HBVdb

Dataset for nucleotide sequence Genomes of genotype G

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*** **    ************** **  ****** * ************** ************************  *
CTCTACAGCATTCCACCAAGCTCTACAAAATCCCAAAGTCAGGGGCCTGTATtTTCCTGCTGGTGGCTCCAGTTCAGGGA
   c  ccag              t  rg      g a              c                        aa 
       a c                         c                                            
                                                                                

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *    * **** ***** *********** **  ** ********* * * ** ***** ** **** **** ******
TAGTGAACCCTGTTCCGACTATTGCCTCTCACATCTCGTCAATCTTCTCCAGGATTGGGGACCCTGCACCGAACATGGAG
c ccag a    c     a           t  ca  a         g g a  c     g  t    a    t      
   a                                           a a                              
                                                                                

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
** ************ **** *************************    ************** ***************
AACATCACATCAGGATTCCTAGGACCCCTGCTCGTGTTACAGGCGGGGTTTTTCTTGTTGACAAGAATCCTCACAATACC
  t            c    c                         tagg              a               
                                                                                
                                                                                

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 ******************************************* *    ********* ***** **************
GCAGAGTCTAGACTCGTGGTGGACTTCTCTCAATTTTCTAGGGGGAGTGCCCGTGTGTCCTGGCCTAAATTCGCAGTCCC
a                                           a acaa         t     a              
                                                                                
                                                                                

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
****************** ** ************** ********* **************  **************** 
CAACCTCCAATCACTCACCAATCTCCTGTCCTCCAACTTGTCCTGGCTATCGCTGGATGTGTCTGCGGCGTTTTATCATA
                  t  c              t         a              gt                c
                                                                                
                                                                                

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
************************************************** ***** ******************** **
TTCCTCTTCATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTGGACTATCAAGGTATGTTGCCCGTTTGTCCTCT
                                                  t     r                    c  
                                                                                
                                                                                

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *** ********** ******** ******** **** *****************************************
GATTcCAGGATCCTCGACCACCAGTACGGGACCCTGCAAAACCTGCACGACTCCTGCTCAAGGCAACTCTATGTATCCCT
a   t          c        c        a    g                                         
                                                                                
                                                                                

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
************ ***** ******  *****************************************************
CATGTTGCTGTACAAAACCTTCGGACGGAAATTGCACCTGTATTCCCATCCCATCATCTTGGGCTTTCGCAAAATACCTA
            t     t      aa                                                     
                                                                                
                                                                                

       650       660       670       680       690       700       710       720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**************** ********* **************** ************************************
TGGGAGTGGGCCTCAGTCCGTTTCTCtTGGCTCAGTTTACTAGTGCCATTTGTTCAGTGGTTCGTAGGGCTTTCCCCCAC
                c         a                c                                    
                          c                                                     
                                                                                

       730       740       750       760       770       780       790       800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*** ********** *** * *********************** ******** ** ****** ** *** *********
TGTCTGGCTTTCAGCTATATgGATGATGTGGTATTGGGGGCCAAATCTGTACAACATCTTGAGTCCCTTTaTACCGCTGT
   t          t   g t                       g        m  c      g  a   t         
                    c                                                           
                                                                                

       810       820       830       840       850       860       870       880
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
******************************* ****   *  ****** **  ************** * *  ** ****
TACCAATTTTCTTTTGTCTTTGGGTATACATCTAAACCcTAACAAAACAAAAAGATGGGGTTATTCCTTAAATTTTATGG
                               t    tta gc      t  gc              c g rc  c    
                                                                                
                                                                                

       890       900       910       920       930       940       950       960
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**** ******************** ******** ** ** **   * * ***** *  * ******* * ***** ***
GATATGTAATTGGAAGTTGGGGTACTTTGCCACAAGAACACATCACACAgAAAATTAAGCAATGTTTTCGGAAACTCCCT
    c                    c        g  t  t  tgt a a     c ga r       a a     a   
                                                                    g           
                                                                                

