HBVdb

Dataset for nucleotide sequence C of genotype D

[Download (right click)] [Edit] [Sequences] [Repertoires]

1962 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


AB555500_C_P-D      aaggaccttgacccttataaagaatttggagctagtgtgactttactctcgtttttgcct
FJ904439_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JX036342_C_P-D      atggacattgatccttataaagaatttggagcttctgcgcagttactctcgtttttacct
JX036343_C_P-D      atggacattgacgcgtataaagaatttggagcttctgtggagttactctcttttttgcct
JX036344_C_P-D      atggacattgatccttataaagaatttggagcttctgcgcagttactctcgtttttgcct
MH725171_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcttttttgcct
AB674415_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactgtcttttttgcct
JF754612_C_P-D      atggacattgatccttataaagaatttggcgcttctgtggagttactctcttttttgcct
JF754594_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
AB674416_C_P-D      atggacattgatccttataaagaatttggagcttctgtcgagttactctcttttttgcct
JN040766_C_P-D      atggacatagatccttataaagaatttggcgcttctgtggagttactctcgtttttgcct
KP857013_C_P-D      atggacmttgatccttataaagaatttggagcttctgtgcagttactctcgtttttgcct
JF754617_C_P-D      atggacatcgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
EU726891_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JN040773_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
AB330367_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JF754609_C_P-D      atggatattgatccttataaagaatttggagcttctgtgcagttactctcgtttttgcct
JN642128_C_P-D      atggacattgatccctataaagaatttggagcttctgtggagttactctcgtttttgcct
GU456677_C_P-D      atggacattgatccctataaagaatttggagcttctgtggagttactctcgtttttgcct
KP857028_C_P-D      atggacattgatccttataaagaatttggagctagtgtggagttactctcgtttttgcct
JF754622_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
GU456679_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
GU456657_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcttttttgcct
MH725153_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JN642135_C_P-D      atggacatcgacccttataaagaatttggagctactgtgcagttactctcgtttttgcct
JF754626_C_P-D      atggacattgatccttataaagaatttggcgctactgtggagttactctcgtttttgcct
X85278_C_P-D        atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
GQ167302_C_P-D      atggacatcgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
GQ167301_C_P-D      atggacattgatccgtataaagaatttggagcttctgtggagttactctcgtttttgcct
GQ184322_C_P-D      atggacattgatccgtataaagaatttggagcttctgtggagttactctcgtttttgcct
JN257165_C_P-D      atggacatcgatccttataaagaatttggagcctctgtggagttactctcatttttgcct
JN257166_C_P-D      atggacatcgatccttataaagaatttggagcctctgtggagttactctcatttttgcct
KF018181_C_P-D      atggaccttgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725126_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP857031_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
AB270541_C_P-D      atggacattgatccatataaagaatttggagcttctgtggagttactctcgtttttgcct
MH725199_C_P-D      atggaacttgatccgtataaagaatttggagctactgtgcagttactctcgtttttgccg
JN257153_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcttttttgcct
JN257195_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcttttttgcct
KP857032_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
GU456651_C_P-D      atggacattgatccttataaagaatttggagctagtatcgagttactctcgtttttgcct
KP857018_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JF754600_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MH725135_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KF018177_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
EU726884_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MH724978_C_P-D      atggacattgatccttataaagaatttggagctagtgtggagttactctcttttttgcct
MH725189_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
DQ486023_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB104710_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KP857039_C_P-D      atggacatcgatccttataaagaatttggagctactgtggagttactctcgtttttgccg
HQ833466_C_P-D      atggacattgatccttataaagaatttggagctwctgtkgagttactctcgtttttgcck
AB270542_C_P-D      atggacatcgatccatataaagaatttggagcttctgtggagttactctcgtttttgcct
X80924_C_P-D        atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
X80926_C_P-D        atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MH725068_C_P-D      atggacattgatccttataaagaatttggagctactgcggagttactcttgtttttgcct
KP857024_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
DQ336680_C_P-D      atggacatcgatccttataaagaatttggagcctctgtggagttactctcgtttttgcct
DQ336682_C_P-D      atggacatcgatccttataaagaatttggagcctctgtggagttactctcgtttttgcct
DQ336684_C_P-D      atggacatcgatccttataaagaatttggagcctctgtggagttactctcgtttttgcct
DQ336681_C_P-D      atggacatcgatccttataaagaatttggagcctctgtggagttactctcgtttttgcct
DQ336683_C_P-D      atggacatcgatccttataaagaatttggagcctctgtggagttactctcgtttttgcct
AB674417_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
AB674418_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KP857005_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
AY371909_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KP857019_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
FJ904426_C_P-D      atggacatcgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
GU456682_C_P-D      atggacattgatccgtataaagaatttggagcttctgtggagttactctcgtttttgcct
JN257176_C_P-D      atggacattgatccttataaagaatttggagctactgtgcagttactctcgtttttgccg
JN257177_C_P-D      atggacattgatccttataaagaatttggagctactgtgcagttactctcgtttttgccg
EU726952_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcttttttgcct
JN040774_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcttttttgcct
JN642136_C_P-D      atggacattgatccttataaagaatttggagctactgtgcagttactctcgtttttgcct
FJ904446_C_P-D      atggacattgatccttataaagaatttggcgctactgtggagttactctcatttttgcct
EU726973_C_P-D      atggatattgatccctataaagaatttggagcttctgtggagttactctcttttttgcct
JN642147_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcttttttgcct
X59795_C_P-D        atggacattgatccttataaagaatttggagcttctatggagttgctctcgtttttgcct
JN040771_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
GU456675_C_P-D      atggacattgatccttataaagaatttggagcttctattgagttactctcgtttttgcct
GU456678_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
FJ904429_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcatttttgcct
EU726941_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KY629633_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JF754593_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KP857029_C_P-D      atggatattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
HQ700439_C_P-D      atggacatcgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
FJ904445_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcyt
AB674413_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
AB674410_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF754592_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
FJ904402_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcatttttgccg
EU726912_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
AB270540_C_P-D      atggacattgatccatataaagaatttggagctactgtggagttactctcgtttttgcct
KY629634_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP857025_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KF018182_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JN040772_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
GU456664_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
GU456654_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JF754619_C_P-D      atggayatygatccttataaagaatttggagctactgtgcagttactctcgtttttgcct
FJ904399_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcatttttgcct
AB270550_C_P-D      atggacattgatccgtataaagaatttggagctactgtggagttactctcgtttttgcct
KP857015_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KP857016_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KP857037_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KP857033_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ687531_C_P-D      atggacattgatccttatgcagaatttggagctactgtggagttactctcgtttttgcct
JN642167_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
GU456658_C_P-D      atggacattgatccttataaagaatttggagcttctattgagttactctcgtttttgcct
GQ477458_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
AJ627224_C_P-D      atggacattgatccttataaagaatttggagctagtgtcgagttactctcgtttttgcct
JF754631_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP857017_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MH725202_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KP857114_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgttcttgcct
JN040781_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcttttttgcct
HQ700463_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
GU456656_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcttttttgcct
FJ904431_C_P-D      atggacattgatccttataaagaatttggagctactgtgcagttactctcgtttttgcct
FJ904418_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcatttttgcct
EU787438_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
AB674419_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
EU726868_C_P-D      atggacattgatccatataaagaatttggagctactgtggagttactctcgtttttgcct
JN040779_C_P-D      atggacattgatccatataaagaatttggagctactgtggagttactctcgtttttgcct
JN642156_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
EU726875_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcttttttgcct
AY796032_C_P-D      atggacatcgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU726885_C_P-D      atggacattgatccgtataaagaatttggagcttctgtggagttactctcgtttttgcct
JN040755_C_P-D      atggacattgatccgtataaagaatttggagcttctgtggagttactctcgtttttgcct
KP857021_C_P-D      atggacattgatccktataaagaatttggagctactgtggagttactctcgtttttgcct
JN642164_C_P-D      atggacattgatccatataaagaatttggagcttctgtggagttactctcgtttttgcct
JF754604_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcatttttgcct
GQ205385_C_P-D      atggacattgacccttataaagaatttggagcaactgtggagttactctcatttttgcct
AY236162_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcctttttgcct
DQ304548_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcctttttgcct
DQ304549_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcctttttgcct
DQ304547_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcctttttgcct
DQ304550_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcctttttgcct
DQ304551_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcctttttgcct
KP857022_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
GU456673_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU726848_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcatttttgcct
MH724970_C_P-D      atggacattgactcttataaagaatttggagctactgttgagttaatctcgtttttgcct
JN642158_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JF754635_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JF754634_C_P-D      atggatattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
EU726850_C_P-D      atggacatcgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
X85277_C_P-D        atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
GU456655_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
EU726906_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcttttttgcct
KP857023_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JF754590_C_P-D      atggacattgatccttataaagaatttggagcttctgtggatttactctcgtttttgcct
GU456681_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
EU787439_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU726944_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN040776_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF419522_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
X85273_C_P-D        atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MH725094_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP857115_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KP857038_C_P-D      atggacatcgatccttataaagaatttggagcttctgtcgagttactctcgtttttgcct
KP857034_C_P-D      atggacattgatccttataaagaatttggagctagtgtggagttactctcgtttttgcct
AB270549_C_P-D      atggacattgattcttataaagaatttggagcttctgtggagttactctcgtttttgcct
EU939681_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
FJ899792_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KP857035_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KP857030_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
AB674403_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN642150_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcttttttgcct
JN040821_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY371915_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY371913_C_P-D      atggacattgatccttataaagaatttggagctactgtcgagttagtctcttttttgcct
MH724962_C_P-D      atggacattgatccttataaagaatttggagcttctgtgcagttactctcgtttttgcct
JN257172_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JN257173_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MH725096_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725110_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725118_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725097_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH724959_C_P-D      atggacatcgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
EU726908_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
DQ464182_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725139_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JN257160_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN257161_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN257159_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
AB270546_C_P-D      atggacattgatccatataaagaatttggagctactgtggagttactctcgtttttgcct
KP995092_C_P-D      -tggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KP995100_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JN642166_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
GU456668_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
FJ904427_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY371904_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF419530_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN642133_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
GU456684_C_P-D      atggacatcgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
FJ904424_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcttttttgcct
HQ700472_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
FJ349220_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AJ344116_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttgctctcgtttttgcct
MH725054_C_P-D      atggacattgatccttataaagaatttggagctagtgtggagttactctcgtttttgcct
MH724960_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH724969_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN257170_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcttttttgcct
EU726864_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
EU726844_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP857036_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN040753_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
DQ178012_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
DQ178011_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
DQ178015_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY371912_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
DQ178019_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY350614_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY371901_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY371905_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY371922_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
X02496_C_P-D        atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
DQ178017_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
DQ178016_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
DQ178018_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
DQ178020_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN040752_C_P-D      atggacattgatccttataaagaatttggagctactgtcgagttactctcgtttttgcct
HQ700455_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
FJ904432_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcttttttgcct
DQ111986_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK598646_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JN687947_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN040780_C_P-D      atggacattgatccttataaagaatttggagcttctgtgcagttactctcgtttttgcct
AY721605_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB674420_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MH725144_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MH725088_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcttttttgcct
JN642153_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN642151_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JN040778_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
FJ904415_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
AB222710_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcttttttgcct
JN132132_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN132130_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN558561_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN132131_C_P-D      atggacattgatccttataaggaatttggagctactgtggagttactctcgtttttgcct
JN558562_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN697591_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN132127_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ641710_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN132128_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF324110_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttcttcct
AF324115_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttcttcct
AF324113_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttcttcct
AF324109_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttcttcct
AF324108_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttcttcct
AF324114_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttcttcct
AF324116_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttcttcct
MF618349_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN040761_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
GQ183449_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ183464_C_P-D      atggacattgatccttataaagaatttggagctacggtggagttactctcgtttttgcct
GQ183463_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ183459_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ183458_C_P-D      atggacattgatccatataaagaatttggagctactgtggagttactctcgtttttgcct
GQ183457_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ183460_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ183461_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ183469_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ183448_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ183450_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ183451_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ183452_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ183453_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ183454_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ183455_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ183456_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ183462_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ183465_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ183466_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ183467_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ183468_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB270547_C_P-D      atggacattgatccatataaagaatttggagctactgtggagttactctcgtttttgcct
EU726876_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725012_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725005_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725011_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC875292_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB716760_C_P-D      ttggtcatgggccatcataaagaatttggagctactgtggagttactctcgtttttgcct
HE805987_C_P-D      ttggtcatgggccatcataaagaatttggagctactgtggagttactctcgtttttgcct
AB674405_C_P-D      atggacatygatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB674404_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF018195_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
X85308_C_P-D        atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
X85259_C_P-D        atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
X85298_C_P-D        atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
X85297_C_P-D        atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
X85299_C_P-D        atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN040792_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN040791_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN040793_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725087_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MH725031_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725033_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
M32138_C_P-D        atggacattgatccttataaagaatttggagctactgtggagttactctcgtttctgcct
KP857109_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF018185_C_P-D      atggacattgatccttataaagaatttggagctactgtgcagttactctcgtttttgcct
JN257179_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN040754_C_P-D      atggacattgatccttataaagaatttggagctggtgtggagttactctcgtttttgcct
JF754614_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
FJ562309_C_P-D      atggacattgatccatataaagaatttggagctactgtggagttactctcgtttttgcct
EU726910_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
AB674408_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MH725172_C_P-D      atggaccttgatccttataaagaatttggaggtattgtggagttacttttttttttgcct
MH725140_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MH725125_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM524348_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF754598_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
HQ700467_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcttttttgcct
EU726861_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU726965_C_P-D      atggacattgatccctataaagaatttggagcttctgtggagttactctcgtttttgcct
JN040757_C_P-D      atggacattgatccctataaagaatttggagcttctgtggagttactctcgtttttgcct
HQ700478_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700553_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF061167_C_P-D      atggacattgatccctataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700481_C_P-D      atggacattgatccttataaagaatatggagctactgtggagttactctcgtttttgcct
MH725086_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700474_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700470_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700468_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700489_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700444_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700483_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB222712_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK598643_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700448_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700477_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700473_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700480_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700469_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700479_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700484_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700449_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700440_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700441_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700445_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700446_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700447_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700450_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700451_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700454_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700459_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700464_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700466_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700471_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700482_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700487_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700488_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700442_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700443_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725123_C_P-D      aagggcattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725077_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JN040750_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcatttttgcct
GU456663_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MH724992_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN642132_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
FJ349219_C_P-D      atggacattgatccttataaagaatttggagccactgtggagttactctcgtttttgcct
AY161158_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC875301_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC875299_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC875302_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KC875303_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
FJ386590_C_P-D      atggacattgatccatataaagaatttggagctactgtggagttactctcgtttttgcct
EU414054_C_P-D      atggacattgatccatataaagaatttggagctactgtggagttactctcgtttttgcct
EU414135_C_P-D      atggacattgatccatataaagaatttggagctactgtggagttactctcgtttttgcct
GQ377589_C_P-D      atggacattgatccatataaagaatttggagctactgtggagttactctcgtttttgcct
AB270543_C_P-D      atggacattgatccatataaagaatttggagctactgtggagttactctcgtttttgcct
AF280817_C_P-D      atggacattgatccatataaagaatttggagctactgtggagttactctcgtttttgcct
MN507838_C_P-D      atggacattgatccatataaagaatttggagctactgtggagttactctcgtttttgcct
AF419516_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF419524_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JN040784_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF754588_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MH725079_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725064_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725065_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725080_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725081_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH724985_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH724977_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725134_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725169_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725133_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725057_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725052_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725046_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725053_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725055_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725056_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725047_C_P-D      atggacattgatccttataaagaatttggagctactggggagttactctcgtttttgcct
MH725198_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725182_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725174_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725101_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725090_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH724980_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcttttttgcct
MH724973_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725181_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725083_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH724995_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MH724976_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH724971_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MH724979_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725183_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725203_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH724997_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725191_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725211_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725208_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725193_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725184_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725180_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725176_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725164_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725136_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725115_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725085_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcttttttgcct
MH725016_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH724991_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH724989_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH724987_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725158_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725205_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH724961_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH724958_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH724954_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH724981_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH724983_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH724986_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725007_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725015_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725131_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725154_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725155_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725166_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725175_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725188_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725190_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725195_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725206_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725148_C_P-D      gtggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725095_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcat
MH725069_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725058_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725060_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725062_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725137_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725078_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725210_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725159_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725128_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725129_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB674406_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU726899_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725194_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KX827291_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP857040_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KP857020_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF018192_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN642130_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF754627_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
EU726926_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
AB674411_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU726961_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN040783_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH724965_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH724966_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN257182_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN040777_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
HM042272_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
HM042273_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
HM042283_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ287601_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ287602_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ287604_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ287605_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ287607_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ287608_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ287609_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ287610_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ287611_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ287612_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ287615_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ287617_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ287618_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ287620_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ287621_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
FJ904420_C_P-D      atggacatcgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
FJ904421_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MH724996_C_P-D      atggacatcgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF471650_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY161150_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY161151_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY161152_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY161153_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY161154_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY161155_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY161156_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ287619_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH724999_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttgtgcct
KP857026_C_P-D      atggacattgatccttataaagaatttggagctactgtcgagttactctcgtttttgcct
KF471646_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC774477_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN642138_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF754606_C_P-D      atggacattgatccttataaagaatttggagctacttcggagttactctcttttttgcct
EU726879_C_P-D      atggacatcgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725045_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725050_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725109_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725119_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725120_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725132_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725018_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM524338_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF170739_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MN507836_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF061170_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN642165_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN642126_C_P-D      atggacatcgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ833467_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
GU456683_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
GU456680_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
FJ349228_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcatttttgcct
FJ349215_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU726957_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU726907_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU726909_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU726905_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB222709_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725071_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725072_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF061169_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN642134_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ833469_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF324141_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
X85302_C_P-D        atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725173_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP671698_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF121239_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH724990_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU726917_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725150_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725147_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725151_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725186_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725146_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725149_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725187_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT749855_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
FJ349230_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725168_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725124_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725004_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725036_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725075_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725084_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725089_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725107_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725102_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF925391_C_P-D      atggacattgatccgtataaagaatttggagctactgtggagttactctcgtttttgcct
KF018190_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN257200_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF754599_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF754623_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
GU456653_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU726943_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725030_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725025_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725032_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725082_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725106_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725029_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
