-G      cctctaggattccttcccgatcaccagttggacccagcattcagagcaaa
AB056513_FT00000_P-G      cctctaggattccttcccgatcaccagttggacccagcattcagagcaaa
AB375166_FT00000_P-G      cctctaggattccttcccgatcaccagttggacccagcattcagagcaaa
AB375167_FT00000_P-G      cctctaggattccttcccgatcaccagttggacccagcattcagagcaaa
AB375169_FT00000_P-G      cctctaggattccttcccgatcaccagttggacccagcattcagagcaaa
AB375170_FT00000_P-G      cctctaggattccttcccgatcaccagttggacccagcattcagagcaaa
AB375168_FT00000_P-G      cctctaggattccttcccgatcaccagttggacccagcattcagagcaaa
KJ194508_FT00000_P-G      cctctaggattccttcccgatcaccagttggacccagcattcagagcaaa
KF767450_FT00000_P-G      cctctaggattccttcccgatcaccagttggacccagcattcagagcaaa
AF405706_FT00000_P-G      cctctaggattccttcccgatcaccagttggacccagcattcagagcaaa
AF160501_FT00000_C-G      cctctaggattccttcccgatcaccagttggacccagcattcagagcaaa
KX264500_FT00000_P-G      cctctaggattccttcccgatcaccagttggacccagcattcagagcaaa
FJ023674_FT00000_P-G      cctctgggatttcttcccgatcatcagttggatcctgcgttcggagccaa
FR714503_FT00000_P-G      cctctgggatttcttcccgatcatcagttggaccctgcgttcggagccaa
                          ***** ***** *********** ******** ** ** *** **** **

EF464097_FT00000_P-G      taccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
EF464098_FT00000_P-G      taccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
JQ707677_FT00000_P-G      taccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
JQ707678_FT00000_P-G      taccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
JQ707679_FT00000_P-G      taccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
JQ707671_FT00000_P-G      taccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
JQ707680_FT00000_P-G      taccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
JQ707673_FT00000_P-G      taccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
JQ707666_FT00000_P-G      taccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
JQ707660_FT00000_P-G      taccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
JQ707657_FT00000_P-G      taccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
JQ707668_FT00000_P-G      taccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
AB056515_FT00000_P-G      taccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
KF414679_FT00000_P-G      taccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
KR230749_FT00000_P-G      taccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
KM998716_FT00000_P-G      taccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
AB064313_FT00000_C-G      taccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
AB064311_FT00000_P-G      taccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
EF634480_FT00000_P-G      taccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
AB064312_FT00000_P-G      taccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
HE981174_FT00000_P-G      taccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
KY004111_FT00000_P-G      taccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
HE981175_FT00000_P-G      taccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
HE981176_FT00000_P-G      taccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
GU563556_FT00000_P-G      taccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
AB375165_FT00000_P-G      taccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
AB064310_FT00000_P-G      taccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
AB056513_FT00000_P-G      taccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
AB375166_FT00000_P-G      taccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
AB375167_FT00000_P-G      taccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
AB375169_FT00000_P-G      taccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
AB375170_FT00000_P-G      taccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