       970       980       990      1000      1010      1020      1030      1040
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
***** *****  ************* ****** ****    ** **  **** ** ******** ** ** ********
GTTAACAGGCCAATTGATTGGAAAGTCTGTCAACGAATAACTGGTCTGTTGGGTTTCGCTGCTCCTTTTACCCAATGTGG
     t     cg             t      a    tttg  a  cc    c  t        c  c  a        
                          r            g a         a           a              
                          a                                                     

      1050      1060      1070      1080      1090      1100      1110      1120
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
********* *********** ***** **********  ** ******** ***************** **********
TTACCCTGCCTTAATGCCTTTATATGCATGTATACAAGCTAAGCAGGCTTTTACTTTCTCGCCAACTTATAAGGCCTTTC
         g           g     m          tc  a        c                 c          
         a                                                                      
                                                                                

      1130      1140      1150      1160      1170      1180      1190      1200
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* ***********   ************ ****   ********************************** *********
TCTGTAAACAATACATGAACCTTTACCCcGTTGCTAGGCAACGGCCCGGTCTGTGCCAAGTGTTTGCTGACGCAACCCCC
 g           tcg            t    tcc                                  t         
 a                                                                              
                                                                                

      1210      1220      1230      1240      1250      1260      1270      1280
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
***** ***** ******** ** ********************************************************
ACTGGTTGGGGCTTGGCCATCGGcCATCAGCGCATGCGTGGAACCTTTGTGGCTCCTCTGCCGATCCATACTGCGGAACT
     c     g        g  a                                                        
                    a                                                           
                                                                                

      1290      1300      1310      1320      1330      1340      1350      1360
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  * ***** *************** ************   * ** ** ***** ************** ** *******
CCTAGCTGCTTGTTTTGCTCGCAGCCGGTCTGGAGCAAAACTCATTGGGACTGACAATTCTGTCGTCCTTTCTCGGAAAT
ga c     c               a            cca t  c  a     t              c  g       
                                                                        c       
                                                                                

      1370      1380      1390      1400      1410      1420      1430      1440
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**** ** ***** **** ************ ****  * ** ***    ************** ********* * ***
ATACATCCTTTCCATGGCTGCTAGGCTGTGCTGCCAACTGGATCCTTCGCGGGACGTCCTTTGTTTACGTCCCGTCAGCG
    c  a     c    a            c    ta c  c   gtca              c         a g   
    m                                                                         
                                                                                

      1450      1460      1470      1480      1490      1500      1510      1520
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 ******* **************  **** ** ****** ***  ** ** ***** * **** *** **  *** ****
CTGAATCCAGCGGACGACCCCTCCCGGGGCCGTTTGGGGCTCTGTCGCCCCCTTCTCCGTCTGCCGTTCCTGCCGACCAC
t       t              tt    t  g      a   ac  t  t     t a    t   a  ga   w    
                                c                                          t    
                                                                           c    

      1530      1540      1550      1560      1570      1580      1590      1600
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
************* ********* ***** *  *** **** ************************ *************
GGGGCGCACCTCTCTTTACGCGGTCTCCCCGTCTGTtCCTTCTCATCTGCCGGACCGTGTGCACTTCGCTTCACCTCTGC
             a         a     g ag   g    t                        t             
                                                                                
                                                                                

      1610      1620      1630      1640      1650      1660      1670      1680
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
****  ****** *** ** ***** **          * ** * *   **  ***** ************* *  *  *
ACGTTACATGGAAACCGCCATGAACACCTCTCATCATCTGCCAAgGCAGTTATATAAGAGGACTCTTGGACTGTTTGTTA
    cg      g   a  g     g  cacttggcct a  c a gta  gc     t             c ca ca 
                                  ata                     c                     
                                   g                                            

      1690      1700      1710      1720      1730      1740      1750      1760
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
******* ****   * ***  ****** ** ******** ***   ** ***** ** ** **  * ***   ******
TGTCAACAACCGGGgTGGAGAAATACTTCAAGGACTGTGTTTTTGCTGAGTGGGAAGAATTAGGCAATGAGTCCAGGTTA
       g    aca t   gc      g  a        g   aaa  c     g  g  g  gg g   att      
              c                         a                                       
                                                                                