FJ349217_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU414136_C_P-D      atggacattgatccttataaagaatttggagctactgtggaattactctcgtttttgcct
MK598645_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725207_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH724956_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP857106_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH724955_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
X85295_C_P-D        atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725209_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725201_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725108_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725061_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MH725014_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MH724972_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP857027_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN257211_C_P-D      atggacattgattcttataaagaatttggagctactgtggagttactctcgtttttgcct
JN257163_C_P-D      atggacattgatccttataaagaatttggagctactgtgsagttactctcgtttttgcct
JF754624_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
GU456662_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
GU456661_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
GU357846_C_P-D      atggacattgatccatataaagaatttggagctactgtggagttactctcgtttttgcct
MN507851_C_P-D      atggacattgatccatataaagaatttggagctactgtggagttactctcgtttttgcct
GQ183470_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
FJ904412_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
FJ349216_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU726874_C_P-D      atggacattgatccttataaagaatttggggctactgtggagttactctcatttttgcct
EU726853_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
EF103281_C_P-D      atggacattgatcgttataaagaatttggagctactgtggagttactctcgtttttgcct
AY721609_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY161157_C_P-D      atggacactgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF324132_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725111_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725113_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725130_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU726958_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH724988_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH724993_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH724994_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725167_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725112_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB270548_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725177_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
X85303_C_P-D        atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
X85304_C_P-D        atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN040751_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU787443_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
LK995395_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF018191_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
FJ349229_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725063_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC774445_C_P-D      atggacattgacccatataaagaatttggagctactgtggagttactctcgtttttgcct
FJ349234_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
HM750155_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
HM750156_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN132126_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN558563_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN558564_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN257209_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY721611_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC875297_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KX196236_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JN040788_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606753_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF018194_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725161_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725204_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725008_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcttttttgcct
MH724974_C_P-D      atggacattgatccttataaagaatttggagctactgtagagttactctcgtttttgcct
MH724967_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
LK995390_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP857107_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN040794_C_P-D      atggacattgatccatataaagaatttggagctactgtggagttactctcgtttttgcct
JN040756_C_P-D      atggacattgatccctataaagaatttggagctactgtggagttactctcgtttttgcct
JF754618_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
HM750152_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU787446_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU787436_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU726960_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EF103275_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY721608_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY721607_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB188244_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB126581_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttctgcct
MH725066_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725067_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB104709_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgttcttgcct
AB104711_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgttcttgcct
MH725196_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725197_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY371919_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725019_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725006_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH724968_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
X85294_C_P-D        atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH724982_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC774462_C_P-D      atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgcct
LK995394_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ205380_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KY353914_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB246347_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT366498_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT366500_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT366502_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KY353920_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KY353921_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KY353911_C_P-D      atggacattgatccttataaagaatttggagctactgtgaagttactctcgtttttgcct
EU726959_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF121242_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK598649_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK598650_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725022_C_P-D      atggacattgattcttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725157_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK598648_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK598644_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK507914_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725185_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725156_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725142_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725076_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725028_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725001_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgttttcgcct
MH724998_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH724984_C_P-D      atggacattgatccttatagagaatttggagctactgtggagttactctcgtttttgcct
KY629630_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KX827300_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT366499_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP857105_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP857104_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP322599_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM524342_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF471656_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF061168_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF018180_C_P-D      atggacatcgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN257171_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN040823_C_P-D      atggacatcgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN040790_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN040786_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN040785_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF754615_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ833468_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ183480_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
FJ904443_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU919197_C_P-D      atggacattgatccttgtaaagaatttggagctactgtggagttactctcgtttttgcct
EU726967_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU726964_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU726900_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU726914_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU726918_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EF103280_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY721610_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY721606_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccg
AF121240_C_C-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF121241_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY371907_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK598641_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP671689_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK598639_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK598637_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU594396_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB222711_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU726962_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK598636_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK598640_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725105_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH724975_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725002_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725023_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
LC365689_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725049_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725051_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725179_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725041_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725117_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725121_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EF103276_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN257193_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN257194_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK693107_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK598642_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK598638_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK507911_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725178_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725138_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725048_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725037_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725040_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725035_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725034_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725027_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725116_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725122_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725170_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725026_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725013_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725070_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725003_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725009_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725017_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725039_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725044_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725073_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725143_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH724964_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP322600_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF798283_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT366508_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF798260_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF018184_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN642131_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN257185_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN257150_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF754628_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF754605_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ833470_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ833465_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
HM750154_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
HM042276_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ287603_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ287606_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ287613_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ287614_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ287616_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU787447_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU787442_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU787441_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU787440_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU787437_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU787445_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
HM750153_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ833471_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK507910_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK507913_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU726923_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725145_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU726878_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY945307_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EF103279_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB583680_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB246348_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU594397_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU726862_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH724963_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725059_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725074_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB674407_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN664922_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN664948_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcct
JN664919_C_P-D      atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcct
JN664921_C_P-D      atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcct
AJ627215_C_P-D      atggacatcgacccttataaagaatttggcgcttctgtggagttactctcgtttttgcct
AJ627216_C_P-D      atggacatcgacccttataaagaatttggcgcttctgtggagttactctcgtttttgcct
AJ627218_C_P-D      atggacatcgacccttataaagaatttggcgcttctgtggagttactctcgtttttgcct
JN257183_C_P-D      atggacatcgacccttataaagaatttggagctactgtgcagttactctcgtttttgcct
KP857049_C_P-D      atggacatcgacccttataaagaatttggagcttctgtgcagttactctcgtttttgcct
KP856996_C_P-D      atggacatcgatccttataaagaatttggcgcttctgtggagttactctcgtttttgcct
EU726901_C_P-D      atggacatcgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
EU726858_C_P-D      atggacatcgatccttataaagaatttggagcttctgtggagttactctcttttttgcct
DQ315778_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcct
AB674424_C_P-D      atggacatcgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
L27106_C_P-D        atggacatcgacccttataaagaatttggagctactgtcgagttactctcgtttttgcct
AB674427_C_P-D      atggacmttgatccttataaagaatttggagctwctgtggagttactctcgtttttgcct
KF471640_C_P-D      atggacattgatccttataaagaatttggagcttctgtgaatttactctcgtttttgcct
EU726975_C_P-D      atggacatcgatccttataaagaatttggagctagtgtggagttactctcgtttttgcct
EU726897_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF754629_C_P-D      atggacattgacccttataaagaatttggagcatctgtggagttactctcgtttttgcct
KP857117_C_P-D      atggacatcgacccttataaagaatttggagcttctgtggagttactctcttttttgcct
JF754632_C_P-D      atggacattgatccgtataaagaatttggagcttctgtggagttactctcgtttttgcct
KP856993_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
GU456639_C_P-D      atggaccttgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JF754611_C_P-D      atggacattgacccgtataaagaatttggagcttctgtggagttactctcgtttttgcct
EU726855_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KF584160_C_P-D      atggacattgacccttataaagaatttggagctwctgtggagttactctcgtttttgcct
KP856997_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttagtctcgtttttgcct
JN642146_C_P-D      atggacattgacctttataaagaatttggagcttctgtggagttactctcgtttttgcct
JN642140_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JN642154_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttctgcct
JN642157_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JN642161_C_P-D      atggacattgacctgtataaagaatttggagcttctgtggagttactctcgtttttgcct
GU456644_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JF754602_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
EU726929_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KP856976_C_P-D      atggacattgacctttataaagaatttggagcttctgtggagttactctcgtttttgcct
KT749823_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF754630_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN257162_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
AB674428_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcatttttgcct
X85255_C_P-D        atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
GU456642_C_P-D      atggacattgatccttataaagaatttggagctagtgtggagttactctcgtttttgcct
KP856977_C_P-D      atggatattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcca
KF584078_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP856975_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KF471655_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB674435_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP671700_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JF754603_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
AB674423_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KP857006_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KP857000_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcatttttgcct
AB674430_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN040818_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
GU456665_C_P-D      atggacattgatccttataaagaatttggcgcttctgtggagttactctcgtttttgcct
AY741798_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KP856978_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GU456636_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN642149_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP856986_C_P-D      atggacattgacccttataaagaatttggagcatctgtggagttactctcgtttttgcct
JN040811_C_P-D      atggacatcgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
EU726881_C_P-D      atggacatcgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
AB674431_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN040819_C_P-D      atggacattgatccttataaagaatttggagcttctgcggagttactctcgtttttgcct
KP857050_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
GU456652_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
GU456637_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP857007_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcttttttgcct
GU456643_C_P-D      atggacatcgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP856984_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JN642142_C_P-D      atggacattgatccatataaagaatttggagctactgtggagttactctcgtttttgcct
JF754610_C_P-D      atggacattgacccttataaagaatttggagctagtgtggagttactctcgtttttgcct
GU456647_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
AY371906_C_P-D      atggacattgacccttataaagaatttggagctactgtcgagttactctcgtttttgcct
KT963508_C_P-D      atggacattgatccttataaagaatttggagctactgtcgagttactctcgtttttgcct
JF754595_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgcct
EU726880_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
EU726847_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JN040800_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN040801_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN257202_C_P-D      atggacattgacctttataaagaatttggagctaccgtggagttactctcgtttttgcct
JF754607_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
GU456650_C_P-D      atggaccttgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
GU456640_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
LT992444_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU726951_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JN040814_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN040796_C_P-D      atggacatcgatccttataaagaattgggagctactgtggagttactctcgtttttgcct
JN040812_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN040804_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttaatctcgtttttgcct
GU456645_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
EU726977_C_P-D      atggacatcgatccttataaagaatttggagctagtgtggagttactctcgtttttgcct
AB674429_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcttttttgcct
EU726970_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN040829_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP857004_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JN040802_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JN040795_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU726925_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KP857003_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU726893_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JN040797_C_P-D      atggacattgatccttataaagaatttggagctactgcggagttactctcgtttttgcct
JN257205_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KP857051_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
FJ349231_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MG686619_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC774459_C_P-D      atggacattgacacgtataaagaatttggagctactgtggagttactctcgtttttgcct
KC774440_C_P-D      atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgcct
KC774444_C_P-D      atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgcct
JN257148_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GU456646_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JN040820_C_P-D      atggacattgatccttataaagaatttggagctgctgtggagttactctcgtttttgcct
GU456649_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN642145_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN257149_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
GU456638_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
FJ349235_C_P-D      atggacattgatccgtataaagaatttggagctactgtggagttactctcgtttttgcct
AB674425_C_P-D      atggacatcgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF018187_C_P-D      atggacatcgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF018189_C_P-D      atggacatcgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP857008_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KF584099_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF471649_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF754601_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GU456648_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU726921_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
AY371917_C_P-D      atggaccttgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
EU726945_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU726947_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN040799_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU726922_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KP857053_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN040810_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JN257169_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GU456641_C_P-D      atggacattgatccttataaagaatttggagcttctgtgcagttactctcgtttttgcct
EU726911_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU726856_C_P-D      atggacattcatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU726857_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU726963_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY371911_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
AY161159_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY161160_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY373431_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY371908_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN257187_C_P-D      atggacattgayccktataaagaatttggagctactgtggagttactctcgtttttgcct
JN257188_C_P-D      atggacattgayccktataaagaatttggagctactgtggagttactctcgtttttgcct
KF584161_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF584163_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF584165_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KY382412_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactmtcgtttttgcct
KF584162_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF584164_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF584166_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KY382414_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MN507853_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH724252_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KP857094_C_P-D      atggacattgayccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP857045_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN040824_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU726919_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN040817_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN040816_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF151735_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN040815_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN257186_C_P-D      atggaccttgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN257152_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF754608_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK598647_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JN257201_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN040813_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU726849_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN040809_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JN040806_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF754633_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccg
JF754596_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
FJ349233_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU726946_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY796030_C_P-D      atggacatcgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY371918_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB674426_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU726845_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC875289_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KC875290_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KX196209_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KX196212_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC875296_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KX196228_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KC875298_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KP857097_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN257203_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY741797_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB104712_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY661792_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcttttttgcct
AY661793_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcttttttgcct
EU726924_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU726935_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN257155_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN257196_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN257199_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN040827_C_P-D      atggatattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK618427_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcttttttgcct
Y07587_C_P-D        atggacattgatccttataaagaatttggagctactgtggagttactctcttttttgcct
KP857100_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcttttttgcct
MK618428_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcttttttgcct
KC875306_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KC875305_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KC875291_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KX196210_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KX196213_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KC875286_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC875284_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KC875287_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KC875283_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KC875275_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KC875281_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KC875304_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC875300_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KX196226_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC875307_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN040808_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK618437_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP857099_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM524339_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC875308_C_P-D      atggacattgatcgttataaagaatttggagctactgtggagttactctcgtttttgcct
KC875295_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KX196227_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JX310733_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB222713_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC875309_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC875279_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KC875278_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC875276_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KX196214_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC875277_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC875280_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC875282_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KX196215_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK618433_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MK618431_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK618429_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP671699_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF471651_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF471652_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF471647_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC875288_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KX196208_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KX196211_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC875285_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC875293_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC875294_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JX310735_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JX310734_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN040828_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN040807_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK618430_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK618432_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN040805_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF754591_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ477459_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU726931_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU726898_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN040826_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY371902_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY371914_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY371921_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY721612_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EF103277_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY371920_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ927384_C_P-D      atggacatcgacccttataaagaatttggagcttctgtggagttactctcttttttgcct
KP168419_C_P-D      atggacatcgacccttataaagaatttggagcttctgtggagttactctcttttttgcct
GU456674_C_P-D      atggacattgatccttataaagaatttggagctactgtgcagttactctcgtttttgcct
EU726979_C_P-D      atggacatcgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
EU726933_C_P-D      atggacattgatccttataaagaatttggagctagtgtggagttactctcgtttttgcct
JN257214_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN257215_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
GU456666_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MK355501_C_P-D      atggacattgatccttataaagaatttggagcttctgtgaagttactctcgtttttgcct
GU456669_C_P-D      atggacattgatccttataaagaatttggagctagtgtggagttactctcgtttttgcct
JN040782_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
EU726938_C_P-D      atggatattgatccgtataaagaatttggagctactgtggagttactctcgtttttgcct
JN040769_C_P-D      atggacatcgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU726904_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcttttttgcct
JN040775_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcttttttgcct
JN040762_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KF471642_C_P-D      atggacatcgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN040768_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcttttttgcct
GU456659_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgttttcgcct
EU726932_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU726892_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN642129_C_P-D      atggacattgatccttataaagaatttggagctagtgtggagttactctcgtttctgcct
EU726969_C_P-D      atggacattgatccttataaagaatttggagctactacggagttactctcgtttttgcct
GU456672_C_P-D      atggacattgatccttataaagaatttggagctactacggagttactctcgtttttgcct
KF471659_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcttttttgcct
KP857116_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU726859_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
EU726954_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JN040770_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
GU456667_C_P-D      atggacattgatccgtataaagaatttggagcttctgtggagttactctcgtttttgcct
EU726860_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcttttttgcct
AY371916_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
AY371910_C_P-D      atggacattgatccttataaagaatttggagctagtgtggagttactctcgtttttgcct
JN040765_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
GU456676_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
EU726872_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
EU726886_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF471658_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
GU456660_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
EU726950_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
EU726865_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF471654_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF471644_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
EU726873_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KF471641_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
GU456670_C_P-D      atggacatcgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF471660_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KF471645_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN040767_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
GU456671_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN642155_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP671695_C_P-D      atggacattgatccgtataaagaatttggagctactgtggagttactctcgtttttgcct
MH725098_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725099_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725100_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725103_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725165_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725162_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725160_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725093_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725091_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725092_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725104_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725127_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725163_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY741794_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY741795_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY741796_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN040822_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF471657_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF471653_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU726930_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU726940_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH725152_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP671697_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP671692_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP671684_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN040758_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK355500_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK693108_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP671691_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK693109_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP671690_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP671686_C_P-D      atggacattgatccgtataaagaatttggagctactgtggagttactctcgtttttgcct