AB375168_FT00000_P-G      taccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
KJ194508_FT00000_P-G      taccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
KF767450_FT00000_P-G      taccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
AF405706_FT00000_P-G      taccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
AF160501_FT00000_C-G      taccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
KX264500_FT00000_P-G      taccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
FJ023674_FT00000_P-G      ctcaaacaatccagattgggacttcaaccccaacaaggaccattggccac
FR714503_FT00000_P-G      ctcaaacaatccagattgggacttcaaccccaacaaggaccattggccac
                            * *********************** ***** ******* ******* 

EF464097_FT00000_P-G      aggccaacaaggtaggagttggagcctatggacccgggttcacccctcca
EF464098_FT00000_P-G      aggccaacaaggtaggagttggagcctatggacccgggttcacccctcca
JQ707677_FT00000_P-G      aggccaacaaggtaggagttggagcctatggacccgggttcacccctcca
JQ707678_FT00000_P-G      aggccaacaaggtaggagttggagcctatggacccgggttcacccctcca
JQ707679_FT00000_P-G      aggccaacaaggtaggagttggagcctatggacccgggttcacccctcca
JQ707671_FT00000_P-G      aggccaacaaggtaggagttggagcctatggacccgggttcacccctcca
JQ707680_FT00000_P-G      aggccaacaaggtaggagttggagcctatggacccgggttcacccctcca
JQ707673_FT00000_P-G      aggccaacaaggtaggagttggagcctatggacccgggttcacccctcca
JQ707666_FT00000_P-G      aggccaacaaggtaggagttggagcctatggacccgggttcacccctcca
JQ707660_FT00000_P-G      aggccaacaaggtaggagttggagcctatggacccgggttcacccctcca
JQ707657_FT00000_P-G      aggccaacaaggtaggagttggagcctatggacccgggttcacccctcca
JQ707668_FT00000_P-G      aggccaacaaggtaggagttggagcctatggacccgggttcacccctcca
AB056515_FT00000_P-G      aggccaacaaggtaggagttggagcctatggacccgggttcacccctcca
KF414679_FT00000_P-G      aggccaacaaggtaggagttggagcctatggacccgggttcacccctcca
KR230749_FT00000_P-G      aggccaacaaggtaggagttggagcctatggacccgggttcacccctcca
KM998716_FT00000_P-G      aggccaacaaggtaggagttggagcctatggacccgggttcacccctcca
AB064313_FT00000_C-G      aggccaacaaggtaggagttggagcctatggacccgggttcacccctcca
AB064311_FT00000_P-G      aggccaacaaggtaggagttggagcctatggacccgggttcacccctcca
EF634480_FT00000_P-G      aggccaacaaggtaggagttggagcctatggacccgggttcacccctcca
AB064312_FT00000_P-G      aggccaacaaggtaggagttggagcctatggacccgggttcacccctcca
HE981174_FT00000_P-G      aggccaacaaggtaggagttggagcctatggacccgggttcacccctcca
KY004111_FT00000_P-G      aggccaacaaggtaggagttggagcctatggacccgggttcacccctcca
HE981175_FT00000_P-G      aggccaacaaggtaggagttggagcctatggacccgggttcacccctcca
HE981176_FT00000_P-G      aggccaacaaggtaggagttggagcctatggacccgggttcacccctcca
GU563556_FT00000_P-G      aggccaacaaggtaggagttggagcctatggacccgggttcacccctcca
AB375165_FT00000_P-G      aggccaacaaggtaggagttggagcctatggacccgggttcacccctcca
AB064310_FT00000_P-G      aggccaacaaggtaggagttggagcctatggacccgggttcacccctcca
AB056513_FT00000_P-G      aggccaacaaggtaggagttggagcctatggacccgggttcacccctcca
AB375166_FT00000_P-G      aggccaacaaggtaggagttggagcctatggacccgggttcacccctcca
AB375167_FT00000_P-G      aggccaacaaggtaggagttggagcctatggacccgggttcacccctcca
AB375169_FT00000_P-G      aggccaacaaggtaggagttggagcctatggacccgggttcacccctcca
AB375170_FT00000_P-G      aggccaacaaggtaggagttggagcctatggacccgggttcacccctcca
AB375168_FT00000_P-G      aggccaacaaggtaggagttggagcctatggacccgggttcacccctcca
KJ194508_FT00000_P-G      aggccaacaaggtaggagttggagcctatggacccgggttcacccctcca
KF767450_FT00000_P-G      aggccaacaaggtaggagttggagcctatggacccgggttcacccctcca
AF405706_FT00000_P-G      aggccaacaaggtaggagttggagcctatggacccgggttcacccctcca
AF160501_FT00000_C-G      aggccaacaaggtaggagttggagcctatggacccgggttcacccctcca
KX264500_FT00000_P-G      aggccaacaaggtaggagttggagcctatggacccgggttcacccctcca
FJ023674_FT00000_P-G      aagcccatcaggtaggagcgggagcattcgggccagggttcacccctcca
