HBVdb

Dataset for nucleotide sequence Genomes of genotype G

[Download (right click)] [Alignment] [Repertoires]

40 sequence(s)

>gnl|hbvnuc|AB056513_FT00000_P-G Feature FT:source AB056513_FT00000_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=3248 residues).
ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttcaggga
tagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggag
aatatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccc
caacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtatccct
catgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaagatggggttattccttaaattttatgg
gatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatgttttcggaaactccct
gttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggtttcgctgctccttttacccaatgtgg
ttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatccagcggacgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactgtttgtta
tgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggtta
atgacctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaactttgcc
atatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctg
actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactctagctacctgggtgggtaataa
tttggaagatccagcatccagagatttggtggtcaattatgttaatactaatttgggtttaaaaatcaggcaactattgt
ggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttccc
aatgttagtattccttggactcacaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctga
ttggcaaactccttcttttccaaatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctca
cagtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagac
aaaggtatcaaaccgtattatccagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaa
ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctac
agcatggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccga
tcaccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
aggccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcag
tctcagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcc
catctctccaccactaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB056515_FT00000_P-G Feature FT:source AB056515_FT00000_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=3248 residues).
ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttcaggga
tagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccaagattggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagcgcccgtgtgtcctggcctaaattcgcagtccc
caacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtatccct
catgttgctgtataaaaccttcggaaggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaagatggggttattccttaaattttatgg
gatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatgttttcggaaactccct
gttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggtttcgctgctccttttacccaatgtgg
ttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttc
tctgtaaacaatacctgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaacactcattgggactgacaattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatccagcggacgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactgtttgtta
tgtcaacaaccggggtggagaaatacttcaaggactgtgtgtttgctgagtgggaagaattaggcaatgagtccaggtta
atgacctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaactttgcc
atatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgttcattgt
tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactctagctacctgggtgggtaataa
tttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggtttaaaaatcaggcaactattgt
ggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacgaagagacaggtc
ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttccc
aatgttagtattccttggactcacaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctga
ttggcaaactccttcttttccaaatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctca
cagtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagac
aaaggtatcaaaccgtattatccagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaa
ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctac
agcatggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccga
tcaccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
aggccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcag
tctcagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB064310_FT00000_P-G Feature FT:source AB064310_FT00000_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=3248 residues).
ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttcaggga
tagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaatatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccc
caacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtatccct
catgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaagatggggttattccttaaattttatgg
gatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatgttttcggaaactccct
gttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggtttcgctgctccttttacccaatgtgg
ttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatccagcggacgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactgtttgtta
tgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggtta
atgacctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaactttgcc
atatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactctagccacctgggtgggtaataa
tttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggtttaaaaatcaggcaactattgt
ggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttccc
aatgttagtattccttggactcacaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatccgga
ttggcaaactccttcttttccaaatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctca
cagtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagac
aaaggtatcaaaccgtattatccagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaa
ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctac
agcatggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccga
tcaccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
aggccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcag
tctcagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcc
catctctccaccactaagagacagtcatcctcaggccctgcagtggaa
>gnl|hbvnuc|AB064311_FT00000_P-G Feature FT:source AB064311_FT00000_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=3248 residues).
ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttcaggga
tagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccc
caacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtatccct
catgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaagatggggttattccttaaattttatgg
gatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatgttttcggaaactccct
gttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggtttcgctgctcctttcacccaatgtgg
ttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctcgctgcttgttttgctcgcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggctgtgccgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatccagcggacgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttacatggaaaccgccatgaacacctatcatcatctgccaaggcagttatataagaggactcttggactgtttgtta
tgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggtta
atgacctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaactttgcc
atatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactctagctacctgggtgggtaataa
tttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggtttaaaaatcaggcaactattgt
ggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttccc
aatgttagtattccttggactcacaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctga
ttggcaaactccttcttttccaaatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctca
cagtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagac
aaaggtatcaaaccgtattatccagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaa
ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctac
agcatggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccga
tcaccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
aggccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcag
tctcagggcacactaacaactttgccagcagatccgcccactgcctccaccaatcgtcagtcagggaggcagcctactcc
catctctccaccactaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB064312_FT00000_P-G Feature FT:source AB064312_FT00000_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=3248 residues).
ctctacagcattccaccaagctctacaaaatcccacagtcaggggcctgtatcttcctgctggtggctccagttcaggga
tagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccc
caacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtatccct
catgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatctaaaccctgacaaaacaaaaagatggggttattccttaaattttatgg
gatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatgttttcggaaactccct
gttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggtttcgctgctccttttacccaatgtgg
ttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatccagcggacgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactgtttgtta
tgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggtta
atgacctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaactttgcc
atatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
tcgcctcaccatgcagcactcaggcaagcaatcctgtgctggggtgagttgatgactctagctacctgggtgggtaataa
tttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggtttaaaaatcaggcaactattgt
ggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttccc
aatgttagtattccttggactcacaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctga
ttggcaaactccttcttttccaaatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctca
cagtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagac
aaaggtatcaaaccgtattatccagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaa
ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctac
agcatggggctttcttggacggtccctctcgagtggggaaggaacctttccaccagcaatcctctaggattccttcccga
tcaccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
aggccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcag
tctcagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcc
catctctccaccactaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB064313_FT00000_C-G Feature FT:source AB064313_FT00000_C-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=3248 residues).
ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttcaggga
tagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccc
caacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcccct
gattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtatccct
catgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaagatggggttattccttaaattttatgg
gatatgtaattggaagttggggtactttgccacaagaacacatcacaaagaaaattaagcaatgttttcggaaactccct
gttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggtttcgctgctccttttacccaatgtgg
ttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctcgctgcttgttttgctcgcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggctgtgccgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatccagcggacgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactgtttgtta
tgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggtta
atgacctttgtattaggaggctgcaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaactttgcc
atatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactctagccacctgggtgggtaataa
tttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggtttaaaaatcaggcaactattgt
ggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttccc
aatgttagtattccttggactcacaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctga
ttggcaaactccttcttttccaaatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctca
cagtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagac
aaaggtatcaaaccgtattatccagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaa
ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctac
agcatggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccga
tcaccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
aggccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcag
tctcagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcc
catctctccaccactaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB375165_FT00000_P-G Feature FT:source AB375165_FT00000_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=3248 residues).
ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttcaggga
tagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccc
caacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtatccct
catgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaagatggggttattccttaarttttatgg
gatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcratgttttcggaaactccct
gttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggtttcgctgctccttttacccaatgtgg
ttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatccagcggacgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactgtttgtta
tgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggtta
atgacctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaactttgcc
atatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactctagccacctgggtgggtaataa
tttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggtttaaaaatcaggcaactattgt
ggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttccc
aatgttagtattccttggactcacaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctga
ttggcaaactccttcttttccaaatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctca
cagtaaatgagaagcgaagattaaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagac
aaaggtatcaaaccgtattatccagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaa
ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctac
agcatggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccga
tcaccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
aggccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcag
tctcagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcc
catctctccaccactaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB375166_FT00000_P-G Feature FT:source AB375166_FT00000_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=3248 residues).
ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttcaggga
tagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccc
caacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gatttcaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtatccct
catgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaagatggggttattccttaaattttatgg
gatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatgttttcggaaactccct
gttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggtttcgctgctccttttacccaatgtgg
ttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatccagcggacgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactgtttgtta
tgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggtta
atgacctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaactttgcc
atatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactctagccacctgggtgggtaataa
tttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggtttaaaaatcaggcaactattgt
ggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttccc
aatgttagtattccttggactcacaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctga
ttggcaaactccttcttttccaaatatccatttgcatcaagacattataactaaatgtgagcaatttgtgggccctctca
cagtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagac
aaaggtatcaaaccgtattatccagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaa
ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctac
agcatggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccga
tcaccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
aggccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcag
tctcagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcc
catctctccaccactaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB375167_FT00000_P-G Feature FT:source AB375167_FT00000_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=3248 residues).
ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttcaggga
tagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccc
caacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gatttcaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtatccct
catgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaagatggggttattccttaaattttatgg
gatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatgttttcggaaactccct
gttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggtttcgctgctccttttacccaatgtgg
ttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatccagcggacgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactgtttgtta
tgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggtta
atgacctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaactttgcc
atatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactctagccacctgggtgggtaataa
tttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggtttaaaaatcaggcaactattgt
ggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttccc
aatgttagtattccttggactcacaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctga
ttggcaaactccttcttttccaaatatccatttgcatcaagacattataactaaatgtgagcaatttgtgggccctctca
cagtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagac
aaaggtatcaaaccgtattatccagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaa
ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctac
agcatggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccga
tcaccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
aggccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcag
tctcagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcc
catctctccaccactaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB375168_FT00000_P-G Feature FT:source AB375168_FT00000_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=3248 residues).
ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttcaggga
tagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccc
caacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gatttcaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtatccct
catgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaagatggggttattccttaaattttatgg
gatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatgttttcggaaactccct
gttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggtttcgctgctccttttacccaatgtgg
ttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatccagcggacgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactgtttgtta
tgtcaacaaccggggtggagaaatacttgaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggtta
atgacctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaactttgcc
atatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactctagccacctgggtgggtaataa
tttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggtttaaaaatcaggcaactattgt
ggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttccc
aatgttagtattccttggactcacaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctga
ttggcaaactccttcttttccaaatatccatttgcatcaagacattataactaaatgtgagcaatttgtgggccctctca
cagtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagac
aaaggtatcaaaccgtattatccagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaa
ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctac
agcatggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccga
tcaccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
aggccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcag
tctcagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcc
catctctccaccactaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB375169_FT00000_P-G Feature FT:source AB375169_FT00000_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=3248 residues).
ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttcaggga
tagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccc
caacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gatttcaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtatccct
catgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaagatggggttattccttaaattttatgg
gatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatgttttcggaaactccct
gttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggtttcgctgctccttttacccaatgtgg
ttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatccagcggacgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactgtttgtta
tgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggtta
atgacctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaactttgcc
atatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactctagccacctgggtgggtaataa
tttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggtttaaaaatcaggcaactattgt
ggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttccc
aatgttagtattccttggactcacaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctga
ttggcaaactccttcttttccaaatatccatttgcatcaagacattataactaaatgtgagcaatttgtgggccctctca
cagtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagac
aaaggtatcaaaccgtattatccagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaa
ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctac
agcatggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccga
tcaccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
aggccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcag
tctcagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcc
catctctccaccactaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB375170_FT00000_P-G Feature FT:source AB375170_FT00000_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=3248 residues).
ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttcaggga
tagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccc
caacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gatttcaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtatccct
catgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaagatggggttattccttaaattttatgg
gatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatgttttcggaaactccct
gttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggtttcgctgctccttttacccaatgtgg
ttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatccagcggacgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactgtttgtta
tgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggtta
atgacctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaactttgcc
atatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactctagccacctgggtgggtaataa
tttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggtttaaaaatcaggcaactattgt
ggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttccc
aatgttagtattccttggactcacaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctga
ttggcaaactccttcttttccaaatatccatttgcatcaagacattataactaaatgtgagcaatttgtgggccctctca
cagtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagac
aaaggtatcaaaccgtattatccagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaa
ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctac
agcatggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccga
tcaccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
aggccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcag
tctcagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcc
catctctccaccactaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AF160501_FT00000_C-G Feature FT:source AF160501_FT00000_C-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=3248 residues).
ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttcaggga
tagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccc
caacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtatccct
catgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaagatggggttattccttaaattttatgg
gatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatgttttcggaaactccct
gttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggtttcgctgctcctttcacccaatgtgg
ttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatccagcggacgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagttatataagtggactcttggactgtttgtta
tgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggtta
atgacctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaactttgcc
atatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactctagctacctgggtgggtaataa
tttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggtttaaaaatcaggcaactattgt
ggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttccc
aatgttagtattccttggactcacaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctga
ttggcaaactccttcttttccaaatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctca
cagtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagac
aaaggtatcaaaccgtattatccagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaa
ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctac
agcatggggctttcttggacggtccctctcgagtggggaaagaacctttccgccagcaatcctctaggattccttcccga
tcaccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
aggccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcag
tctcagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcc
catctctccaccactaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AF405706_FT00000_P-G Feature FT:source AF405706_FT00000_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 235/01). Complete genome. [Hepadnaviridae] (length=3248 residues).
ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttcaggga
tagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccc
caacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtatccct
catgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatctaaaccctaccaaaacaaaaagatggggttattccttaaattttatgg
gatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatgttttcggaaactccct
gttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggtttcgctgctccttttacccaatgtgg
ttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatccagcggacgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactgtttgtta
tgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggtta
atgacctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaactttgcc
atatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactctagctacctgggtgggtaataa
tttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggtttaaaaatcaggcaactattgt
ggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttccc
aatgttagtattccttggactcacaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctga
ttggcaaactccttcttttccaaatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctca
cagtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagac
aaaggtatcaaaccgtattatccagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaa
ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctac
agcatggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccga
tcaccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
aggccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcag
tctcagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcc
catctctccaccactaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|EF464097_FT00000_P-G Feature FT:source EF464097_FT00000_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 06hac). Complete genome. [Hepadnaviridae] (length=3248 residues).
ctccacccagttccaccaagctctacaaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttcagaga
cacagaaccctgttccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgcaccgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggaagtgcccgtgtgtcctggcctaaattcgcagtccc
caacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtatccct
catgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattccttaaattttatgg
gatacgtaattggaagttggggtactttgccacaggaacacatcgcacagaaaattaagcaatgttttgggaaactacct
gttaacaggccaattgattggaaagtttgtcaaagaatagttggtcttttgggattcgctgctccttttacccaatgtgg
ttaccctgccttaatgcctttatatgcatgtatacaagttaagcaggcttttactttctcgccaacttataaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggttgggggttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcattggaactgacaattctgtcgtcctctctcggaaat
atacctcctttccatggctgctaggctgtgctgccatatcgaccctttcagggacgtcctttgtttacgtcccgtcagcg
ttgaatccagcggacgacccctcctggggtcgtttggggatctgtcgcccccttctccgtctgccgttcctgccgaccac
ggggcgcacctctctttacgcggtctcccggtctgttccttctcatctgccggaccgtgtgcactttgcttcacctctgc
acgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactgtttgtta
tgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggtta
atgacctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaactttgcc
atatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactctagctacctgggtgggtaataa
tttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggtttaaaaatcaggcaactattgt
ggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttccc
aatgttagtattccttggactcacaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctga
ttggcaaactccttcttttccaaatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctca
cagtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagac
aaaggtatcaaaccgtattatccagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaa
ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctac
agcatggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccga
tcaccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
aggccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcag
tctcagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcc
catctctccaccactaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|EF464098_FT00000_P-G Feature FT:source EF464098_FT00000_P-G of [Viruses] Hepatitis B Virus genotype G (isolate 09hgg). Complete genome. [Hepadnaviridae] (length=3248 residues).
ctccacccagttccaccaagctctacaaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttcagaga
cagcagaacctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgcaccgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtgtttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggaagtgcccgtgtgtcctggcctaaattcgcagtccc
caacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtatccct
catgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattccttaaactttatgg
gatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatgttttcggaaactccct
gttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggtttcgctgctccttttacccaatgtgg
ttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
catagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaat
atacctcctttccatggcagctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatccagcggacgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcactttgcttcacctctgc
acgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactgtttgtta
tgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggtta
atgacctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaactttgcc
atatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactctagctacctgggtgggtaataa
tttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggtttaaaaatcaggcaactattgt
ggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttccc
aatgttagtattccttggactcacaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctga
ttggcaaactccttcttttccaaatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctca
cagtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagac
aaaggtatcaaaccgtattatccagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaa
ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctac
agcatggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccga
tcaccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
aggccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcag
tctcagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcc
catctctccaccactaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|EF634480_FT00000_P-G Feature FT:source EF634480_FT00000_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=3248 residues).
ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttcaggga
tagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccc
caacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcctccaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtatccct
catgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaagatggggttattccttaaattttatgg
gatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatgttttcggaaactccct
gttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggtttcgctgctccttttacccaatgtgg
ttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatccagcggacgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgtcgttcctgccgaccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactgtttgtta
tgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggtta
atgacctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaactttgcc
atatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactctagctacctgggtgggtaataa
tttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggtttaaaaatcaggcaactattgt
ggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttccc
aatgttagtattccttggactcacaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctga
ttggcaaactccttcttttccaaatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctca
cagtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagac
aaaggtatcaaaccgtattatccagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaa
ggcgggtattctatataagagagaaacatcacgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctac
agcatggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccga
tcaccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
aggccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttctggggtggagccctcag
tctcagggcacactaacaactttaccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcc
catctctccaccactaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ023674_FT00000_P-G Feature FT:source FJ023674_FT00000_P-G of [Viruses] Hepatitis B Virus genotype G (isolate I2/C2_C04-0790). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaccttccaccaagctcttcargatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgaatattgcctctcacatctcatcaatcttcgcaaggactggggaccttgcaccgaacatggag
aacatcacatcaggattcctcggacccctgctcgtgttacaggcgggatttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaacaaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcarggtatgttgcccgtttgtcctct
aattccaggatcctcgaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtatccct
catgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacamcaccttgagtccatttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaagcgatggggttattccttgaatttcatgg
gatacgtaattggaagttggggtaccttgccacaagatcatattatacagaaaatcagacaatgttttagaaaactccct
gttaataggcccgttgattggaaagtrtgtcaaagaatttcgggtctcctgggctttgctgctcccttcacacaatgtgg
ttaccctgcattaatgcctttatatgcmtgtatacaagccaaacaggctttcactttctcgccaacttacaaggcctttc
tatgtaaacaatatctgaacctttaccccgttgtcaggcaacggcccggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcctgttttgctcgcagccggtctggagcaaacatcatcgggactgataattctgtcgtcctttcccggaaat
atacmtcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatccagcggacgacccctctcggggccggttggggatctaccgtccccttctccgtctgccgtaccggccgwccac
ggggcgcacctctctttacgcggactccccgagtgtgccttttcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccacctggtattgcccaaggtattgcataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccaacaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgggatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaacatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcgtacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctaacattcatttgca
tgaggacattatcgataggtgtcaacagtttgtgggccctttgacagtgaatgaaaaaaggagactaaaattaattatgc
ctgctaggttttatcctaacagtaccaagtatttgcccttagataaaggtattaaaccttattatcctgaacatgcagtt
aatcattacttcaaagccaggcattatttacatactctgtggaaagctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagggtggacatccacccctcggaaaggc
atggggacgaatctttctgtacccaatcctctgggatttcttcccgatcatcagttggatcctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggaccattggccacaagcccatcaggtaggagcgggagcattcgggc
cagggttcacccctccacacggaggtctgttggggtggagccctcaggctcagggcatattaacaaatgtgccagcagtt
cctcctcctgcctcaaccaatcggcagtcaggacggcagcccactcccatctctccacctctgagagacagycatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FR714503_FT00000_P-G Feature FT:source FR714503_FT00000_P-G of [Viruses] Hepatitis B Virus genotype G (isolate TZ306). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccaccttccaccaagctctacaagatcccagaatcaggggcctgtatcttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcatcaatcttcacgaggattggggaccctgcaacgaacatggag
aacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcgaccaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtatccct
catgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaggccatttataccgctgt
taccaattttcttttgtctttgggtatacatttaaattctaacaaaactaagcgatggggttattccctaaacttcatgg
gatatgtaattggaagttggggtaccttgccacaagatcatattatacagaaaatcaaacaatgttttagaaaactccct
gttaacaggcccattgattggaaagtatgtcaaagaatttcaggactcttgggctttgctgctccatttacacaatgtgg
ttaccctgcgttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
gctagctgcctgttttgctcgcagcaggtctggagcaaaacttatcgggactgataattctgtcgtcctttcgcggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccctctcggggccgcttggggatctaccgtcctcttcttcatctgccgtaccgaccgtccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacttgagcttgcccaaggtattgcataagcggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgcctactgatttctttccgtctattcgggaccttctcgacaccg
catcagctctgtatcgagaggccttagagtctccagaacattgttcacctcaccatacagcaatcaggcaagcagttttg
tgttggggtgagttgatgactctagctacctgggtgggaagtaatttggacgaccctgcctccagggatttggtagtcag
ctatgtcaatgttaatatgggcctaaaaattagacaaatattatggtttcacatttcctgtcttatgtttggaagagaca
ctgttcttgagtatttggtgtctttcggagtgtggattcgcactcctcccgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgttagtattccttggactcataaggtgggaaac
tttaccgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcctaacattcatttgca
tgaggacattatcaataggtgtcaacaatttgtgggccctcttacagttaatgaaaaaagaagattaaacttaattatgc
ctgctaggttctatcctaaccgtactaagtatttgcccttagataaaggcataaaaccttattatcctgagcaggccgtt
aatcattatttcaaaactaggcattatttacatactctgtggaaagctggcattctatataagagagaaacaacacgcag
cgcatcattttgtgggtcaccatattatagggaacaagagccacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggatttcttcccgatcatcagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggaccattggccacaagcccatcaggtaggagcgggagcattcgggc
cagggttcacccctcctcacggaggtcttttggggtggagccctcaggctcagggcatattaacaaacgtgccagcagtt
cctcctcctgcctccaccaatcggcagtcaggaaggcagccaactcccatatctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GU563556_FT00000_P-G Feature FT:source GU563556_FT00000_P-G of [Viruses] Hepatitis B Virus genotype G (isolate BV-55). Complete genome. [Hepadnaviridae] (length=3248 residues).
ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttcaggga
tagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccc
caacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtatccct
catgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaagatggggttattccttaaattttatgg
gatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatgttttcggaaactccct
gttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggtttcgctgctccttttacccaatgtgg
ttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatccagcggacgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactgtttgtta
tgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggtta
atgacctttgtattaggaggctgtaggcataaatgggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaactttgcc
atatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgagcattgt
tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactctagctacctgggtgggtaataa
tttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggtttaaaaatcaggcaactattgt
ggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttccc
aatgttagtattccttggactcacaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctga
ttggcaaactccttcttttccaaatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctca
cagtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagac
aaaggtatcaaaccgtattatccagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaa
ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctac
agcatggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccga
tcaccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
aggccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcag
tctcagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcc
catctctccaccactaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|HE981174_FT00000_P-G Feature FT:source HE981174_FT00000_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=3248 residues).
ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtatcttcctgctggtggctccagttcaggga
tagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccc
caacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcctcgaccaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtatccct
catgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaagatggggttattccttaaattttatgg
gatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatgttttcggaaactccct
gttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggtttcgctgctccttttacccaatgtgg
ttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatccagcggacgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgtcgttcctgccgaccac
ggggcgcacctctatttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactgtttgtta
tgtcaacaaccgggatggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggtta
atgacctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaactttgcc
atatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
tcgcctcaccatacagcactcaggcaagcaattctgtgctggggtgagttgatgactctagctacctgggtgggtaataa
tttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggtttaaaaatcaggcaactattgt
ggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttccc
aatgttagtattccttggactcacaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctga
ttggcaaactccttcttttccaaatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctca
cagtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagac
aaaggtatcaaaccgtattatccagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaa
ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctac
agcatggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccga
tcaccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
aggccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccttcaa
tctcagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcc
catctctccaccactaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|HE981175_FT00000_P-G Feature FT:source HE981175_FT00000_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=3248 residues).
ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttcaggga
tagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccc
caacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcctcgaccaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtatccct
catgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaagatggggttattccttaaattttatgg
gatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatgttttcggaaactccct
gttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggtttcgctgctccttttacccaatgtgg
ttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatccagcggacgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttacatggaaaccgccatgaacacctctcatcatctaccaaggcagttatataagaggactcttggactgtttgtta
tgtcaacaaccgggatggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggtta
atgacctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaactttgcc
atatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
tcgcctcaccatacagcactcaggcaagcaattctgtgctggggtgagttgatgactctagctacctgggtgggtaataa
tttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggtttaaaaatcaggcaactattgt
ggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttccc
aatgttagtattccttggactcacaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctga
ttggcaaactccttcttttccaaatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctca
cagtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagac
aaaggtatcaaaccgtattatccagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaa
ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctac
agcatggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccga
tcaccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
aggccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccttcag
tctcagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcc
catctctccaccactaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|HE981176_FT00000_P-G Feature FT:source HE981176_FT00000_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=3248 residues).
ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttcaggga
tagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccc
caacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcctcgaccaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtatccct
catgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaagatggggttattccttaaattttatgg
gatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatgttttcggaaactccct
gttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggtttcgctgctccttttacccaatgtgg
ttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatccagcggacgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttacatggaaaccgccatgaacacctctcatcatctaccaaggcagttatataagaggactcttggactgtttgtta
tgtcaacaaccgggatggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggtta
atgacctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaactttgcc
atatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
tcgcctcaccatacagcactcaggcaagcaattctgtgctggggtgagttgatgactctagctacctgggtgggtaataa
tttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggtttaaaaatcaggcaactattgt
ggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttccc
aatgttagtattccttggactcacaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctga
ttggcaaactccttcttttccaaatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctca
cagtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagac
aaaggtatcaaaccgtattatccagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaa
ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctac
agcatggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccga
tcaccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
aggccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccttcag
tctcagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcc
catctctccaccactaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707657_FT00000_P-G Feature FT:source JQ707657_FT00000_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_1). Complete genome. [Hepadnaviridae] (length=3248 residues).
ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtatcttcctgctggtggctccagttcaggga
tagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccc
caacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtatccct
catgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagctatattgatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatctaaaccataacaaaacaaaaagatggggttattccttaaattttatgg
gatatgtaattggaagttggggtactttgccacaagaacacatcacacaaaaaattaagcaatgttttcggaaactccct
gttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggtttcgctgctccttttacccaatgtgg
ttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttc
tctgtaaacaatacatgaacctttaccctgttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggacatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatccagcggacgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttacatggaaaccgccatgaacacctctcatcatctgccaaagcagttatataagaggactcttggactgtttgtta
tgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggtta
atgacctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaactttgcc
atatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactctagctacctgggtgggtaataa
tttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggtttaaaaatcaggcaactattgt
ggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctcaagcttccc
aatgttagtattccttggactcacaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctga
ttggcaaactccttcttttccaaatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctca
cagtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagac
aaaggtatcaaaccgtattatccagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaa
ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctac
agcatggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccga
tcaccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
aggccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcag
tctcagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcc
catctctccaccactaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707660_FT00000_P-G Feature FT:source JQ707660_FT00000_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_17). Complete genome. [Hepadnaviridae] (length=3248 residues).
ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtatcttcctgctggtggctccagttcaggga
tagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccc
caacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtatccct
catgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagctatattgatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatctaaaccataacaaaacaaaaagatggggttattccttaaattttatgg
gatatgtaattggaagttggggtactttgccacaagaacacatcacacaaaaaattaagcaatgttttcggaaactccct
gttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggtttcgctgctccttttacccaatgtgg
ttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttc
tctgtaaacaatacatgaacctttaccctgttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggacatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatccagcggacgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttacatggaaaccgccatgaacacctctcatcatctgccaaagcagttatataagaggactcttggactgtttgtta
tgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggtta
atgacctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaactttgcc
atatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactctagctacctgggtgggtaataa
tttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggtttaaaaatcaggcaactattgt
ggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttccc
aatgttagtattccttggactcacaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctga
ttggcaaactccttcttttccaaatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctca
cagtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagac
aaaggtatcaaaccgtattatccagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaa
ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctac
agcatggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccga
tcaccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
aggccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcag
tctcagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcc
catctctccaccactaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707666_FT00000_P-G Feature FT:source JQ707666_FT00000_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_22). Complete genome. [Hepadnaviridae] (length=3248 residues).
ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtatcttcctgctggtggctccagttcaggga
tagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccc
caacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtatccct
catgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagctatattgatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatctaaaccataacaaaacaaaaagatggggttattccttaaattttatgg
gatatgtaattggaagttggggtactttgccacaagaacacatcacacaaaaaattaagcaatgttttcggaaactccct
gttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggtttcgctgctccttttacccaatgtgg
ttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttc
tctgtaaacaatacatgaacctttaccctgttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggacatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggctgtgctgccacctggatccttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatccagcggacgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttacatggaaaccgccatgaacacctctcatcatctgccaaagcagttatataagaggactcttggactgtttgtta
tgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggtta
atgacctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaactttgcc
atatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactctagctacctgggtgggtaataa
tttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggtttaaaaatcaggcaactattgt
ggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttccc
aatgttagtattccttggactcacaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctga
ttggcaaactccttcttttccaaatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctca
cagtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagac
aaaggtatcaaaccgtattatccagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaa
ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctac
agcatggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccga
tcaccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
aggccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcag
tctcagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcc
catctctccaccactaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707668_FT00000_P-G Feature FT:source JQ707668_FT00000_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_26-5). Complete genome. [Hepadnaviridae] (length=3248 residues).
ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtatcttcctgctggtggctccagttcaggga
tagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccc
caacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtatccct
catgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagctatattgatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatctaaaccataacaaaacaaaaagatggggttattccttaaattttatgg
gatatgtaattggaagttggggtactttgccacaagaacacatcacacaaaaaattaagcaatgttttcggaaactccct
gttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggtttcgctgctccttttacccaatgtgg
ttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttc
tctgtaaacaatacatgaacctttaccctgttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggacatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatccagcggacgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttacatggaaaccgccatgaacacctctcatcatctgccaaagcagttatataagaggactcttggactgtttgtta
tgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggtta
atgacctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaactttgcc
atatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactctagctacctgggtgggtaataa
tttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggtttaaaaatcaggcaactattgt
ggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttccc
aatgttagtattccttggactcacaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctga
ttggcaaactccttcttttccaaatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctca
cagtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagac
aaaggtatcaaaccgtattatccagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaa
ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctac
agcatggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccga
tcaccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
aggccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcag
tctcagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcc
catctctccaccactaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707671_FT00000_P-G Feature FT:source JQ707671_FT00000_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_3). Complete genome. [Hepadnaviridae] (length=3248 residues).
ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtatcttcctgctggtggctccagttcaggga
tagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccc
caacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtatccct
catgttgctgtacaaaactttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagctatattgatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatctaaaccataacaaaacaaaaagatggggttattccttaaattttatgg
gatatgtaattggaagttggggtactttgccacaagaacacatcacacaaaaaattaagcaatgttttcggaaactccct
gttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggtttcgctgctccttttacccaatgtgg
ttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttc
tctgtaaacaatacatgaacctttaccctgttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggacatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatccagcggacgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttacatggaaaccgccatgaacacctctcatcatctgccaaagcagttatataagaggactcttggactgtttgtta
tgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggtta
atgacctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaactttgcc
atatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactctagctacctgggtgggtaataa
tttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggtttaaaaatcaggcaactattgt
ggtttcacatttcctgtcttacttttggaagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttccc
aatgttagtattccttggactcacaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctga
ttggcaaactccttcttttccaaatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctca
cagtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagac
aaaggtatcaaaccgtattatccagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaa
ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctac
agcatggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccga
tcaccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
aggccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcag
tctcagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcc
catctctccaccactaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707673_FT00000_P-G Feature FT:source JQ707673_FT00000_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_33). Complete genome. [Hepadnaviridae] (length=3248 residues).
ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtatcttcctgctggtggctccagttcaggga
tagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccc
caacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtatccct
catgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagctatattgatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatctaaaccataacaaaacaaaaagatggggttattccttaaattttatgg
gatatgtaattggaagttggggtactttgccacaagaacacatcacacaaaaaattaagcaatgttttcggaaactccct
gttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggtttcgctgctccttttacccaatgtgg
ttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttc
tctgtaaacaatacatgaacctttaccctgttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggacatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatccagcggacgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttacatggaaaccgccatgaacacctctcatcatctgccaaagcagttatataagaggactcttggactgtttgtta
tgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggtta
atgacctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaactttgcc
atatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactctagctacctgggtgggtaataa
tttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggtttaaaaatcaggcaactattgt
ggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcggaagatctgcatctccagcttccc
aatgttagtattccttggactcacaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctga
ttggcaaactccttcttttccaaatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctca
cagtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagac
aaaggtatcaaaccgtattatccagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaa
ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctac
agcatggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccga
tcaccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
aggccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcag
tctcagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcc
catctctccaccactaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707677_FT00000_P-G Feature FT:source JQ707677_FT00000_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_45). Complete genome. [Hepadnaviridae] (length=3248 residues).
ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtatcttcctgctggtggctccagttcaggga
tagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccc
caacctccaatcactcaccaatctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtatccct
catgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagctatattgatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatctaaaccataacaaaacaaaaagatggggttattccttaaattttatgg
gatatgtaattggaagttggggtactttgccacaagaacacatcacacaaaaaattaagcaatgttttcggaaactccct
gttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggtttcgctgctccttttacccaatgtgg
ttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttc
tctgtaaacaatacatgaacctttaccctgttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggacatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgacagcg
ctgaatccagcggacgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttacatggaaaccgccatgaacacctctcatcatctgccaaagcagttatataagaggactcttggactgtttgtta
tgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggtta
atgacctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaactttgcc
atatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactctagctacctgggtgggtaataa
tttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggtttaaaaatcaggcaactattgt
ggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttccc
aatgttagtattccttggactcacaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctga
ttggcaaactccttcttttccaaatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctca
cagtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagac
aaaggtatcaaaccgtattatccagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaa
ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctac
agcatggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccga
tcaccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
aggccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcag
tctcagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcc
catctctccaccactaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707678_FT00000_P-G Feature FT:source JQ707678_FT00000_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_47). Complete genome. [Hepadnaviridae] (length=3248 residues).
ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtatcttcctgctggtggctccagttcaggga
tagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccc
caacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtttgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtatccct
catgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagctatatcgatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatctaaaccataacaaaacaaaaagatggggttattccttaaattttatgg
gatatgtaattggaagttggggtactttgccacaagaacacatcacacaaaaaattaagcaatgttttcggaaactccct
gttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggtttcgctgctccttttacccaatgtgg
ttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttc
tctgtaaacaatacatgaacctttaccctgttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggacatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatccagcggacgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttacatggaaaccgccatgaacacctctcatcatctgccaaagcagttatataagaggactcttggactgtttgtta
tgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggtta
atgacctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaactttgcc
atatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactctagctacctgggtgggtaataa
tttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggtttaaaaatcaggcaactattgt
ggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttccc
aatgttagtattccttggactcacaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctga
ttggcaaactccttcttttccaaatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctca
cagtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagac
aaaggtatcaaaccgtattatccagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaa
ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctac
agcatggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccga
tcaccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
aggccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcag
tctcagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcc
catctctccaccactaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707679_FT00000_P-G Feature FT:source JQ707679_FT00000_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_48). Complete genome. [Hepadnaviridae] (length=3248 residues).
ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtatcttcctgctggtggctccagttcaggga
tagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccc
caacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtttgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtatccct
catgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagctatattgatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatctaaaccataacaaaacaaaaagatggggttattccttaaattttatgg
gatatgtaattggaagttggggtactttgccacaagaacacatcacacaaaaaattaagcaatgttttcggaaactccct
gttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggtttcgctgctccttttacccaatgtgg
ttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttc
tctgtaaacaatacatgaacctttaccctgttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggacatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatccagcggacgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttacatggaaaccgccatgaacacctctcatcatctgccaaagcagttatataagaggactcttggactgtttgtta
tgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggtta
atgacctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaactttgcc
atatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactctagctacctgggtgggtaataa
tttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggtttaaaaatcaggcaactattgt
ggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttccc
aatgttagtattccttggactcacaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctga
ttggcaaactccttcttttccaaatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctca
cagtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagac
aaaggtatcaaaccgtattatccagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaa
ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctac
agcatggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccga
tcaccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
aggccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcag
tctcagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcc
catctctccaccactaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707680_FT00000_P-G Feature FT:source JQ707680_FT00000_P-G of [Viruses] Hepatitis B Virus genotype G (isolate S11_6). Complete genome. [Hepadnaviridae] (length=3248 residues).
ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtatcttcctgctggtggctccagttcaggga
tagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccc
caacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtatccct
catgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagctatattgatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatctaaaccataacaaaacaaaaagatggggttattccttaaattttatgg
gatatgtaattggaagttggggtactttgccacaagaacacatcacacaaaaaattaagcaatgttttcggaaactccct
gttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggtttcgctgctccttttacccaatgtgg
ttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttc
tctgtaaacaatacatgaacctttaccctgttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggacatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatccagcggacgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgcccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttacatggaaaccgccatgaacacctctcatcatctgccaaagcagttatataagaggactcttggactgtttgtta
tgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggtta
atgacctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaactttgcc
atatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactctagctacctgggtgggtaataa
tttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggtttaaaaatcaggcaactattgt
ggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttccc
aatgttagtattccttggactcacaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctga
ttggcaaactccttcttttccaaatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctca
cagtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagac
aaaggtatcaaaccgtattatccagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaa
ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctac
agcatggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccga
tcaccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
aggccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcag
tctcagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcc
catctctccaccactaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KF414679_FT00000_P-G Feature FT:source KF414679_FT00000_P-G of [Viruses] Hepatitis B Virus genotype G (isolate B213). Complete genome. [Hepadnaviridae] (length=3248 residues).
ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtatcttcctgctggtggctccagttcaggga
tagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccc
caacctccaatcactcactaatctcctgtcctccaacttgtcctggctatcgctggatgtggctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtatccct
catgttgctgtacaaaaccttcggacagaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaagatggggttattccttaaattttatgg
gatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatgttttcggaaactccct
gttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggtttcgctgctccttttacccaatgtgg
ttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatccagcggacgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttacatggaaaccgccatgaacacctctcatcctctgccaaggcagttatataagaggactcttggactgtttgtta
tgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggtta
atgacctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaactttgcc
atatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactctagctacctgggtgggtaataa
tttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggtttaaaaatcaggcaactattgt
ggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttccc
aatgttagtattccttggactcacaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctga
ttggcaaactccttcttttccaaatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctca
cagtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagac
aaaggtatcaaaccgtattatccagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaa
ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctac
agcatggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccga
tcaccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
aggccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcag
tctcagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcc
catctctccaccactaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KF767450_FT00000_P-G Feature FT:source KF767450_FT00000_P-G of [Viruses] Hepatitis B Virus genotype G (isolate patient_23). Complete genome. [Hepadnaviridae] (length=3248 residues).
ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttcaggga
tagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccc
caacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtatccct
catgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaagatggggttattccttaaattttatgg
gatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatgttttcggaaactccct
gttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggtttcgctgctccttttacccaatgtgg
ttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatccagcggacgacccctcccggggccgtttggggctctatcgcccccttctccgtctgccgttcctgccgaccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactgtttgtta
tgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggtta
atgacctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaactttgcc
atatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattct
tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactctagccacctgggtgggtaataa
tttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggtttaaaaatcaggcaactattgt
ggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttccc
aatgttagtattccttggactcacaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctga
ttggcaaactccttcttttccaaatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctca
cagtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagac
aaaggtatcaaaccgtattatccagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaa
ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctac
agcatggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccga
tcaccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
aggccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcag
tctcagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcc
catctctccaccactaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KJ194508_FT00000_P-G Feature FT:source KJ194508_FT00000_P-G of [Viruses] Hepatitis B Virus genotype G (isolate HBV_Amsterdam_2_1994). Complete genome. [Hepadnaviridae] (length=3248 residues).
ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttcaggga
tagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccc
caacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtatccct
catgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaagatggggttattccttaaattttatgg
gatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatgttttcggaaactccct
gttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggtttcgctgctccttttacccaatgtgg
ttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaat
atacatcctttccctggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatccagcggacgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactgtttgtta
tgtcaacaaccgggatggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggtta
atgacctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaactttgcc
atatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
tcgcctcaccatacagcactcaggcaagcaattctgtgctggggtgagttgatgactctagctacctgggtgggtaataa
tttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggtttaaaaatcaggcaactattgt
ggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttccc
aatgttagtattccttggactcacaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctga
ttggcaaactccttcttttccaaatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctca
cagtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagac
aaaggtatcaaaccgtattatccagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaa
ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctac
agcatggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccga
tcaccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
aggccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcag
tctcagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcc
catctctccaccactaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KM998716_FT00000_P-G Feature FT:source KM998716_FT00000_P-G of [Viruses] Hepatitis B Virus genotype G. Complete genome. [Hepadnaviridae] (length=3248 residues).
ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtatcttcctgctggtggctccagttcaggga
tagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccc
caacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtatccct
catgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaagatggggttattccttaaattttatgg
gatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatgttttcggaaactccct
gttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggtttcgctgctccttttacccaatgtgg
ttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatccagcggacgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttacatggaaaccgccatgaacacctctcatcctctgccaaagcagttatataagaggactcttggactgtttgtta
tgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggtta
atgatctatgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaactttgcc
atatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactctagccacctgggtgggtaataa
tttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggtttaaaaatcaggcaactattgt
ggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgccgaagatctgcatctccagcttccc
aatgttagtattccttggactcacaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctga
ttggcaaactccttcttttccaaatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctca
cagtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagac
aaaggtatcaaaccgtattatccagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaa
ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctac
agcatggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccga
tcaccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
aggccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcag
tctcagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcc
catctctccaccactaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KR230749_FT00000_P-G Feature FT:source KR230749_FT00000_P-G of [Viruses] Hepatitis B Virus genotype G (isolate ENDV06GG). Complete genome. [Hepadnaviridae] (length=3236 residues).
ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttcaggga
tagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcgggggttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccc
caacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtatccct
catgttgctgtacaaaaccttcggacagaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaagatggggttattccttaaattttatgg
gatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatgttttcggaaactccct
gttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggtttcgctgctccttttacccaatgtgg
ttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttc
tctgtaaacaatacaggaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatccagcggacgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactgtttgtta
tgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggtta
atgacctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaactttgcc
atatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactctagctacctgggtgggtaataa
tttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggtttaaaaatcaggcaactattgt
ggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttccc
aatgttagtattccttggactcacaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctga
ttggcaaactccttcttttccaaatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctca
cagtaaatgagaaacaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagacaaaggtatc
aagtattacccagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaaggcgggtattct
atataagagagaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctacagcatggggctt
tcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccgatcaccagttgga
cccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccagaggccaacaagg
taggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcagtctcagggcaca
ctaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcccatctctccacc
actaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KX264500_FT00000_P-G Feature FT:source KX264500_FT00000_P-G of [Viruses] Hepatitis B Virus genotype G (isolate G-aej). Complete genome. [Hepadnaviridae] (length=3248 residues).
ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttcaggga
tagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccc
caacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtatccct
catgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaagatggggttattccttaaattttatgg
gatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatgttttcggaaactccct
gttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggtttcgctgctccttttacccaatgtgg
ttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatccagcggacgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactgtttgtta
tgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggtta
atgacctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaactttgcc
atatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactctagctacctgggtgggtaataa
tttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggtttaaaaatcaggcaactattgt
ggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttccc
aatgttagtattccttggactcacaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctga
ttggcaaactccttcttttccaaatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctca
cagtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagac
aaaggtatcaaaccgtattatccagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaa
ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctac
agcatggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccga
tcaccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
aggccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcag
tctcagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcc
catctctccaccactaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KY004111_FT00000_P-G Feature FT:source KY004111_FT00000_P-G of [Viruses] Hepatitis B Virus genotype G (isolate M-2015). Complete genome. [Hepadnaviridae] (length=3248 residues).
ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttcaggga
tagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccc
caacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtatccct
catgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaagatggggttattccttaaattttatgg
gatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatgttttcggaaactccct
gttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggtttcgctgctccttttacccaatgtgg
ttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatccagcggacgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactgtttgtta
tgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggtta
atgacctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaactttgcc
atatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaagccttagagtcctttgatcattgt
tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactctagccacctgggtgggtaataa
tttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggtttaaaaatcaggcaactattgt
ggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctacatctccagcttccc
aatgttagtattccttggactcacaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctga
ttggcaaactccttcttttccaaatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctca
cagtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagac
aaaggtatcaaaccgtattatccagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaa
ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctac
agcatggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccga
tcaccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
aggccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcag
tctcagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcc
catctctccaccactaagagacagtcatcctcaggccatgcagtggaa
© 1998-2020Legal notice