KP671688_C_P-D      atggacattgatccgtataaagaatttggagctactgtggagttactctcgtttttgcct
KP671693_C_P-D      atggacattgatccgtataaagaatttggagctactgtggagttactctcgtttttgcct
KP671694_C_P-D      atggacattgatccgtataaagaatttggagctactgtggagttactctcgtttttgcct
KP671696_C_P-D      atggacattgatccgtataaagaatttggagctactgtggagttactctcgtttttgcct
JN257151_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU726971_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU726972_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU726937_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU726902_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU726895_C_P-D      atggacattgacccatataaagaatttggagctactgtggagttactctcgtttttgcct
EU726854_C_P-D      atggacattgatccatataaagaatttggagctactgtggagttactctcgtttttgcct
EU726869_C_P-D      atggacattgatccatataaagaatttggagctactgtggagttactctcgtttttgcct
EU726888_C_P-D      atggacattgatccatataaagaatttggagctactgtggagttactctcgtttttgcct
EU726894_C_P-D      atggacattgatccatataaagaatttggagctactgtggagttactctcgtttttgcct
EU726887_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU726976_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN040759_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP671685_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP671687_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
FJ904435_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
FJ904433_C_C-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN688712_C_P-D      atggacatcgacccttataaagaatttggagcttctgtggagttactctcgtttttacct
JN688713_C_P-D      atggacatcgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
GQ922000_C_P-D      atggacattgacccttataaagaatttggagcttccgctcccttactctcgtttttgcct
X85276_C_P-D        atggacatcgacccttataaagaatttggagctactgtggagttactctcttttttgcct
X85268_C_P-D        atggacattagcccttataaagaatttggagctagcgtggagttactctcgtttttgcct
JN664920_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN688710_C_P-D      atggacatcgacccttataaagaatttggcgctaccgtggagttactctcgtttttgcct
MH724248_C_P-D      atggaccttgacccttataaagaatttggagctnccgtggagttactctcgtttttgcct
JN688711_C_P-D      atggacatcgacccttataaagaatttggagctactctagagttactttcttttttgcck
KJ647355_C_P-D      atggacattgacccttataaagaatttggagcttctgtgcagttactctcgtttttgcct
AF419527_C_P-D      atggacatcgacccttataaagaatttggagcttccgtggagttactctcctttttgcct
KT749845_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttaatctcgtttttgcct
AF419528_C_P-D      atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgcct
JN688683_C_P-D      atggacattgacccatataaagaatttggagcttccgtggagttactctcgtttttgcct
X85263_C_P-D        atggacatcgacccttataaagaatttggagctactgtggagttactctcttttttgcct
MH724234_C_P-D      atggacattgacccttataaagaatttggagctacagtggagttactctcgtttttgcct
X85270_C_P-D        atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH724245_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
DQ464181_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KP857048_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN688708_C_P-D      atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgcct
JF754625_C_P-D      atggacattgacccttataaagaatttggagcttccgtggagttactctcttttttgcct
FJ349213_C_P-D      atggacattgacccttataaagaatttggagcctctgtggagttactctcgtttttgcct
JN688678_C_P-D      atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgcct
AB270537_C_P-D      atggacatcgacccttataaagaatttggagcttccgtggagttactctcgtttttgcct
AF419521_C_P-D      atggacattgacccgtataaagaatttggagcttctgtggagttactctcgtttttgcct
DQ464173_C_P-D      atggacattgacccttataaagaatttggagcttccgtggagttactctcgttttcgcct
DQ329356_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
DQ464175_C_P-D      atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgcct
DQ464172_C_P-D      atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgcct
DQ336692_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
DQ329357_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
DQ336691_C_P-D      atggacattgacccttataaagaatttggagcttccgtggggttactctcgtttttgcct
DQ336690_C_P-D      atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgcct
AY236164_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
DQ486022_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
DQ336689_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
DQ464174_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
DQ464178_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
DQ336686_C_P-D      atggacattgacccttataaagaatttggagcttccgtggagctactctcgtttttgcct
DQ464176_C_P-D      atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgcct
DQ336687_C_P-D      atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgcct
DQ486021_C_P-D      atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgcct
DQ336685_C_P-D      atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgcct
DQ336677_C_P-D      atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgcct
DQ336674_C_P-D      atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgcct
AY236160_C_P-D      atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgcct
DQ336675_C_P-D      atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgcct
DQ336676_C_P-D      atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgcct
DQ336678_C_P-D      atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgcct
DQ336679_C_P-D      atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgcct
DQ464177_C_P-D      atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgcct
KM524361_C_P-D      atggacattgacccttataaagaatttggagcgactgtggagttactctcatttttgcct
MF488704_C_P-D      atggacattgacccttataaagaatttggagcgactgtggagttactctcatttttgcct
MH724224_C_P-D      atggacatttacccttataaagaatttggagctaccggggagttactctcttttttgcct
MH724235_C_P-D      atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgcct
KP857042_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgcct
X85280_C_P-D        atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH724237_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KU736927_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
AF419523_C_P-D      atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgcct
KP857047_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcatttttgcct
MH724230_C_P-D      atggacctttacccttataaagaaattggagcttccggggagtttcttttgttttttcct
KU668434_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcct
KJ647353_C_P-D      atggacattgacccttataaagaatttggagctacagtggagttactctcgtttttgcct
JN688679_C_P-D      atggacatcgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
HQ236015_C_P-D      atggaccttgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
JN664909_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF192830_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF192831_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF192832_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF192834_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
X85269_C_P-D        atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MH724227_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
MH724228_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
X85261_C_P-D        atggacatcgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MH724229_C_P-D      atggacattgacccttataaagaatttggagctncggtggagttactctcntttttgcct
JN688685_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
X85264_C_P-D        atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgcct
FJ349211_C_P-D      atggacatcgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
DQ486025_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KU736926_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
X85260_C_P-D        atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
FJ349214_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JN688722_C_P-D      atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgcct
X85301_C_P-D        atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779219_C_P-D      atggacatcgacccttataaagaattcggagctactgtggagttactctcgtttttgcct
KF779223_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
JF439700_C_P-D      atggacatcgacccttataaagaatttggagccactgtggagttactctcgtttttgcct
JF439701_C_P-D      atggacatcgacccttataaagaatttggagccactgtggagttactctcgtttttgcct
KF779218_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KJ843187_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU185779_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JX470760_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC012652_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KX827292_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779224_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439712_C_P-D      atggacatcgacccttataaagaatttggagctattgtggagttactctcgtttttgcct
KF779301_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
KF779289_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779209_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
KF779212_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
KF779285_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
KF779288_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
KF779296_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
KF779302_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
KF779303_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
KF779318_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
KF779340_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
KF779292_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779341_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779376_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779377_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439718_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439692_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439699_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439703_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439696_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779222_C_P-D      atggacatcgacccttataaagaattcggagctactgtggagttactctcgtttttgcct
KF779216_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK618441_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AJ131956_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK618443_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JX898689_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JX898691_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JX898692_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JX898694_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JX898697_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779229_C_P-D      atggacatcgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KF779225_C_P-D      atggacatcgacccttataaagaattcggagctactgtggagttactctcgtttttgcct
KF779230_C_P-D      atggacatcgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KF779217_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779228_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439695_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439704_C_P-D      atggacatcgacccttataaagaatttggagctattgtggagttactctcgtttttgcct
JF439705_C_P-D      atggacatcgacccttataaagaatttggagctattgtggagttactctcgtttttgcct
X85254_C_P-D        atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MH724225_C_P-D      atggacattgacccttataaagaatttggagctnccggggagttactctcgtttttgcct
KP857110_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
MN507852_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
HQ236014_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
HQ236016_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
MH724242_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
MH724232_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
MH724226_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
JN664910_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU594434_C_P-D      atggacattgacccttataaagaatttggagcttccgtcgagttactctcgtttttgcct
EU155895_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU155893_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
EU414057_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
EU414143_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
MH724233_C_P-D      atggacattganccttataaagaatttggagctaccgtggagttactctcgtttttgcct
KM524356_C_P-D      atggacattgacccttataaagaatttggagctaccgtgcagttactctcgtttttgcct
AF419540_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF419542_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
X85318_C_P-D        atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
X65258_C_P-D        atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK598658_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
GQ922001_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
DQ464170_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN257181_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC875326_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC875330_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC875329_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KX196235_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KC875328_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN664947_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JN664912_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
DQ336688_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP090178_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP090177_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH724219_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH724218_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH724214_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
MH724221_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
KP090179_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
MH724249_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
MH724250_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
MH724215_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH724220_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606745_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ922002_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
DQ464168_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AM422939_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC875333_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KC875335_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KX196218_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KX196230_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KU668444_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP090181_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
KC875337_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KX196220_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KX196232_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC875334_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KX196221_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KX196233_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC875331_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KC875324_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC875315_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC875314_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
FJ349232_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
FJ349209_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
DQ464169_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY230114_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC875322_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC875323_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KX196224_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KX196225_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC875318_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC875320_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KX196217_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN664938_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KU668437_C_P-D      agggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF618343_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccc
KU668447_C_P-D      atggacatcgacccttataaagaatttggagttactgtggagttactctcgtttttgcct
KU668441_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KU668439_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ205388_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY230112_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
DQ315776_C_P-D      atagacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN664911_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN664913_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN664917_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN664937_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM524349_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM524350_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KU668436_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KU668438_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KU668446_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF618339_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF618340_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF618341_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
V01460_C_P-D        atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC875325_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KC875317_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KX196222_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KX196234_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC875316_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC875313_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC875319_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC875321_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC875332_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC875336_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KX196216_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KX196219_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KX196231_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
LT992438_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
FJ692506_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
FJ692507_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
KP090180_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
AB048701_C_P-D      atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgcct
KJ470895_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttgctgtcgtttttgcct
MH724251_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KJ470894_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KJ470885_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KJ470889_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KJ470893_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttgctctcgtttttgcct
KJ470896_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ922005_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
GQ922003_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
GQ922004_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KM606754_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgcct
HQ700458_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779382_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
AJ627219_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KM606655_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KM606698_C_P-D      atggaccttgacccttataaagaatttggagcttctgtggagttactctcttttttgcct
KM606645_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KM606675_C_P-D      atggaccttgacccttataaagaatttggagctactgtggagttactctcatttttgcct
FJ692532_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
FJ692533_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606682_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgcct
KM606654_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KM606752_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KM606690_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KM606686_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KM606697_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KM606644_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KM606744_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KM606664_C_P-D      atggacattgacccgtataaagaatttggagctactgtggagttactctcatttttgcct
KM606670_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KM606755_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JN664924_C_P-D      atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcct
KM577670_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KJ647350_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgcct
GQ477453_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JN642144_C_P-D      atggacattgacccttataaagaatttggagctactgtgcagttactctcgtttttgcct
FJ904438_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
GQ477456_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY090452_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF925366_C_P-D      atggacattgacccttataaagaatttggagcgactgtggagatactctcatttttgcct
KJ647352_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM577669_C_P-D      atggacatcgacccttataaagaatttggagcttctgtggagttactctcttttttgcct
AB188241_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP857041_C_P-D      atggacatcgacccttataaagagtttggagcttctgtggagttactctcgtttttgcct
JN642162_C_P-D      atggacattgacccttataaagaatttggagctactgtcgagttactctcgtttttgcct
EU726871_C_P-D      atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgcct
JN664932_C_P-D      atggacattgacccttataaagaatttggagcgactgtggagttactctcatttttgcct
KP856990_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AJ627222_C_P-D      atggacatygacccttataaagaatttggagcttctgtgcagttactctcgtttttgcct
KX260231_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgcct
AB210820_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JN642163_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN642148_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN257190_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB555496_C_P-D      atggaccttgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM577668_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN642159_C_P-D      atggaccttgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KM577671_C_P-D      atggacatcgacccttataaagaatttggagcttctgttgagttactctcgtttttgcct
AB555501_C_P-D      atggacatcgacccttatataagaattggagctactgtggagttactctcgtttttgcct
MH724238_C_P-D      atggacattgacccttataaagaatttggagcttcngtggagttactctcntttttgcct
JN792904_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KC875342_C_P-D      atggacattgacccttataaagaatttggagcatctgtggagttactctcatttttgcct
KX196229_C_P-D      atggacattgacccttataaagaatttggagcatctgtggagttactctcatttttgcct
KC875340_C_P-D      atggacattgacccttataaagaatttggagcatctgtggagttactctcatttttgcct
KC875341_C_P-D      atggacattgacccttataaagaatttggagcatctgtggagttactctcatttttgcct
KM524340_C_P-D      atggacattgactcttataaagaatttggagcgactgtggagttactctcatttttgcct
GQ205389_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcatttttgcct
GQ205382_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF618342_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KU668433_C_P-D      atggacatcgacccttataaagaatttggagcaactgtggagttactctcgtttttgcct
KU668435_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ205384_C_P-D      atggacattgacccttataaagaatttggagcgactgtggagttactctcatttttgcct
KM524345_C_P-D      atggacattgacccttataaagaatttggagcgactgtggagttactctcatttttgcct
JN664926_C_P-D      atggacattgacccttataaagaatttggagcgactgtggagttactctcatttttgcct
JN792911_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JN792912_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
AF419537_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF419538_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB555497_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP856981_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JN257178_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP856989_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
GQ477452_C_P-D      atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgcct
KX357637_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KX357638_C_P-D      atggacattgacccttataaagaatttggagctactgtgcagttactctcgtttttgcct
KU736924_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KU736925_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KX357639_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GU456635_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
AF043593_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcct
MK598679_C_P-D      atggacattgacccttataaagaatttggagctactgtgcagttactctcttttttgcct
MK598678_C_P-D      atggacattgacccttataaagaatttggagctactgtgcagttactctcttttttgcct
MK598676_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcct
AF043594_C_P-D      atggacattgacccttataaagaatttggagctactgtgcagttactctcttttttgcct
MK598677_C_P-D      atggacattgacccttataaagaatttggagctactgtgcagttactctcttttttgcct
GQ477454_C_P-D      atggacatcgagccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU594404_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH724241_C_P-D      atggacatcgacccttataaagaatttggagcttctgtggagttactctcttttttgcct
LT992439_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN642143_C_P-D      atggaccttgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN792905_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JN792906_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JN664936_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU594398_C_P-D      atggacattgacccttataaagagtttggagctactgtggagttactctcgtttttgcct
MK598674_C_P-D      atggacattgacccttataaagagtttggagctactgtggagttactctcgtttttgcct
X85279_C_P-D        atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP857043_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
AF419512_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB270539_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcct
AB188242_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700510_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN792908_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KF922432_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY603445_C_P-D      atggacatcgacccgtataaagaatttggagctactgtggagttactctcgttttcgcct
AY603433_C_P-D      atggacatcgacccgtataaagaatttggagctactgtggagttactctcgtttttgcct
MK598670_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
FJ349218_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB205127_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK598659_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN792907_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN792909_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN792910_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN792903_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH724247_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC774436_C_P-D      atggacattgacccgtataaagaatttggagctaccgtggagttactctcttttttgcct
KC774460_C_P-D      atggacattgacccgtataaagaatttggagctaccgtggagttactctcttttttgcct
MH724244_C_P-D      atggacattgacccatataaagaatttggagctactgtggagttactctcgtttttgcct
KX827290_C_P-D      atggacattgacccgtataaggaatttggagctactgtggagttactctcgtttttgcct
KX827301_C_P-D      atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgcct
KF779220_C_P-D      atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgcct
AY603443_C_P-D      atggacatcgacccgtataaagaatttggagctactgtggagttactctcatttttgcct
EU594411_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU594412_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU414058_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY603439_C_P-D      atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgcct
MK618426_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU594422_C_P-D      atggacatcgacccgtataaagaatttggagctactgtggagttactctcgtttttgcct
JX096955_C_P-D      atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgcct
EU594408_C_P-D      atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgcct
MK618418_C_P-D      atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgcct
AY603434_C_P-D      atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgcct
MK598667_C_P-D      atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgcct
MK598672_C_P-D      atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgcct
AY603440_C_P-D      atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgcct
AY603437_C_P-D      atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgcct
AY603428_C_P-D      atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgcct
EU414060_C_P-D      atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgcct
EU414140_C_P-D      atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgcct
EU594423_C_P-D      atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgcct
EU594428_C_P-D      atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgcct
JX096956_C_P-D      atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgcct
MK598675_C_P-D      atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgcct
MK618420_C_P-D      atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgcct
Z35716_C_P-D        atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK618419_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU594415_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK598669_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK598673_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK598666_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JX096958_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU594421_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU594400_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU594401_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU594402_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU594403_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU594405_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU594409_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU594410_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU594416_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU594431_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU594432_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK598671_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK618422_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU594407_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU594427_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK618421_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH724246_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH724216_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN664914_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU594426_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB205128_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU414061_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU414138_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP857111_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
LT992454_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcttttttgcct
EU594399_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY603427_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF324138_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU594424_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccg
MH724217_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH724223_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH724231_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttacct
EU594425_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU594430_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU594433_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JX096954_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JX096957_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB330369_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB330370_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700512_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700513_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700514_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
HQ700511_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
MN507837_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttccct
KP322601_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AJ627223_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AJ627220_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK598662_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK598668_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH464838_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
AF419539_C_P-D      atggacgttgacccttataaagaatttggagctactgtggagttactctcatttttgcct
X80927_C_P-D        atggacattgatccttataaagaatttggagctactgtggagttactctcatttttgcct
X80928_C_P-D        atggacattgatccttataaagaatttggagctactgtggagttactctcttttttgcct
X97849_C_P-D        atggacattgatccttataaagaatttggagctactgtggagttactctcttttttgcct
MK052972_C_P-D      atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgcct
MK052947_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MK052952_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MK052973_C_P-D      atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgcct
MK052975_C_P-D      atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgcct
MK052974_C_P-D      atggacattgacccttataaagaatttggtgcttccgtggagttactctcgtttttgcct
MK052954_C_P-D      atggacattgacccttataaaggatttggagctcccgtggagttactctcgtttttgcct
MK052948_C_P-D      atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgcct
MK052949_C_P-D      atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgcct
MK052961_C_P-D      atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgcct
MK052951_C_P-D      atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgcct
MK052959_C_P-D      atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgcct
MK052953_C_P-D      atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgcct
MK052958_C_P-D      atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgcct
MK052955_C_P-D      atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgcct
MK052950_C_P-D      atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgcct
MK052956_C_P-D      atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgcct
MK052960_C_P-D      atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgcct
MK052963_C_P-D      atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgcct
MK052966_C_P-D      atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgcct
MK052971_C_P-D      atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgcct
MK541688_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccg
JN040830_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
AF419529_C_P-D      atggaccttgacccttataaagaatttggagcttctgtggagttactctcatttttgcct
JF754597_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgcct
JF754621_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
AY796031_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
X97848_C_P-D        atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
AF419532_C_P-D      atggatattgacccttataaagaatttggagcttctgtggagttactctcatttttgcct
FJ349208_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcctttttgcct
FJ349205_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KT749828_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccg
KT749827_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgcct
JQ687530_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgcct
GQ477455_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgcct
GQ477457_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
AF419526_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
FJ349206_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KT749821_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
X72702_C_P-D        atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
EU414059_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
EU414139_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
MK598660_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
MK598661_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KF679990_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
DQ399006_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH724236_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU921419_C_P-D      atggacattgacccttataaagaatttggagcttccgtggagttactctcatttttgcct
EU921418_C_P-D      atggacattgacccttataaagaatttggagcttccgtggagttactctcatttttgcct
KP857046_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB355452_C_P-D      atggacattgacccttataaagaatttggagcttccgtggagttactctcatttttgcct
AB355456_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcatttttgcct
AB493846_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcatttttgcct
MH464840_C_P-D      atggacattgatccttataaagaatttggagctaccgtggagttactctcgtttttgcct
MH464842_C_P-D      nnnnnnnnnagtccttataaagaatttggagctaccgtggagttactctcgtttttgcct
MH464843_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
MH464844_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
AY233296_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcatttttgcct
MH464848_C_P-D      nnnnnnnnngacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