FR714503_FT00000_P-G      aagcccatcaggtaggagcgggagcattcgggccagggttcacccctcct
                          * *** *  *********  ***** *  ** ** ************** 

EF464097_FT00000_P-G      cacggaggccttttggggtggagccctcagtctcagggcacactaacaac
EF464098_FT00000_P-G      cacggaggccttttggggtggagccctcagtctcagggcacactaacaac
JQ707677_FT00000_P-G      cacggaggccttttggggtggagccctcagtctcagggcacactaacaac
JQ707678_FT00000_P-G      cacggaggccttttggggtggagccctcagtctcagggcacactaacaac
JQ707679_FT00000_P-G      cacggaggccttttggggtggagccctcagtctcagggcacactaacaac
JQ707671_FT00000_P-G      cacggaggccttttggggtggagccctcagtctcagggcacactaacaac
JQ707680_FT00000_P-G      cacggaggccttttggggtggagccctcagtctcagggcacactaacaac
JQ707673_FT00000_P-G      cacggaggccttttggggtggagccctcagtctcagggcacactaacaac
JQ707666_FT00000_P-G      cacggaggccttttggggtggagccctcagtctcagggcacactaacaac
JQ707660_FT00000_P-G      cacggaggccttttggggtggagccctcagtctcagggcacactaacaac
JQ707657_FT00000_P-G      cacggaggccttttggggtggagccctcagtctcagggcacactaacaac
JQ707668_FT00000_P-G      cacggaggccttttggggtggagccctcagtctcagggcacactaacaac
AB056515_FT00000_P-G      cacggaggccttttggggtggagccctcagtctcagggcacactaacaac
KF414679_FT00000_P-G      cacggaggccttttggggtggagccctcagtctcagggcacactaacaac
KR230749_FT00000_P-G      cacggaggccttttggggtggagccctcagtctcagggcacactaacaac
KM998716_FT00000_P-G      cacggaggccttttggggtggagccctcagtctcagggcacactaacaac
AB064313_FT00000_C-G      cacggaggccttttggggtggagccctcagtctcagggcacactaacaac
AB064311_FT00000_P-G      cacggaggccttttggggtggagccctcagtctcagggcacactaacaac
EF634480_FT00000_P-G      cacggaggccttctggggtggagccctcagtctcagggcacactaacaac
AB064312_FT00000_P-G      cacggaggccttttggggtggagccctcagtctcagggcacactaacaac
HE981174_FT00000_P-G      cacggaggccttttggggtggagccttcaatctcagggcacactaacaac
KY004111_FT00000_P-G      cacggaggccttttggggtggagccctcagtctcagggcacactaacaac
HE981175_FT00000_P-G      cacggaggccttttggggtggagccttcagtctcagggcacactaacaac
HE981176_FT00000_P-G      cacggaggccttttggggtggagccttcagtctcagggcacactaacaac
GU563556_FT00000_P-G      cacggaggccttttggggtggagccctcagtctcagggcacactaacaac
AB375165_FT00000_P-G      cacggaggccttttggggtggagccctcagtctcagggcacactaacaac
AB064310_FT00000_P-G      cacggaggccttttggggtggagccctcagtctcagggcacactaacaac
AB056513_FT00000_P-G      cacggaggccttttggggtggagccctcagtctcagggcacactaacaac
AB375166_FT00000_P-G      cacggaggccttttggggtggagccctcagtctcagggcacactaacaac
AB375167_FT00000_P-G      cacggaggccttttggggtggagccctcagtctcagggcacactaacaac
AB375169_FT00000_P-G      cacggaggccttttggggtggagccctcagtctcagggcacactaacaac
AB375170_FT00000_P-G      cacggaggccttttggggtggagccctcagtctcagggcacactaacaac
AB375168_FT00000_P-G      cacggaggccttttggggtggagccctcagtctcagggcacactaacaac
KJ194508_FT00000_P-G      cacggaggccttttggggtggagccctcagtctcagggcacactaacaac
KF767450_FT00000_P-G      cacggaggccttttggggtggagccctcagtctcagggcacactaacaac
AF405706_FT00000_P-G      cacggaggccttttggggtggagccctcagtctcagggcacactaacaac
AF160501_FT00000_C-G      cacggaggccttttggggtggagccctcagtctcagggcacactaacaac
KX264500_FT00000_P-G      cacggaggccttttggggtggagccctcagtctcagggcacactaacaac
FJ023674_FT00000_P-G      cacggaggtctgttggggtggagccctcaggctcagggcatattaacaaa
FR714503_FT00000_P-G      cacggaggtcttttggggtggagccctcaggctcagggcatattaacaaa
                          ******** **  ************ ***  ********* * ****** 

EF464097_FT00000_P-G      tttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggc
EF464098_FT00000_P-G      tttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggc
JQ707677_FT00000_P-G      tttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggc
JQ707678_FT00000_P-G      tttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggc
JQ707679_FT00000_P-G      tttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggc
JQ707671_FT00000_P-G      tttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggc
JQ707680_FT00000_P-G      tttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggc
JQ707673_FT00000_P-G      tttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggc
JQ707666_FT00000_P-G      tttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggc
JQ707660_FT00000_P-G      tttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggc
JQ707657_FT00000_P-G      tttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggc
JQ707668_FT00000_P-G      tttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggc
AB056515_FT00000_P-G      tttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggc
KF414679_FT00000_P-G      tttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggc
KR230749_FT00000_P-G      tttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggc
KM998716_FT00000_P-G      tttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggc
AB064313_FT00000_C-G      tttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggc
AB064311_FT00000_P-G      tttgccagcagatccgcccactgcctccaccaatcgtcagtcagggaggc
EF634480_FT00000_P-G      tttaccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggc
AB064312_FT00000_P-G      tttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggc
HE981174_FT00000_P-G      tttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggc
KY004111_FT00000_P-G      tttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggc
HE981175_FT00000_P-G      tttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggc
HE981176_FT00000_P-G      tttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggc
GU563556_FT00000_P-G      tttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggc
AB375165_FT00000_P-G      tttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggc
AB064310_FT00000_P-G      tttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggc
AB056513_FT00000_P-G      tttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggc
AB375166_FT00000_P-G      tttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggc
AB375167_FT00000_P-G      tttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggc
AB375169_FT00000_P-G      tttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggc
AB375170_FT00000_P-G      tttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggc
AB375168_FT00000_P-G      tttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggc
KJ194508_FT00000_P-G      tttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggc
KF767450_FT00000_P-G      tttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggc
AF405706_FT00000_P-G      tttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggc
AF160501_FT00000_C-G      tttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggc
KX264500_FT00000_P-G      tttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggc
FJ023674_FT00000_P-G      tgtgccagcagttcctcctcctgcctcaaccaatcggcagtcaggacggc
FR714503_FT00000_P-G      cgtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggc
                            * ******* *** **  ******* ******** ********  ***

EF464097_FT00000_P-G      agcctactcccatctctccaccactaagagacagtcatcctcaggccatg
EF464098_FT00000_P-G      agcctactcccatctctccaccactaagagacagtcatcctcaggccatg
JQ707677_FT00000_P-G      agcctactcccatctctccaccactaagagacagtcatcctcaggccatg
JQ707678_FT00000_P-G      agcctactcccatctctccaccactaagagacagtcatcctcaggccatg
JQ707679_FT00000_P-G      agcctactcccatctctccaccactaagagacagtcatcctcaggccatg
JQ707671_FT00000_P-G      agcctactcccatctctccaccactaagagacagtcatcctcaggccatg
JQ707680_FT00000_P-G      agcctactcccatctctccaccactaagagacagtcatcctcaggccatg
JQ707673_FT00000_P-G      agcctactcccatctctccaccactaagagacagtcatcctcaggccatg
JQ707666_FT00000_P-G      agcctactcccatctctccaccactaagagacagtcatcctcaggccatg
JQ707660_FT00000_P-G      agcctactcccatctctccaccactaagagacagtcatcctcaggccatg
JQ707657_FT00000_P-G      agcctactcccatctctccaccactaagagacagtcatcctcaggccatg