      1770      1780      1790      1800      1810      1820      1830      1840
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* *  ** **** * ******** ********** ******  ***** ******* ***********************
ATGACCTTTGTATTAGGAGGCTGTAGGCATAAATTGGTCTGcgCACCAGCACCATGtAACTTTTTCACCTCTGCCTAATC
 a gt  a    c g        c          g      tt     a       c                       
                                                                                
                                                                                

      1850      1860      1870      1880      1890      1900      1910      1920
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
***** *********** ************************************* ** ****                 
ATCTCTTGTTCATGTCCtACTGTTCAAGCCTCCAAGCTGTGCCTTGGGTGGCTTTAGGGCATGGATAGAACAACTTTGCC
     a           c                                     g  a    -----------------
                                                                                
                                                                                

      1930      1940      1950      1960      1970      1980      1990      2000
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                   *********** ****************** ********** ***** ********* ***
ATATGGCCTTTTTGGCTTAGACATTGACCCTTATAAAGAATTTGGAGCTACTGTGGAGTTGCTCTCGTTTTTGCCTTCTG
-------------------           g                  t          a     t         a   
                                                                                
                                                                                

      2010      2020      2030      2040      2050      2060      2070      2080
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* ** ** ****** **** ** ** *********** ** *** **** ** **  **********    *  **** *
ACTTTTTCCCGTCTGTTCGTGATCTTCTCGACACCGCTTCAGCTTTGTACCGGGAATCCTTAGAGTCCTCTGATCATTGT
 t  c  t      a    g  c  c           c  t   c    t  a  gg          tctg ta    c 
                                     a                                a  g      
                                                                                

      2090      2100      2110      2120      2130      2140      2150      2160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
** ********* ***** * ********  *  **** **************** *** ** *********** * ***
TCGCCTCACCATACAGCACTCAGGCAAGCAATcCTGTGCTGGGGTGAGTTGATGACTCTAGCtACCTGGGTGGGTAATAA
  a         g     a a        tg tt    t                a   g  c           a g   
                                                                                
                                                                                

      2170      2180      2190      2200      2210      2220      2230      2240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
****** ** ** ** ***** ** ** ** ** *  ***** ***  ***  ****  ******* ** *** **** *
TTTGGAAGATCCAGCATCCAGAGATTTGGTGGTCAATTATGTTAATACTAATATGGGTTTAAAAATCAGGCAACTATTGT
      c  c  t  c     g  a  a  a  a gc     c   gt   ct    cc       t  a   a    a 
                                                                                
                                                                                

      2250      2260      2270      2280      2290      2300      2310      2320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*********************  ***** ***** ** ***** ***************** ******************
GGTTTCACATTTCCTGTCTTACTTTTGGGAGAGAAACCGTTCTTGAGTATTTGGTGTCTTTTGGAGTGTGGATTCGCACT
                     tg     a     c  t     a                 c                  
                                                                                
                                                                                

      2330      2340      2350      2360      2370      2380      2390      2400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
***** ** ** ********************* **************** ****************** *** ******
CCTCCTGCTTATAGACCACCAAATGCCCCTATCCTATCAACACTTCCGGAGACTACTGTTGTTAGACGAAGAGGCAGGTC
     c  g  c                     t                a                  c   a      
        a                                                                       
                                                                                

      2410      2420      2430      2440      2450      2460      2470      2480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**** ******************************* ****************** ********  *****  *   * *
CCCTCGAAGAAGAACTCCCTCGCCTCGCAGACGAAGATCTCAATCGCCGCGTCGCAGAAGATCTGCATCTCCAGCTTCCC
    a                               g                  g        ca     gg aac t 
                                                       c                    
                                                                                