MH464849_C_P-D      nnnnnnnnngacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
AY233292_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
AY233294_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
MH464833_C_P-D      nnnnnnnttgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
MH464845_C_P-D      nnnnnnattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
MH464836_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH464831_C_P-D      nnnnnnattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
KT347090_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
KM519455_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
AY233291_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
MH464847_C_P-D      nnnnnnnnnnacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
MH464832_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
MH464854_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
MH464834_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
EU939680_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU414055_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
EU414142_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
MK507912_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
KC774437_C_P-D      atggacattgacccgtataaagaatttggagctaccgtggagttactctcgtttttgcct
EU414056_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
EU414141_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
KF679989_C_P-D      atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgcct
MK598657_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
GQ183485_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
GQ183478_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
MK598655_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
EU594382_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
MK598651_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
KF779214_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
KF679992_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
KF679993_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
KF798282_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
KF798306_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
KT366497_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
KT366507_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
X65257_C_P-D        atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
FJ562338_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
HM750151_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
KX276856_C_P-D      atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN688695_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KX276857_C_P-D      atggacattgacccttataaagaatttggagctwctgtggagttactctcgtttttgcct
JN664941_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KU668448_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF324111_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707704_C_P-D      atggacattgactcttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707702_C_P-D      atggacattgactcttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707696_C_P-D      atggacattgactcttataaagaatttggagctactgtggagttactctcgtttctgcct
JQ707695_C_P-D      atggacattgactcttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707689_C_P-D      atggacattgactcttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707682_C_P-D      atggacattgactcttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707683_C_P-D      atggacattgactcttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707684_C_P-D      atggacattgactcttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707685_C_P-D      atggacattgactcttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707687_C_P-D      atggacattgactcttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707688_C_P-D      atggacattgactcttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707690_C_P-D      atggacattgactcttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707691_C_P-D      atggacattgactcttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707692_C_P-D      atggacattgactcttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707693_C_P-D      atggacattgactcttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707694_C_P-D      atggacattgactcttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707697_C_P-D      atggacattgactcttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707698_C_P-D      atggacattgactcttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707699_C_P-D      atggacattgactcttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707700_C_P-D      atggacattgactcttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707701_C_P-D      atggacattgactcttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707703_C_P-D      atggacattgactcttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707705_C_P-D      atggacattgactcttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707706_C_P-D      atggacattgactcttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707686_C_P-D      atggacattgactcttataaagaatttggagctactgtggagttactctcgtttttgcct
KM524358_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB109478_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF925379_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB119255_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MK598664_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
AB119256_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB119254_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ924652_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
AY090453_C_P-D      atggacattgatccttataaagaatttggagctactgtgcagttactctcgtttttgcct
MF925390_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB119253_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM524344_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KU668442_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB109479_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB119251_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN664931_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN664939_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF925383_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ183484_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB109477_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB110075_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB119252_C_P-D      atggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgcct
AB120308_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707497_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK618423_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK618424_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK618425_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF679994_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF679996_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK598663_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF679998_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK618434_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707518_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK618435_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707529_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707521_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707514_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707483_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707486_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707512_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707513_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707515_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707516_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707517_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707519_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707520_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707522_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707523_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707524_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707525_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707526_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707527_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707528_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707530_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK618436_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707498_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707509_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707504_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ183472_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT366496_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM524354_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ183471_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ183477_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM524341_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT366494_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF925363_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF925364_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF925393_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN664927_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN664930_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707506_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707491_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707484_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707500_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707489_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707476_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707478_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707479_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707481_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707482_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707485_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707487_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707488_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707490_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707494_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707496_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707499_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707502_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707503_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707505_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707507_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707508_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707480_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707511_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707510_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707493_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707477_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707492_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707495_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707501_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH932714_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF798281_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
HM042266_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK516278_C_P-D      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
KC875312_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ183479_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ183473_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT366491_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ183475_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT151620_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF798301_C_P-D      atggacattgacccttataaagaatttggagctactgtgcagttactctcgtttttgcct
KF679997_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN664918_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ183474_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM524355_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB267090_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB210821_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB210822_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB109476_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB090268_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB078031_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB078032_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB078033_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB109475_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB116266_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC875310_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB090270_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC875311_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB090269_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB205126_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB471856_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB471857_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MN507839_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KU668445_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KU668449_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF618348_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF679995_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KR905423_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF925358_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT366511_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM524346_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF798299_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT366493_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
HM042277_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ183481_C_P-D      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT366501_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM524347_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN664928_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF798273_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
FJ040872_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM524353_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK598665_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT366510_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT366495_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF896606_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcca
KM524352_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcca
KF798307_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT366465_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
HM042267_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ183476_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM524351_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KR905424_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT366506_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT366509_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ183482_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ183483_C_P-D      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
FJ904410_C_P-D      atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KX357622_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
FJ904419_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
FJ904395_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
FJ904422_C_P-D      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
                                     *         ** *            *  * *  **    *  

AB555500_C_P-D      gcttacttcttcccttccgtaccagatcttctagataccgcctcagctttatatcgggaa
FJ904439_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgccacagctctgtatcgggat
JX036342_C_P-D      gctgacttctttccttcagtacgagatcttctagatactgcctcagctttatatcgggaa
JX036343_C_P-D      tctgacttctttccttcagtacgagatcttctagatactgcctcagctttatatcgggaa
JX036344_C_P-D      gctgacttctttccttcagtacgagatcttctagatactgcctcagctttatatcgggaa
MH725171_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgccacagccctatatcgggat
AB674415_C_P-D      gagaacttctatccttcaatacgagatcttctagataccgcctcagccctatatcgggat
JF754612_C_P-D      tctgacttctttcctgcagtacgagatcttctagataccgccaccgctctatatcgggat
JF754594_C_P-D      gctgacttctttccttcggtacgagatcttctagataccgccacagctctatttcggcaa
AB674416_C_P-D      gatgacttctttccttctgcacgagatctgcttgataccgccacagctctatatcgggaa
JN040766_C_P-D      ggtgacttctttccttccgtacgcgatcttctagataccgcctcagctctgtatcgggaa
KP857013_C_P-D      tctgacttctttccttcmgtacgagatcttctagatackgcatcagctttatatcgggaa
JF754617_C_P-D      tctgacttctttccttcagtaagagatctgctggataccgccgcaggcctatatcgggaa
EU726891_C_P-D      tccgacttctttccttcggtacgagatcttctagataccgcctcagctctatatcgggac
JN040773_C_P-D      tccgacttctttccttcggtacgagatcttctagataccgcctcagctctatatcgggac
AB330367_C_P-D      tccgacttctttccttcagcacgagatcttctagataccgcctcagctctatatcgggaa
JF754609_C_P-D      gaagacttctttccttcagtacgagatcttctagataccgcatcagctctatatcgggaa
JN642128_C_P-D      tctgacttctttccttccgtacgagatcttctagataccgcctcagctttatatcgggaa
GU456677_C_P-D      tctgacttctttccttccgtacgagaccttcttgataccgcctcagctttatttcgggaa
KP857028_C_P-D      tctgacttttatccttcagtacgagatcttctagataccgcctcagctctatttcgggac
JF754622_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
GU456679_C_P-D      gttgacttctatccttcagtacgagatcttctagataccgcctcagctttgtatcgggaa
GU456657_C_P-D      gctgacttctttccttcagtacgagatctactagataccgcctcagctctatatcgggaa
MH725153_C_P-D      gaagatttctttccttccgtacgagatcttctagataccgcctcagcgctatatcgggag
JN642135_C_P-D      tctgacttttttccttccgtacgagatcttctagataccgcctcagctctatatcgggac
JF754626_C_P-D      gatgacttctttccttcagtacgagatcttctagatgccacctcagctctatatcgggaa
X85278_C_P-D        tctgacttctttccttcagtacgagatcttctagataccgccacagctctatatcgggaa
GQ167302_C_P-D      tctgacttctttccttcagtacgggatcttctagataccgcctcagctctatttcgggac
GQ167301_C_P-D      tctgacttctttccttcagtacgggatcttctagataccgcctcagctctatttcgggac
GQ184322_C_P-D      tctgacttctttccttcagtacgggatcttctagataccgcctcagctctatttcgggac
JN257165_C_P-D      tccgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggat
JN257166_C_P-D      tccgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggat
KF018181_C_P-D      catgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggat
MH725126_C_P-D      tctgacttctttccgtcagtacgagatcttctagataccgccgcagctctatttcgggaa
KP857031_C_P-D      gctgacttctttccttcagtacgagatcttctagataccgtctcagctctatatcgggaa
AB270541_C_P-D      gctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggat
MH725199_C_P-D      tctgacttctttccttcagtacgagatcttctcgataccgccacagctctatatcgggaa
JN257153_C_P-D      tctgacttctttccttccgtacgagatcttctagataccgcctcagctctatatcgggaa
JN257195_C_P-D      tctgacttctttccttccgtacgagatcttctagataccgcctcagctctatatcgggaa
KP857032_C_P-D      actgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
GU456651_C_P-D      tctgacttctatccttcagtaagagatcttctagataccgcctcagctttatatcgagaa
KP857018_C_P-D      actgacttctttccttccgtacgagatcttctagataccgcctcagctctgtatcgggaa
JF754600_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725135_C_P-D      gctgacttctttccttctgtacgagatcttctagataccgcctcagctctatatcgggat
KF018177_C_P-D      gctgacttctttccttcaatacgagatcttctagataccgcctcagctctatatcgggat
EU726884_C_P-D      actgacttctttccttcagtacgagatcttctagataccgccgcagctttatatcgggaa
MH724978_C_P-D      caagacttctttcctgccgtacgagatcttctagataccgcctcagctctatatcgggaa
MH725189_C_P-D      tctgacttctttccttcggtacgggatcttctagataccgccgcagctctatatcgggat
DQ486023_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
AB104710_C_P-D      tctgacttctttcctgctgtacgagatctgctagataccgcctcagctctatatcgggaa
KP857039_C_P-D      tctgacttctttccttcggtacgagatcttctagataccgcctcagctctatatcgggac
HQ833466_C_P-D      actgacttctttccttcmgtacgagatcttctagayaccgcctcagckctatatcgrgaa
AB270542_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggat
X80924_C_P-D        actgacttctttccttcagtacgagatcttctagataccgccacagctctatatcgggat
X80926_C_P-D        actgacttctttccttcagtacgagatcttctagataccgccacagctctatatcgggat
MH725068_C_P-D      tatgacttttttccttcagtacgagattttatagataccgcctcagctttatatcgggaa
KP857024_C_P-D      tctgacttctttccttccgtgcgagatcttctagataccgcctcagctctatatcgggaa
DQ336680_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
DQ336682_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
DQ336684_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
DQ336681_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
DQ336683_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
AB674417_C_P-D      tctgacttctttcctgcagtacgagatcttctagataccgcctcagctytatatcgggaa
AB674418_C_P-D      tctgacttctttcctgcagtacgagatcttctagataccgcctcagctttatatcgggaa
KP857005_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgccgcagctctgtatcgggaa
AY371909_C_P-D      actgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KP857019_C_P-D      tctgacttctttcctaccgtacgagatcttctagataccgcctcagctctgtttcgggaa
FJ904426_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
GU456682_C_P-D      tctgacttctttccttcagtacgggatcttctagataccgcctcagctctatatcgggat
JN257176_C_P-D      yctgacttctttccttcagtacgagatcttctagataccgcctcggctctrtttcgggaa
JN257177_C_P-D      yctgacttctttccttcagtacgagatcttctagataccgcctcggctctrtttcgggaa
EU726952_C_P-D      actgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
JN040774_C_P-D      actgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
JN642136_C_P-D      gaggacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
FJ904446_C_P-D      gctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcggcaa
EU726973_C_P-D      gctgacttctttccttcagtacgagatcttctagataccggctcagctctatttcgggat
JN642147_C_P-D      actgacttctttccttccgtacgagatcttctagataccgcctcagctctatatcgggac
X59795_C_P-D        tctgacttctatccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
JN040771_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
GU456675_C_P-D      tctgacttctttccttcggtacgagatcttctagataccgctgcagctctgtatcgggat
GU456678_C_P-D      tctgacttctttccttcaatacgagatcttctagataccgcctcagctttgtatcgggaa
FJ904429_C_P-D      ggtgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggat
EU726941_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggat
KY629633_C_P-D      tctgacttctttccttcagtacgagatcttctagatacagcctcagckytatatcgagaa
JF754593_C_P-D      actgacttctttccttcagtacgagatcttctagataccgccacagctctatatcgggaa
KP857029_C_P-D      gctgacttctttccttcagtacgcgatcttctagataccgccttcgctctatttcgggat
HQ700439_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagcgctatatcgggaa
FJ904445_C_P-D      gttgacttctttccttcagtacgagatcttctggataccgcctcagctctatatcgggaa
AB674413_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
AB674410_C_P-D      tctgacttctttccttcggtacgagatcttctagataccgcctcagctctatatcgggaa
JF754592_C_P-D      aatgacttctttccttcagcacgagatcttctagataccgcctcagctctatttcgggat
FJ904402_C_P-D      gctgacttctttccttctgtacgagatcttctagataccgcctcagctctatatcgggat
EU726912_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcttcagctctatatcgggaa
AB270540_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcggctctatatcgggaa
KY629634_C_P-D      tctgacttctatccgtcagtacgagatcttctagataccgcctcagctctatatcgggaa
KP857025_C_P-D      tctgacttctttccttccgtacgagatcttctagataccgcctcagctctatatcgggat
KF018182_C_P-D      gctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
JN040772_C_P-D      tccgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
GU456664_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtttcgggaa
GU456654_C_P-D      actgacttctttcctgcagtacgagatcttctagataccgcctcagctctatatcgggaa
JF754619_C_P-D      cctgacttctttccttcagtacgagatcttctagataccgcctcagctctatttcgggaa
FJ904399_C_P-D      tctgacttctttccttcagtacgagatgttctagataccgcctcagctctatatcgggaa
AB270550_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
KP857015_C_P-D      actgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
KP857016_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
KP857037_C_P-D      gctgacttctttccttcagtacgagatcttctagataccgcctcagctctatttcgggat
KP857033_C_P-D      gctgacttctttccttcagtacgagatcttctagataccgcctcagctctatttcgggaa
JQ687531_C_P-D      tctgacttctttccttccgtacgagatcttctagataccgcctcagctttgtatcgggat
JN642167_C_P-D      tcggacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
GU456658_C_P-D      actgacttctttccttcagtacgagatcttctagataccgcctcagctctgtttcgggaa
GQ477458_C_P-D      ggtgactactttccttccgtacgtgatcttctagataccgcctcagctctgtttcgggaa
AJ627224_C_P-D      tctgacttctttcctaacgtacgagatcttctagataccgcctcagctctgtttcgggaa
JF754631_C_P-D      actgacttctatccttccgtacgagatcttctagataccgcctcagctctatatcgggaa
KP857017_C_P-D      actgacttctatccttccgtacgagatcttctagataccgcctcagctctatatcgggaa
MH725202_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatttcgggat
KP857114_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatttcgggaa
JN040781_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
HQ700463_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctccgctctatatcgagaa
GU456656_C_P-D      tctgacttctttccttcagtacgagatctgctagataccgcctcagctctatatcgggaa
FJ904431_C_P-D      gccgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
FJ904418_C_P-D      tctgacttctttccttctgtacgagatcttctagataccgcctcagctctatatcgggaa
EU787438_C_P-D      tctgacttctttccttcggtacgagatcttctagataccgcctcagctctatatcgggaa
AB674419_C_P-D      gctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
EU726868_C_P-D      gctgacttctttccttccgtacgagatcttctagataccgcctcagctctatttcgggaa
JN040779_C_P-D      gctgacttctttccttccgtacgagatcttctagataccgcctcagctctatttcgggaa
JN642156_C_P-D      tctgacttctatccttcagtacgagatcttctagataccgcctcagctctatatcgggat
EU726875_C_P-D      tctgacttctttccttccgtacgagatcttctagataccgccgcagctctatttcgggat
AY796032_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
EU726885_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgccaccgctctatatcgggaa
JN040755_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgccaccgctctatatcgggaa
KP857021_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatttcgggaa
JN642164_C_P-D      actgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
JF754604_C_P-D      tctgacttctttccttccgtacgagatcttctagataccgcctcagctctatatcgggaa
GQ205385_C_P-D      tccgatttctttccgtcagtccgagatcttctagataccgcctcagcgctatatcgggat
AY236162_C_P-D      tctgacttctttccgtcggtacgagatcttctagataccgcctcagctctatatcgggaa
DQ304548_C_P-D      tctgacttctttccgtcggtacgagatcttctagataccgcctcagctctatatcgggaa
DQ304549_C_P-D      tctgacttctttccgtcggtacgagatcttctagataccgcctcagctctatatcgggaa
DQ304547_C_P-D      tctgacttctttccgtcggtacgagatcttctagataccgcctcagctctatatcgggaa
DQ304550_C_P-D      tctgacttctttccgtcggtacgagatcttctagataccgcctcagctctatatcgggaa
DQ304551_C_P-D      tctgacttctttccgtcggtacgagatcttctagataccgcctcagctctatatcgggaa
KP857022_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
GU456673_C_P-D      actgacttttatccttcggtacgagatcttctagataccgcctcagctctgtatcgggat
EU726848_C_P-D      gctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH724970_C_P-D      tctgacttctttccttccgtacgagatcttctggataccgcctcagctctatatcgggaa
JN642158_C_P-D      tctgacttctttccttccgtacgagatcttctagataccgccacagctctatatcgggag
JF754635_C_P-D      ggtgacttctttccttccgtacgagatcttctagataccgcctcagctctatttcggcaa
JF754634_C_P-D      actgacttctatccttcagtacgagatcttctagatactgcctcagctctatatcgggaa
EU726850_C_P-D      tccgacttctttccttcagtacgagatcttctagataccgcctcagctctatttcgggaa
X85277_C_P-D        tctgacttctttccttcggtacgagatcttctagataccgcctcagctctatatcgggaa
GU456655_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
EU726906_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
KP857023_C_P-D      tctgacttctttccttccgtacgagatctactagataccgcctcagctctatatcggcaa
JF754590_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatttcgggat
GU456681_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgccccagctttgtatcgggat
EU787439_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
EU726944_C_P-D      tctgacttctttccttcagtacgagatcttctggataccgcctcagctctgtatcgggaa
JN040776_C_P-D      tctgacttctttccttcagtacgagatcttctggataccgcctcagctctgtatcgggaa
AF419522_C_P-D      tctgacttctttccttcagtacgagatctgctagataccgtctcagctctatatcgggaa
X85273_C_P-D        gttgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
MH725094_C_P-D      tctgacttttttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
KP857115_C_P-D      actgactactttccttcagtacgagatcttctagataccgccagagctctatatcgggat
KP857038_C_P-D      tccgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
KP857034_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgccgcagctctatatcgggat
AB270549_C_P-D      tccgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
EU939681_C_P-D      tctgacttctttccatccgtacgagatcttctagataccgcctcagctctatatcgggaa
FJ899792_C_P-D      tctgacttctttccatccgtacgagatcttctagataccgcctcagctctatatcgggaa
KP857035_C_P-D      actgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
KP857030_C_P-D      actgacttctttccttcagtacgagatcttctagataccgcctcagctctatttcgggaa
AB674403_C_P-D      tctgacttctttccttccgtacgagatcttctagacaccgcctcagctctgtatcgggaa
JN642150_C_P-D      gctgacttctttccttcagtacgagatcttctagataccgccacagctctatatcgggaa
JN040821_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
AY371915_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
AY371913_C_P-D      gctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH724962_C_P-D      tctgacttctttccttcagcacgagatcttctagataccgcctcagctctatatcgggaa
JN257172_C_P-D      tctgacttctttccttcggtacgagatcttctagataccgcctcagctctgtatcgggaa
JN257173_C_P-D      tctgacttctttccttcggtacgagatcttctagataccgcctcagctctgtatcgggaa
MH725096_C_P-D      ggggacttttttccttcagtgcgtgatcttctagataccgcctcagctttatatcgggaa
MH725110_C_P-D      ggggacttttttccttcagtgcgtgatcttctagataccgcctcagctttatatcgggaa
MH725118_C_P-D      ggggacttttttccttcagtgcgtgatcttctagataccgcctcagctttatatcgggaa
MH725097_C_P-D      ggggacttttttccttcagtgcgagatcttctagataccgcctcagctttatttcgggaa
MH724959_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
EU726908_C_P-D      tctgacttctttccttccgtacgagatctgctggataccgcctcagctctatatcgggac
DQ464182_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
MH725139_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
JN257160_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
JN257161_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
JN257159_C_P-D      kctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
AB270546_C_P-D      tctgacttctttccttcagtacgagatcttctagacaccgcctcagctctatatcgggaa
KP995092_C_P-D      tctgacttctttcctgcagtacgagatcttctagataccgcctcagctttatatcgggaa
KP995100_C_P-D      tctgacttctttcctgcagtacgagatcttctagataccgcctcagctttatatcgggaa
JN642166_C_P-D      tcggacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
GU456668_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
FJ904427_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggac
AY371904_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
AF419530_C_P-D      gctgacttctttccttcagtacgagatctgctagataccgcctcagctctatatcgggat
JN642133_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
GU456684_C_P-D      catgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgggac
FJ904424_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcggctctatttcgggaa
HQ700472_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggat
FJ349220_C_P-D      tctgacttctttccttccgtacgagatcttctagataccgcctcagctctgtatcgggaa
AJ344116_C_P-D      tctgacttctttccttccgtacgagatcttctagataccgcctcagctctatatcgggaa
MH725054_C_P-D      catgacttctttccttcagcacgagatcttctagataccgcctcagctctatatcgggaa
MH724960_C_P-D      catgacttctttccttcaatacgagatcttctagataccgcctcagctctatttcgggaa
MH724969_C_P-D      catgacttctttccttcaatacgagatcttctagataccgcctcagctctatttcgggaa
JN257170_C_P-D      ggtgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
EU726864_C_P-D      gctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtttcgggaa
EU726844_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
KP857036_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
JN040753_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggat
DQ178012_C_P-D      tctgacttctttccttcagtacaagatcttctagataccgcctcagctctgtatcgggaa
DQ178011_C_P-D      tctgacttctttccttcagtacaagatcttctagataccgcctcagctctgtatcgggaa
DQ178015_C_P-D      tctgacttctttccttcagtacaagatcttctagataccgcctcagctctgtatcgggaa
AY371912_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
DQ178019_C_P-D      tctgacttctttccttcagtacaagatcttctagataccgcctcagctctgtatcgggaa
AY350614_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
AY371901_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
AY371905_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
AY371922_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
X02496_C_P-D        tctgacttctttccttcagtacgagatcttctagataacgcctcagctctgtatcgggaa
DQ178017_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
DQ178016_C_P-D      tctgacttctttccttcagtacaagatcttctagataccgcctcagctctatatcgggaa
DQ178018_C_P-D      tctgacttctttccttcagtacaagatcttctagataccgcctcagctctatatcgggaa
DQ178020_C_P-D      tctgacttctttccttcagtacaagatcttctagataccgcctcagctctatatcgggaa
JN040752_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
HQ700455_C_P-D      tctgacttctttccttcagtacgagmtcttctagataccgcctcagctctatatcgggaa
FJ904432_C_P-D      gctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
DQ111986_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MK598646_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
JN687947_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctataccgggaa
JN040780_C_P-D      gttgacttctttccttcaatacgagatcttctagataccgcctcagctctatatcgggaa
AY721605_C_P-D      tctgacttctttccttcagtacgggatcttctagataccgcctcagctctataccgagaa
AB674420_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725144_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcggcaa
MH725088_C_P-D      tctgacttctttccttcaatacgagatcttctagataccgcctcagctctatatcgggaa
JN642153_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttattccgggaa
JN642151_C_P-D      gctgacttctttccttccgtacgagatcttctagataccgcctcagctctatttcgggaa
JN040778_C_P-D      actgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggat
FJ904415_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
AB222710_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
JN132132_C_P-D      tctgacttctttccttccgtacgagatctcctagataccgcctcagctctgtatcgggaa
JN132130_C_P-D      tctgacttctttccttcagtacgagatctcctagataccgcctcagctctgtatcgggaa
JN558561_C_P-D      tctgacttctttccttcagtacgagatctcctagataccgcctcagctctgtatcgggaa
JN132131_C_P-D      tctgacttctttccttcagtacgagatctcctagataccgcctcagctctgtatcgggaa
JN558562_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
JN697591_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
JN132127_C_P-D      tctgacttctttccttcagtacgagatctcctagataccgcctcagctctgtatcgggaa
HQ641710_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
JN132128_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
AF324110_C_P-D      tctgacttctttccatcagtacgagatcttctagataccgcctcagctctatatcgggaa
AF324115_C_P-D      tctgacttctttccatcagtacgagatcttctagataccgcctcagctctatatcgggaa
AF324113_C_P-D      tctgacttctttccatcagtacgagatcttctagataccgcctcagctctatatcgggaa
AF324109_C_P-D      tctgacttctttccatcagtacgagatcttctagataccgcctcagctctatatcgggaa
AF324108_C_P-D      tctgacttctttccatcagtacgagatcttctagataccgcctcagctctatatcgggaa
AF324114_C_P-D      tctgacttctttccatcagtacgagatcttctagataccgcctcagctctatatcgggaa
AF324116_C_P-D      tctgacttctttccatcagtacgagatcttctagataccgcctcagctctatatcgggaa
MF618349_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctttcgggaa
JN040761_C_P-D      actgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
GQ183449_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
GQ183464_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
GQ183463_C_P-D      tctgacttctttccttcaatacgagatcttctagataccgcctcagctctatatcgggaa
GQ183459_C_P-D      tccgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
GQ183458_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
GQ183457_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
GQ183460_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
GQ183461_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
GQ183469_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
GQ183448_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
GQ183450_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
GQ183451_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
GQ183452_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
GQ183453_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
GQ183454_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
GQ183455_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
GQ183456_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
GQ183462_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
GQ183465_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
GQ183466_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
GQ183467_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
GQ183468_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
AB270547_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
EU726876_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725012_C_P-D      tctgacttttttccttcagtgcgtgatcttctagataccgcctcagctctatatcgggaa
MH725005_C_P-D      tctgacttcttttcttcagtgcgtgatcttctagataccgcctcagctctatatcgggaa
MH725011_C_P-D      tctgacttttttccttcagtgcgtgatcttctagataccgcctcagctctatatcgggaa
KC875292_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
AB716760_C_P-D      tctgacttctttccttcagtacgagstcttctagataccgcctcagctatatatcgggaa
HE805987_C_P-D      tctgacttctttccttcagtacgagstcttctagataccgcctcagctatatatcgggaa
AB674405_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
AB674404_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
KF018195_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
X85308_C_P-D        tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
X85259_C_P-D        tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
X85298_C_P-D        tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
X85297_C_P-D        tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
X85299_C_P-D        tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
JN040792_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
JN040791_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
JN040793_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725087_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