JQ707668_FT00000_P-G      agcctactcccatctctccaccactaagagacagtcatcctcaggccatg
AB056515_FT00000_P-G      agcctactcccatctctccacctctaagagacagtcatcctcaggccatg
KF414679_FT00000_P-G      agcctactcccatctctccaccactaagagacagtcatcctcaggccatg
KR230749_FT00000_P-G      agcctactcccatctctccaccactaagagacagtcatcctcaggccatg
KM998716_FT00000_P-G      agcctactcccatctctccaccactaagagacagtcatcctcaggccatg
AB064313_FT00000_C-G      agcctactcccatctctccaccactaagagacagtcatcctcaggccatg
AB064311_FT00000_P-G      agcctactcccatctctccaccactaagagacagtcatcctcaggccatg
EF634480_FT00000_P-G      agcctactcccatctctccaccactaagagacagtcatcctcaggccatg
AB064312_FT00000_P-G      agcctactcccatctctccaccactaagagacagtcatcctcaggccatg
HE981174_FT00000_P-G      agcctactcccatctctccaccactaagagacagtcatcctcaggccatg
KY004111_FT00000_P-G      agcctactcccatctctccaccactaagagacagtcatcctcaggccatg
HE981175_FT00000_P-G      agcctactcccatctctccaccactaagagacagtcatcctcaggccatg
HE981176_FT00000_P-G      agcctactcccatctctccaccactaagagacagtcatcctcaggccatg
GU563556_FT00000_P-G      agcctactcccatctctccaccactaagagacagtcatcctcaggccatg
AB375165_FT00000_P-G      agcctactcccatctctccaccactaagagacagtcatcctcaggccatg
AB064310_FT00000_P-G      agcctactcccatctctccaccactaagagacagtcatcctcaggccctg
AB056513_FT00000_P-G      agcctactcccatctctccaccactaagagacagtcatcctcaggccatg
AB375166_FT00000_P-G      agcctactcccatctctccaccactaagagacagtcatcctcaggccatg
AB375167_FT00000_P-G      agcctactcccatctctccaccactaagagacagtcatcctcaggccatg
AB375169_FT00000_P-G      agcctactcccatctctccaccactaagagacagtcatcctcaggccatg
AB375170_FT00000_P-G      agcctactcccatctctccaccactaagagacagtcatcctcaggccatg
AB375168_FT00000_P-G      agcctactcccatctctccaccactaagagacagtcatcctcaggccatg
KJ194508_FT00000_P-G      agcctactcccatctctccaccactaagagacagtcatcctcaggccatg
KF767450_FT00000_P-G      agcctactcccatctctccaccactaagagacagtcatcctcaggccatg
AF405706_FT00000_P-G      agcctactcccatctctccaccactaagagacagtcatcctcaggccatg
AF160501_FT00000_C-G      agcctactcccatctctccaccactaagagacagtcatcctcaggccatg
KX264500_FT00000_P-G      agcctactcccatctctccaccactaagagacagtcatcctcaggccatg
FJ023674_FT00000_P-G      agcccactcccatctctccacctctgagagacagycatcctcaggccatg
FR714503_FT00000_P-G      agccaactcccatatctccacctctaagagacagtcatcctcaggccatg
                          **** ******** ******** ** ******** ************ **

EF464097_FT00000_P-G      cagtggaa
EF464098_FT00000_P-G      cagtggaa
JQ707677_FT00000_P-G      cagtggaa
JQ707678_FT00000_P-G      cagtggaa
JQ707679_FT00000_P-G      cagtggaa
JQ707671_FT00000_P-G      cagtggaa
JQ707680_FT00000_P-G      cagtggaa
JQ707673_FT00000_P-G      cagtggaa
JQ707666_FT00000_P-G      cagtggaa
JQ707660_FT00000_P-G      cagtggaa
JQ707657_FT00000_P-G      cagtggaa
JQ707668_FT00000_P-G      cagtggaa
AB056515_FT00000_P-G      cagtggaa
KF414679_FT00000_P-G      cagtggaa
KR230749_FT00000_P-G      cagtggaa
KM998716_FT00000_P-G      cagtggaa
AB064313_FT00000_C-G      cagtggaa
AB064311_FT00000_P-G      cagtggaa
EF634480_FT00000_P-G      cagtggaa
AB064312_FT00000_P-G      cagtggaa
HE981174_FT00000_P-G      cagtggaa
KY004111_FT00000_P-G      cagtggaa
HE981175_FT00000_P-G      cagtggaa
HE981176_FT00000_P-G      cagtggaa
GU563556_FT00000_P-G      cagtggaa
AB375165_FT00000_P-G      cagtggaa
AB064310_FT00000_P-G      cagtggaa
AB056513_FT00000_P-G      cagtggaa
AB375166_FT00000_P-G      cagtggaa
AB375167_FT00000_P-G      cagtggaa
AB375169_FT00000_P-G      cagtggaa
AB375170_FT00000_P-G      cagtggaa
AB375168_FT00000_P-G      cagtggaa
KJ194508_FT00000_P-G      cagtggaa
KF767450_FT00000_P-G      cagtggaa
AF405706_FT00000_P-G      cagtggaa
AF160501_FT00000_C-G      cagtggaa
KX264500_FT00000_P-G      cagtggaa
FJ023674_FT00000_P-G      cagtggaa
FR714503_FT00000_P-G      cagtggaa
                          ********

© 1998-2020Legal notice