      2490      2500      2510      2520      2530      2540      2550      2560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*********** *********** ***************** ***** ************ **************** **
AATGTTAGTATTCCTTGGACTCACAAGGTGGGAAACTTTACGGGGCTGTATTCTTCTACTATACCTGTCTTTAATCCTGA
           c           t                 t     t            g                g  
                                         c                                      
                                                                                

      2570      2580      2590      2600      2610      2620      2630      2640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *********** ******** ** ** ********* * ********   **  *** * ** ************ * *
TTGGCAAACTCCTTCTTTTCCAAATATCCATTTGCATCAAGACATTATAACTAAATGTGAaCAATTTGTGGGCCCTCTCA
g           c        t  c  t         g g        cga  gg   c g  g            t t 
c                                                                             g 
                                                                                

      2650      2660      2670      2680      2690      2700      2710      2720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**** ***** **           *  ** ********** ** ** *  ** ***  *** ** ***** ** ***** 
CAGTAAATGAGAAACGAAGATTAAAACTAGTTATGCCTGCCAGATTTTTCCCAAACTCTACTAAATATTTACCATTAGAC
    t     a  ga--------- ct  a          t  g  c at  t   cg   c  g     g  c     t
    g           g   c                                                         
                                                                                

      2730      2740      2750      2760      2770      2780      2790      2800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
***** ** **    ***** ** **  * *  *********** *** *  * ** ************** ** *****
AAAGGTATCAAACCGTATTATCCAGAAAATGTAGTTAATCATTACTTCCAGACCAGACATTATTTACATACCCTTTGGAA
     c  t  ---t     c  t  gc g cc           t   a ag t  g              t  g     
        a                                                                       
                                                                                

      2810      2820      2830      2840      2850      2860      2870      2880
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 ** ** ********************  * ** ***** *********************  * ********** * **
GGCGGGTATTCTATATAAGAGAGAAACATCCCGTAGCGCTTCATTTTGTGGGTCACCATATACTTGGGAACAAGATCTAC
a  t  c                    ta a  c     c                     ta a          g c  
                                       a                                        
                                                                                

      2890      2900      2910      2920      2930      2940      2950      2960
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
********        **  ** *        ****         *** * *** *****      ********* ****
AGCATGGGGCTTTCTTGGACGGTC-----CCTCTCGAGTG-----GGGAAAGAACCTTTCCACCAGCAATCCTCTAGGAT
        a-------  tt  a ttccaaac    gaaaggcat   g c   t     tgttcc         g    
                      a                         g            a                
                                                                                

      2970      2980      2990      3000      3010      3020      3030      3040
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* *********** ******** ** ** *** **** **  * *********************** ***** ******
TCCTTCCCGATCACCAGTTGGACCCAGCATTCAGAGCAAATACCAACAATCCAGATTGGGACTTCAATCCCAAAAAGGAC
 t           t        t  t  g   g    c  ct a                       c     c      
                                                                                
                                                                                

      3050      3060      3070      3080      3090      3100      3110      3120
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* ******* * *** *  *********  ***** *  ** ** ************** ******** **  *******
CCTTGGCCAGAGGCCAACAAGGTAGGAGTTGGAGCCTATGGACCCGGGTTCACCCCTCCACACGGAGGCCTTTTGGGGTG
 a       c a   c tc         cg     a tc  g  a              t        t  gc       
                                                                                
                                                                                

      3130      3140      3150      3160      3170      3180      3190      3200
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
***** ***  ********* * ******   * ******* *** **  ******* ******** ********  ***
GAGCCCTCAGTCTCAGGGCACACTAACAACTTTGCCAGCAGATCCGCCTCCTGCCTCCACCAATCGTCAGTCAGGGAGGC
     t   ag         t t      acg a       t   t  ca       a        g        ac   
                                                                                
                                                                                

      3210      3220      3230      3240      3250        
....:....|....:....|....:....|....:....|....:....|....:...
**** ******** ******** ** ******** ************ **********
AGCCTACTCCCATCTCTCCACCACTAAGAGACAGTCATCCTCAGGCCATGCAGTGGAA
    c        a        t  g        y            c          
    a                                                     
                                                          
© 1998-2020Legal notice