MH725031_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725033_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
M32138_C_P-D        tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
KP857109_C_P-D      tctgacttctttccttccgtacgagatcttctagataccgcctcagctctatatcgggaa
KF018185_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctatatcgggaa
JN257179_C_P-D      tctgacttctttccttccgtacgagatcttctrgataccgcctcagctctatatcgggaa
JN040754_C_P-D      tctgacttctttccttccgtacgagatcttctagataccgcctcagctctgtatcgagaa
JF754614_C_P-D      actgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
FJ562309_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgagaa
EU726910_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
AB674408_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgccacagctttatatcggcaa
MH725172_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725140_C_P-D      tctgacttctttccttcagtacgagatctgctagacaccgcctcagctctatatcgggaa
MH725125_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctatatcgggaa
KM524348_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JF754598_C_P-D      catgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcggcaa
HQ700467_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcggctctatttcgggaa
EU726861_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
EU726965_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatttcgggaa
JN040757_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatttcgggaa
HQ700478_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
HQ700553_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
KF061167_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
HQ700481_C_P-D      tctgacttttttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725086_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
HQ700474_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
HQ700470_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
HQ700468_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
HQ700489_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
HQ700444_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
HQ700483_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
AB222712_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagcactatatcgggaa
MK598643_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagcactatatcgggaa
HQ700448_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
HQ700477_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
HQ700473_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
HQ700480_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
HQ700469_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
HQ700479_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
HQ700484_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
HQ700449_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
HQ700440_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
HQ700441_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
HQ700445_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
HQ700446_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
HQ700447_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
HQ700450_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
HQ700451_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
HQ700454_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
HQ700459_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
HQ700464_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
HQ700466_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
HQ700471_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
HQ700482_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
HQ700487_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
HQ700488_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
HQ700442_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
HQ700443_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725123_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725077_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
JN040750_C_P-D      tctgacttctttccttcagttcgagatcttctagataccgcctcagctctatatcgggaa
GU456663_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
MH724992_C_P-D      tctgacttctttccttcagtacgagatcttctcgataccgcctcagctctatatcgggaa
JN642132_C_P-D      caggacttctttccttcagtacgagatcttctagataccgccagagctctatttcgggaa
FJ349219_C_P-D      tctgacttctttccttccgtacgagatcttctagataccgcctcagctctgtatcgggaa
AY161158_C_P-D      tctgacttctttccttcagtacgagatctcctagataccgcctcagctctatatcgggaa
KC875301_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
KC875299_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
KC875302_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
KC875303_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
FJ386590_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggar
EU414054_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
EU414135_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
GQ377589_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
AB270543_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
AF280817_C_P-D      tctgacttttttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MN507838_C_P-D      tctgacttttttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
AF419516_C_P-D      tctgacttctttccttcagtacgagatctgctagataccgcctcagctctatatcgggaa
AF419524_C_P-D      tctgacttctttccttcagtacgagatctgctagataccgcctcagctctatatcgggaa
JN040784_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgccgcagctctatatcgggaa
JF754588_C_P-D      tctgacttctttccttcagtacgagatctgctagataccgcctcagctctatatcgggat
MH725079_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725064_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725065_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725080_C_P-D      tctgacttttttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725081_C_P-D      tctgacttttttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH724985_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
MH724977_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725134_C_P-D      tctgatttctttccttcaatacgagatcttctagataccgcctcagctctatatcgggaa
MH725169_C_P-D      tctgatttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725133_C_P-D      tctgatttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725057_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725052_C_P-D      tctgatttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725046_C_P-D      tctgatttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725053_C_P-D      tctgatttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725055_C_P-D      tctgatttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725056_C_P-D      tctgatttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725047_C_P-D      tctgatttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725198_C_P-D      tctgacttctttccttcagttcgagatcttctagataccgcctcagctttatatcgggaa
MH725182_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
MH725174_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcacctttatatcgggaa
MH725101_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
MH725090_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
MH724980_C_P-D      tctgacttctttccttctatacgagatcttctagataccgcctcagctttatatcgggaa
MH724973_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
MH725181_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
MH725083_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH724995_C_P-D      tctgacttctttccttctatacgagatcttctagataccgcctcagctttatatcgggaa
MH724976_C_P-D      tctgacttctttccttcaatacgagatcttctacataccgcctcagctttatatcgggaa
MH724971_C_P-D      tctgacttctttccttcaatacgagatcttctagataccgcctcagctttatatcgggaa
MH724979_C_P-D      tctgacttctttccttcaatacgagatcttctagataccgcctcagctttatatcgggaa
MH725183_C_P-D      tctgacttctttccttcaatacgagatcttctagataccgcctcagctttatatcgggaa
MH725203_C_P-D      tctgacttctttccttcaatacgagatcttctagataccgcctcagctttatatcgggaa
MH724997_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725191_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
MH725211_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
MH725208_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
MH725193_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
MH725184_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
MH725180_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
MH725176_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
MH725164_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
MH725136_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatattgggaa
MH725115_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
MH725085_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
MH725016_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagccttatatcgggaa
MH724991_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
MH724989_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
MH724987_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
MH725158_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
MH725205_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
MH724961_C_P-D      tctgacctctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
MH724958_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
MH724954_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
MH724981_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
MH724983_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
MH724986_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
MH725007_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
MH725015_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
MH725131_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
MH725154_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
MH725155_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
MH725166_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
MH725175_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
MH725188_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
MH725190_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
MH725195_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
MH725206_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
MH725148_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
MH725095_C_P-D      tttgacttctttccttcagtacgacatcttctagataccgcctcagctctatatcgggaa
MH725069_C_P-D      tctgacttctttccttcagtacgacatcttctagataccgcctcagctctatatcgggaa
MH725058_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725060_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725062_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725137_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725078_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725210_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctttatcgggaa
MH725159_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctttatcgggaa
MH725128_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctttatcgggaa
MH725129_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctttatcgggaa
AB674406_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
EU726899_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725194_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
KX827291_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
KP857040_C_P-D      tccgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
KP857020_C_P-D      tctgacttctttccttccgtacgagatcttctagacaccgcctcagctctatatcgggaa
KF018192_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
JN642130_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
JF754627_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
EU726926_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggat
AB674411_C_P-D      tctgacttttttccttcagtaagagatcttctagataccgcctcagctctatatcgggaa
EU726961_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
JN040783_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH724965_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH724966_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
JN257182_C_P-D      tctgacttctttccttcagtacgagatctgctagataccgcctcagctctataccgggaa
JN040777_C_P-D      tctgacttctttccttcagtacgagatctactagataccgcctcagctctctatcgggaa
HM042272_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
HM042273_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
HM042283_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
JQ287601_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
JQ287602_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
JQ287604_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
JQ287605_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
JQ287607_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
JQ287608_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
JQ287609_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
JQ287610_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
JQ287611_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
JQ287612_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
JQ287615_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
JQ287617_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
JQ287618_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
JQ287620_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
JQ287621_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
FJ904420_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
FJ904421_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH724996_C_P-D      tctgatttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
KF471650_C_P-D      tctgacttctttccttcagtacgagatctgctagataccgcctcagctctatatcgggac
AY161150_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
AY161151_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
AY161152_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
AY161153_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
AY161154_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
AY161155_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
AY161156_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
JQ287619_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH724999_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
KP857026_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatttcgggac
KF471646_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggac
KC774477_C_P-D      tctgacttcttcccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
JN642138_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JF754606_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
EU726879_C_P-D      tctgacttctttccttcggtacgagatcttctagataccgcctcagctctgtttcgggaa
MH725045_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725050_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725109_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725119_C_P-D      tctgacttctttccttctatacgagatcttctagataccgcctcagctctatatcgggaa
MH725120_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725132_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725018_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
KM524338_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
KF170739_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
MN507836_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
KF061170_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
JN642165_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
JN642126_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
HQ833467_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
GU456683_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
GU456680_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
FJ349228_C_P-D      tctgacttctttccttccgtacgggatcttctagataccgcctcagctctatatcgggaa
FJ349215_C_P-D      tctgacttctttccttccgtacgagatcttctagataccgcctcagctctgtatcgggaa
EU726957_C_P-D      tccgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
EU726907_C_P-D      tctgacttctttccttccgtacgagatcttctagataccgcctcagctctatatcgggaa
EU726909_C_P-D      tctgacttctttccttccgtacgagatcttctagataccgcctcagctctatatcgggaa
EU726905_C_P-D      tctgacttctttccttcggtacgagatcttctagataccgcctcagctctgtatcgggat
AB222709_C_P-D      tctgacttctttccttcggtacgagatcttctagataccgcctcagctctatatcgggaa
MH725071_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725072_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
KF061169_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
JN642134_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggat
HQ833469_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctttatatcgggaa
AF324141_C_P-D      tctgacttctttccttcagtacgggatcttctagataccgcctcagctctatatcgggaa
X85302_C_P-D        tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725173_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctatatcgggaa
KP671698_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
AF121239_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgagaa
MH724990_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
EU726917_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725150_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725147_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725151_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725186_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725146_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725149_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725187_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
KT749855_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgccgcagctctatatcgggaa
FJ349230_C_P-D      gctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725168_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725124_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggag
MH725004_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725036_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725075_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725084_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725089_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725107_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725102_C_P-D      tctgacttctttccttctatacgagatcttctagataccgcctcagctctgtatcgggaa
MF925391_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
KF018190_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctatatcgggaa
JN257200_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
JF754599_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
JF754623_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
GU456653_C_P-D      tctgacttctttccttcagtacgagatctactagataccgcctcagctctatatcgggaa
EU726943_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
MH725030_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725025_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725032_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725082_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725106_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725029_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
FJ349217_C_P-D      tctgacttctttccttccgtacgagatcttctagataccgcctcagctctgtatcgggaa
EU414136_C_P-D      tctgacttctttccttccgtacgagatctgctagacaccgcctcagctctgtatcgggaa
MK598645_C_P-D      tctgacttctttccttccgtacgagatctgctagataccgcctcagctctgtatcgggaa
MH725207_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH724956_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
KP857106_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH724955_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
X85295_C_P-D        tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725209_C_P-D      tctgacttctttccttcagtacgacatcttctagataccgcctcagctctatatcgggat
MH725201_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725108_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725061_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725014_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggat
MH724972_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
KP857027_C_P-D      tctgacttctttccttcagtacgggatcttctagataccgcctcagctctatatcgggaa
JN257211_C_P-D      tctgacttctttccttcggtacgagatcttctagataccgcctcagctctatatcgggaa
JN257163_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
JF754624_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
GU456662_C_P-D      tctgacttttttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
GU456661_C_P-D      tctgacttctttcctgcagtacgagatcttctagataccgcctcagctctgtatcgggaa
GU357846_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctccgctctatatcgggaa
MN507851_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctccgctctatatcgggaa
GQ183470_C_P-D      tctgacttttttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
FJ904412_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
FJ349216_C_P-D      tctgacttctttccttccgtacgagatcttctagataccgcctcagctctgtatcgggaa
EU726874_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcttcagctctatatcgggaa
EU726853_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
EF103281_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
AY721609_C_P-D      tctgacttcttcccttcagtacgtgatcttctagatactgcctcagctctgtatcgggaa
AY161157_C_P-D      tctgacttctttccttcagtacgagatctcctagataccgcctcagctctatatcgggaa
AF324132_C_P-D      tctgacttctttccttccgtacgagatcttctagataccgcctcagctctatatcgggaa
MH725111_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725113_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725130_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
EU726958_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH724988_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
MH724993_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
MH724994_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
MH725167_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
MH725112_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
AB270548_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725177_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
X85303_C_P-D        tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
X85304_C_P-D        tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
JN040751_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
EU787443_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatttcgggaa
LK995395_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
KF018191_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
FJ349229_C_P-D      tctgacttctttccttcagtacgagatcttctagatactgcatcagctctatatcgggaa
MH725063_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
KC774445_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
FJ349234_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
HM750155_C_P-D      tctgacttctttccttcagtacgagatcttctagatactgcctcagctctatatcgggaa
HM750156_C_P-D      tctgacttctttccttcagtacgagatcttctagatactgcctcagctctatatcgggaa
JN132126_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
JN558563_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
JN558564_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
JN257209_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
AY721611_C_P-D      tctgacttctttccttcagtacgagatctactagataccgcctcagctctatatcgggaa
KC875297_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
KX196236_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
JN040788_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
KM606753_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
KF018194_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725161_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725204_C_P-D      actgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725008_C_P-D      tctgacttctttccttcaatacgagatcttctagataccgcctcaactctatatcgggaa
MH724974_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH724967_C_P-D      tctgacctctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
LK995390_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
KP857107_C_P-D      tctgacttctttccttccgtacgagatcttctagataccgcctcagctctgtatcgggaa
JN040794_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
JN040756_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
JF754618_C_P-D      tctgacttctttccttccgtacgagatcttctagataccgcctcagctctgtatcgggaa
HM750152_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
EU787446_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
EU787436_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
EU726960_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
EF103275_C_P-D      tctgacttctttccttccgtacgagatcttctagataccgcctcagctctatatcgggaa
AY721608_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
AY721607_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
AB188244_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
AB126581_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725066_C_P-D      tctgacttctttccttcattacgaaatcttctagataccgcctcagctctatatcgggaa
MH725067_C_P-D      tctgacttctttccttcattacgaaatcttctagataccgcctcagctctatatcgggaa
AB104709_C_P-D      tctgacttctttccttcagtacgagatctactagataccgcctcagctctatatcgggaa
AB104711_C_P-D      tctgacttctttccttcagtacgagatctactagataccgcctcagctctatatcgggaa
MH725196_C_P-D      gctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725197_C_P-D      gctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
AY371919_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
MH725019_C_P-D      tctgacttctttccttcaatacgagatcttctagataccgcctcagctctatatcgggaa
MH725006_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH724968_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
X85294_C_P-D        tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH724982_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
KC774462_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
LK995394_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
GQ205380_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
KY353914_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
AB246347_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
KT366498_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
KT366500_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
KT366502_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
KY353920_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
KY353921_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
KY353911_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
EU726959_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
AF121242_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
MK598649_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
MK598650_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
MH725022_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725157_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MK598648_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MK598644_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagcactatatcgggaa
MK507914_C_P-D      tctgacttctttccttcagtgcgagatcttctagataccgcctcagctctatatcgggaa
MH725185_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725156_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725142_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatattgggaa
MH725076_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725028_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725001_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH724998_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH724984_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
KY629630_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
KX827300_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
KT366499_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
KP857105_C_P-D      tctgacttctttccttcagtgcgagatctactagataccgcctcagctctatatcgggaa
KP857104_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
KP322599_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
KM524342_C_P-D      tctgacttctttccttcagtatgagatcttctagataccgcctcagctctatatcgggaa
KF471656_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
KF061168_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KF018180_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
JN257171_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
JN040823_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
JN040790_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
JN040786_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
JN040785_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
JF754615_C_P-D      tctgacttctttccttccgtacgagatcttctagataccgcctcagctctgtatcgggaa
HQ833468_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
GQ183480_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctttatcgggaa
FJ904443_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
EU919197_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
EU726967_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
EU726964_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
EU726900_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
EU726914_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
EU726918_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
EF103280_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
AY721610_C_P-D      tctgacttctttccttcagtacgagatctactagataccgcctcagctctatatcgggaa
AY721606_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
AF121240_C_C-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
AF121241_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
AY371907_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
MK598641_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
KP671689_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
MK598639_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MK598637_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
EU594396_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
AB222711_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
EU726962_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MK598636_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MK598640_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725105_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH724975_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725002_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725023_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
LC365689_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725049_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725051_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725179_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725041_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725117_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725121_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
EF103276_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
JN257193_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
JN257194_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MK693107_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MK598642_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagcactatatcgggaa
MK598638_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MK507911_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725178_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725138_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725048_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725037_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725040_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725035_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725034_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725027_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725116_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725122_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725170_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725026_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725013_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725070_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725003_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725009_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725017_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725039_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725044_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725073_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725143_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH724964_C_P-D      tctgacttctttccttcaatacgagatcttctagataccgcctcagctctatatcgggaa
KP322600_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KF798283_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
KT366508_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
KF798260_C_P-D      tctgacttctttccttcagtgcgagatcttctagataccgcctcagctctatatcgggaa
KF018184_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
JN642131_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
JN257185_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
JN257150_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
JF754628_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JF754605_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
HQ833470_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctttatatcgggaa
HQ833465_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
HM750154_C_P-D      tctgacttctttccatcagtacgagatcttctagataccgcctcagctctatatcgggaa
HM042276_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
JQ287603_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
JQ287606_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
JQ287613_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
JQ287614_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
JQ287616_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
EU787447_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
EU787442_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
EU787441_C_P-D      tctgacttctttccatcagtacgagatcttctagataccgcctcagctctatatcgggaa
EU787440_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
EU787437_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
EU787445_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
HM750153_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
HQ833471_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MK507910_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MK507913_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
EU726923_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725145_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
EU726878_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
AY945307_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
EF103279_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
AB583680_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
AB246348_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
EU594397_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
EU726862_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH724963_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725059_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
MH725074_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
AB674407_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
JN664922_C_P-D      tctgacttctttccgtctgttcgagatctcctcgataccgcctctgctctgtatcgggag
JN664948_C_P-D      tctgacttctttccttctattcgagatctcctcgacaccgcctctgctctctatcgggag
JN664919_C_P-D      tctgacttttttccgtctattcgagatctcctcgacaccgcctctgctctgtatcgggag
JN664921_C_P-D      tctgacttctttccgtctattcgggatctcctcgacaccgcctctgctctgtatcgggag
AJ627215_C_P-D      tctgacttttttccttccgtacgagatcttctagataccgcctcagctctgtttcgggat
AJ627216_C_P-D      tctgacttttttccttccgtacgagatcttctagataccgcctcagctctgtttcgggat
AJ627218_C_P-D      tctgacttttttccttccgtacgagatcttctagataccgcctcagctctgtttcgggat
JN257183_C_P-D      tctgacttctttccttcaatacgagatcttctagataccgccgcagctctgtatggggaa
KP857049_C_P-D      tctgacttctttccttcaattcgagatcttctagataccgccgcagctctgtttggggaa
KP856996_C_P-D      gctgatttcttcccttcagtacgtgatcttctagataccgcctcagctctgtatcgggat
EU726901_C_P-D      actgacttctttccctcggtacgagatcttctagatactgcctcagctctgtatcgggaa
EU726858_C_P-D      actgacttctttccttccgtacgagatcttctagataccgcctcagctttgtatcgggac
DQ315778_C_P-D      tctgacttctttccttcttttcgagatcttctcgataccgcctctgctctgtatcgggag
AB674424_C_P-D      actgacttctttccttcagtacgtgatcttctagataccgcctcagctctgtatcgagat
L27106_C_P-D        tctgacttctttccttccgcacgagatcttctagataccgcctcagctctgtttcgggaa
AB674427_C_P-D      cttgacttctatccttcagtacgtgatcttctagataccgcctcagctctgtatcgggaa
KF471640_C_P-D      gctgactactttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
EU726975_C_P-D      gctgacttttttccttccgtacgagatctcctagataccgcctcagctctgtttcgggat
EU726897_C_P-D      gctgacttttttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JF754629_C_P-D      tctgacttttttccttcagttcgagatcttctagataccgcctcagctttgtatcgggac
KP857117_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttgtatcgggat
JF754632_C_P-D      gctgacttctttccttcagtacgtgatcttctagataccgccacagctctgtatcgggac
KP856993_C_P-D      gaggacttctttccttcagtacgagatcttctagataccgcctcagctttgtatcgggaa
GU456639_C_P-D      caggacttctatccttcagtacgagatcttctagataccgccacagctctgtatcgggaa
JF754611_C_P-D      tctgacttctttccttcagtacgagatcttctagacaccgcctcagctctgtatcgggaa
EU726855_C_P-D      tctgacttctttccttcagtacgggatcttctagataccgcctcagctttgtatcgggat
KF584160_C_P-D      tcygacttctttccttccgtacgagatcttctagataccgcctcagctctgtatcgggaa
KP856997_C_P-D      actgacttctatccttcagtacgagatcttctggataccgcctcagctctgtatcgggaa
JN642146_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggat
JN642140_C_P-D      tctgacttctttccttcagtacgagatcttctcgatactgcctcagctctgtatcgagat
JN642154_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JN642157_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JN642161_C_P-D      gctgacttttttccttcagtacgagatcttctagatactgcctcagctctgtttcgagac
GU456644_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggat
JF754602_C_P-D      ggtgacttctttccttcagtacgtgatcttctagataccgcctcagctctgtatcgggaa
EU726929_C_P-D      actgacttctttccttcagtacgagatcttctagataccgcctcagctttgtatcgggaa
KP856976_C_P-D      actgacttctatccttcagtacgagatcttctagataccgcckcagctctgtatcgggam
KT749823_C_P-D      gctgacttctttccttcagtacgagatcttcgagataccgcctcagctctgtatcgggac
JF754630_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggat
JN257162_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
AB674428_C_P-D      tctgacttctttccttcagtacgtgatcttctagataccgcctcagctctgtatcgggaa
X85255_C_P-D        tctgacttctttccttcagtacgagatcttctagacacctcctcagctctgtttcgggat
GU456642_C_P-D      aatgacttctttccttcactacgagatcttctagataccgccgcagctctgtttcgggaa
KP856977_C_P-D      ggcgacttctttccttcaatacgagatcttctagataccgcctcagctctgtatcgggaa
KF584078_C_P-D      tctgacttctttccttccgtacgagatcttctaggtaccgcctcagctctgtatcgggaa
KP856975_C_P-D      caggacttctatccttcagtacgtgatcttctagataccgcctcagctctgtatcgggac
KF471655_C_P-D      tctgacttctttccttcaatacgagatcttctagataccgcctcagctctgtatcgggaa
AB674435_C_P-D      tctgacttctttccttcagtacgagaccttctagacaccgcctcagctctgtatcgggaa
KP671700_C_P-D      tctgacttctttccttcagtacgagatctgctagataccgcctcagctctgtttcgggaa
JF754603_C_P-D      caggacttctttccttcagtacgagatcttctagataccgcttcagctctgtatcgggaa
AB674423_C_P-D      gtcgacttctttccttcagtacgtgatcttctagataccgcctcagctctgtttcgggaa
KP857006_C_P-D      ggtgacttctttccttcagtacgagatctactagataccgcctcagctctgtatcgggaa
KP857000_C_P-D      tctgacttctttccttcagtacgtgatcttctagataccgccgcagctctgtatcgggat
AB674430_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgagat
JN040818_C_P-D      gctgacttctttccttcagtacgagatctgctagataccgcctcagctctgtttcgggaa
GU456665_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtttcgggaa
AY741798_C_P-D      actgacttctttcctgcagtacgagatcttttagataccgcctcagctctgtttcgggaa
KP856978_C_P-D      tccgacttctttccttccgtacgagatcttctagataccgcctcagctctgtttcgggaa
GU456636_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JN642149_C_P-D      tcagacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KP856986_C_P-D      gttgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JN040811_C_P-D      tctgacttttttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
EU726881_C_P-D      actgacttctttccttcagtacgagatcttctagataccgcctcagctctgtttcgggaa
AB674431_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgccgcagctctgtatcgggaa
JN040819_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgagaa
KP857050_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
GU456652_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttatatcgggaa
GU456637_C_P-D      tctgacttctttccttcagtacgagatcttctagatgccgcctcagctctgtatcgggaa
KP857007_C_P-D      tctgacttctttccttcagtacgtgatctgctagataccgcctcagctctgtatcgggaa
GU456643_C_P-D      catgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggat
KP856984_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JN642142_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggac
JF754610_C_P-D      tctgacttctttccttccgtacgagatcttctggataccgcctcagctctgtatcgggaa
GU456647_C_P-D      gctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
AY371906_C_P-D      tctgacttctttccttcagtacgggatcttctagataccgcctcagctctgtatcgggaa
KT963508_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtttcgggac
JF754595_C_P-D      acggacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
EU726880_C_P-D      actgacttctttccttcagtacgagatcttctagataccgcctcagctttgtatcgggaa
EU726847_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JN040800_C_P-D      tctgacttctttccttcagtacgagatcttcttgctaccgcctcagctctgtatcgggaa
JN040801_C_P-D      tctgacttctttccttcagtacgagatcttcttgctaccgcctcagctctgtatcgggaa
JN257202_C_P-D      actgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JF754607_C_P-D      tctgacttctttccttcagtacgggatcttctagataccgcctcagctctgtatcgggaa
GU456650_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttgtatcgggat
GU456640_C_P-D      tccgacttctttccttcagtacgagatcttctagataccgcctcagctttgtttcgggaa
LT992444_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
EU726951_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggat
JN040814_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgccacagctctgtatcgggaa
JN040796_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JN040812_C_P-D      tctgacttctttccttcggtacgagatcttctagataccgcctcagccctgtatcgggaa
JN040804_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
GU456645_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtttcgggaa
EU726977_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggat
AB674429_C_P-D      tctgacttctttccttcagtacgtgatcttctagataccgcctcagctctgtatcgggaa
EU726970_C_P-D      actgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JN040829_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KP857004_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
JN040802_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JN040795_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgccacagctttgtttcgggaa
EU726925_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KP857003_C_P-D      tctgacttctttccttcagtacgtgatcttctagataccgcctcagctctgtatcgggaa
EU726893_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttgtatcgggaa
JN040797_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtttcgggaa
JN257205_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KP857051_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
FJ349231_C_P-D      tctgacttctttccttcggtgcgagatcttctagataccgcctcagctctgtatcgggaa
MG686619_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcacctctgtatcgggaa
KC774459_C_P-D      tctgacttttttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KC774440_C_P-D      tctgacttttttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KC774444_C_P-D      tctgacttttttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JN257148_C_P-D      tctgacttcttcccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
GU456646_C_P-D      gttgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JN040820_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttgtatcgggaa
GU456649_C_P-D      tctgacttttttccttcagtacgagatcttctagataccgcctcagctttgtatcgggaa
JN642145_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JN257149_C_P-D      tctgacttctttccttcagtacgasatcttctagataccgcctcagctctgtatcgggaa
GU456638_C_P-D      actgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
FJ349235_C_P-D      tctgacttctttccttcagtacgtgatcttctagataccgcctcagctctgtatcgggaa
AB674425_C_P-D      tctgacttctttccttcagtacgtgatcttctagataccgcctcagctctgtatcgggaa
KF018187_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KF018189_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KP857008_C_P-D      tctgacttctttccttcagtacgtgatcttctagataccgcctcagctctgtatcgggaa
KF584099_C_P-D      tccgacttctttccttccgtacgagatcttctagataccgcctcagctctgtatcgggaa
KF471649_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttgtatcgggaa
JF754601_C_P-D      tctgacttctttccttcagttcgagatcttctagataccgcctcagctttgtatcgggaa
GU456648_C_P-D      tctgacttctttccttcagtgcgagatcttctagataccgcctcagctctgtatcgggaa
EU726921_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
AY371917_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgccgcagctctgtatcgggaa
EU726945_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtttcgggaa
EU726947_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtttcgggaa
JN040799_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtttcgggaa
EU726922_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KP857053_C_P-D      tctgacttctttccttcggtacgagatcttctagataccgcctcagctctgtatcgggaa
JN040810_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcttcagctctgtatcgggat
JN257169_C_P-D      tctgacttttttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
GU456641_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtttcgggaa
EU726911_C_P-D      gctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
EU726856_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
EU726857_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
EU726963_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
AY371911_C_P-D      tatgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
AY161159_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
AY161160_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
AY373431_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
AY371908_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtttcgggaa
JN257187_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JN257188_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KF584161_C_P-D      tctgacttctttccttccgtacraratcttctarataccgcctcagctctgtatcgggaa
KF584163_C_P-D      tctgacttctttccttccgtacraratcttctarataccgcctcagctctgtatcgggaa
KF584165_C_P-D      tctgacttctttccttccgtacraratcttctarataccgcctcagctctgtatcgggaa
KY382412_C_P-D      tctgacttctttccttccgtacgagatcttctagataccgcctcagctctgtatcgggaa
KF584162_C_P-D      tctgacttctttccttccgtacgagatcttctagataccgcctcagctctgtatcgggaa
KF584164_C_P-D      tctgacttctttccttccgtacgagatcttctagataccgcctcagctctgtatcgggaa
KF584166_C_P-D      tctgacttctttccttccgtacgagatcttctagataccgcctcagctctgtatcgggaa
KY382414_C_P-D      tctgacttctttccttccgtacgagatcttctagataccgcctcagctctgtatcgggaa
MN507853_C_P-D      tctgacttctttccttccgtacgagatcttctagataccgcctcagctctgtatcgggaa
MH724252_C_P-D      tctgacttctttccttcngtacgagatcttctagataccgcctcagctctgtatcgggaa
KP857094_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttgtatcgggaa
KP857045_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JN040824_C_P-D      tctgacttctttccttcagtacgagatcttctagacaccgcctcagctctgtatcgggaa
EU726919_C_P-D      tctgacttttttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JN040817_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JN040816_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
AF151735_C_P-D      tctgacttttttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JN040815_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JN257186_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JN257152_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JF754608_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
MK598647_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JN257201_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JN040813_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
EU726849_C_P-D      tctgacttctttccttcagtacgagatcttctagacaccgcctcagctctgtatcgggaa
JN040809_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgccgcagctctgtttcgggaa
JN040806_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JF754633_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JF754596_C_P-D      tctgacttctttccttcagtacgcgatcttctagataccgcctcagctctgtatcgggaa
FJ349233_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
EU726946_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttgtatcgggat
AY796030_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
AY371918_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
AB674426_C_P-D      tctgacttctttccttcagtacgtgatcttctagataccgcctcagctctgtatcgggaa
EU726845_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttgtaccgggaa
KC875289_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgccacagctctgtatcgggaa
KC875290_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgccacagctctgtatcgggaa
KX196209_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgccacagctctgtatcgggaa
KX196212_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgccacagctctgtatcgggaa
KC875296_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgccacagctctgtatcgggaa
KX196228_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgccacagctctgtatcgggaa
KC875298_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgccacagctctgtatcgggaa
KP857097_C_P-D      tcggacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JN257203_C_P-D      tctgacttctttccttcagtacgagatcttctagayaccgcctcagctctgtatcgggaa
AY741797_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
AB104712_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
AY661792_C_P-D      tctgacttctttccttcagtacgtgatcttctagataccgcctcagctctgtatcgggaa
AY661793_C_P-D      tctgacttctttccttcagtacgtgatcttctagataccgcctcagctctgtatcgggaa
EU726924_C_P-D      tctgacttctttccttccgtacgagatcttctagataccgcctcagctttgtatcgggaa
EU726935_C_P-D      tctgacttctttccttccgtacgagatcttctagataccgcctcagctttgtatcgggaa
JN257155_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JN257196_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JN257199_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JN040827_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
MK618427_C_P-D      tctgacttctttccttcagtacgcgatcttctagataccgcctcagctctgtatcgggaa
Y07587_C_P-D        tctgacttctttccttcagtacgtgatcttctagataccgcctcagctctgtatcgggaa
KP857100_C_P-D      tctgacttctttccttcagtacgtgatcttctagataccgcctcagctctgtatcgggaa
MK618428_C_P-D      tctgacttctttccttcagtacgtgatcttctagataccgcctcagctctgtatcgggaa
KC875306_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KC875305_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgccacagctctgtatcgggaa
KC875291_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KX196210_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KX196213_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KC875286_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KC875284_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KC875287_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KC875283_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KC875275_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KC875281_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KC875304_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KC875300_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KX196226_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KC875307_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JN040808_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
MK618437_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KP857099_C_P-D      tctgacttctttccttcagtacgtgatcttctagataccgcctcagctctgtatcgggaa
KM524339_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KC875308_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgccacagctctgtatcgggaa
KC875295_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KX196227_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JX310733_C_P-D      tctgacttctttccttccgtacgagatcttctagataccgcctcagctctgtatcgggaa
AB222713_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KC875309_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KC875279_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KC875278_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KC875276_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KX196214_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KC875277_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KC875280_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KC875282_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KX196215_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
MK618433_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttgtatcgggaa
MK618431_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttgtatcgggaa
MK618429_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttgtatcgggaa
KP671699_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctccgctctgtatcgggaa
KF471651_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KF471652_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KF471647_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KC875288_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KX196208_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KX196211_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KC875285_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KC875293_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KC875294_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JX310735_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JX310734_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JN040828_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JN040807_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttgtatcgggaa
MK618430_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttgtatcgggaa
MK618432_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttgtatcgggaa
JN040805_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JF754591_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
GQ477459_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
EU726931_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
EU726898_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JN040826_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
AY371902_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
AY371914_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
AY371921_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
AY721612_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
EF103277_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
AY371920_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JQ927384_C_P-D      tccgacttctttccttcrgcacgagatcttctagataccgcctcagctctgtatcgggat
KP168419_C_P-D      tcygacttctttccttcggcacgagatcttctagataccgcctcagctctgtatcgggat
GU456674_C_P-D      gctgacttctttccttcggtacgagatcttctagataccgccgccgctctgtatcgggat
EU726979_C_P-D      tctgacttctttccttccgtacgagatcttctagataccgccacagctctgtatcgggat
EU726933_C_P-D      catgacttctttccttccgtgcgagatcttctagataccgcctcagctctgtatcgagaa
JN257214_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JN257215_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
GU456666_C_P-D      gctgacttttttccttcggtaagagatcttctagataccgcctcagctctgtatcgggaa
MK355501_C_P-D      tctgacttctttccttccgtacgagatcttctagataccgcctcagctctgtatcgggaa
GU456669_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtttcgggat
JN040782_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
EU726938_C_P-D      tctgacttcttcccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JN040769_C_P-D      tctgacttctttccttcagtacgcgctcttctagataccgcctcagctctgtatcgggaa
EU726904_C_P-D      tctgacttctttccttccgtacgagatcttctagataccgcctcagctctgtatcgggaa
JN040775_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JN040762_C_P-D      gctgacttctttccttccgtacgagatcttctagataccgcctcagctctgtatcggggt
KF471642_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JN040768_C_P-D      gctgacttctttccttcggtacgagatcttctagataccgccacagctctgtatcgggaa
GU456659_C_P-D      catgacttctttccttcagtacgagatcttctagataccgcttcagctctgtatcgggaa
EU726932_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtttcgggat
EU726892_C_P-D      tctgacttttttccttcggtacgagatcttctagataccgcctcagctctgttccgggaa
JN642129_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggat
EU726969_C_P-D      tctgacttctttccttcggtacgagatcttctagataccgcctcagctctgtatcgggaa
GU456672_C_P-D      atggacttctttccttcggtacgagatcttctagataccgcctcagctctgtatcgggaa
KF471659_C_P-D      tctgacttctttccttcggtacgagatcttctagataccgcctcagctctgtatcgggaa
KP857116_C_P-D      actgacttctttccttcagtacgagatcttctagataccgcctcagctctgtttcgggaa
EU726859_C_P-D      gctgacttctttccttcagtacgagatctgctagataccgcctcagctctgtttcgggaa
EU726954_C_P-D      gctgacttctttccttcagttcgagatcttctagataccgcctcagctctgtttcgggaa
JN040770_C_P-D      gctgacttctttccttcagttcgagatcttctagataccgcctcagctctgtttcgggaa
GU456667_C_P-D      ggtgacttctttccttcggtacgagatcttctagataccgcctcagctctgtatcgggaa
EU726860_C_P-D      tctgacttctttccttcggtacgagatcttctagataccgcctcagctctgtttcgggaa
AY371916_C_P-D      tctgacttctttccttcggtacgagatcttctagataccgcctcagctttgtatcgggaa
AY371910_C_P-D      gctgacttctttccttcagtacgagatcttctagataccgcctcagctctatttcggcaa
JN040765_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtacagggaa
GU456676_C_P-D      tctgacttctttccttctgtacgagatcttctagataccgcctcagctctgtatcgggaa
EU726872_C_P-D      gctgacttctttccttcagtacgcgatcttctagataccgcctcagctctgtatcgggaa
EU726886_C_P-D      tcggacttctttccttcagtacgagatcttctagataccgcctcagctctgtttcgggaa
KF471658_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
GU456660_C_P-D      gctgacttctatccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
EU726950_C_P-D      caagacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
EU726865_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KF471654_C_P-D      gctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtttcgggaa
KF471644_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
EU726873_C_P-D      tctgacttctttccttcggtacgagatcttctagataccgcctcagctctgtatcgggaa
KF471641_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggat
GU456670_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KF471660_C_P-D      tctgacttcttcccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KF471645_C_P-D      tctgacttctttccttcggtacgagatcttctagacaccgcctccgctctgtatcgggaa
JN040767_C_P-D      tctgacttctttccttcagtacgagatcttctagacaccgcctcagctctgtatcgagaa
GU456671_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JN642155_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
KP671695_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
MH725098_C_P-D      tctgacttctttccttcagtacgagatcttctagatactgcctcagcgctatatcgggaa
MH725099_C_P-D      tctgacttctttccttcagtacgagatcttctagatactgcctcagcgctatatcgggaa
MH725100_C_P-D      tctgacttctttccttcagtacgagatcttctagatactgcctcagcgctatatcgggaa
MH725103_C_P-D      tctgactcctttccttcagtacgagatcttctagatactgcctcagcgctatatcgggaa
MH725165_C_P-D      tctgacttctttccttcagtacgagatcttctagatactgcctcagcgctatatcgggaa
MH725162_C_P-D      tctgacttctttccttcagtacgagatcttctagatactgcctcagcgctatatcgggaa
MH725160_C_P-D      tctgacttctttccttcagtacgagatcttctagatactgcctcagcgctatatcgggaa
MH725093_C_P-D      tctgacttctttccttcagtacgagatcttctagatactgcctcagcgctatatcgggaa
MH725091_C_P-D      tttgacttctttccttcagtacgagatcttctagatactgcctcagcgctatatcgggaa
MH725092_C_P-D      tttgacttctttccttcagtacgagatcttctagatactgcctcagcgctatatcgggaa
MH725104_C_P-D      tctgacttctttccttcagtacgagatcttctagatactgcctcagcgctatatcgggaa
MH725127_C_P-D      tctgacttctttccttcagtacgagatcttctagatactgcctcagcgctatatcgggaa
MH725163_C_P-D      tctgacttctttccttcagtacgagatcttctagatactgcctcagcgctatatcgggaa
AY741794_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
AY741795_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
AY741796_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JN040822_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KF471657_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KF471653_C_P-D      tctgacttctttccttcggtacgagatcttctagataccgcctcagctctgtatcggcaa
EU726930_C_P-D      tctgacttctttccttcggttcgagatcttctagataccgcctcagctctgtatcgggaa
EU726940_C_P-D      tctgacttctttccttcggttcgagatcttctagataccgcctcagctctgtatcgggaa
MH725152_C_P-D      tctgacttctttccttcggtacgagatcttctagataccgcctcagctctgtatcgggaa
KP671697_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KP671692_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KP671684_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JN040758_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgccttagctctgtatcgggaa
MK355500_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
MK693108_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KP671691_C_P-D      tctgacttttttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
MK693109_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KP671690_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KP671686_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KP671688_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KP671693_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KP671694_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KP671696_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JN257151_C_P-D      tctgacttctttccttcggtacgagatcttctagataccgcctcagctctgtatcgggaa
EU726971_C_P-D      tctgacttcttcccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
EU726972_C_P-D      tctgacttcttcccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
EU726937_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
EU726902_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
EU726895_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
EU726854_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
EU726869_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
EU726888_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
EU726894_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
EU726887_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
EU726976_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JN040759_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KP671685_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KP671687_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
FJ904435_C_P-D      tttgacttctttccttccgtwcgagattttttagattccgccttagctttgtatcgggat
FJ904433_C_C-D      tctgacttctttccttcagtacgggatcttctagataccgcctcagctctgtatcgggat
JN688712_C_P-D      tctgacttctttccttccatacgagatcttctagatacagccgcagctctgtatcgggat
JN688713_C_P-D      rctgacttctttcctwccgtacgagatcttctagataccgcctcagctctgtatcgggaa
GQ922000_C_P-D      catgacttctttccttcaatacgagatcttctagataccgccacagctctatatcgggaa
X85276_C_P-D        tccgacttctttctttcggtacgacatcttctagataccgccaaagctctgtttcaggac
X85268_C_P-D        gttgacttctttccttcagtacgagatcttcatgataccgccacagctctgtatcgggaa
JN664920_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JN688710_C_P-D      tccgacttctttcctgcagtacgagatcttctagataccgcctcagctctgtttcgggat
MH724248_C_P-D      tctgacttttttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JN688711_C_P-D      tctgacttctwtccttcggtacgagatcttctagataccgcctcagctctgtrtcgggaa
KJ647355_C_P-D      gctgacttctttccttcagttcgagattttctagataccgccaccgctttgtttcgggat
AF419527_C_P-D      tctgacttctttccttcggtacgagatctcttagataccgcctcagctctgtatcgggaa
KT749845_C_P-D      tctgacttctttccttcggtacgagatcttctagctaccgcccaagcgctgtatcgagat
AF419528_C_P-D      gctgacttctttccttcagtacgagatctcctagataccgccaaagctctgtttcgggaa
JN688683_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgccgcagctctgtttcgggat
X85263_C_P-D        actgacttctttccttcagtacgagatcttctagataccgccaaagctctgcttcgggac
MH724234_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctccgctctgtttcgggaa
X85270_C_P-D        tctgacttctttccttcagtacgagatcttctagataccgccgcagctctgtttcgggaa
MH724245_C_P-D      tttgacttctttccttcagtacgggatcttctagataccgcctcagctctgtatcgggaa
DQ464181_C_P-D      gctgacttctttccttcagtacgagatcttctagataccgcctcagctctatttcgggaa
KP857048_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JN688708_C_P-D      actgacttctttccttcagtacgagatcttctagataccgcctcagccctgtatcgggaa
JF754625_C_P-D      actgacttctttccttcggtacgagatcttctagataccgccaaagctctgtatcgggaa
FJ349213_C_P-D      ggtgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JN688678_C_P-D      tctgacttctttccttcaatacgagatcttctagataccgcctcagctctgtatcgggaa
AB270537_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
AF419521_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtttcgggaa
DQ464173_C_P-D      tctgacttctatccttcagtacaagatcttctagataccgccttagctctgtttcgggac
DQ329356_C_P-D      tctgacttctatccttcagtacgagatcttctagataccgcctcagctctgtttcgggaa
DQ464175_C_P-D      tctgacttctatccttcagtacgagatcttctagataccgcctcagctctgtttcgggaa
DQ464172_C_P-D      tctgacttctatccttcagtacgagatcttctagataccgccttagctctgtttcgggac
DQ336692_C_P-D      tctgacttccttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
DQ329357_C_P-D      tctgacttctatccttcagtacgagatcttctagataccgcctcagctctgtttcgggaa
DQ336691_C_P-D      tctgacttctatccttcagtacgcgatcttctagataccgcctcagctctgtttcgggac
DQ336690_C_P-D      tctgacttctatccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
AY236164_C_P-D      tctgaattctatccttcagtacgagatcttctagataccgcctcagctctgtttcgggaa
DQ486022_C_P-D      tctgaattctatccttcagtacgagatcttctagataccgcctcagctctgtttcgggaa
DQ336689_C_P-D      tctgacttctatccttcagtacgagatcttctagataccgcctcagctctgtttcgggaa
DQ464174_C_P-D      tctgacttctatccttcagtacgagatcttctagataccgcctcagctctgtttcgggaa
DQ464178_C_P-D      tctgacttctatccttcagtacgagatcttctagataccgcctcagctctgtttcgggaa
DQ336686_C_P-D      tctgacttctatccttcagtacgagatcttctagataccgcctcagctctgtttcgggac
DQ464176_C_P-D      tctgacttctatccttcagtacgagatcttctacataccgcctcagctctgtttcgggaa
DQ336687_C_P-D      tctgacttctatccttcagtacgcgatcttctagataccgcctcagctctgtttcgggac
DQ486021_C_P-D      tctgacttctatccttcagtacgagatcttctagataccgcctcagctctgtttcgggaa
DQ336685_C_P-D      tctgacttctatccttcagtacgagatcttctagataccgcctcagctctgtttcgggaa
DQ336677_C_P-D      tctgacttctatccttcagtacgagatcttctagataccgcctcagctctgtttcgggac
DQ336674_C_P-D      tctgacttctatccttcagtacgagatcttctagataccgcctcagctctgtttcgggaa
AY236160_C_P-D      tctgacttctatccttcagtacgagatcttctagataccgcctcagctctgtttcgggaa
DQ336675_C_P-D      tctgacttctatccttcagtacgagatcttctagataccgcctcagctctgtttcgggaa
DQ336676_C_P-D      tctgacttctatccttcagtacgagatcttctagataccgcctcagctctgtttcgggaa
DQ336678_C_P-D      tctgacttctatccttcagtacgagatcttctagataccgcctcagctctgtttcgggaa
DQ336679_C_P-D      tctgacttctatccttcagtacgagatcttctagataccgcctcagctctgtttcgggaa
DQ464177_C_P-D      tctgacttctatccttcagtacgagatcttctagataccgcctcagctctgtttcgggaa
KM524361_C_P-D      tctgatttctttccgtctgtacgcgatcttctagataccgccgcagctctgtatcgggaa
MF488704_C_P-D      tctgatttctttccgtctgtccgagatcttctagataccgccgcagctctgtatcgggaa
MH724224_C_P-D      tctgacttttttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
MH724235_C_P-D      actgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KP857042_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
X85280_C_P-D        tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
MH724237_C_P-D      tctgacttctttccttcaatacgagatcttctagataccgcctcagctctgtaccgggat
KU736927_C_P-D      tctgacttctttcctwcagtacgagatcttctagataccgcctcagctctgtttcgggaa
AF419523_C_P-D      tctgacttctttccttcaatacgagatcttctagataccgcctcagctctgtttctgcaa
KP857047_C_P-D      tctgacttctttccttcggtacgagatcttctagataccgcctcagctctatatcgggaa
MH724230_C_P-D      tctgacttttttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KU668434_C_P-D      tctgacttctttccgtctattcgggacctcctagacaccgcctctgctctgtatcgggag
KJ647353_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtttcgggaa
JN688679_C_P-D      gttgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggat
HQ236015_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JN664909_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KF192830_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KF192831_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KF192832_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KF192834_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
X85269_C_P-D        tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtttcgggaa
MH724227_C_P-D      tctgacttttttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
MH724228_C_P-D      tctgacttttttccttcagtacgagatcttctagattccgcctcagctctgtatcgggaa
X85261_C_P-D        tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtttcgggat
MH724229_C_P-D      tctgacttttttccttcngtacgagatcttctagataccgcctcagctctgtatcgggaa
JN688685_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggat
X85264_C_P-D        tctgacttctttccttcagtacgagatcttctagataccgccgcagctctgtatcgggaa
FJ349211_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctccgctctgtatcgggaa
DQ486025_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KU736926_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
X85260_C_P-D        tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtttcgggat
FJ349214_C_P-D      tctgacttctttccttcggtacgagatcttctagataccgcctcagctctgtttcgggaa
JN688722_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
X85301_C_P-D        tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KF779219_C_P-D      tctgacttctttcattcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KF779223_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggat
JF439700_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JF439701_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KF779218_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KJ843187_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
EU185779_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JX470760_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KC012652_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KX827292_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KF779224_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JF439712_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KF779301_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KF779289_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KF779209_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KF779212_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KF779285_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KF779288_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KF779296_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KF779302_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KF779303_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KF779318_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KF779340_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KF779292_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KF779341_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KF779376_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KF779377_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JF439718_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JF439692_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JF439699_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JF439703_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JF439696_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KF779222_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KF779216_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
MK618441_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
AJ131956_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
MK618443_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JX898689_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JX898691_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JX898692_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JX898694_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JX898697_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KF779229_C_P-D      tctgacttctttccttccgtacgagatcttctagataccgcctcagctctgtatcgggat
KF779225_C_P-D      tctgacttctttcattcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KF779230_C_P-D      tctgacttctttccttccgtacgagatcttctagataccgcctcagctctgtatcgggaa
KF779217_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KF779228_C_P-D      tctgacttctttccttccgtacgagatcttctagataccgcctcagctctgtatcgggaa
JF439695_C_P-D      actgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JF439704_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JF439705_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
X85254_C_P-D        tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
MH724225_C_P-D      tctgacttttttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KP857110_C_P-D      cctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
MN507852_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
HQ236014_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
HQ236016_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
MH724242_C_P-D      tctgacttctttccttcactacgagatcttctagataccgcctcagctctgtatcgggaa
MH724232_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtttcgggat
MH724226_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JN664910_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggat
EU594434_C_P-D      tctgacttctttccttcggtacgagatcttctagataccgcctcagctctgtatcgggaa
EU155895_C_P-D      tctgacttcttcccttcggttcgagatcttctagataccgcctcagctctgtatcgggaa
EU155893_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
EU414057_C_P-D      tctgacttctttccttcggtacgagatcttctagataccgcctcagctctgtatcgggaa
EU414143_C_P-D      tctgacttctttccttcggtacgagatcttctagataccgcctcagctctgtatcgggaa
MH724233_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgggaa
KM524356_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttgtatcgggaa
AF419540_C_P-D      tctgacttctttccttcaatacgagatcttctagataccgcctcagctctgtatcgggat
AF419542_C_P-D      tctgacttctttccttcaatacgagatcttctagataccgcctcagctctgtatcgggat
X85318_C_P-D        tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
X65258_C_P-D        tctgacttctttccttccgtacgagatctcctagacaccgcctcagctctgtatcgggaa
MK598658_C_P-D      tctgacttctttccttcggtacgagatcttctagataccgcctcagctctgtatcgggaa
GQ922001_C_P-D      tctgacttctttccttcagtgcgagatcttctagataccgcctcagctctgtatcgggaa
DQ464170_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JN257181_C_P-D      tctgatttctttccttcggtacgagatcttctagataccgcctcagctctgtatcgggaa
KC875326_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgccacagctctgtatcgggaa
KC875330_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgccacagctctgtatcgggaa
KC875329_C_P-D      tctgacttctttctttcagtacgagatcttctagataccgccacagctctgtatcgggaa
KX196235_C_P-D      tctgacttctttctttcagtacgagatcttctagataccgccacagctctgtatcgggaa
KC875328_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgccacagctctgtatcgggaa
JN664947_C_P-D      actgacttctttccttcggtacgagatcttctagataccgcctcagctctgtatcgggaa
JN664912_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
DQ336688_C_P-D      tctgacttccttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KP090178_C_P-D      tctgacttctttccttccgtacgagatcttctagataccgcctcagctctgtatcgggaa
KP090177_C_P-D      tctgacttctttccttccgtacgagatcttctagataccgcctcagctctgtatcgggaa
MH724219_C_P-D      tctgacttctttccttccgtacgagatcttctagataccgcctcagctctgtatcgggaa
MH724218_C_P-D      tctgacttctttccttccgtacgagatcttctagataccgcctcagctctgtaccgggaa
MH724214_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
MH724221_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KP090179_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagccctgtatcgggaa
MH724249_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
MH724250_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
MH724215_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggat
MH724220_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggat
KM606745_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
GQ922002_C_P-D      tctgacttctttccttcagtgcgagatcttctagataccgcctcagctctgtatcgggaa
DQ464168_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggag
AM422939_C_P-D      tctgacttctttccttcagtacgaggtcttctagataccgcctcagctctgtatcgggaa
KC875333_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KC875335_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KX196218_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KX196230_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KU668444_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KP090181_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KC875337_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KX196220_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KX196232_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KC875334_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KX196221_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KX196233_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KC875331_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KC875324_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KC875315_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KC875314_C_P-D      tctgacttctttcctccagtacgagatcttctagataccgcctcagctctgtatcgggaa
FJ349232_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
FJ349209_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
DQ464169_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggag
AY230114_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KC875322_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KC875323_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KX196224_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KX196225_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KC875318_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KC875320_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KX196217_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JN664938_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KU668437_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
MF618343_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KU668447_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KU668441_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KU668439_C_P-D      cctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
GQ205388_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
AY230112_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
DQ315776_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JN664911_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JN664913_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JN664917_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JN664937_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KM524349_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KM524350_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KU668436_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KU668438_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KU668446_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
MF618339_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
MF618340_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
MF618341_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
V01460_C_P-D        tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KC875325_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KC875317_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KX196222_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KX196234_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KC875316_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KC875313_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KC875319_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KC875321_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KC875332_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KC875336_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KX196216_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KX196219_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KX196231_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
LT992438_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
FJ692506_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
FJ692507_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KP090180_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
AB048701_C_P-D      tctgacttctttccttccgtacgagatcttctagacaccgcaacagctctgtatcgggat
KJ470895_C_P-D      actgacttctttccttccgtccgagatctactagataccgcaacagcgctgtttcgggat
MH724251_C_P-D      tctgacttctttccttccgtccgagatctactagataccgctgcagcgctgtatcgggat
KJ470894_C_P-D      tctgacttctttccttccgtccgagatctactagataccgctgcagcgctgtatcgggat
KJ470885_C_P-D      actgacttctttccttccgtccgagatctactagacaccgctgcagcgctgtatcgggat
KJ470889_C_P-D      tctgacttctttccttccgtccgagatctactagatactgctgcagcgctgtatcgggat
KJ470893_C_P-D      tctgacttctttccttccgtccgagatctactagataccgctgcagcgctgtttcgggat
KJ470896_C_P-D      tctgacttctttccttccgtccgagatctactagataccgctgcagcgctgtttcgggat
GQ922005_C_P-D      gctgacttttttccttccatacgagatcttctagataccgccgcagctctgtttcgggat
GQ922003_C_P-D      caagacttttttccttccgtacgmgatcttctagataccgccgcagctctgtatcggaat
GQ922004_C_P-D      gctgacttttttccttccgtacgagatcttctagataccgccacagctctgtatcgagat
KM606754_C_P-D      tctgacttttttccttccgtgcgagatcttctagataccgccgcagctctgtatcgggat
HQ700458_C_P-D      tctgacttctttccttccgtacgagatcttctagataccgccgcggctctgtatcgggat
KF779382_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgccgcggctctgtatcgggat
AJ627219_C_P-D      gctgacttctttccttccgtacgagatcttctagataccgccacagctctgtatcggaat
KM606655_C_P-D      tctgacttctttccttccgtgcgagatcttctagataccgccgcagctctgtatcgggat
KM606698_C_P-D      tctgacttctttccttccgtgcgagatctcctagataccgccgcagctctgtatcgggat
KM606645_C_P-D      tctgacttctatccttccgtgcgagatcttctagataccgccacagctctgtatcgagat
KM606675_C_P-D      tctgacttctttccttccgtgcgagatcttctggataccgccgcagctctgtatcgggat
FJ692532_C_P-D      tctgacttctttccttccgtacgagatcttctagataccgccgcagctctgtatcgggat
FJ692533_C_P-D      tctgacttctttccttccgtacgagatcttctagataccgccgcagctctgtatcgggat
KM606682_C_P-D      tctgacttctttccttccgtgcgagatcttctagataccgccgcagctctgtatcgggat
KM606654_C_P-D      actgacttctttccttccgtgcgagatcttctagataccgccgcagctctgtatcgggat
KM606752_C_P-D      tctgacttctttccttccgtgcgagatcttctagataccgccgcagctctgtatcgggat
KM606690_C_P-D      tctgacttctttccttccgtgcgagatcttctagataccgccgcagctctgtatcgggat
KM606686_C_P-D      tctgacttctttccttccgtgcgagatcttctagataccgccgcagctctgtatcgggat
KM606697_C_P-D      tctgacttctttccttccgtgcgagatcttctagataccgccgcagctctgtatcgggat
KM606644_C_P-D      tctgacttctttccttccgtgcgagatcttctagataccgccgcagctctgtatcgggat
KM606744_C_P-D      tctgacttctttccttccgtgcgagatcttctagataccgccgcagctctgtatcgggat
KM606664_C_P-D      tctgacttctttccttccgtgcgagatcttctagataccgccgcagctctgtatcgggat
KM606670_C_P-D      actgacttctttccttccgtgcgagatcttctagataccgccgcagctctgtatcgggat
KM606755_C_P-D      tctgacttctttccttccgtgcgagatcttctagataccgccgcagctctgtatcgggat
JN664924_C_P-D      tctgacttcttcccgtctgtacgggacctcctcgacaccgcctctgctctatatcgggat
KM577670_C_P-D      actgacttctttccttcactacgagatctgctagataccgcctcagctctctatcggcaa
KJ647350_C_P-D      tctgacttttttccttcagtacgagatcttttagataccgcctcagctctctatcgggaa
GQ477453_C_P-D      gctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgggat
JN642144_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggat
FJ904438_C_P-D      tctgacttctttccatcagtacgagatcttctagataccgcctcagctctgtatcgggat
GQ477456_C_P-D      tctgacttctttcctacagtacgagatcttctagataccgcctcagctctctatcgggaa
AY090452_C_P-D      tctgacttctttccttccgcacgagatcttctagataccgccgcagctctctatcgggaa
MF925366_C_P-D      tctgatttctttccgtctgtacgagatcttctagacaccgccgcagctctatttcgggat
KJ647352_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgggaa
KM577669_C_P-D      ggcgactactttccttcagtacgagatcttctagataccgcctcagctctgtatcgggat
AB188241_C_P-D      tctgacttctttccatcagtacgagatcttctagataccgcctcagctctmtatcgggaa
KP857041_C_P-D      gctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgggat
JN642162_C_P-D      gcggacttctttcctccagtacgagctcttctagataccgcccaagctctgtatcgggat
EU726871_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
JN664932_C_P-D      tctgatttctttccgtctgtgcgggatcttctcgacaccgccgcagctctgtatcgggat
KP856990_C_P-D      gccgacttctttccttcagtacgagatttgctagataccgcctcagctctgtttcgggat
AJ627222_C_P-D      gccgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgggaa
KX260231_C_P-D      actgacttctttcctgcagtacgagatcttctagataccgcctcagctctctatcgggaa
AB210820_C_P-D      tctgacttctttccttcagtacgggatcttctagataccgcctcagctctctatcgggaa
JN642163_C_P-D      gctgacttctttccttcagtacgagatcttctagataccgcctcagcattgtatcgggaa
JN642148_C_P-D      tcggacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggat
JN257190_C_P-D      tctgacttctttccttcagtacgagatcttctrgataccgcctcagcactgtatcgggat
AB555496_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttgtatcgggaa
KM577668_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggat
JN642159_C_P-D      ggtgacttctttccttcaatacgagatcttctagataccgcctcagctctgtttcgggat
KM577671_C_P-D      gctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtttcgggat
AB555501_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttgtatcgggaa
MH724238_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcngctctcgttcgggaa
JN792904_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggac
KC875342_C_P-D      tccgatttctttccgtctgtccgagatcttctagataccgcctcagcgctatatcgggat
KX196229_C_P-D      tccgatttctttccgtctgtccgagatcttctagataccgcctcagcgctatatcgggat
KC875340_C_P-D      tccgatttctttccgtctgtccgagatcttctagataccgcctcagcgctatatcgggat
KC875341_C_P-D      tccgatttctttccgtctgtccgagatcttctagataccgcctcagcgctatatcgggat
KM524340_C_P-D      tctgatttctttccgtctgtccgagatcttctagataccgccgcagctttatatcgggat
GQ205389_C_P-D      tctgacttctttccgtcagtacgagatcttctagataccgcctcagctctatatcgggaa
GQ205382_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
MF618342_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KU668433_C_P-D      tctgatttctttccgtctgtccgagatcttctagataccgccgcagcgctatatcgggat
KU668435_C_P-D      tctgatttctttccgtcagtccgagatcttctagataccgcctcagctctatatcgggat
GQ205384_C_P-D      tctgatttctttccgtctgtacgagatcttctagataccgccgcagctctatatcgggat
KM524345_C_P-D      tctgatttctttccgtctgtacgagatcttctagataccgccgcagctctgtatcgggat
JN664926_C_P-D      tctgatttctttccgtctgttcgagatcttctagataccgccgcagctctatatcgggat
JN792911_C_P-D      tctgacttctttccttcagtacgggatcttctagataccgcctcagctctatatcgggac
JN792912_C_P-D      tctgacttctttccttcagtacgggatcttctagataccgcctcagctctatatcgggac
AF419537_C_P-D      gctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgggaa
AF419538_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgggat
AB555497_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttgtatcgggaa
KP856981_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctttcgggat
JN257178_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggat
KP856989_C_P-D      tctgacttctttccttcagtacgagatctgctagataccgcctcagctctgtatcggaat
GQ477452_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctttcgggat
KX357637_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KX357638_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KU736924_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KU736925_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KX357639_C_P-D      cctgacttctttccttcaatacgagatcttctagataccgcctcagctctgtatcgggaa
GU456635_C_P-D      gctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggac
AF043593_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctttcgggat
MK598679_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctttcgggat
MK598678_C_P-D      catgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgggaa
MK598676_C_P-D      catgacttctttccttcagtacgagatcttctagataccgcctcagctctctttcgggat
AF043594_C_P-D      catgacttctttccttcagtacgagatcttctagataccgcctcagctctctttcgggat
MK598677_C_P-D      catgacttctttccttcagtacgagatcttctagataccgcctcagctctctttcgggat
GQ477454_C_P-D      tctgacttctttccttcagtacgagatctgctagataccgcctcagctctgtatcgggat
EU594404_C_P-D      tctgacttctatccttcagtacgagatcttctagataccgcctcagctctctatcgggaa
MH724241_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctttcgggaa
LT992439_C_P-D      tctgatttctttccgtctgtacgagatcttctagataccgcctcagctctgtatcgggaa
JN642143_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagcactgtatcgggat
JN792905_C_P-D      gctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggac
JN792906_C_P-D      gctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggac
JN664936_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
EU594398_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctttcgggaa
MK598674_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctttcgggaa
X85279_C_P-D        tctgacttctttccttcagtacgagatcttctagataccgccaaagctctgtttcgggaa
KP857043_C_P-D      tctgacttctttcctgcagtacgagatcttctagataccgcctcagctctctatcgggaa
AF419512_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgggaa
AB270539_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctatatcgggaa
AB188242_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgggaa
HQ700510_C_P-D      tctgacttctttccttcaatacgagatcttctagataccgcctcagctctctatcgggaa
JN792908_C_P-D      attgacttctttccttcaatacgagatcttctagataccgcctcagctctgtatcgggac
KF922432_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggat
AY603445_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgggaa
AY603433_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgggaa
MK598670_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggat
FJ349218_C_P-D      tctgacttctttccttcagtacgagatctgctagataccgcctcagctctgtatcgggat
AB205127_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggat
MK598659_C_P-D      tctgacttctttccttcagtacgagatctgctagataccgcctcagctctgtatcgggat
JN792907_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggac
JN792909_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggac
JN792910_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggac
JN792903_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggac
MH724247_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgggaa
KC774436_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgccgcagccctgtatcgggaa
KC774460_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgccgcagccctgtatcgggaa
MH724244_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgggaa
KX827290_C_P-D      tctggcttttttccttccgtacgagatcttctagataccgcctcagctctctatcgggaa
KX827301_C_P-D      tctgacttttttccttccgtacgagatcttctagataccgcctcagctctctatcgggaa
KF779220_C_P-D      tctgacttttttccttcagtacgagatcttctagataccgcctcagctctctatcgggaa
AY603443_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgggaa
EU594411_C_P-D      tctgacttctttccttcggtacgagatcttctagataccgcctcagctctctatcgggaa
EU594412_C_P-D      tctgacttctttccttcggtacgagatcttctagataccgcctcagctctctatcgggaa
EU414058_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgggaa
AY603439_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgggaa
MK618426_C_P-D      tctgacttctttccttccgtacgagatcttctagataccgcctcagctctctatcgggaa
EU594422_C_P-D      tctgacttctttccttcagtacgagctcttctagataccgcctcagctctctatcgggaa
JX096955_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgggaa
EU594408_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgggaa
MK618418_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgggaa
AY603434_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgggaa
MK598667_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgagaa
MK598672_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgagaa
AY603440_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgggaa
AY603437_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgggaa
AY603428_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgggaa
EU414060_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgggaa
EU414140_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgggaa
EU594423_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgggaa
EU594428_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgggaa
JX096956_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgggaa
MK598675_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgggaa
MK618420_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgggaa
Z35716_C_P-D        tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgggaa
MK618419_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgggaa
EU594415_C_P-D      tctgacttctttccttccgtacgagatcttctagataccgcctcagctctctatcgagaa
MK598669_C_P-D      tctgacttctttccttcagtacgcgatcttctagataccgcctcagctctctatcgagaa
MK598673_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgagaa
MK598666_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgggaa
JX096958_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgagaa
EU594421_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgagaa
EU594400_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgagaa
EU594401_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgagaa
EU594402_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgagaa
EU594403_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgagaa
EU594405_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgagaa
EU594409_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgagaa
EU594410_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgagaa
EU594416_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgagaa
EU594431_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgagaa
EU594432_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgagaa
MK598671_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgagaa
MK618422_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgagaa
EU594407_C_P-D      tctgacttctttccttcagtacgcgatcttctagataccgcctcagctctctatcgagaa
EU594427_C_P-D      tctgacttctttccttcagtacgcgatcttctagataccgcctcagctctctatcgagaa
MK618421_C_P-D      tctgacttctttccttcagtacgcgatcttctagataccgcctcagctctctatcgagaa
MH724246_C_P-D      tctgacttctttccttcactacgagatcttctagataccgcctcagctctctatcgggaa
MH724216_C_P-D      tctgacttctttccttcggtacgacatcttctagataccgcctcagctctctatcgggaa
JN664914_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
EU594426_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgggaa
AB205128_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgggaa
EU414061_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgggaa
EU414138_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgggaa
KP857111_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgggaa
LT992454_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
EU594399_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgggaa
AY603427_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgggaa
AF324138_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
EU594424_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgggaa
MH724217_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgggaa
MH724223_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgggaa
MH724231_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgggaa
EU594425_C_P-D      tctgacttctttccttcggtacgagatcttctagataccgcctcagctctctatcgggaa
EU594430_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgggaa
EU594433_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgggaa
JX096954_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgggaa
JX096957_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgggaa
AB330369_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgagaa
AB330370_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgagaa
HQ700512_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgggaa
HQ700513_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgggaa
HQ700514_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgggaa
HQ700511_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
MN507837_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KP322601_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
AJ627223_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgggaa
AJ627220_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgggaa
MK598662_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgggaa
MK598668_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctctatcgggaa
MH464838_C_P-D      gctgacttctttccttcagtacatgaccttctagataccgccaaagctctgtatcgggat
AF419539_C_P-D      tctgacttctttccttcggtacgagatcttctagataccgcctcagctctgtatcgggat
X80927_C_P-D        catgacttctttccttcgctacgagatcttctagataccgcctcagctctgtatcgggat
X80928_C_P-D        catgacttctttccttcgctacgagatcttctagataccgcctcagctctgtatcgggat
X97849_C_P-D        catgacttctttccttcgctacgagatcttctagataccgcctcagctctgtatcgggat
MK052972_C_P-D      gctgacttctttcctacagtacgagatcttctagataccgcctcagctctgtatcgggaa
MK052947_C_P-D      gctgactcctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
MK052952_C_P-D      gctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
MK052973_C_P-D      tctgacttctttccttcaatacgagatcttctagataccgcctcagctctgtatcgggaa
MK052975_C_P-D      tctgacttctttccttcaatacgagatcttctagataccgcctcagctctgtatcgggaa
MK052974_C_P-D      tctgacttctttccttcaatacgagatcttctagataccgcctcagctctgtatcgggaa
MK052954_C_P-D      tctgacttctttccttcaatacgagatcttttagataccgcctcagctctgtatcgggaa
MK052948_C_P-D      tctgacttctttccttcaatacgagatcttctagataccgcctcagctctgtatcgggaa
MK052949_C_P-D      tctgacttctttccttcaatacgagatcttctagataccgcctcagctctgtatcgggaa
MK052961_C_P-D      tctgacttctttccttcaatacgagatcttctagataccgcctcagctctgtatcgggaa
MK052951_C_P-D      tctgacttctttccttcaatacgagatcttctagataccgcctcagctctgtatcgggaa
MK052959_C_P-D      tctgacttctttccttcaatacgagatcttctagataccgcctcagctctgtatcgggat
MK052953_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
MK052958_C_P-D      tctgacttctttccttcaatacgagatcttctagataccgcctcagctctgtatcgggat
MK052955_C_P-D      tctgacttctttccttcaatacgagatcttctagataccgcctcagctctgtatcgggat
MK052950_C_P-D      tctgacttctttccttcaatacgagatcttctagataccgcctcagctctgtatcgggat
MK052956_C_P-D      tctgacttctttccttcaatacgagatcttctagataccgcctcagctctgtatcgggat
MK052960_C_P-D      tctgacttctttccttcaatacgagatcttctagataccgcctcagctctgtatcgggaa
MK052963_C_P-D      tctgacttctttccttcaatacgagatcttctagataccgcctcagctctgtatcgggaa
MK052966_C_P-D      tctgacttctttccttcaatacgagatcttctagataccgcctcagctctgtatcgggaa
MK052971_C_P-D      tctgacttctttccttcaatacgagatcttctagataccgcctcagctctgtatcgggaa
MK541688_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttgtatcgggat
JN040830_C_P-D      tctgacttctttccttcagtacgggatcttctagataccgcctcagctctgtttcgggat
AF419529_C_P-D      tctgacttctttccttcggtacgagatcttctagataccgcctcagctctgtatcgggat
JF754597_C_P-D      tctgacttctttccttcggtacgagatcttctagataccgcttcagctctgtatcgggag
JF754621_C_P-D      tctgacttctttccttcggtacgagatcttctagataccgcctcagctctgtttcgggat
AY796031_C_P-D      tctgacttctttccttcggtacgagatcttctagataacgcctcagctctgtatcgggat
X97848_C_P-D        tctgacttctttccttcggtacgagatcttctagataccgcctcagctctgtatcgggat
AF419532_C_P-D      tctgacttctttccttcggtacgagatcttctagataccgcctcagctctgtatcgggat
FJ349208_C_P-D      gctgacttctttccttcggtacgagatcttctggataccgcctcagctctgtttcgggat
FJ349205_C_P-D      tctgacttctttccttcggtacgagatcttctagataccgcctcagctctgtatcgggat
KT749828_C_P-D      actgacttctttccttcggtacgagatcttctagataccgcctcagctctgtatcgggat
KT749827_C_P-D      tctgacttctttccttcggtacgagatcttctagataccgcctcagctctgtatcgggat
JQ687530_C_P-D      tctgacttctttccttcggtacgagatcttctagataccgcctcagctctgtatcgggat
GQ477455_C_P-D      tctgacttctttccgtcggtacgacatcttctagataccgcctcagctctgtttcgggat
GQ477457_C_P-D      tctgacttctttccgtcggtacgagatcttctagataccgcctcagctctgtatcgggat
AF419526_C_P-D      tctgacttctttccttcggtacgagatcttctagataccgcctcagctctgtatcgggat
FJ349206_C_P-D      tctgacttctttccttcggtacgagatcttctagataccgcctcagctctgtatcgggat
KT749821_C_P-D      tctgacttctttccttcggtacgagatcttctagataccgcctcagctctgtatcgggat
X72702_C_P-D        tctgacttttttccttcggtacgagatcttctagataccgcctcagctctgtatcgggat
EU414059_C_P-D      tctgacttctttccttcggtacgagatcttctagataccgcctcagctctgtatcgggat
EU414139_C_P-D      tctgacttctttccttcggtacgagatcttctagataccgcctcagctctgtatcgggat
MK598660_C_P-D      tctgacttctttccttcggtacgagatcttctagataccgcctcagctctgtatcgggat
MK598661_C_P-D      tctgacttctttccttcggtacgagatcttctagataccgcctcagctctatatcgggat
KF679990_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggat
DQ399006_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttgtaccgggat
MH724236_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctttgtatcgggat
EU921419_C_P-D      tctgacttctttccttcggtacgagatcttctagataccgcctcagctctatatcgggat
EU921418_C_P-D      tctgatttctttccttcggtacgagatcttctagataccgcctcagctctgtatcgggac
KP857046_C_P-D      aatgacttctttccttcagtacgagatcttctagataccgcctcagctctgtttcgggac
AB355452_C_P-D      tctgacttctttccttcggttcgagatcttctagataccgcctcagctttgtatcgggaa
AB355456_C_P-D      tctgacttctttccttcggtacgagatcttctagataccgcctcagctctgtatcgggaa
AB493846_C_P-D      tctgacttctttccttcggttcgagatcttctagataccgcctcagctctgtatcgggaa
MH464840_C_P-D      tctgacttctttccttcagtacgtgaccttctagataccgcctcagctctgtatcgggaa
MH464842_C_P-D      tctgacttctttccttcagtacgtgaccttctagataccgcctcagctctgtatcgggaa
MH464843_C_P-D      tctgacttctttccttcagtacgtgaccttctagataccgcctcagctctgtatcgggac
MH464844_C_P-D      tctgacttctttccttcagtacgtgaccttctagataccgcctcagctctgtatcgggac
AY233296_C_P-D      tctgacttctttccttcagtacgtggccttctagataccgcctcagctctgtatcgggaa
MH464848_C_P-D      tctgacttctttccttcagtacgtgacctcctagataccgcctcagctctgtatcgggaa
MH464849_C_P-D      tctgacttctttccttcagtacgtgaccttctagataccgcctcagctctgtatcgggaa
AY233292_C_P-D      tctgacttctttccttcggtccgtggccttctagataccgcctcagctctgtatcgggaa
AY233294_C_P-D      tctgacttctttccttcagtacgtggccttctagataccgcctcagctctgtatcgggaa
MH464833_C_P-D      tctgacttctttccttcagtacgtgaccttctagataccgcctcagctctgtatcgggaa
MH464845_C_P-D      tctgacttctttccttcagtacgtgaccttctagataccgcctcagctctgtatcgggaa
MH464836_C_P-D      tctgacttctttccttcagtacgtgaccttctagataccgcctcagctctgtatcgggaa
MH464831_C_P-D      tctgacttctttccttcagtacgtgaccttctagataccgcctcagctctgtatcgggaa
KT347090_C_P-D      tctgacttctttccttcagtacgtgaccttctagataccgcctcagctctgtatcgggaa
KM519455_C_P-D      tctgacttctttccttcagtacgtgaccttctagataccgcctcagctctgtatcgggaa
AY233291_C_P-D      tctgacttctttccttcagtacgtgaccttctagataccgcctcagctctgtatcgggaa
MH464847_C_P-D      tctgacttctttccttcagtacgtgaccttctagataccgcctcagctctgtatcgggaa
MH464832_C_P-D      tctgacttctttccttcagtacgtgaccttctagataccgcctcagctctgtatcgggaa
MH464854_C_P-D      tctgacttctttccttcagtacgtgaccttctagataccgcctcagctctgtatcgggaa
MH464834_C_P-D      tctgacttctttccttcagtacgtgaccttctagataccgcctcagctctgtatcgggaa
EU939680_C_P-D      tctgacttctttccttcggtacgagatcttctagataccgcctcagctctgtatcgggat
EU414055_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggat
EU414142_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggat
MK507912_C_P-D      tctgacttctttccttcagtacgagaccttctagataccgcctcagctctgtatcgggat
KC774437_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggat
EU414056_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcarctctgtatcgggat
EU414141_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcarctctgtatcgggat
KF679989_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggat
MK598657_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggat
GQ183485_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggat
GQ183478_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggat
MK598655_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggat
EU594382_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggat
MK598651_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggat
KF779214_C_P-D      tctgacttctttccttcagtccgagatcttctagacaccgcctcagctctgtatcgggat
KF679992_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggat
KF679993_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggat
KF798282_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggat
KF798306_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggat
KT366497_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggat
KT366507_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggat
X65257_C_P-D        tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggat
FJ562338_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggat
HM750151_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggat
KX276856_C_P-D      tctgacttcttcccgtcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
JN688695_C_P-D      tctgacttctttccttcaatacgagatcttttagataccgcctcagctctgtatcgggaw
KX276857_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgccwcagctctgtatcgggaa
JN664941_C_P-D      tctgacttctttccttcagtacgagatcttcttgctaccgcctcagctctctatcgggaa
KU668448_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
AF324111_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
JQ707704_C_P-D      gctgacttttttccttcagtacgagatcttcttgataccgcctcagctctctatcgggaa
JQ707702_C_P-D      gctgacttttttccttcagtacgagatcttcttgataccgcctcagctctctatcgggaa
JQ707696_C_P-D      gctgacttttttccttcagtacgagatcttcttgataccgcctcagctctctatcgggaa
JQ707695_C_P-D      gctgacttttttccttcagtacgagatcttcttgataccgcctcagctctctatcgggaa
JQ707689_C_P-D      gctgacttttttccttcagtacgagatcttcttgataccgcctcagctctctatcgggaa
JQ707682_C_P-D      gctgacttttttccttcagtacgagatcttcttgataccgcctcagctctctatcgggaa
JQ707683_C_P-D      gctgacttttttccttcagtacgagatcttcttgataccgcctcagctctctatcgggaa
JQ707684_C_P-D      gctgacttttttccttcagtacgagatcttcttgataccgcctcagctctctatcgggaa
JQ707685_C_P-D      gctgacttttttccttcagtacgagatcttcttgataccgcctcagctctctatcgggaa
JQ707687_C_P-D      gctgacttttttccttcagtacgagatcttcttgataccgcctcagctctctatcgggaa
JQ707688_C_P-D      gctgacttttttccttcagtacgagatcttcttgataccgcctcagctctctatcgggaa
JQ707690_C_P-D      gctgacttttttccttcagtacgagatcttcttgataccgcctcagctctctatcgggaa
JQ707691_C_P-D      gctgacttttttccttcagtacgagatcttcttgataccgcctcagctctctatcgggaa
JQ707692_C_P-D      gctgacttttttccttcagtacgagatcttcttgataccgcctcagctctctatcgggaa
JQ707693_C_P-D      gctgacttttttccttcagtacgagatcttcttgataccgcctcagctctctatcgggaa
JQ707694_C_P-D      gctgacttttttccttcagtacgagatcttcttgataccgcctcagctctctatcgggaa
JQ707697_C_P-D      gctgacttttttccttcagtacgagatcttcttgataccgcctcagctctctatcgggaa
JQ707698_C_P-D      gctgacttttttccttcagtacgagatcttcttgataccgcctcagctctctatcgggaa
JQ707699_C_P-D      gctgacttttttccttcagtacgagatcttcttgataccgcctcagctctctatcgggaa
JQ707700_C_P-D      gctgacttttttccttcagtacgagatcttcttgataccgcctcagctctctatcgggaa
JQ707701_C_P-D      gctgacttttttccttcagtacgagatcttcttgataccgcctcagctctctatcgggaa
JQ707703_C_P-D      gctgacttttttccttcagtacgagatcttcttgataccgcctcagctctctatcgggaa
JQ707705_C_P-D      gctgacttttttccttcagtacgagatcttcttgataccgcctcagctctctatcgggaa
JQ707706_C_P-D      gctgacttttttccttcagtacgagatcttcttgataccgcctcagctctctatcgggaa
JQ707686_C_P-D      gctgacttttttccttcagtacgagatcttcttgataccgcctcagctctctatcgggaa
KM524358_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtttcgggaa
AB109478_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggat
MF925379_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctttgtttcgggat
AB119255_C_P-D      tctgacttctttccttcaatacgagatcttcttgatactgcctcagctctgtatcgggaa
MK598664_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
AB119256_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
AB119254_C_P-D      tctgacttctttccttcggtacgagatcttcttgataccgcctcagctctgtatcgggaa
GQ924652_C_P-D      tctgacttctttccttcagtacgggatcttcttgataccgcctcagctctgtatcgggaa
AY090453_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
MF925390_C_P-D      tctgacttctttccttcagtacgagctcttcttgataccgcctcagctttgtttcgggaa
AB119253_C_P-D      caagacttctttcctgccgtacgagatcttcttgataccgcctcagctctgtatcgggaa
KM524344_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
KU668442_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggag
AB109479_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
AB119251_C_P-D      caagacttctttccttcagtacgcgatcttcttgataccgcctcagctctgtatcggcaa
JN664931_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctctttcgggaa
JN664939_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctctttcgggaa
MF925383_C_P-D      tctgacttctttccttcagtacgggatcttcttgataccgcctcagctctgtatcgggaa
GQ183484_C_P-D      tctgacttctttccttcggtacgagatcttcttgataccgcctcagctctgtatcgggaa
AB109477_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
AB110075_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
AB119252_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
AB120308_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
JQ707497_C_P-D      tctgacttctttccttcagtacgagatcgtcttgataccacttcagctctgtatcgagaa
MK618423_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccacttcagctctgtatcgagaa
MK618424_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccacttcagctctgtatcgagaa
MK618425_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccacttcagctctgtatcgggaa
KF679994_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
KF679996_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
MK598663_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
KF679998_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
MK618434_C_P-D      tctgacttctttccttccgtacgagatcttcttgataccgcctcagctctgtatcgggaa
JQ707518_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcttcagctctgtatcgggaa
MK618435_C_P-D      tctgacttctttccttccgtacgagatcttcttgataccgcttcagctctgtatcgggaa
JQ707529_C_P-D      tctgacttctttccttccgtacgagatcttcttgataccgcttcagctctgtatcgggac
JQ707521_C_P-D      tctgacttctttccttccgtacgagatcttcttgataccgcttcagctctgtatcgggac
JQ707514_C_P-D      tctgacttctttccttccgtacgagatcttcttgataccgcttcagctctgtatcgggac
JQ707483_C_P-D      tctgacttctttccttccgtacgagatcttcttgataccgcttcagctctgtatcgggac
JQ707486_C_P-D      tctgacttctttccttccgtacgagatcttcttgataccgcttcagctctgtatcgggac
JQ707512_C_P-D      tctgacttctttccttccgtacgagatcttcttgataccgcttcagctctgtatcgggac
JQ707513_C_P-D      tctgacttctttccttccgtacgagatcttcttgataccgcttcagctctgtatcgggac
JQ707515_C_P-D      tctgacttctttccttccgtacgagatcttcttgataccgcttcagctctgtatcgggac
JQ707516_C_P-D      tctgacttctttccttccgtacgagatcttcttgataccgcttcagctctgtatcgggac
JQ707517_C_P-D      tctgacttctttccttccgtacgagatcttcttgataccgcttcagctctgtatcgggac
JQ707519_C_P-D      tctgacttctttccttccgtacgagatcttcttgataccgcttcagctctgtatcgggac
JQ707520_C_P-D      tctgacttctttccttccgtacgagatcttcttgataccgcttcagctctgtatcgggac
JQ707522_C_P-D      tctgacttctttccttccgtacgagatcttcttgataccgcttcagctctgtatcgggac
JQ707523_C_P-D      tctgacttctttccttccgtacgagatcttcttgataccgcttcagctctgtatcgggac
JQ707524_C_P-D      tctgacttctttccttccgtacgagatcttcttgataccgcttcagctctgtatcgggac
JQ707525_C_P-D      tctgacttctttccttccgtacgagatcttcttgataccgcttcagctctgtatcgggac
JQ707526_C_P-D      tctgacttctttccttccgtacgagatcttcttgataccgcttcagctctgtatcgggac
JQ707527_C_P-D      tctgacttctttccttccgtacgagatcttcttgataccgcttcagctctgtatcgggac
JQ707528_C_P-D      tctgacttctttccttccgtacgagatcttcttgataccgcttcagctctgtatcgggac
JQ707530_C_P-D      tctgacttctttccttccgtacgagatcttcttgataccgcttcagctctgtatcgggac
MK618436_C_P-D      tctgacttctttccttccgtacgagatcttcttgataccgcttcagctctgtatcgggac
JQ707498_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcttcagctctgtatcgggaa
JQ707509_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcttcagctctgtatcgggaa
JQ707504_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcttcagctctgtatcgggaa
GQ183472_C_P-D      tctgacttctttccttcagtacgagatcttcttgacaccgcctcagctctgtatcgggaa
KT366496_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgagaa
KM524354_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
GQ183471_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
GQ183477_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
KM524341_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
KT366494_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
MF925363_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
MF925364_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
MF925393_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
JN664927_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
JN664930_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
JQ707506_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcttcagctctgtatcgggaa
JQ707491_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcttcagctctgtatcgggaa
JQ707484_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcttcagctctgtatcggaaa
JQ707500_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcttcagctctgtatcgggaa
JQ707489_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcttcagctctgtatcgggaa
JQ707476_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcttcagctctgtatcgggaa
JQ707478_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcttcagctctgtatcgggaa
JQ707479_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcttcagctctgtatcgggaa
JQ707481_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcttcagctctgtatcgggaa
JQ707482_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcttcagctctgtatcgggaa
JQ707485_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcttcagctctgtatcgggaa
JQ707487_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcttcagctctgtatcgggaa
JQ707488_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcttcagctctgtatcgggaa
JQ707490_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcttcagctctgtatcgggaa
JQ707494_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcttcagctctgtatcgggaa
JQ707496_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcttcagctctgtatcgggaa
JQ707499_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcttcagctctgtatcgggaa
JQ707502_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcttcagctctgtatcgggaa
JQ707503_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcttcagctctgtatcgggaa
JQ707505_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcttcagctctgtatcgggaa
JQ707507_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcttcagctctgtatcgggaa
JQ707508_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcttcagctctgtatcgggaa
JQ707480_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcttcagctctgtatcgggaa
JQ707511_C_P-D      tctgacttctttccttcagtacgacatcttcttgataccgcttcagctctgtatcgggaa
JQ707510_C_P-D      tctgacttctttccttcaatacgagatcttcttgataccgcttcagctctgtatcgggaa
JQ707493_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcttcagctctgtatcgggaa
JQ707477_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcttcagctctgtatcgggaa
JQ707492_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcttcagctctgtatcgggaa
JQ707495_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcttcagctctgtatcgggaa
JQ707501_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcttcagctctgtatcgggaa
MH932714_C_P-D      tctgacttctttccttcagtacgggatcttcttgataccgcctcagctctgtatcgggaa
KF798281_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
HM042266_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
MK516278_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
KC875312_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
GQ183479_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
GQ183473_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
KT366491_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggat
GQ183475_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
KT151620_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
KF798301_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
KF679997_C_P-D      tctgacttctttccttcagtacgggatcttcttgataccgcctcagctctgtatcgggaa
JN664918_C_P-D      tctgacttctttccttcagtacgagctcttcttgataccgcctcagctctgtatcgggaa
GQ183474_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
KM524355_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
AB267090_C_P-D      tctgacttctttccttcgctacgagatcttcttgataccgcctcagctctgtatcgggaa
AB210821_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
AB210822_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
AB109476_C_P-D      tctgacttctttccttcagtacgagatcttcttgacaccgcctcagctctgtatcgggaa
AB090268_C_P-D      actgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
AB078031_C_P-D      tctgacttctttccttcgctacgagatcttcttgataccgcctcagctctgtatcgggaa
AB078032_C_P-D      tctgacttctttccttcgctacgagatcttcttgataccgcctcagctctgtatcgggaa
AB078033_C_P-D      tctgacttctttccttcgctacgagatcttcttgataccgcctcagctctgtatcgggaa
AB109475_C_P-D      tctgacttctttccttcggtacgagatcttcttgataccgcctcagctctgtatcgggaa
AB116266_C_P-D      tctgacttctttccttcggtacgagatcttcttgataccgcctcagctctgtatcgggaa
KC875310_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
AB090270_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KC875311_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
AB090269_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
AB205126_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
AB471856_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
AB471857_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
MN507839_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KU668445_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KU668449_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
MF618348_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggaa
KF679995_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
KR905423_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
MF925358_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
KT366511_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctttgtatcgggaa
KM524346_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
KF798299_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
KT366493_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
HM042277_C_P-D      tctgacttctttccttcaatacgagatcttcttgataccgcctcagctctgtatcgggaa
GQ183481_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
KT366501_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
KM524347_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
JN664928_C_P-D      tctgacttctttccttcagtacgagctcttcttgataccgcctcagctctgtatcgggaa
KF798273_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
FJ040872_C_P-D      tctgacttctttccttcggtacgagatcttcttgataccgcctcagctctgtatcgggaa
KM524353_C_P-D      tctgacttctttccttcggtacgagatcttcttgataccgcctcagctctgtatcgggaa
MK598665_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
KT366510_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
KT366495_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
KF896606_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
KM524352_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
KF798307_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctatatcgggaa
KT366465_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctatatcgggaa
HM042267_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
GQ183476_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
KM524351_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
KR905424_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
KT366506_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
KT366509_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
GQ183482_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
GQ183483_C_P-D      tctgacttctttccttcagtacgagatcttcttgataccgcctcagctctgtatcgggaa
FJ904410_C_P-D      catgacttctttccttcagtacgagatctactagataccgccactgctctgtttcgggat
KX357622_C_P-D      tctgacttctttccttcggctcgagatcttctagataccgccgcagccctgtatcgggat
FJ904419_C_P-D      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggat
FJ904395_C_P-D      tctgacttctatccttcggtacgagatcttctcgataccgcctcagctctgtatcgggat
FJ904422_C_P-D      tctgacttctttccttcactacgagatcttctagataccgcctcagctctgtttcgggat
                                                                     *          

AB555500_C_P-D      gccttagagtctcctgagcatgtttcagctcaccacactgcactcaggcaagcaattctt
FJ904439_C_P-D      gccttagagtctcctgagcattgcacacctcatcatactgcactcaggcaagccatacta
JX036342_C_P-D      gccttagagtctcctgagcatgtttcatctcaccatactgctctcaggcaagcaattctt
JX036343_C_P-D      gccttagagtctcctgagcatgtttcatctcaccatactgctctcaggcaagcaattctt
JX036344_C_P-D      gccttagagtctcctgagcatgtttcatctcaccatactgctctcaggcaagcaattctt
MH725171_C_P-D      gctttggaatctcctgagcattgtacacctcaccatactgcactcaggcaagcaattctc
AB674415_C_P-D      gccttggaatctcctgagcactgctcacctcaccatactgcactcaggcaagcaattctt
JF754612_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
JF754594_C_P-D      gacttagagtctcctgagcatgtttcagctcaccacactgcactcaggcaagcaatacta
AB674416_C_P-D      gccttagagtctcaggagcattgctcacctcaccatactgcactcaggcaagcaattctt
JN040766_C_P-D      gccttagagtctccggagcattgtactcctcatcatactgcactcaggcaagcaattctt
KP857013_C_P-D      gccttagagtctccwgagcattgttcacctcatcatactgcactcaggcaagcaattcta
JF754617_C_P-D      gccttagagtctcctgagcattgctcagctcaccatactgcactcaggcaagcaattctt
EU726891_C_P-D      gccttagagtctactgaacattgttcacctcaccatactgcactcaggcaagcaattttg
JN040773_C_P-D      gccttagagtctactgaacattgttcacctcaccatactgcactcaggcaagcaattttg
AB330367_C_P-D      gccttagagtcttctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
JF754609_C_P-D      gccttagagtctcctgagcattgcacacctcaccatactgcactcaggcaagccatacta
JN642128_C_P-D      gccttagagtctcctgagcattgttcgcctcaccatactgcaatcaggcaagaatgtctt
GU456677_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
KP857028_C_P-D      gccttagagtctcctgagcattgctcagctcaccatactgcactcaggcaagcaattctt
JF754622_C_P-D      gccttagagtcttctgagcattgtacacctcaccatactgcactcaggcaagcaattcta
GU456679_C_P-D      gcattagagtctcctcagcatgtttcacctcatcatactgcactcaggcaagcaattctt
GU456657_C_P-D      gcattagagtctcctgaacattgttcagctcaccatactgcactcaggcaagcaattctt
MH725153_C_P-D      gccttagagtctcctgagcattgtacacctcaccatactgcaatcaggcaagcaatttta
JN642135_C_P-D      gccttagagtctcctgagcattgtacatatcatcatactgcactcaggcaagcaattcta
JF754626_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
X85278_C_P-D        gccttgag---tcctgagcattgttcacctcaccatactgcactcaggcaagcaattatt
GQ167302_C_P-D      gccttagagtctcctgagcattgtacacctcaccatactgcactcaggcaagcaattctt
GQ167301_C_P-D      gccttagagtctcctgagcattgtacacctcaccatactgcactcaggcaagcaattctt
GQ184322_C_P-D      gccttagaatctcctgagcattgtacacctcaccatactgcactcaggcaagcaattctt
JN257165_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
JN257166_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
KF018181_C_P-D      gccttggagtctcctgagcattgttcacctcaccatactgcactcaggcacgtaattctt
MH725126_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaatacta
KP857031_C_P-D      gccttagagtctcctgagcattgtacacctcaccatactgcaatcaggcaagcagttctt
AB270541_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcgctcaggcaagcaattctt
MH725199_C_P-D      gccttagagtctcctgagcattgttcaccgcaccatactgcactcaggcacgtaattctt
JN257153_C_P-D      gccttagagtctcctgagcattgtacacctcatcatactgcactcaggcaagcaattctt
JN257195_C_P-D      gccttagagtctcctgagcattgtacacctcatcatactgcactcaggcaagcaattctt
KP857032_C_P-D      gccttagagtctcctgagcattgcacacctcaccatactgcactcaggcaagcaattctg
GU456651_C_P-D      gccttagaatctcctgagcattgctcacctcaccatactgcactcaggcaagcaattcta
KP857018_C_P-D      gccttagaatctcctgagcattgtacgcctcaccatactgcactcaggcaagcaattatt
JF754600_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
MH725135_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
KF018177_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcaatcaggcatgtatttctt
EU726884_C_P-D      gccttagagtctcctgagcattgcacacctcaccatactgcactcaggcaagccattatt
MH724978_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
MH725189_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
DQ486023_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
AB104710_C_P-D      gccttagaatctcctgagcattgttcacctcaccataccgcactcaggcaagcaattcta
KP857039_C_P-D      gccttagagtctcctgagcattgcacacctcaccatactgcactcaggcaagccattctt
HQ833466_C_P-D      gccttagagtctcctgagcattgytcacctcaccatackgcactcaggcaagcaattctt
AB270542_C_P-D      gccttagagtctcctgagcatggttcagctcaccatactgcactcaggcaagcaattcta
X80924_C_P-D        gccttagaatctcctgagcattgtacacctcatcatactgcactcaggcaagcaattcta
X80926_C_P-D        gccttagaatctcctgagcattgtacacctcatcatactgcactcaggcaagcaattcta
MH725068_C_P-D      gcctcagagtctcctgagcattgttcacctcaccataccgcaatcaggcaagcaattttt
KP857024_C_P-D      gccttagagtctcctgagcattgttcgcctcaccatactgcactcaggcaagcaatacta
DQ336680_C_P-D      gccttagaatctcctgatcattgcacacctcaccacactgcactaaggcaagccattctt
DQ336682_C_P-D      gccttagaatctcctgatcattgcacacctcaccacactgcactaaggcaagccattctt
DQ336684_C_P-D      gccttagaatctcctgatcattgcacacctcaccacactgcactaaggcaagccattctt
DQ336681_C_P-D      gccttagagtctcctgagcattgctcagctcaccacactgcactaaggcaagcaattctt
DQ336683_C_P-D      gccttagagtctcctgatcattgcgcacctcaccacactgcactaaggcaagcaattctt
AB674417_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcatgtctt
AB674418_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattcta
KP857005_C_P-D      gccttagagtctcctgagcattgtacacctcaccatactgcactcaggcaagcaatacta
AY371909_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcagtcaggcaagcaattctt
KP857019_C_P-D      gccttagagtctcctgagcatgtttctcctcaccatactgcactcaggcaagcaattctt
FJ904426_C_P-D      gccttagagtctcctgagcattgtacacctcaccatactgcactcaggcaagcaatacta
GU456682_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcatttctt
JN257176_C_P-D      cccttagagtctactgagcattgctcacctcaccatactgcactcaggcaagcaattctt
JN257177_C_P-D      cccttagagtctactgagcattgctcacctcaccatactgcactcaggcaagcaattctt
EU726952_C_P-D      gccttagagtctcctgagcattgtacgcctcaccatactgcactcaggcaagcaattctt
JN040774_C_P-D      gccttagagtctcctgagcattgtacgcctcaccatactgcactcaggcaagcaattctt
JN642136_C_P-D      gccttagagtcacctgagcattgttctcctcaccatactgcactcaggcaagcagttctt
FJ904446_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
EU726973_C_P-D      gccttagagtctcctgaacattgttcaccccaccatactgcactcaggcaagcaattctt
JN642147_C_P-D      gccttagagtctcctgagcattgttcacctcaccacactgcactcaggcaagcaattcta
X59795_C_P-D        gccttagagtctcctgagcattgtacacctcatcatactgcactcaggcaagcaattctt
JN040771_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcaatcaggcaagcagttcta
GU456675_C_P-D      gccttagagtctcaggagcattgttcacctcaccatactgcactcaggcaagcaattctt
GU456678_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcaatcaggcaagcatatctt
FJ904429_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
EU726941_C_P-D      gccttagagtctcctgagcattgtacacctcaccatactgctctcaggcaagcaattctt
KY629633_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
JF754593_C_P-D      gccttagagtctcctgagcattgcacacctcaccatactgcactcaggcaagcaattcta
KP857029_C_P-D      gccttagagtctcctgagcattgcacacctcaccatactgcactcaggcaagcaattctt
HQ700439_C_P-D      gccttagagtctcctgagcattgctcacatcaccatactgcactcaggcaagcaattctt
FJ904445_C_P-D      gccttagagtctcctgagcattgtacacctcaccatactgcactcaggcaagcaattctt
AB674413_C_P-D      gccctagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaatacta
AB674410_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcatgtatttctt
JF754592_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
FJ904402_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
EU726912_C_P-D      gccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaattcta
AB270540_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
KY629634_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
KP857025_C_P-D      gccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagcaattctt
KF018182_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcatggctt
JN040772_C_P-D      gccttagagtctcctgaacattgttcacctcaccatactgcgctcaggcaagccattctt
GU456664_C_P-D      gccttagagtctcctgagcattgttcatctcaccatactgcactaaggcaagcaattctt
GU456654_C_P-D      gccttagagtctcctgagcattgttctcctcaccatactgcactcaggcaagcaatcctt
JF754619_C_P-D      gccttagagtctcctgagcattgttcatctcaccatactgcactcaggcaagcaattctt
FJ904399_C_P-D      gccttagagtctcctgagcattgttcacatcaccatactgcactcaggcaagcaattctt
AB270550_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctc
KP857015_C_P-D      gccttagagtctcctgaacattgttcacctcaccatactgcactcaggcaagcaatacta
KP857016_C_P-D      gccttagagtctcctgaacattgttcacctcaccatactgcactcaggcaagcaattcta
KP857037_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctt
KP857033_C_P-D      gccttagagtctcctgagcattgctcacatcaccatactgcactcaggcaagcaattctt
JQ687531_C_P-D      gccttagagtctcctgagcattgttcacctcacctatctgtactcaagcaagcaattctt
JN642167_C_P-D      gccttagagtcttgtgagcattgttcacctcaccatactgcactcaggcaagcaattttt
GU456658_C_P-D      cccttggagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
GQ477458_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
AJ627224_C_P-D      gccttagagtctcctgagcattgttcgcctcaccatactgcactcaggcaagcaattctt
JF754631_C_P-D      gccttagagtctcctgagcattgtacacctcaccatactgcactcaggcaagcaattatt
KP857017_C_P-D      gccttagagtctcctgagcattgtacacctcaccatactgcactcaggcaagcaattatt
MH725202_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
KP857114_C_P-D      gccttagactctcctgaacattgttcgcctcaccatactgcactcaggcaagcaattctt
JN040781_C_P-D      gccttagagtctcctgagcattgttcacctcaccatacggctctcaggcaagcatgtctg
HQ700463_C_P-D      gccttagagtctcctgagcattgcacacctcaccatactgcactcaggcaagcaattctt
GU456656_C_P-D      gccttagagtctcatgatcattgttcacctcaccatactgcactcaggcaagcaattctt
FJ904431_C_P-D      gccttagagtctcmtgagcattgttcacctcaccataccgcactcaggcaagcaattctt
FJ904418_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattcta
EU787438_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
AB674419_C_P-D      gccttagagtctcctgagcattgcacacctcaccatactgcactcaggcaagcaatacta
EU726868_C_P-D      gccttagagtctcctgagcattgtacacctcaccatactgcactcaggcaagcaattctt
JN040779_C_P-D      gccttagagtctcctgagcattgtacacctcaccatactgcactcaggcaagcaattctt
JN642156_C_P-D      gccttagagtctcctgaacattgtacacctcaccatactgcactcaggcaagcaattctt
EU726875_C_P-D      gccttagagtctcctgagcattgtacgcctcaccatactgcactcaggcaagcaattctt
AY796032_C_P-D      gccttagagtctcctgagcattgttcacatcaccatactgcactcaggcaagcaattctt
EU726885_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
JN040755_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
KP857021_C_P-D      gccttagagtctcctgaacatgtytcacctcaccatactgcactcaggcaagcaattctt
JN642164_C_P-D      gcattagagtctcctgaacatgtttcacctcaccatactgcactcaggcaagcatatctt
JF754604_C_P-D      gccttagagtctcctgagcatgtttcagctcatcatactgcactcaggcaagcaattctt
GQ205385_C_P-D      gctttagagtctcctgagcattgttcacctcaccatactgcattcaggcaagcaattctt
AY236162_C_P-D      gccttagagtctcctgaacattgctcacctcaccatactgcactcaagcaagcaattctt
DQ304548_C_P-D      gccttagagtctcctgaacattgctcacctcaccatactgcactcaggcaagcaattctt
DQ304549_C_P-D      gccttagagtctcctgaacattgctcacctcaccatactgcactcaggcaagcaattctt
DQ304547_C_P-D      gccttagagtctcctgaacattgctcacctcaccatactgcactcaggcaagcaattctt
DQ304550_C_P-D      gccttagagtctcctgaacattgctcacctcaccatactgcactcaggcaagcaattctt
DQ304551_C_P-D      gccttagagtctcctgaacattgctcacctcaccatactgcactcaggcaagcaattctt
KP857022_C_P-D      gcgttagagtctcctgagcattgtacacctcaccatactgcactcaggcaagcaattctt
GU456673_C_P-D      gccttagagtctcctgagcattgtacacctcaccatactgcactcaggcaagcaattctt
EU726848_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaatcctt
MH724970_C_P-D      gccttagagtctccggagcattgttctcctcaccatactgcactcaggcaagcaattctt
JN642158_C_P-D      gccttagagtctcctgaacattgttcacctcaccatacggcactcaggcaagcaattcta
JF754635_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaatcctt
JF754634_C_P-D      gccttagagtctcctgagcattgttcagctcatcatactgcactcaggcaagcaattctt
EU726850_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
X85277_C_P-D        gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
GU456655_C_P-D      gccttagagtctcctgagcattgtactcctcaccatactgcactcaggcaagcattccta
EU726906_C_P-D      gccttagaatctcctgaacattgttcacctcaccatactgcactcaggcaagccattctt
KP857023_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
JF754590_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
GU456681_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
EU787439_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
EU726944_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgctctcaggcaagcaattctt
JN040776_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgctctcaggcaagcaattctt
AF419522_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcgattctt
X85273_C_P-D        gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725094_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
KP857115_C_P-D      gccttagagtctcctgagcattgttctcctcaccatactgcactcaggcaagcaattctt
KP857038_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
KP857034_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattcta
AB270549_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
EU939681_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
FJ899792_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
KP857035_C_P-D      gccttagagtctcctgagcattgctcagctcaccatactgcactcaggcaagcaattcta
KP857030_C_P-D      gccttagagtctcctcagcattgttcacctcaccatactgcactcaggcaagcatatctt
AB674403_C_P-D      gccttagagtctcctgagcattgtacgcctcaccatactgcactcaggcaagcaattctt
JN642150_C_P-D      gccttagagtctcctgaacattgttcacctcaccatactgcactcaggcaagcaattctt
JN040821_C_P-D      gccttagaatctcctgaacattgttcacctcaccatactgcgctcaggcaagccgttctt
AY371915_C_P-D      gccttagagtcttctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
AY371913_C_P-D      gccttagagtctcctgagcactgttcacctcaccatactgcactcaggcaagcaattctt
MH724962_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcaatcaggcaagcaattctt
JN257172_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
JN257173_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725096_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725110_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725118_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725097_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH724959_C_P-D      gcattagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
EU726908_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgctctcaggcaagcaattctt
DQ464182_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcagttctt
MH725139_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
JN257160_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
JN257161_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
JN257159_C_P-D      gccttagagtctcctgagcattgttctcctcaccatactgcactcaggcaagcaattctt
AB270546_C_P-D      gcattagagtctcctgagcattgttcgcctcaccataccgcactcaggcaagcaactatt
KP995092_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
KP995100_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
JN642166_C_P-D      gccttagaatctcctgaccattgttcacctcaccatactgcactcaggcaagcaattctc
GU456668_C_P-D      gccttagagtctcctgagcattgtactcctcaccatactgcactcaggcaagcaattctt
FJ904427_C_P-D      gccttagagtctcctgagcattgtacatctcaccatactgcactcaggcaagcaattctt
AY371904_C_P-D      gccttagaatctcctgagcattgttcacctcaccatactgcactcacgcaagcaattctt
AF419530_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
JN642133_C_P-D      gccttagagtctcctgaacattgttcacctcaccatactgcactcaggcaagcaattcta
GU456684_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
FJ904424_C_P-D      gccttagagtctcctgagcattgttcwcctcaccatactgcactcaggcaagcaattctt
HQ700472_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
FJ349220_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcaatcaggcaagcaattctt
AJ344116_C_P-D      gccttagagtctcctgagcattgttcacctcaccatacggcactcaggcaagcaattctt
MH725054_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH724960_C_P-D      gccttagagtctcctgagcattgtacacctcaccatactgctctcaggcaagcaattctt
MH724969_C_P-D      gccttagagtctcctgagcattgtacacctcaccatactgctctcaggcaagcaattctt
JN257170_C_P-D      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
EU726864_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagccgttctt
EU726844_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgctctcaggcaagccattctt
KP857036_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
JN040753_C_P-D      gccttagagtctcctgaacattgttcacctcaccatactgcgctcaggcaagcaattctt
DQ178012_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaatactg
DQ178011_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaatactg
DQ178015_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaatactg
AY371912_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaatactg
DQ178019_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaatactg
AY350614_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaatactg
AY371901_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaatactg
AY371905_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaatactg
AY371922_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaatactg
X02496_C_P-D        gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaatactg
DQ178017_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaatactg
DQ178016_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaatactg
DQ178018_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaatactg
DQ178020_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaatactg
JN040752_C_P-D      gccttagaatctcctgaacattgttcacctcaccatactgcactcaggcaagccattctt
HQ700455_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
FJ904432_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
DQ111986_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MK598646_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
JN687947_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
JN040780_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcaatcaggcaagcaattatt
AY721605_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
AB674420_C_P-D      gctttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725144_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725088_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
JN642153_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
JN642151_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
JN040778_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
FJ904415_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattcta
AB222710_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
JN132132_C_P-D      gccttagagtctcctgaacattgctcacctcatcatactgcactcaggcaagcaactctt
JN132130_C_P-D      gccttagagtctcctgaacattgctcacctcatcatactgcactcaggcaagcaattctt
JN558561_C_P-D      gccttagagtctcctgaacattgctcacctcatcatactgcactcaggcaagcaattctt
JN132131_C_P-D      gccttagagtctcctgaacattgctcacctcatcatactgcactcaggcaagcaattctt
JN558562_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
JN697591_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
JN132127_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
HQ641710_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
JN132128_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
AF324110_C_P-D      gccttagagtcgcctgaacattgttcacctcaccatactgcactcaggcaagcaattctt
AF324115_C_P-D      gccttagagtctcctgaacattgttcacctcaccatactgcactcaggcaagcaattctt
AF324113_C_P-D      gccttagagtcgcctgaacattgttcacctcaccatactgcactcaggcaagcaattctt
AF324109_C_P-D      gccttagagtcgcctgaacattgttcacctcaccatactgcactcaggcaagcaattctt
AF324108_C_P-D      gccttagagtcgcctgaacattgttcacctcaccatactgcactcaggcaagcaattctt
AF324114_C_P-D      gccttagagtcgcctgaacattgttcacctcaccatactgcactcaggcaagcaattctt
AF324116_C_P-D      gccttagagtcgcctgaacattgttcacctcaccatactgcactcaggcaagcaattctt
MF618349_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
JN040761_C_P-D      gccttagagtctcctgagcattgtacacctcaccatactgcactcaggcaagcaattctt
GQ183449_C_P-D      gcattagagtctcctgagcattgttcacctcaccatacggcactcaggcaagcaattctt
GQ183464_C_P-D      gcattagagtctcctgagcattgttcacctcaccatacggcactcaggcaagcaattctt
GQ183463_C_P-D      gcattagagtctcctgagcattgttcacctcaccatacggcactcaggcaagcaattctt
GQ183459_C_P-D      gcattagagtctcctgagcattgttcacctcaccatacggcactcaggcaagcaattctt
GQ183458_C_P-D      gcattagagtctcctgagcattgttcacctcaccatacggcactcaggcaagcaattctt
GQ183457_C_P-D      gccttagagtctcctgagcattgttcacctcaccatacggcactcaggcaagcaattctt
GQ183460_C_P-D      gccttagagtctcctgagcattgttcacctcaccatacggcactcaggcaagcaattctt
GQ183461_C_P-D      gccttagagtctcctgagcattgttcacctcaccatacggcactcaggcaagcaattctt
GQ183469_C_P-D      gccttagagtctcctgagcattgttcacctcaccatacggcactcaggcaagcaattctt
GQ183448_C_P-D      gcattagagtctcctgagcattgttcacctcaccatacggcactcaggcaagcaattctt
GQ183450_C_P-D      gcattagagtctcctgagcattgttcacctcaccatacggcactcaggcaagcaattctt
GQ183451_C_P-D      gcattagagtctcctgagcattgttcacctcaccatacggcactcaggcaagcaattctt
GQ183452_C_P-D      gcattagagtctcctgagcattgttcacctcaccatacggcactcaggcaagcaattctt
GQ183453_C_P-D      gcattagagtctcctgagcattgttcacctcaccatacggcactcaggcaagcaattctt
GQ183454_C_P-D      gcattagagtctcctgagcattgttcacctcaccatacggcactcaggcaagcaattctt
GQ183455_C_P-D      gcattagagtctcctgagcattgttcacctcaccatacggcactcaggcaagcaattctt
GQ183456_C_P-D      gcattagagtctcctgagcattgttcacctcaccatacggcactcaggcaagcaattctt
GQ183462_C_P-D      gcattagagtctcctgagcattgttcacctcaccatacggcactcaggcaagcaattctt
GQ183465_C_P-D      gcattagagtctcctgagcattgttcacctcaccatacggcactcaggcaagcaattctt
GQ183466_C_P-D      gcattagagtctcctgagcattgttcacctcaccatacggcactcaggcaagcaattctt
GQ183467_C_P-D      gcattagagtctcctgagcattgttcacctcaccatacggcactcaggcaagcaattctt
GQ183468_C_P-D      gcattagagtctcctgagcattgttcacctcaccatacggcactcaggcaagcaattctt
AB270547_C_P-D      gccttagaatctcctgagcattgttcacctcatcatactgcactcaggcaagcaattctt
EU726876_C_P-D      gccctagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaattctt
MH725012_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725005_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725011_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
KC875292_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctg
AB716760_C_P-D      gccttagartctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
HE805987_C_P-D      gccttagartctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
AB674405_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
AB674404_C_P-D      gccttagagtctcctgagcactgctcacctcaccatactgcactcaggcaagcaattctt
KF018195_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
X85308_C_P-D        gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
X85259_C_P-D        gccttagagtctcctgagcattgttcacctcagcatactgcactcaggcaagcaattctt
X85298_C_P-D        gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcacgcaattctt
X85297_C_P-D        gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
X85299_C_P-D        gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcacgtatttctt
JN040792_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
JN040791_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
JN040793_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725087_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725031_C_P-D      gccttagagtctcctgagcattgctctcctcaccatactgcactcaggcaagcaattctt
MH725033_C_P-D      gccttagagtctcctgagcattgctctcctcaccatactgcactcaggcaagcaattctt
M32138_C_P-D        gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctc
KP857109_C_P-D      gccttagagtcgcctgcgcattgttcacctcaccatactgcactcaggcaagcaactatt
KF018185_C_P-D      gccttagagtctccggagcattgttctcctcaccatactgcactcaggcaagcaattctt
JN257179_C_P-D      gccctagagtctcctgaacattgttcacctcaccatactgcactcaggcaagcaattctt
JN040754_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
JF754614_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
FJ562309_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
EU726910_C_P-D      gccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
AB674408_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725172_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725140_C_P-D      gccttagagtctcctgagcattgttctcatcaccatactgcactcaggcaagccattctt
MH725125_C_P-D      tccttagagtctcctgagcattgttctcctcaccatactgcaatcaggcaagcaagtttt
KM524348_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaatcctt
JF754598_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
HQ700467_C_P-D      gccttagagtctcctgagcattgctcagctcaccatactgcactcaggcaagcaattctt
EU726861_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
EU726965_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
JN040757_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
HQ700478_C_P-D      gccttagagtctcctgagcattgctcagctcaccatactgcactcaggcaagcaattctt
HQ700553_C_P-D      gccttagagtctcctgagcattgctcagctcaccatactgcactcaggcaagcaattctt
KF061167_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
HQ700481_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcacgtaattctt
MH725086_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
HQ700474_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
HQ700470_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
HQ700468_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
HQ700489_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
HQ700444_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
HQ700483_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
AB222712_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
MK598643_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
HQ700448_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
HQ700477_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
HQ700473_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
HQ700480_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
HQ700469_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
HQ700479_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
HQ700484_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
HQ700449_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
HQ700440_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
HQ700441_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
HQ700445_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
HQ700446_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
HQ700447_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
HQ700450_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
HQ700451_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
HQ700454_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
HQ700459_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
HQ700464_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
HQ700466_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
HQ700471_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
HQ700482_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
HQ700487_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
HQ700488_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
HQ700442_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
HQ700443_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
MH725123_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725077_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
JN040750_C_P-D      gccttagagtctcctgagcattgcacacctcaccatactgcactcaggcaagcaattctt
GU456663_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaatacta
MH724992_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
JN642132_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
FJ349219_C_P-D      gccttagagtcttctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
AY161158_C_P-D      gctttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
KC875301_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
KC875299_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
KC875302_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
KC875303_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
FJ386590_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
EU414054_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
EU414135_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
GQ377589_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
AB270543_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
AF280817_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MN507838_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
AF419516_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
AF419524_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcgattctt
JN040784_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
JF754588_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725079_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725064_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725065_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725080_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725081_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH724985_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH724977_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725134_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725169_C_P-D      gcattagagtctcctgagcattgttcaccttaccatactgcactcaggcaagcaattctt
MH725133_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725057_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725052_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725046_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725053_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725055_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725056_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725047_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725198_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725182_C_P-D      gcactagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaattctt
MH725174_C_P-D      gcattagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
MH725101_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725090_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH724980_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH724973_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725181_C_P-D      gcattagagtctcctgagcattgttcacctcaccataccgcactcaggcaagcaattctt
MH725083_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH724995_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH724976_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH724971_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH724979_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725183_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725203_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH724997_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725191_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725211_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725208_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725193_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725184_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725180_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725176_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725164_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725136_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725115_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725085_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725016_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH724991_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH724989_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH724987_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725158_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725205_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH724961_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH724958_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH724954_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH724981_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH724983_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH724986_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725007_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725015_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725131_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725154_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725155_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725166_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725175_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725188_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725190_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725195_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725206_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725148_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725095_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725069_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725058_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725060_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725062_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725137_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725078_C_P-D      gcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725210_C_P-D      gccttagagtctcctgagcattgttcacctcaccatacagcactcaggcaagcaattctt
MH725159_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725128_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725129_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
AB674406_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
EU726899_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH725194_C_P-D      gccttagagtctcctgaacattgttcacctcaccatactgcactcaggcaagcaattctt
KX827291_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
KP857040_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
KP857020_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
KF018192_C_P-D      gcattagagtctcctgaacattgttcacctcaccatactgcactcaggcaagcaattctt
JN642130_C_P-D      gccttagagtctcctgaacattgttcacctcaccatactgcactcaggcaagcaattcta
JF754627_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcagttctt
EU726926_C_P-D      gccttagagtctcctgagcattgtacacctcaccatactgcactcaggcaagcaattctt
AB674411_C_P-D      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
EU726961_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
JN040783_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH724965_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
MH724966_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
JN257182_C_P-D      gccttagagtctcctgagcattgttctcctcaccatactgcactcaggcaagcaattctt
JN040777_C_P-D      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
HM042272_C_P-D      gccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
HM042273_C_P-D      gccttagagtctcctgagcattgttcacctcatcatactgcactcagg